TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4778-5p
miRNA Sequence: AAUUCUGUAAAGGAAGAAGAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96891 5979 5514 4475 4313 2240 1781 1390 1224 ----11191
NM_000092chr2114226 4149 3602 3506 2834 1670 1353 1246 1077 725 144 23373 1792 24111 3237 --
NM_000112chr534434 2028 1819 --24185 187 22153 646
NM_000165chr621515 453 1150 11181 1610
NM_000245chr772029 1999 1392 416 382 349 168 --2903 539 11909
NM_000259chr15176296 6114 6050 5654 5324 4561 4502 4288 3976 3940 2327 1558 1538 1301 875 420 252 21363 150 ----
NM_000264chr963000 2943 2816 2678 2209 260 22472 739 12427 --
NM_000314chr1033001 1094 726 --12456 23195 3050
NM_000318chr852799 2346 1140 647 366 --22539 1100 12473
NM_000332chr6136872 6781 6384 5898 5632 5285 4830 4782 1876 1433 1276 954 302 56294 5807 5783 2289 2280 ----
NM_000337chr5146570 6487 5853 5588 5515 4940 2100 1958 1573 1176 943 346 301 90 14514 26591 374 25297 2456
NM_000368chr9144818 4392 3899 3468 3436 3410 3077 1939 1625 1435 984 642 155 46 14756 23030 1191 --
NM_000390chrX102614 2473 1112 930 900 485 457 127 68 55 12366 ----
NM_000439chr562586 1992 1846 920 882 190 --22339 1900 --
NM_000448chr11103152 3049 2721 1138 1067 881 676 253 214 162 32807 1081 725 12777 --
NM_000461chr384219 4140 1261 1198 820 550 416 337 11332 23949 1396 14405
NM_000489chrX92974 2698 1377 1153 976 226 201 79 40 --1579 --
NM_000529chr1882526 2277 1955 1577 971 961 485 25 157 12339 1240
NM_000533chrX71718 1459 1250 675 593 495 390 --21920 1404 --
NM_000555chrX137253 7236 6814 6731 5401 3114 3070 2790 2784 1735 1319 1076 22 27425 30 46448 5321 1167 646 15917
NM_000574chr16982 869 289 228 216 152 ----11208
NM_000599chr2153674 3180 1746 1662 1642 1585 1565 1164 960 628 501 465 262 191 151 --11428 --
NM_000618chr12155945 5848 5243 5208 5128 4760 4643 4549 4494 4211 4037 1150 736 249 44 --15780 25047 863
NM_000618chr12155945 5848 5243 5208 5128 4760 4643 4549 4494 4211 4037 1150 736 249 44 --15780 25047 863
NM_000633chr18124837 4659 4389 3777 3590 3291 3233 1679 1247 1107 981 526 14090 43608 3331 2047 865 14323
NM_000719chr12146397 6097 6048 5875 5484 5277 5162 5084 4375 4325 2611 2591 1479 936 --25495 2157 --
NM_000793chr14165042 4840 4829 4591 4364 4030 3946 3643 1762 1339 797 789 720 628 110 84 --23998 742 --
NM_000806chr571963 1674 1609 1441 1307 777 208 11706 2247 198 --
NM_000809chr4189120 8621 8395 8261 8016 6808 6717 6239 6136 5873 5672 3021 1653 1603 1128 1104 399 45 58709 6566 6279 3640 2770 67605 7329 2359 2265 1811 1136 21113 233
NM_000813chr5135470 4661 4534 4461 4228 2061 1671 1492 1327 1025 1002 742 563 34182 2094 749 14797 13917
NM_000814chr1573146 3060 2941 2776 1001 895 211 --24029 288 --
NM_000831chr1206109 6021 5565 5132 5034 4979 4642 2279 2153 1996 1930 1810 1290 755 663 605 594 507 340 303 ------
NM_000859chr511316 ----21714 621
NM_000872chr1071218 1197 1129 619 389 225 48 --2458 368 11330
NM_000875chr15136656 6353 6324 6298 5231 5203 4482 2329 2261 1539 1260 355 275 ----15679
NM_000885chr262143 1702 1569 1555 883 179 11799 --12076
NM_000910chr451879 1779 713 706 436 --11412 --
NM_000950chrX43326 3279 2786 1411 12685 32666 926 165 13189
NM_000961chr20123749 3701 3592 2993 2595 1510 1438 837 622 434 420 309 ------
NM_001001419chr564524 4501 4202 3385 1558 1482 33283 3202 221 44967 4637 4261 3252 --
NM_001001420chr564524 4501 4202 3385 1558 1482 33283 3202 221 44967 4637 4261 3252 --
NM_001001481chr883430 3387 2506 2274 1303 1131 374 28 23134 2576 12662 --
NM_001001664chr2103853 3404 3354 3301 3111 3062 3028 1429 297 112 ----11289
NM_001001668chr19114165 3487 3014 1715 1460 1303 1199 873 688 430 387 --13454 --
NM_001001928chr22158087 7857 7725 7718 7463 7410 6285 6167 5614 5572 5296 5217 2780 851 190 15942 48315 2998 2204 1013 --
NM_001001974chr1052306 2086 1710 1661 635 --12404 11844
NM_001002838chrX91452 1383 577 529 478 274 210 196 41 --11622 --
NM_001002860chr14114624 4088 3480 3113 1491 1382 1025 738 672 509 484 11691 23326 1169 --
NM_001003652chr18158067 7849 7426 6585 6406 6271 6077 3477 3026 2504 2141 2107 1286 994 894 26801 2388 12859 16979
NM_001003674chr18166893 6568 5568 5529 5093 4553 4444 2826 2047 1413 1295 1228 1190 363 308 266 16127 15105 --
NM_001003675chr18166893 6568 5568 5529 5093 4553 4444 2826 2047 1413 1295 1228 1190 363 308 266 16127 15105 --
NM_001003712chr1274009 3737 3329 3268 2827 1320 644 1945 --13858
NM_001004419chr12154081 3673 2986 2955 2943 2882 1521 1313 1240 1175 1030 954 434 373 34 --13009 --
NM_001005473chr5186569 6258 6191 6184 5073 5057 4808 4622 4363 4148 4124 4108 2618 2076 1563 985 883 541 14173 36035 5900 288 25248 5163
NM_001005502chr12105023 3909 3853 3321 2054 1789 1637 1075 590 337 ----1668
NM_001007023chr14165042 4840 4829 4591 4364 4030 3946 3643 1762 1339 797 789 720 628 110 84 --23998 742 --
NM_001007094chr10164185 3797 3611 3494 1714 1684 1650 1577 1054 1005 990 692 463 447 104 25 33540 2858 715 24056 3387 1356
NM_001007097chr9184773 4678 4520 4478 4314 4153 3764 3704 3672 3621 3614 3452 1997 1802 1616 1001 963 23 1829 23947 1728 --
NM_001008239chr18103637 3487 2840 2730 1047 834 710 521 514 196 22746 309 43759 2332 1104 234 --
NM_001008392chr373518 2772 1116 577 378 264 163 11072 32486 2297 394 --
NM_001008405chr791744 1636 1379 1281 1254 1246 726 510 232 11236 ----
NM_001008408chr7116296 5298 4910 4780 2460 2444 1674 1323 1129 180 78 --35380 2276 1309 --
NM_001008539chr8155333 5192 4925 4737 4005 3945 3856 3385 3368 3338 2140 1974 1915 1174 1081 ------
NM_001008738chr552578 1177 604 598 417 1529 12609 --
NM_001008925chr4113524 3140 2956 2916 2878 723 637 540 467 226 162 22495 33 --11139
NM_001009554chr494716 4613 4410 3917 3331 1855 1350 227 211 21876 743 24345 1822 1969
NM_001009554chr494716 4613 4410 3917 3331 1855 1350 227 211 21876 743 24345 1822 1969
NM_001009899chr3136341 5677 5185 4968 4660 2035 1814 1652 1595 1538 1298 1000 717 --11091 --
NM_001009959chr252486 2018 1858 1805 547 51612 973 890 632 138 42559 2187 2172 2157 --
NM_001010867chr1115019 4874 4325 4206 4084 2189 1921 1858 1497 1162 706 --35163 4629 4178 --
NM_001010891chr5146344 6061 5871 5741 4786 4741 4724 4219 2479 2430 2109 1949 1874 1139 34901 4555 2210 12520 --
NM_001010971chr1------2817 84
NM_001010984chr192483 2284 1879 1668 1614 1018 524 316 161 1370 ----
NM_001010986chrX62507 2103 1926 611 364 215 2539 48 --31792 491 460
NM_001011513chr463769 1604 1461 1398 1349 476 2310 282 2789 414 --
NM_001011537chr3111847 1785 601 490 476 329 296 288 277 236 70 --22200 1650 --
NM_001011666chr7115897 5732 5673 4638 4367 4052 4035 2642 1939 466 77 15874 11354 15764
NM_001011885chr1541777 1641 342 167 --21115 649 --
NM_001012420chr1582872 2861 2825 2206 1932 1788 914 637 --22424 392 --
NM_001012423chr1582872 2861 2825 2206 1932 1788 914 637 --22424 392 --
NM_001013746chr741935 1873 1860 446 --11854 --
NM_001014797chr10248097 7988 7701 7652 7542 7478 7467 7131 7046 6874 6731 6521 6171 5659 5616 5403 5168 3219 2997 2717 2377 2309 2049 1900 13072 ----
NM_001017440chr7208258 7938 7859 7325 6942 6453 6403 6120 5437 5000 3304 2749 2485 2364 2301 1243 476 417 318 253 37922 2038 1271 23269 2619 --
NM_001018025chrX10862 829 820 668 634 340 270 230 200 137 ------
NM_001018037chr951182 1033 493 170 89 ----11211
NM_001018065chr9105013 4939 4704 4558 1545 1266 1148 849 493 256 25258 2403 22298 2093 14415
NM_001018066chr9105013 4939 4704 4558 1545 1266 1148 849 493 256 25258 2403 22298 2093 14415
NM_001018067chr1105266 4648 4595 4286 3928 3887 1909 1228 623 177 13653 24665 1327 --
NM_001018068chr1105266 4648 4595 4286 3928 3887 1909 1228 623 177 13653 24665 1327 --
NM_001018069chr1105266 4648 4595 4286 3928 3887 1909 1228 623 177 13653 24665 1327 --
NM_001018111chr7113698 3503 3417 3076 2863 2688 2435 1285 375 368 36 --13520 22802 2778
NM_001024647chr12167143 7032 7000 6976 6923 6602 5479 5445 2462 2425 2140 883 791 601 440 331 --21873 1097 27064 2991
NM_001024649chr562641 2397 1090 574 509 306 1837 32761 1171 299 21070 1065
NM_001024660chr381681 1599 1565 1434 1159 660 505 239 ------
NM_001025076chr1095086 4580 4507 1706 1600 856 755 601 305 21827 960 1437 16197
NM_001025077chr10126444 5938 5865 5016 4937 4620 2958 2214 2113 1959 1663 1191 12318 11795 17555
NM_001025233chr12112111 2093 2027 1830 1789 1748 998 676 667 537 221 --1200 12807
NM_001025266chr3114500 3923 3633 3346 1790 1475 1464 1331 1145 1044 379 --13736 --
NM_001025356chr12102781 2220 2138 2097 1853 1040 957 304 259 162 ------
NM_001025580chrX103504 1687 1281 1118 972 816 752 727 685 276 22882 1592 1862 --
NM_001031623chr631614 1148 189 1731 --1200
NM_001031695chr22145101 4916 3629 3327 1992 1882 1821 1586 1530 1348 920 755 445 329 11859 1401 21087 473
NM_001031732chr493470 3217 3115 3084 2661 2508 1204 908 235 13158 21039 972 --
NM_001032999chr20195227 5156 4576 4543 4432 4409 4231 4194 4047 3762 3551 3270 2062 1828 1305 863 733 572 564 --35217 4374 45 --
NM_001033059chr641973 1275 438 117 21340 1320 11872 11355
NM_001033087chr20102617 2571 2427 2055 1997 985 642 625 472 167 43288 2946 483 424 1963 --
NM_001033564chr631382 1314 144 11755 21900 1684 1208
NM_001034841chr16105350 5106 3639 3378 1932 1722 1600 1028 237 100 13863 24394 1619 --
NM_001037334chr18102407 2190 2038 1938 1810 1636 273 220 171 133 --11801 11504
NM_001039538chr263602 2503 1339 694 201 173 1558 --11170
NM_001039547chr3197243 6882 6787 6128 5840 5666 2568 2401 2315 1950 1441 1339 1310 1187 1062 1034 895 722 157 15337 17639 17115
NM_001039590chrX133821 3757 3687 3262 3164 2998 2987 2965 2929 1603 1425 441 148 21256 769 11453 --
NM_001039591chrX133821 3757 3687 3262 3164 2998 2987 2965 2929 1603 1425 441 148 21256 769 11453 --
NM_001039618chr11115885 5459 4463 4212 3863 3622 2335 1938 1376 818 263 24351 3728 15139 25957 5733
NM_001039693chr273301 2922 2766 2589 769 686 524 1612 33246 3060 283 13917
NM_001039709chr20195227 5156 4576 4543 4432 4409 4231 4194 4047 3762 3551 3270 2062 1828 1305 863 733 572 564 --35217 4374 45 --
NM_001039840chrX86064 5323 4337 4124 2029 1973 1531 1324 25354 119 24783 4116 15730
NM_001039937chr1374185 3942 3715 3419 3409 2957 2596 13442 --11117
NM_001040152chr7114929 4688 4545 4448 4419 4154 1530 1171 842 623 560 14697 1526 11363
NM_001040157chr462297 2182 2118 1832 1785 971 --21811 256 12047
NM_001040284chr16105302 4465 4288 3660 1907 714 608 510 360 322 14005 21480 146 --
NM_001040402chr452840 2362 2175 1163 457 12112 11212 12430
NM_001040441chr1115271 5195 4985 4801 4716 3974 3445 1362 1313 990 21 --22085 1246 14789
NM_001040712chr983135 3129 2911 2502 2477 2278 352 319 --13497 --
NM_001040876chr461742 1233 469 176 83 54 --11354 11671
NM_001042355chr1695248 4682 4523 4487 3543 1957 1225 1217 40 13557 2991 864 25297 3464
NM_001042412chr1695248 4682 4523 4487 3543 1957 1225 1217 40 13557 2991 864 25297 3464
NM_001042413chr983062 2768 2743 2614 1637 1223 576 120 22513 1066 --13780
NM_001042481chr1492336 1874 1065 686 597 576 461 199 182 1282 ----
NM_001042494chr1593689 3241 2935 2815 2494 1532 1289 271 192 --13660 --
NM_001042495chr1593689 3241 2935 2815 2494 1532 1289 271 192 --13660 --
NM_001042496chr1593689 3241 2935 2815 2494 1532 1289 271 192 --13660 --
NM_001042497chr1593689 3241 2935 2815 2494 1532 1289 271 192 --13660 --
NM_001042510chr851744 1609 1579 402 121 --11333 1326
NM_001042511chr851744 1609 1579 402 121 --11333 1326
NM_001042599chr2127047 5291 5173 5002 3155 3071 2781 2715 2708 1819 1677 129 --57756 6122 5466 2489 750 12223
NM_001042601chr3112868 2831 2681 2609 2412 2276 1235 1209 983 971 955 32464 2121 2028 1525 11249
NM_001042604chr374613 3641 2983 1848 1405 1133 85 31423 646 637 ----
NM_001048183chr173802 2504 1490 1432 704 603 100 --43730 3464 2613 164 --
NM_001099678chr3135827 5313 4998 3915 1992 1222 977 958 791 766 518 382 278 16303 21689 475 1942
NM_001106chr3209261 8820 8490 8257 6967 6775 6728 6512 6371 3914 3534 3511 2308 1906 1466 1122 927 672 360 275 49191 8515 7729 2405 19338 --
NM_001117chr1852183 1960 789 747 356 --11894 11642
NM_001149chr1061146 1128 520 378 352 205 ----2572 530
NM_001167chrX65551 1710 1637 895 722 83 15459 34685 4677 4483 26628 596
NM_001174chrX31953 1518 884 11611 21508 209 11939
NM_001186chr2153079 3024 2535 854 387 2804 294 22497 2209 --
NM_001204chr2147704 7304 6523 5009 2801 1965 1561 869 857 706 652 371 157 56 11629 76833 5630 5476 5411 5089 1938 258 --
NM_001206chr9102899 2490 2207 1265 848 743 690 478 378 112 22634 942 11011 --
NM_001241chr272253 2194 2065 973 682 624 155 --11998 1659
NM_001241chr272253 2194 2065 973 682 624 155 --11998 1659
NM_001256chr1752301 1878 996 923 357 22766 2546 1160 1417
NM_001259chr7156369 5932 5613 4667 4653 2416 2023 1747 1701 1564 1422 1040 886 738 81 --12555 15404
NM_001289chrX41350 1245 540 455 11172 --11208
NM_001310chr1273063 2690 2123 2006 1213 883 273 1752 12083 12465
NM_001364chr11104552 1898 1812 1772 1375 735 614 190 169 31 --34506 4478 4042 11229
NM_001412chrX93444 3430 3362 3264 2754 1482 805 655 448 42633 2288 1075 789 23007 348 --
NM_001419chr19114616 3994 3789 3558 3321 1495 1009 899 713 477 243 --11873 21513 29
NM_001420chr1973195 2018 1980 928 918 791 551 --12984 --
NM_001609chr1094420 3363 3086 2859 1602 1474 652 594 194 33025 2943 587 13405 --
NM_001634chr641973 1275 438 117 21340 1320 11872 11355
NM_001650chr1893854 3323 3219 2834 2619 1466 1351 319 173 11177 13424 13158
NM_001656chr571905 578 545 537 316 220 179 --1487 --
NM_001695chr8134203 4095 3658 3337 3203 2692 1659 813 757 621 509 237 54 ----14033
NM_001742chr721487 1302 --11733 21802 1625
NM_001746chr562641 2397 1090 574 509 306 1837 32761 1171 299 21070 1065
NM_001759chr12105092 4555 4079 3967 3709 2105 1626 1232 832 284 1298 24395 1762 1177
NM_001781chr122697 148 2988 820 136 1745
NM_001821chr183658 3579 3467 1833 353 232 213 51 33322 1311 1177 44701 3677 927 245 --
NM_001830chrX103567 3423 3062 2841 2832 1601 1455 1256 1168 107 13136 24058 2509 --
NM_001858chr694538 4266 3765 3449 1335 1141 819 548 246 13914 31531 1453 1000 --
NM_001874chr12105023 3909 3853 3321 2054 1789 1637 1075 590 337 ----1668
NM_001918chr1188845 8202 8025 7688 7680 7580 7444 6524 6386 6052 6017 3507 3204 3000 1404 1231 558 222 39079 7280 5881 48796 8696 8338 2056 19315
NM_001977chr451493 1299 1211 1138 457 ----11085
NM_001987chr12104147 4003 3772 3461 3119 2637 1306 1235 1089 59 12830 3774 737 691 --
NM_001992chr551956 1656 1563 1451 185 1756 11462 22036 340
NM_002006chr475627 4999 4200 1780 1663 1360 742 --12177 14442
NM_002025chrX148967 8710 8112 8086 7289 5645 3498 3064 2916 2246 1678 967 452 148 46042 5816 2807 2795 ----
NM_002033chr11103880 3664 3200 3118 1532 1051 935 885 287 166 23536 1640 ----
NM_002126chr1753308 2628 1587 1514 689 --1697 11430
NM_002203chr5134080 3998 3839 3540 3532 3322 3263 2661 1639 1264 979 412 271 1754 13187 --
NM_002210chr2103483 3442 3069 2448 1160 1061 950 530 341 41 21216 473 12780 --
NM_002214chr795650 5207 4912 3472 1703 1422 1102 1078 81 1775 1273 35512 5384 683
NM_002270chr535428 4758 4068 11945 24947 1552 15530
NM_002290chr641193 1146 293 120 11133 21225 991 1568
NM_002293chr1112578 2442 2289 2108 1115 1027 952 812 621 551 371 --32565 149 61 --
NM_002310chr5166476 6428 6387 6241 5969 5684 5368 4712 4283 4254 1752 1589 1327 1240 1136 195 54597 4313 2449 2309 2242 36292 4730 4639 --
NM_002336chr1294576 3911 3129 2007 1849 1511 688 322 162 34439 1932 1286 14401 --
NM_002374chr263602 2503 1339 694 201 173 1558 --11170
NM_002387chr585140 4542 3992 3852 3694 1977 404 65 --25107 1076 --
NM_002395chr671489 1401 1326 925 441 291 136 --21201 531 --
NM_002397chr572126 1544 1417 845 413 222 183 11449 1723 --
NM_002481chr1207459 7115 6965 6624 6536 6177 5856 5835 5765 5688 5656 5633 5268 5077 2718 2370 2310 754 471 439 27371 6646 16096 --
NM_002577chr393906 3825 3752 3746 3136 2839 1187 749 489 23277 383 22676 2509 11289
NM_002581chr985632 4215 4207 3553 1790 1766 1099 479 2536 414 21621 87 --
NM_002610chr292573 2207 2116 1185 1078 1031 846 511 487 1125 12886 12423
NM_002655chr8134921 4703 4522 4390 4329 4197 3659 3531 1685 1172 805 145 28 --45327 3834 1948 395 1723
NM_002657chr2093733 2805 2579 1556 1201 1091 894 349 137 --23885 3309 --
NM_002670chr331055 1010 510 21390 1030 21394 59 21627 215
NM_002737chr17136362 6037 5725 4887 2521 2480 2217 2099 1681 1206 1159 533 437 36346 6253 2076 12106 --
NM_002740chr392606 2558 2477 1994 1130 1095 779 576 557 12762 ----
NM_002760chrY155808 5029 4609 4522 3864 3639 2333 1418 1194 595 538 381 325 214 157 22020 1517 15070 --
NM_002834chr1273362 2483 1379 1124 1090 602 28 24059 3743 2271 101 --
NM_002837chr12104488 4449 4023 2812 1024 729 680 399 313 80 14541 34129 3889 1323 --
NM_002839chr983135 3129 2911 2502 2477 2278 352 319 --13497 --
NM_002843chr1162794 2412 2302 1164 882 364 ----23380 605
NM_002858chr111248 ----2140 47
NM_002886chr394583 4492 4001 3681 3587 3217 1605 1107 1044 14558 13519 14449
NM_002940chr461742 1233 469 176 83 54 --11354 11671
NM_002959chr1104251 4076 3034 2740 1670 1596 1561 1375 1092 940 23434 3221 11287 --
NM_002977chr273154 2556 831 754 522 448 372 12589 1323 1745
NM_003010chr1792242 1766 1692 1653 864 793 683 618 414 --1689 --
NM_003017chr661346 1111 340 64 52 32 --1542 --
NM_003034chr12207671 7389 7219 7147 6814 6126 5744 5417 4955 3194 3096 2538 2292 1906 1371 1363 731 710 653 117 --26376 6201 15558
NM_003046chr8155333 5192 4925 4737 4005 3945 3856 3385 3368 3338 2140 1974 1915 1174 1081 ------
NM_003099chr15136079 5345 4939 4894 4695 2338 2153 1968 1789 1179 1111 404 303 --16417 --
NM_003108chr2147289 7052 6935 6835 6727 6078 6063 5892 5547 4858 4610 2805 1591 775 15247 25843 5073 --
NM_003112chr793177 2367 2217 2190 1286 1007 945 424 204 22844 1220 22097 270 191
NM_003144chr6122181 2019 1913 1440 1385 899 852 515 509 264 134 96 22211 299 31768 1739 539 --
NM_003161chr1773610 2947 2493 1309 976 135 119 23404 989 --22782 2690
NM_003199chr18115277 4985 2272 2068 1536 1304 1071 943 866 248 182 13501 15395 --
NM_003262chr384728 4274 4143 3755 3352 1831 865 509 24710 4391 33189 2123 1871 1164
NM_003298chr395935 5827 5508 4324 4290 2402 1811 1429 543 --31817 1784 34 --
NM_003369chr1141812 613 157 33 12626 1954 21039 420
NM_003392chr394152 3801 3674 3502 3103 1253 1230 1121 52 24204 3701 1273 --
NM_003409chr1851401 1235 890 519 457 --1948 1363
NM_003410chrX62607 2504 1920 1156 280 47 13018 1121 --
NM_003421chr10164185 3797 3611 3494 1714 1684 1650 1577 1054 1005 990 692 463 447 104 25 33540 2858 715 24056 3387 1356
NM_003474chr1061580 758 628 444 210 35 1655 31913 1840 343 --
NM_003478chr1183003 2883 2649 2558 1087 980 927 55 22686 1265 12628 --
NM_003489chr2152823 2646 1017 923 830 --1758 12942
NM_003566chr1252507 786 474 284 250 123 23099 2437 --
NM_003574chr1881907 1759 1455 1260 853 831 502 319 --25304 5260 --
NM_003583chr12103867 3452 3329 2953 1535 1462 1111 885 752 501 23930 264 22754 728 --
NM_003590chr284021 3774 3155 2775 1582 1404 1331 280 11228 --12979
NM_003607chr1124395 4287 3959 3878 3706 3479 3036 3018 1458 1338 1056 728 14136 31605 1483 530 --
NM_003618chr221098 849 ----2830 811
NM_003622chr12102558 1689 640 604 536 529 405 338 287 139 ------
NM_003644chr17135920 5649 5294 4761 4584 4239 2020 1530 628 480 437 431 273 11845 24978 2339 --
NM_003671chr9123251 2952 2704 2649 2617 2368 2332 1122 1098 1062 709 57 --11129 --
NM_003759chr484142 4011 3474 2941 2907 2669 1640 130 31680 1603 79 1574 13320
NM_003799chr18124271 4227 3745 3455 3323 3243 3100 3042 1690 1657 1485 116 --2627 374 --
NM_003816chr851009 947 504 150 142 ------
NM_003831chr1871698 1474 1216 1140 550 539 441 --1602 1215
NM_003895chr2152144 2026 1568 1465 692 2671 44 3686 425 144 --
NM_003948chr482564 2386 2315 1842 1767 952 733 371 12356 1820 --
NM_003966chr5157560 7237 6393 6189 5605 5433 5254 3021 1870 1753 1545 1396 593 130 87 26256 1309 33037 2227 1615 12364
NM_003983chr1684084 3924 3633 3579 3411 3399 2944 171 12992 44219 3871 3048 562 --
NM_004028chr1893854 3323 3219 2834 2619 1466 1351 319 173 11177 13424 13158
NM_004171chr11199374 9276 9047 8800 8764 8680 8479 7891 7699 7446 7117 6521 3132 2859 2150 1247 1197 806 311 --32459 1959 1634 12907
NM_004232chr1882972 2764 2727 2436 1380 1026 813 529 23289 249 53773 3619 2505 470 389 13139
NM_004273chr10214418 4232 4046 4040 3699 3591 3472 3424 3260 3140 1785 1488 1306 1222 1177 1054 961 538 329 292 178 25016 1745 35020 1945 1149 --
NM_004274chr1442695 2430 2005 399 --13114 12408
NM_004293chr993625 3392 3386 2409 1493 1269 927 699 259 ----12488
NM_004331chr842185 1018 741 217 --22432 230 1672
NM_004338chr18166893 6568 5568 5529 5093 4553 4444 2826 2047 1413 1295 1228 1190 363 308 266 16127 15105 --
NM_004342chr792064 1835 1782 850 732 395 342 314 210 ------
NM_004438chr293107 3057 2422 2265 2143 889 283 277 180 ------
NM_004458chrX82594 1827 623 413 336 244 89 62 ------
NM_004464chr483358 3311 3156 2979 2690 1477 1320 66 ------
NM_004501chr183671 3210 2622 1535 1177 400 363 299 33526 3203 2495 32983 2560 1345 --
NM_004586chrX125427 4794 4168 4128 3564 3525 3511 3487 2081 2026 1859 904 --11747 --
NM_004612chr9104269 4118 4069 3455 1851 685 484 225 154 98 44831 1806 1714 1144 --13796
NM_004726chrX105571 4902 4884 4081 3595 1577 1204 1187 402 377 --13504 --
NM_004734chr13123132 2821 2502 2440 2078 1289 1194 1016 948 577 227 48 --1448 --
NM_004744chr463332 3275 3016 2936 610 249 ----11565
NM_004745chr8206618 6428 6316 5715 5645 5237 5150 5059 5022 4755 4474 2647 2265 2132 1950 1411 1107 645 559 164 26545 1523 ----
NM_004798chr20113148 3072 2738 2623 2438 2344 1418 1217 1013 668 397 --22807 2300 --
NM_004808chr1092898 2721 2498 1318 975 671 599 428 174 12122 23169 341 13321
NM_004815chr184786 4388 4122 3708 3612 3577 1829 170 ------
NM_004824chr61357 1958 3462 409 329 11438
NM_004845chrX134201 3695 2725 2691 1550 1536 1480 1429 1254 728 274 98 36 23360 436 ----
NM_004857chr14184491 4477 4419 4071 3985 3737 3571 3548 3319 3092 3074 3064 1689 1345 1190 897 135 25 1569 13957 14808
NM_004859chr1772278 2138 1982 1120 821 625 196 12050 1925 --
NM_004863chr14115178 5078 4921 4847 3798 3219 2067 1779 1461 1425 517 --24224 1480 15033
NM_004866chr5134750 4600 4363 3811 3789 3650 1959 1498 1365 1234 946 685 205 24683 561 13445 --
NM_004869chr1831441 248 129 --1451 21533 1228
NM_004898chr472907 2635 2002 1898 1862 514 381 22203 1758 21843 849 --
NM_004904chr7115897 5732 5673 4638 4367 4052 4035 2642 1939 466 77 15874 11354 15764
NM_004926chr1441706 1553 360 145 ----11251
NM_004956chr794375 4356 3938 3611 3603 2960 2845 225 60 12818 34061 3851 1591 --
NM_004992chrX188151 6851 6765 6104 3356 3243 3213 2632 2274 2063 1751 1710 1627 972 710 617 373 365 ------
NM_004992chrX188151 6851 6765 6104 3356 3243 3213 2632 2274 2063 1751 1710 1627 972 710 617 373 365 ------
NM_004999chr684522 3623 3445 3415 1560 1375 869 579 32920 1203 689 ----
NM_005036chr22158087 7857 7725 7718 7463 7410 6285 6167 5614 5572 5296 5217 2780 851 190 15942 48315 2998 2204 1013 --
NM_005044chrX134364 4044 3548 3128 3041 1649 1320 1314 471 435 412 142 31 11406 11057 13118
NM_005065chr1494981 4825 1455 1236 1155 923 795 458 148 1284 13990 --
NM_005093chr20195227 5156 4576 4543 4432 4409 4231 4194 4047 3762 3551 3270 2062 1828 1305 863 733 572 564 --35217 4374 45 --
NM_005116chr2063649 3267 3211 3126 2982 2877 23372 3290 13437 13039
NM_005121chr1742481 1397 1098 62 33101 877 740 12362 1827
NM_005135chr1593689 3241 2935 2815 2494 1532 1289 271 192 --13660 --
NM_005151chr18102407 2190 2038 1938 1810 1636 273 220 171 133 --11801 11504
NM_005156chr9104990 4054 4003 2069 2010 1654 1640 1402 1390 1021 22106 736 14836 --
NM_005188chr11208168 8149 7993 7913 7303 7251 6670 6567 6508 6465 6124 5608 5400 5378 5368 3289 1725 1605 1038 301 35855 1868 1056 27481 1881 --
NM_005197chr14135949 5767 4487 4188 4075 2321 1390 1232 1179 1045 598 364 221 12292 34818 4006 1808 --
NM_005235chr2127047 5291 5173 5002 3155 3071 2781 2715 2708 1819 1677 129 --57756 6122 5466 2489 750 12223
NM_005339chr463949 3811 1312 1097 536 326 --13026 --
NM_005359chr18126142 5664 5586 4467 4213 4063 2518 1657 1536 330 155 37 34624 2014 990 --21583 359
NM_005385chr372489 2243 2041 1779 940 478 384 1329 22478 561 11095
NM_005397chr7113698 3503 3417 3076 2863 2688 2435 1285 375 368 36 --13520 22802 2778
NM_005399chr164407 4285 3262 2845 798 791 1500 22743 187 --
NM_005433chr1862794 993 932 605 332 69 21958 712 21096 574 --
NM_005436chr10124042 3887 3216 3079 2682 1500 1010 826 801 548 503 389 --33018 2839 1545 --
NM_005486chr174664 497 244 205 2683 167 --1153
NM_005497chr17105863 5772 5443 4882 2376 1100 1057 789 648 223 ----15391
NM_005502chr962977 2616 1214 1091 574 493 --22122 604 12132
NM_005506chr482865 2605 2559 2187 754 611 449 295 11858 22505 1171 --
NM_005530chr151566 167 1340 2423 334
NM_005578chr3104660 4493 3633 3572 3502 3141 1280 1266 620 613 ------
NM_005596chr9166217 6070 5870 5776 5507 4805 4628 4487 4439 4421 4325 1116 871 554 207 100 14432 15450 --
NM_005665chr1104059 3422 3322 3262 3055 2989 1688 1431 1136 517 --11523 14816
NM_005668chr5114452 3664 3467 3314 3077 1732 1491 1454 1408 867 408 24149 1339 24500 1667 14473
NM_005746chr71275 32104 1739 614 1586 1841
NM_005748chr12102882 2846 2490 2308 1201 958 938 915 145 133 --11325 --
NM_005759chr294077 3924 3818 2906 1645 1161 367 92 31 11484 ----
NM_005779chr5142900 2624 2275 2244 1379 1328 1310 1147 1002 918 464 402 329 133 --1490 --
NM_005808chr373518 2772 1116 577 378 264 163 11072 32486 2297 394 --
NM_005819chr1123118 3012 2948 2784 2696 2679 2549 2380 693 545 520 233 ------
NM_005832chr3------21095 1022
NM_005840chrX207466 6955 6833 6632 6352 5881 5821 5574 5513 5287 3037 2163 2128 2059 1729 1376 1271 1066 985 165 37538 6800 6435 15929 17592
NM_005868chr752228 1878 1802 1768 1541 12465 1363 1744
NM_005885chr531396 358 344 --21305 256 11126
NM_005895chr1283312 3284 3238 1022 947 757 437 143 --43964 3771 2882 571 --
NM_005901chr18158067 7849 7426 6585 6406 6271 6077 3477 3026 2504 2141 2107 1286 994 894 26801 2388 12859 16979
NM_005902chr15154412 4310 3979 3905 3787 3476 3330 1786 1776 1461 1447 1156 652 639 271 ------
NM_005903chr564524 4501 4202 3385 1558 1482 33283 3202 221 44967 4637 4261 3252 --
NM_005941chr893787 3194 2861 2664 1539 1205 1081 1042 288 13427 ----
NM_005955chr165068 4426 4108 3540 2220 916 44407 3682 1838 1461 21868 1295 14391
NM_005966chr28841 781 596 522 446 439 329 65 12116 ----
NM_006007chr974495 3653 3307 1490 735 172 105 14475 13235 14375
NM_006011chr15113160 1728 1674 1335 1322 1075 1066 938 562 226 88 2814 139 ----
NM_006024chr73891 578 267 2616 356 --1757
NM_006037chr284023 1452 1229 1073 612 606 575 363 --24580 1745 --
NM_006047chr2061365 611 404 386 336 157 1175 --21156 1043
NM_006080chr782242 2202 2190 2121 1969 1120 988 208 1867 ----
NM_006122chr15122718 2583 2529 1752 638 509 476 470 352 333 241 38 12773 ----
NM_006203chr5135193 5110 4444 4121 4067 3885 3638 3567 2036 1454 921 474 429 --1389 --
NM_006212chr1115413 4190 4156 3924 2117 1719 1653 1370 879 698 148 13604 --1711
NM_006251chr593208 2992 2277 2159 2066 1201 1123 386 173 13322 22592 889 --
NM_006256chr132233 827 655 --42014 1758 709 553 12801
NM_006267chr23736 526 491 11555 --11892
NM_006275chr2062350 1869 1811 327 204 120 ----11608
NM_006282chr20114703 4087 3534 3342 3016 1768 1761 1321 1217 263 243 24194 1576 34026 3057 1086 13731
NM_006283chr894838 3827 3698 3178 3134 1928 1749 1312 588 --31143 963 917 --
NM_006298chr683251 2893 2532 2382 763 599 115 88 12870 12506 12606
NM_006306chrX145704 5672 5607 5575 5483 5440 5374 5308 5233 5196 4662 1836 1079 154 11024 34312 3617 615 --
NM_006379chr751877 1795 472 365 295 21570 1562 1452 --
NM_006380chr17154270 4216 3695 3286 3227 3165 3105 1579 807 703 623 473 295 254 155 ------
NM_006393chr10104415 3400 2767 1429 1287 1144 1070 563 497 67 --24510 679 23759 2861
NM_006420chr20123381 2953 2499 2286 1395 883 645 626 534 116 86 37 1808 ----
NM_006457chr463769 1604 1461 1398 1349 476 2310 282 2789 414 --
NM_006482chr12103867 3452 3329 2953 1535 1462 1111 885 752 501 23930 264 22754 728 --
NM_006534chr20113336 3093 2976 2823 2778 2686 2231 2077 936 645 235 1398 33043 2314 1051 --
NM_006544chr14176087 5937 5695 5512 5209 5169 4967 4349 4327 4208 4008 3969 3898 412 89 80 43 1657 15773 --
NM_006561chr1095086 4580 4507 1706 1600 856 755 601 305 21827 960 1437 16197
NM_006572chr1772211 1404 1337 865 834 519 91 --22446 733 --
NM_006599chr1685894 5191 3034 2033 1638 796 711 259 37242 6189 5700 15225 12994
NM_006609chr262531 1943 845 772 735 581 --12669 11079
NM_006614chr362950 1232 788 769 610 90 22368 993 12442 --
NM_006626chr952573 1901 902 868 564 --32523 2418 1029 --
NM_006628chr1594518 3820 3411 3380 2834 1778 1016 546 419 31483 1122 646 --1888
NM_006629chr1882627 2353 2095 1054 730 694 629 197 --1509 --
NM_006729chrX135414 4718 4625 3875 3790 3502 1654 1005 995 560 440 392 205 ------
NM_006731chr9105800 5390 5225 5185 4495 4320 2217 1861 1674 130 35355 3634 635 25542 949 --
NM_006750chr1687514 7132 5998 5948 5597 2935 2314 1536 27770 3032 37397 5251 1123 16729
NM_006827chr1463412 2673 2425 1309 723 46 --1880 12101
NM_006885chr16104119 3780 2951 2669 1582 1169 625 533 375 286 --13485 --
NM_006948chr2172003 1771 1674 1636 1612 674 131 12296 ----
NM_007030chr5184003 3907 3571 3419 2036 2005 1974 1912 1881 1832 1618 1544 1422 872 798 537 343 95 --1434 --
NM_007038chr21175621 5370 4768 4177 4140 4115 3988 3905 3724 1959 595 290 206 138 120 90 70 --1324 --
NM_007050chr20137933 7369 6740 6431 6275 5923 5501 5458 5200 5120 3196 1645 255 16787 25792 2903 --
NM_007064chr381681 1599 1565 1434 1159 660 505 239 ------
NM_007114chr333076 2143 262 12542 190 21044 931
NM_007137chrX145283 4554 4460 3860 2221 1796 1553 1507 1372 1180 1023 481 469 281 45421 4504 1458 518 24986 1113 --
NM_007146chr1772344 2250 1075 782 447 370 275 12627 1826 1248
NM_007159chr331639 109 73 --21703 1560 11247
NM_007173chr1172116 2106 2021 1842 1729 739 241 1529 1779 --
NM_007249chr13228919 8676 8366 7974 7760 7438 7143 7001 6245 5974 3714 2960 2948 2851 2536 2473 2288 2279 1703 1329 758 427 47996 6577 6258 2228 47803 7666 5812 1861 --
NM_012089chr141486 990 183 55 ----2972 453
NM_012096chr383604 3127 1301 943 525 500 451 63 --22940 2628 11079
NM_012104chr1193718 3376 3302 3038 2950 2662 1204 648 198 ----13800
NM_012104chr1193718 3376 3302 3038 2950 2662 1204 648 198 ----13800
NM_012120chr642580 2500 2463 136 32970 2019 685 12418 --
NM_012141chr1374185 3942 3715 3419 3409 2957 2596 13442 --11117
NM_012164chr9157222 7122 5468 5211 3000 2821 2704 2150 2126 2119 1956 1900 1078 729 615 14606 22228 966 --
NM_012249chr2112634 2256 1308 1070 1035 989 958 496 443 305 134 --23470 363 --
NM_012252chr7155229 4581 4461 4302 1988 1744 1507 1459 1415 974 844 748 425 145 136 ----24868 1428
NM_012281chr752474 2047 779 488 63 21774 533 --1205
NM_012287chr3103674 3641 3491 3373 3157 1778 1734 1493 362 243 12877 ----
NM_012297chr452550 2492 2220 519 448 12151 1182 12367
NM_012309chr11114696 4442 3866 3672 1642 1300 1294 1279 1260 920 889 ------
NM_012316chr174798 4313 3953 3941 3518 2225 183 13988 --1526
NM_012334chr574733 4336 4193 4028 1363 383 98 --23611 1499 13671
NM_012347chr642557 2486 2058 1088 12333 12881 1577
NM_012382chr594299 3576 3432 3160 2759 1509 1220 1063 150 13944 ----
NM_012431chr7103666 3228 3149 2883 2600 2583 1370 1156 889 115 2430 326 ----
NM_012465chr1092754 2428 2292 2096 711 629 566 127 24 --22122 1122 --
NM_013250chr1171469 1345 469 168 152 42 36 --1137 --
NM_013255chr7158826 8575 7412 7306 5870 2979 2139 1523 896 753 637 603 112 36 23 36574 5777 1684 36384 5368 3132 12950
NM_013261chr472948 2449 832 730 655 398 27 33491 3234 2635 1218 --
NM_013269chr12144008 3600 2913 2882 2870 2809 1448 1240 1167 1102 957 881 361 300 --12936 --
NM_013309chr1552485 2266 1643 456 260 11832 1230 1298
NM_013372chr1573348 3122 799 784 715 368 355 22497 642 ----
NM_013381chr122504 281 1342 11611 11659
NM_013423chrX4915 480 219 146 --1470 1901
NM_013427chrX4915 480 219 146 --1470 1901
NM_013943chr152955 2874 962 336 85 12089 33242 3187 2230 --
NM_013989chr14165042 4840 4829 4591 4364 4030 3946 3643 1762 1339 797 789 720 628 110 84 --23998 742 --
NM_014021chr1102659 2568 2538 2156 2129 1262 1211 882 806 209 1773 ----
NM_014028chr6102667 2456 2337 1295 1210 1170 1019 933 899 251 ------
NM_014048chr1694998 4899 4443 4295 3679 3474 1240 673 119 --23907 1306 14490
NM_014106chr1552880 1865 778 523 154 22990 147 11950 --
NM_014112chr8105336 5259 4501 4287 3460 3375 1172 348 308 30 ------
NM_014141chr785260 4564 4551 4541 1800 1743 1629 468 --15197 --
NM_014155chr11127518 7117 6883 6438 6426 6364 5260 2750 1986 494 170 125 --1699 14753
NM_014157chr16103862 3741 3506 3382 3367 3293 2714 998 880 727 33662 3357 734 13848 --
NM_014181chr282692 2571 2494 2392 2363 2067 1019 308 21146 191 1424 --
NM_014240chr3154121 3975 3936 3639 3470 3037 2858 2812 1573 1301 1181 768 709 602 514 21097 1020 ----
NM_014243chr45707 645 280 200 134 1624 11763 11945
NM_014309chr22145091 4906 3619 3317 1982 1872 1811 1576 1520 1338 910 745 435 319 11849 1391 21077 463
NM_014331chr4167239 7175 7125 6723 6711 6655 6260 6056 5849 5370 5196 5023 4722 2531 2456 194 26279 1842 36623 2253 1930 --
NM_014421chr462052 2007 853 507 173 90 22069 427 1752 11329
NM_014423chr595463 5258 5147 4879 4110 3949 1759 1356 1055 ----24409 900
NM_014456chr1031216 1158 211 ----11397
NM_014504chr741690 1649 415 80 1693 12138 11737
NM_014711chr1651553 599 532 416 266 11745 --1314
NM_014721chr6147475 6422 6220 6108 5946 2964 2439 2418 1722 1514 1140 292 223 28 12506 15084 24533 800
NM_014739chr6103977 3955 3630 3006 1124 846 809 397 126 27 32588 1647 897 13351 --
NM_014766chr7103091 2958 2927 2795 1408 1163 1135 1089 685 547 23006 1181 22822 819 1910
NM_014826chr1124395 4287 3959 3878 3706 3479 3036 3018 1458 1338 1056 728 14136 31605 1483 530 --
NM_014838chr22102413 2383 2178 2011 1978 1897 1832 1019 565 312 12244 --1423
NM_014860chr282570 2135 2007 1961 1871 494 67 48 12448 ----
NM_014873chr184138 3972 3936 3922 3519 1822 1024 980 2549 87 13137 --
NM_014877chr17137665 7012 6368 6113 5926 5781 5433 5243 4818 2088 1119 1108 57 56741 4782 2991 1670 225 47259 6700 5206 2144 26694 5143
NM_014897chr17133275 2975 2937 2485 2137 1182 1047 847 680 566 515 182 60 13141 22827 465 --
NM_014912chr1072986 2817 2655 2392 211 204 195 1821 23564 1078 11415
NM_014920chr673421 2858 2740 2590 1207 1028 903 32919 1376 45 11437 --
NM_014932chr381941 1600 1324 1242 792 725 702 304 ------
NM_014934chr13134027 3744 3028 2840 2789 1464 1431 1424 1188 847 588 503 120 23722 664 ----
NM_014936chr652070 1836 1017 556 411 22514 1942 11062 32593 1830 1126
NM_014946chr292930 2884 2694 2553 2481 2379 101 82 26 ----1971
NM_014950chr1461455 1195 1164 689 525 433 ----1559
NM_014953chr13114060 3232 3124 3045 3006 1665 1162 883 388 378 250 2682 211 1196 13270
NM_014961chr452091 1835 1812 1418 667 12243 --11946
NM_014962chr2041139 932 399 365 32523 2341 594 --12240
NM_014982chr14115006 4884 4529 4495 4014 3803 3378 1745 1639 394 76 --2770 128 14897
NM_014988chr442134 1788 405 360 11946 21036 393 22215 2005
NM_014991chr4103114 3053 2444 2325 2049 1315 1260 972 874 170 --22455 1066 --
NM_015000chr1253000 2557 2046 1132 885 1509 31109 582 137 --
NM_015025chr252452 2414 2085 1664 735 1174 32518 955 821 --
NM_015026chr1254300 4233 3617 3606 420 34013 3667 1491 11465 23541 1822
NM_015035chr20156438 5529 4730 4681 4568 2693 1547 1490 1358 1320 1139 1129 652 278 134 --24376 305 --
NM_015039chr173846 3297 3065 3014 2757 1241 930 34339 3831 862 12873 13096
NM_015051chr963251 3207 3188 2711 594 113 ----23359 906
NM_015068chr7103781 3540 3397 3300 3271 3006 1571 1293 382 23 13549 --1215
NM_015071chr5195857 5743 5434 4956 4811 4746 4600 4451 4401 4220 4140 4020 2554 2543 2256 2043 1576 524 348 36351 5608 930 56313 5484 5228 1462 843 --
NM_015076chr6103855 3746 3512 3305 3248 3194 1631 1394 603 513 --2691 391 --
NM_015077chr17134733 4672 4468 4394 3935 3187 3097 1839 1696 1432 902 703 382 --23872 3500 --
NM_015090chr1115600 5385 5144 5012 4580 4330 1606 981 880 842 826 22215 1016 25240 4928 --
NM_015092chr16124262 4051 3840 2989 2958 1777 1486 1023 884 411 275 53 11451 1338 12877
NM_015115chr452840 2362 2175 1163 457 12112 11212 12430
NM_015132chr731666 1289 322 --2626 533 31935 1564 1463
NM_015144chr16173982 3173 3055 2995 2727 2588 2530 1582 1570 1516 1268 936 735 639 504 137 21 ------
NM_015172chr171637 1524 1348 1247 1176 1013 251 ------
NM_015192chr2042536 2154 873 377 ----12187
NM_015199chr372011 2003 713 678 331 232 189 ----12776
NM_015200chr4112529 2421 2068 1753 1729 653 455 445 197 92 40 ------
NM_015206chr15113360 3350 3032 2665 2550 2377 1399 1334 1098 361 62 --1569 --
NM_015208chr1894068 3608 3600 3561 3322 3123 2705 2635 203 --13129 --
NM_015215chr152379 1196 1025 178 168 22480 2404 22592 715 --
NM_015225chr972748 2736 2559 2150 1963 548 143 13064 12510 --
NM_015247chr1695248 4682 4523 4487 3543 1957 1225 1217 40 13557 2991 864 25297 3464
NM_015271chr464069 3269 2805 1233 940 365 13787 44288 3930 1146 265 --
NM_015275chr1232023 1631 42 --11400 11354
NM_015282chr272754 2371 1177 804 627 233 157 13068 11186 --
NM_015310chr8188348 8212 7656 6914 6411 5912 5377 5344 3252 3038 2880 2859 2429 1591 1118 470 463 255 26388 2012 22161 1689 21900 1356
NM_015313chr11133918 3690 3408 3256 1869 1844 1421 1406 1230 494 481 154 103 1262 ----
NM_015314chr772292 2201 2078 1734 1638 1597 139 --2694 233 1812
NM_015336chr1272064 1957 1063 866 799 476 178 12696 21854 758 --
NM_015365chrX103504 1687 1281 1118 972 816 752 727 685 276 22882 1592 1862 --
NM_015375chr1104329 4240 4071 3747 3730 3646 1997 1068 763 563 14791 31108 990 955 --
NM_015396chr351441 1334 934 377 58 ----21155 1067
NM_015436chr4103343 2959 2775 2735 2697 542 456 359 286 45 12314 --1958
NM_015455chr533296 471 333 11202 1433 1278
NM_015458chr885073 4807 3356 2054 1978 1775 1152 427 1823 13528 --
NM_015553chr6134872 4765 4636 4493 4373 4278 3921 1913 1433 1132 1036 853 497 --14057 --
NM_015554chr1572577 2144 2029 1799 1119 794 44 --22758 2287 --
NM_015555chr631614 1148 189 1731 --1200
NM_015560chr352151 2105 911 781 553 32537 847 238 22130 803 --
NM_015568chr2084030 2855 1218 1062 809 550 475 433 23696 3481 34309 3485 2728 --
NM_015571chr662659 2324 2139 1709 842 506 11900 --12242
NM_015640chr1105266 4648 4595 4286 3928 3887 1909 1228 623 177 13653 24665 1327 --
NM_015713chr863392 3065 2629 2575 804 542 1816 33474 3086 2891 --
NM_015879chr18128481 8406 8391 8037 7748 7534 7193 6718 5579 5268 2187 2002 2946 72 12835 --
NM_015886chr8145223 4750 4678 4660 4433 2116 2090 1949 1676 1663 1637 1630 1148 1044 --25445 4210 --
NM_015995chr15155272 5066 4246 3937 3906 3640 3479 3423 2159 1847 1165 1111 1041 829 365 --11540 --
NM_016009chr184365 4185 3942 1198 579 534 471 281 --23094 175 23620 848
NM_016018chr882612 2552 2148 1798 698 489 365 288 1254 12618 1961
NM_016073chr152432 116 1839 --11076
NM_016096chr851744 1609 1579 402 121 --11333 1326
NM_016142chr114864 268 240 148 11323 1297 --
NM_016206chr3158927 8519 7974 7595 6983 6038 2844 2788 2753 2469 2433 1717 1398 1194 106 37337 3615 2164 27131 3190 --
NM_016220chr741935 1873 1860 446 --11854 --
NM_016221chr562314 2133 1896 1650 931 641 11955 21681 118 11532
NM_016230chr61105 1520 1459 1525
NM_016260chr2197460 6190 5144 4926 2931 2895 2831 2572 2405 2055 1646 1393 1384 1228 983 380 369 352 191 1791 36406 2066 1488 --
NM_016275chr372644 2523 2317 2207 1074 1008 967 22477 568 12676 --
NM_016353chr841958 1529 342 75 2698 127 31818 1730 560 --
NM_016374chr121468 1361 ----21519 528
NM_016374chr121468 1361 ----21519 528
NM_016422chr1192864 2840 2418 2182 1945 1204 1131 912 93 1435 22374 2361 --
NM_016485chr692222 1819 1777 1627 1614 1598 796 608 78 31448 835 424 ----
NM_016513chr673421 2858 2740 2590 1207 1028 903 32919 1376 45 11437 --
NM_016530chr15173748 3639 3408 3389 3201 3149 2837 1631 1598 1562 1465 1274 1196 683 629 267 82 13560 --13516
NM_016531chr4144215 3987 3936 3902 3833 3485 3441 2958 2833 1657 1516 1296 1109 741 23774 355 12982 --
NM_016544chr283820 2502 2410 1508 863 795 729 92 33204 2632 2442 23923 375 --
NM_016577chr3144423 3832 3681 3614 3408 3215 3002 2786 1779 1756 1635 1425 1055 607 --12797 --
NM_016617chr1332141 1606 207 138 21528 650 1810
NM_016929chr6154481 4177 3899 3526 3383 3112 2929 2909 2796 1808 1621 1192 468 206 33 24030 1600 13200 --
NM_016953chr295414 5184 5082 5020 4878 4050 814 676 531 15257 14949 15395
NM_017420chr14113695 3528 2943 2781 1038 1026 879 772 661 352 169 --43662 3635 2720 975 --
NM_017447chr2174053 1306 1263 1099 841 777 221 23627 2777 --1853
NM_017551chr1062587 2489 2271 1823 1641 114 --1158 1799
NM_017563chr3166381 6258 5766 5574 5446 4931 4482 4423 4331 4002 2546 1025 694 509 438 317 12130 22370 1082 --
NM_017580chr1082328 2088 1529 238 186 112 79 22 11906 --12208
NM_017594chr962564 2300 2209 2152 1040 401 12699 22587 193 --
NM_017610chr1551789 1308 737 609 331 ----21344 564
NM_017628chr4145290 4803 4472 4346 4247 4176 4047 3900 3325 2129 1799 1513 1256 979 ----15304
NM_017633chr693831 3690 2741 2489 1578 1265 618 477 49 11109 --11165
NM_017637chr9109120 9040 7614 3565 3372 3330 2694 1544 1269 1128 32564 1242 1229 17445 38175 355 264
NM_017644chr3105043 4630 4180 4088 1733 1681 1574 873 651 599 --24071 1949 --
NM_017645chr942929 881 635 569 --12645 2901 58
NM_017650chr794506 4156 3828 3743 2128 1289 1164 1062 890 21719 1428 24455 165 14410
NM_017658chr1473669 3634 3616 3097 2996 1206 1097 --34401 3200 430 --
NM_017676chr581756 1719 1356 1188 745 680 548 82 138 1213 1505
NM_017694chr261966 1669 1348 735 656 158 180 41554 1417 430 279 --
NM_017712chr19136341 5807 5788 5761 5516 4929 4914 4765 4535 4386 2408 1016 376 ----1612
NM_017753chr95987 898 824 389 214 ----1338
NM_017762chr1592312 1891 1522 854 835 780 679 502 351 --11628 --
NM_017769chr1441316 619 467 430 --31107 738 361 --
NM_017813chr865008 3686 3606 1796 1004 544 14162 31962 355 160 --
NM_017919chr9114817 4786 4753 4504 4058 4052 3959 3828 3756 2286 1306 --1645 --
NM_017935chr44506 310 138 116 1672 --1206
NM_018036chr14144000 3888 3703 3279 3179 3123 3101 1552 1403 1198 762 414 198 54 ----13517
NM_018085chr1148168 8010 7899 7818 7547 7407 7014 6783 6363 3291 3225 2780 2583 1779 27670 6576 36771 2679 792 21585 1545
NM_018121chr1072298 1276 820 792 773 365 231 1265 184 --
NM_018155chr352794 2352 1145 87 68 12740 --12745
NM_018157chr12113092 2844 2620 2318 1061 711 535 411 328 229 192 22164 612 22946 2563 --
NM_018225chr9125317 5017 4860 4850 4755 4425 1977 1037 1017 1004 846 797 15091 24635 3838 1126
NM_018243chr473878 3640 3212 2956 1147 308 179 1903 --11486
NM_018299chr883430 3387 2506 2274 1303 1131 374 28 23134 2576 12662 --
NM_018323chr471163 1157 691 491 435 299 36 21775 312 ----
NM_018340chr16145016 4657 3718 3576 3519 3065 1988 1897 1880 1792 1355 858 813 179 --33781 1241 593 --
NM_018351chr1263742 1742 1537 1179 224 54 1704 23514 651 13078
NM_018361chr893773 3433 3035 2783 1479 1116 717 658 496 14041 1135 1965
NM_018362chr1163983 3598 3379 2592 1289 1045 --33186 2692 1422 --
NM_018364chr153266 3010 1593 1554 1167 22781 713 ----
NM_018367chr1192128 1937 1913 982 678 642 272 242 149 154 22326 730 --
NM_018374chr745168 4678 1395 384 24246 3724 --15018
NM_018383chr231685 588 407 --21259 382 11579
NM_018403chr3113788 2800 2628 1624 990 948 500 417 373 347 78 13484 --1456
NM_018439chr1882634 2440 2361 2317 1025 887 836 661 12275 11688 --
NM_018440chr8157987 6844 6403 5921 5915 5708 5638 3446 3260 2792 2659 2403 1968 869 170 32541 2086 1600 ----
NM_018444chr832107 1975 1556 21602 772 12345 12274
NM_018452chr6_random123689 3578 3543 3186 2867 2785 2548 2516 430 233 155 38 --11489 --
NM_018566chr194826 4683 4538 4516 1274 1235 759 713 585 24884 4703 24748 4349 1241
NM_018638chr12104108 4033 3866 3777 3747 3536 1749 1589 967 637 --14660 --
NM_018841chr132765 2424 1149 23213 584 13286 1199
NM_018844chr791986 1878 1621 1523 1496 1488 1355 752 474 11478 ----
NM_018947chr7114978 4433 3618 3314 3083 1724 1701 1432 1116 91 35 34663 3651 1042 13863 1117
NM_018958chr15103435 2811 2765 2597 2589 1584 1438 1250 1223 354 --23896 851 --
NM_019001chr374613 3641 2983 1848 1405 1133 85 31423 646 637 ----
NM_019022chr1892713 2540 2517 1263 1155 362 250 208 91 3927 782 318 1673 --
NM_019050chr452236 1962 1499 725 324 1741 ----
NM_019072chr5144064 3985 3828 3294 3143 2962 2794 2768 2738 2649 1701 1113 657 576 --14055 --
NM_019117chrX62988 2835 2796 1223 786 420 22449 451 1810 --
NM_019859chr1081249 1228 1160 650 420 256 79 53 --2489 399 11361
NM_019860chr1081297 1276 1208 468 304 127 101 56 --2537 447 11409
NM_019891chr151137 851 518 278 118 1986 --11033
NM_020119chr7103869 3333 3300 3142 1625 1588 1121 153 75 55 22867 2655 11324 23760 3544
NM_020122chr255162 5140 4054 3816 2125 25935 2163 1871 12263
NM_020141chr1102179 2085 1846 1799 1681 1641 341 239 194 113 --12242 --
NM_020390chr384712 4688 3521 3348 1810 1639 1566 630 23496 3242 ----
NM_020403chr1341207 1106 537 204 ----21730 298
NM_020432chr782232 2154 1927 1811 1581 1484 490 317 22091 40 --11832
NM_020443chr186633 5682 2326 2012 1786 1198 119 36 26688 1405 16585 15706
NM_020466chr6114822 4374 1976 1951 1707 1645 1464 941 681 672 620 23036 934 1562 --
NM_020662chr661842 1398 1311 1296 167 46 --31774 1629 1302 --
NM_020673chr20106964 6682 6666 6646 6289 2794 2009 1962 131 58 34704 3021 730 12356 --
NM_020699chr1175275 4765 4663 4186 3296 1585 1342 1245 1089 1014 885 762 565 286 131 123 111 --14840 --
NM_020711chr252486 2018 1858 1805 547 51612 973 890 632 138 42559 2187 2172 2157 --
NM_020717chrX114379 4203 3822 3816 3725 3577 1858 1388 516 440 281 14619 34946 3874 3650 --
NM_020718chr16106511 6371 5756 5595 5186 4944 4475 2575 2457 2255 15981 15501 --
NM_020752chr1052459 2260 2038 341 55 --32591 1881 1821 1649
NM_020771chr651099 1027 990 52 45 --1449 11074
NM_020772chr17128156 8001 7644 7489 3258 2883 2388 1433 1346 803 464 115 13029 --1124
NM_020774chr18105785 4441 3865 2223 2187 2106 1939 1491 1216 537 14334 1589 15231
NM_020782chr12134841 4671 4430 3581 3543 3495 3482 3009 2993 1835 1648 1337 1056 --11132 13713
NM_020810chr1472988 2946 2710 1188 812 607 582 --153 13037
NM_020841chr1274009 3737 3329 3268 2827 1320 644 1945 --13858
NM_020866chr133870 846 194 ----2417 160
NM_020870chr491632 1406 813 730 622 532 246 162 68 ------
NM_020922chrX91452 1383 577 529 478 274 210 196 41 --11622 --
NM_020935chr274575 4511 4133 3250 1701 1417 158 23000 360 31636 1406 833 13005
NM_020940chr1052765 2427 457 129 32 1243 11027 12959
NM_020948chr173463 3321 3313 2577 1155 1099 554 13641 13687 --
NM_020987chr1061146 1128 520 378 352 205 ----2572 530
NM_021033chr13172925 2559 2517 2240 2154 1337 931 920 737 705 677 303 130 108 86 77 54 ------
NM_021072chr552498 1797 1778 1730 24 --12289 12548
NM_021101chr3184 --22437 1563 11776
NM_021205chr142867 2144 600 346 ----12410
NM_021255chr1484099 3566 3393 3182 3143 2793 2754 2704 12901 13058 --
NM_021622chr1052306 2086 1710 1661 635 --12404 11844
NM_021629chr3104888 4680 4302 4221 3444 1723 1366 420 410 267 34428 3772 1604 33783 1979 292 11650
NM_021647chr494716 4613 4410 3917 3331 1855 1350 227 211 21876 743 24345 1822 1969
NM_021911chr5135470 4661 4534 4461 4228 2061 1671 1492 1327 1025 1002 742 563 34182 2094 749 14797 13917
NM_021912chr1573146 3060 2941 2776 1001 895 211 --24029 288 --
NM_021954chr1393495 2559 2366 2309 1358 1051 876 669 87 1578 13014 11157
NM_021961chr11107064 5494 2981 2892 2847 2434 2351 1644 1512 357 --25329 1030 11000
NM_021964chr375146 4868 4417 2474 2223 931 211 --25579 430 25967 1676
NM_021998chrX31019 272 219 11382 1209 1600
NM_022133chr821568 100 1758 --11311
NM_022166chr16176338 6248 6160 6092 5899 5423 4272 4222 3893 2210 2145 1997 1892 842 341 165 32 11780 24335 130 --
NM_022340chr3143163 3132 3100 3092 1285 1254 1134 570 488 449 342 192 76 64 --11400 --
NM_022351chr873643 3087 3079 2608 998 974 943 --22515 574 --
NM_022456chr12167143 7032 7000 6976 6923 6602 5479 5445 2462 2425 2140 883 791 601 440 331 --21873 1097 27064 2991
NM_022469chr163214 2664 2449 2068 2056 1301 1772 22644 2232 33105 2744 1329
NM_022716chr142497 470 392 123 13175 --11150
NM_022735chr191583 1201 616 584 572 527 493 236 40 11817 ----
NM_022893chr282990 2523 2243 1261 1251 689 681 141 22872 2410 --1574
NM_022912chr282037 1984 1945 1882 1172 1012 824 138 --22967 95 --
NM_022977chrX82594 1827 623 413 336 244 89 62 ------
NM_023923chr173802 2504 1490 1432 704 603 100 --43730 3464 2613 164 --
NM_024007chr532015 78 53 --1897 22863 488
NM_024513chr3103834 3424 3122 2993 1328 1043 963 854 848 36 --12899 11036
NM_024524chr382786 2381 946 589 301 254 162 84 ----12605
NM_024596chr8175343 5094 4817 4725 4198 3812 3642 3491 2088 1835 1825 1769 1756 1300 1110 907 526 23288 1456 21553 479 21204 764
NM_024665chr394278 3718 3644 3445 2920 1273 426 306 276 14726 1179 --
NM_024740chr1173941 3471 2662 2627 573 332 319 12796 22949 1536 --
NM_024744chr262386 779 722 660 344 21 --1819 --
NM_024770chr2136251 6204 6050 5988 5405 5284 5234 5098 5089 4300 4198 2526 1633 25261 2535 21083 550 --
NM_024817chr15105157 5120 5032 4693 2175 1570 1107 954 834 623 13870 ----
NM_024947chr3199075 9027 8435 8411 8399 7219 7192 6691 6284 5870 3137 2780 2677 2167 1598 1279 894 818 247 35906 1898 84 69558 8075 8007 2061 1433 464 19502
NM_024949chr4174749 4626 4343 4236 4132 3963 3713 3271 3217 3197 3183 3070 1995 1805 1476 1224 897 --44120 3191 1881 977 14422
NM_025054chr8104154 4013 4007 3777 3606 1312 1102 944 763 27 23262 2616 1567 12680
NM_025134chr1632293 998 445 11844 --1323
NM_025179chr1154638 4609 4585 4021 3840 3800 3757 3464 3157 1614 1540 1287 1204 652 392 11603 13327 --
NM_030579chr1653332 3216 1322 848 73 23651 867 12926 1909
NM_030621chr1494172 4006 3584 3196 2949 2741 1706 466 116 1862 1809 2154 142
NM_030623chr241152 652 274 110 11624 --21596 154
NM_030627chr543234 1169 852 756 137 --13097
NM_030647chr785289 4343 2413 1952 1805 1486 1185 1044 15887 34305 2428 129 --
NM_030648chr475593 4472 3744 2247 1559 1237 37 11887 44110 1677 1017 505 1728
NM_030674chr12195817 5796 5381 5292 5026 4676 3931 3751 1998 1992 1686 1662 1577 981 784 461 152 104 94 --31874 1359 1226 1116
NM_030755chr1442635 1961 1058 47 11249 12461 1586
NM_030806chr1239145 8997 8829 8791 8155 7868 7664 6968 6891 6836 6148 6017 3637 3518 3134 2925 1833 1689 1517 1443 1260 1211 827 28978 7815 13038 --
NM_030816chr193046 3012 2757 2468 1376 1110 743 72 47 1930 23315 3224 11037
NM_030918chr1154926 4686 4660 4366 4248 4238 3878 3782 3709 3690 3540 3328 2163 1316 569 --25128 349 23472 889
NM_030945chr562358 2214 2189 2171 953 306 --1929 --
NM_030962chr1161342 1305 1047 59 33 24 ------
NM_030964chr583519 2650 2473 1119 605 418 295 150 --1661 23624 933
NM_031371chr121468 1361 ----21519 528
NM_031371chr121468 1361 ----21519 528
NM_031418chr1142808 2287 2067 234 --12337 1887
NM_031427chr14105884 5802 5470 5464 4900 3961 3820 2196 1255 1151 25564 4510 --14398
NM_031435chr1283125 2968 2295 1253 945 714 469 204 13347 ----
NM_031442chrX62895 2017 1272 1169 816 717 12477 --12279
NM_031468chr7208258 7938 7859 7325 6942 6453 6403 6120 5437 5000 3304 2749 2485 2364 2301 1243 476 417 318 253 37922 2038 1271 23269 2619 --
NM_031469chr6153731 3595 3543 3495 3416 3369 3355 1618 1574 1457 1171 491 425 355 128 11088 ----
NM_031483chr2042892 1179 916 910 --13223 12235
NM_031844chr183671 3210 2622 1535 1177 400 363 299 33526 3203 2495 32983 2560 1345 --
NM_031845chr263602 2503 1339 694 201 173 1558 --11170
NM_031847chr263602 2503 1339 694 201 173 1558 --11170
NM_032012chr974830 4808 4796 3904 875 211 120 14018 24010 144 14023
NM_032047chr352263 1642 1580 916 133 32016 1702 327 12020 --
NM_032105chr1227592 7248 7098 6757 6669 6310 5989 5968 5898 5821 5789 5766 5401 5210 2851 2503 2443 887 604 572 111 58 27504 6779 16229 --
NM_032160chr1893514 3136 3053 1741 1648 1409 918 180 138 --53555 2668 997 592 254 --
NM_032208chr2103237 3154 3087 2514 2469 1328 1195 1148 551 342 23476 1455 1287 --
NM_032228chr1153329 2907 2789 1215 712 --13422 12278
NM_032281chr1973195 2018 1980 928 918 791 551 --12984 --
NM_032288chr3111847 1785 601 490 476 329 296 288 277 236 70 --22200 1650 --
NM_032373chr10135739 5437 5378 5330 5087 4756 4264 4225 3786 2336 1846 1779 1083 --12175 25487 1069
NM_032439chr1051381 1101 551 513 450 ----1601
NM_032446chr5113164 3095 2611 1447 831 678 647 626 594 507 289 --21518 961 --
NM_032449chr182923 2911 2741 2468 2311 2233 2014 486 ----11057
NM_032457chr492938 2529 2481 1497 1333 1212 1023 943 352 --11471 23371 1527
NM_032826chr7114986 4716 3923 3581 2159 2079 1550 1174 1106 202 180 --11009 23490 1945
NM_032859chr13123403 3209 2665 1490 1320 1272 1104 920 889 745 736 45 12522 --12651
NM_032873chr1133874 2856 267 33603 2910 106 23898 3056 14192
NM_032900chr10133713 3579 3442 3395 3388 3077 2938 2925 2833 2380 1003 689 35 1653 22443 1122 --
NM_032932chr17156054 5971 5757 5296 4367 4330 4117 3967 3895 2498 1482 1417 1000 623 615 22513 2230 45631 5436 4068 2469 --
NM_032968chrX83899 1439 1346 1273 716 259 190 112 1127 11191 --
NM_032969chrX83899 1439 1346 1273 716 259 190 112 1127 11191 --
NM_032973chrY83891 1439 1346 1273 716 259 190 112 1127 11191 --
NM_032983chr793392 2978 2543 892 863 473 384 225 204 --1731 12375
NM_033083chr362945 2585 1032 1022 527 446 22110 542 2548 243 --
NM_033138chr792064 1835 1782 850 732 395 342 314 210 ------
NM_033139chr792064 1835 1782 850 732 395 342 314 210 ------
NM_033140chr792064 1835 1782 850 732 395 342 314 210 ------
NM_033143chr4103689 3642 3487 3310 3021 2865 1808 1651 397 65 ------
NM_033157chr792064 1835 1782 850 732 395 342 314 210 ------
NM_033224chr7198104 7985 7973 7803 7305 6197 5337 3017 2957 2607 2275 2007 1279 1209 1119 754 718 704 627 36143 1918 306 --15888
NM_033225chr8113202 3016 2915 2659 2347 2270 2118 1236 1022 930 632 --1390 --
NM_033305chr951182 1033 493 170 89 ----11211
NM_033331chr9123251 2952 2704 2649 2617 2368 2332 1122 1098 1062 709 57 --11129 --
NM_033394chr241368 1209 325 318 1548 1203 --
NM_033426chr1482919 2809 2682 1873 1103 453 376 343 12057 --1183
NM_033429chr1552544 2154 2044 522 128 --33164 2920 639 --
NM_033430chr4113692 3332 2876 2657 2647 1662 1464 1222 631 35 21 ------
NM_033437chr4113692 3332 2876 2657 2647 1662 1464 1222 631 35 21 ------
NM_033480chr642557 2486 2058 1088 12333 12881 1577
NM_033481chr642557 2486 2058 1088 12333 12881 1577
NM_033505chr2106459 6453 5275 5268 4818 4518 4439 4431 990 223 75898 4598 4468 4199 2520 2205 1644 ----
NM_033512chr882829 2406 2249 2174 1997 1032 594 452 --1981 12193
NM_033656chr21105994 5675 5524 5496 5359 4071 3817 2182 2083 541 25341 4965 ----
NM_052886chr871835 1626 1512 841 720 556 454 ------
NM_052937chr851097 1054 867 778 230 12220 1758 --
NM_053016chr9137526 7311 7179 6954 6853 5649 5635 5348 5340 2403 2296 1853 1635 --37110 5424 2332 14844
NM_053043chr7116296 5298 4910 4780 2460 2444 1674 1323 1129 180 78 --35380 2276 1309 --
NM_057175chr462088 1661 962 884 518 338 --196 1187
NM_058241chr272153 2094 1965 873 582 524 55 --11898 1559
NM_058241chr272153 2094 1965 873 582 524 55 --11898 1559
NM_080661chr111820 --1326 2377 66
NM_080676chr20102617 2571 2427 2055 1997 985 642 625 472 167 43288 2946 483 424 1963 --
NM_080867chr14104882 4328 4157 3967 3919 1984 1199 1128 921 627 21788 1759 13583 --
NM_080872chr8143909 3828 3744 3481 2720 2637 2602 1237 859 749 535 528 410 281 --24033 25 --
NM_080874chr451498 1444 628 525 474 ----21629 1573
NM_080927chr3103281 3221 2951 2841 2515 1341 1007 800 256 140 --183 1302
NM_101395chr2193140 2612 2543 2350 1385 1182 711 632 422 12330 3650 461 164 --
NM_130391chr983135 3129 2911 2502 2477 2278 352 319 --13497 --
NM_130392chr983135 3129 2911 2502 2477 2278 352 319 --13497 --
NM_130393chr983135 3129 2911 2502 2477 2278 352 319 --13497 --
NM_130434chr1581084 1007 968 906 843 752 416 70 --180 11121
NM_130437chr2193099 2571 2502 2309 1344 1141 670 591 381 12289 3609 420 123 --
NM_130438chr2193049 2521 2452 2259 1294 1091 620 541 331 12239 3559 370 73 --
NM_130831chr352151 2105 911 781 553 32537 847 238 22130 803 --
NM_130832chr352151 2105 911 781 553 32537 847 238 22130 803 --
NM_130833chr352151 2105 911 781 553 32537 847 238 22130 803 --
NM_130834chr352151 2105 911 781 553 32537 847 238 22130 803 --
NM_130835chr352151 2105 911 781 553 32537 847 238 22130 803 --
NM_130836chr352151 2105 911 781 553 32537 847 238 22130 803 --
NM_130837chr352151 2105 911 781 553 32537 847 238 22130 803 --
NM_130847chr11154774 4659 3804 3763 2017 1945 1827 1744 1358 1347 1117 749 286 183 30 15237 35498 5383 5230 1632
NM_133170chr20137933 7369 6740 6431 6275 5923 5501 5458 5200 5120 3196 1645 255 16787 25792 2903 --
NM_133334chr4116177 5515 5371 5070 4276 1936 1143 819 314 217 21 22194 1239 25849 3890 --
NM_133370chr493470 3217 3115 3084 2661 2508 1204 908 235 13158 21039 972 --
NM_133372chr552578 1177 604 598 417 1529 12609 --
NM_133478chr2102317 1881 1870 1768 940 439 322 301 93 22 --1991 --
NM_133493chr6104642 4459 3817 3747 3169 3092 1582 535 250 202 2300 281 14370 12876
NM_133496chr1114299 3708 3525 2859 1779 1528 1380 1241 1135 884 635 --13599 --
NM_133646chr2175275 4880 4854 4734 4704 4691 4215 3591 2068 1899 1731 1713 1314 1092 245 177 94 15196 14050 --
NM_133647chr1593689 3241 2935 2815 2494 1532 1289 271 192 --13660 --
NM_138270chrX92974 2698 1377 1153 976 226 201 79 40 --1579 --
NM_138423chr1542102 384 368 314 1811 31858 431 122 --
NM_138444chr13114889 4747 4706 3966 1779 1637 1631 718 462 166 65 14253 24635 3040 1685
NM_138468chr2156277 5287 4309 4295 4215 2448 2372 2051 1764 1620 1031 753 720 714 566 31781 1010 684 23982 257 --
NM_138713chr1685894 5191 3034 2033 1638 796 711 259 37242 6189 5700 15225 12994
NM_138714chr1685894 5191 3034 2033 1638 796 711 259 37242 6189 5700 15225 12994
NM_138731chr1444100 1345 1035 313 13265 11134 11262
NM_138959chr186219 6140 5046 5030 4560 4362 2506 2303 15237 66685 6383 4412 2533 1522 1209 --
NM_138971chr1193718 3376 3302 3038 2950 2662 1204 648 198 ----13800
NM_138971chr1193718 3376 3302 3038 2950 2662 1204 648 198 ----13800
NM_138972chr1193718 3376 3302 3038 2950 2662 1204 648 198 ----13800
NM_138972chr1193718 3376 3302 3038 2950 2662 1204 648 198 ----13800
NM_138973chr1193718 3376 3302 3038 2950 2662 1204 648 198 ----13800
NM_138973chr1193718 3376 3302 3038 2950 2662 1204 648 198 ----13800
NM_139048chr361146 460 261 194 148 142 1777 ----
NM_139246chr9102203 1946 1720 863 794 598 219 90 84 62 ------
NM_144571chr465878 5226 4723 4254 2330 1343 22072 1937 65869 4701 4623 4595 817 790 34999 1284 501
NM_144578chr1495336 4103 4000 3873 3775 1762 1114 341 200 --34274 1507 283 14467
NM_144590chr10102704 2290 2136 1835 1164 996 740 716 565 31 12237 1601 11091
NM_144599chr15105210 4921 4473 4269 4262 1415 1105 629 318 103 35168 5152 725 ----
NM_144628chr20112992 2762 2267 2176 896 809 552 426 362 187 105 1750 22632 212 --
NM_144721chr452750 2314 1824 276 167 42089 1028 950 671 ----
NM_144778chr1342692 2209 2172 348 22578 382 193 22343 916
NM_144963chr831879 899 858 22501 1058 32359 1765 748 --
NM_144973chr12105089 4659 4449 4026 3486 2116 1882 1793 1066 431 13497 ----
NM_145055chr18103637 3487 2840 2730 1047 834 710 521 514 196 22746 309 43759 2332 1104 234 --
NM_145206chr1073007 2594 2275 1272 1013 725 564 --1755 12564
NM_145207chr4125385 5247 5184 5136 4544 3831 3345 1900 1507 1345 303 124 --43415 1909 1144 719 15207
NM_145259chr2167120 6873 6359 6121 5774 5403 4600 4553 4362 2693 1233 1079 920 861 715 351 --24680 2682 11284
NM_145307chr10104467 4392 4284 4157 1155 1131 1067 876 188 136 2567 306 31550 1036 442 23332 71
NM_145341chr1031216 1158 211 ----11397
NM_145753chr3------2356 329
NM_145808chr732852 1243 1085 --1824 22240 2235
NM_145912chr22154712 4608 4163 3740 3226 3157 3133 3073 3023 1610 1473 1108 884 763 342 ------
NM_148955chr15136079 5345 4939 4894 4695 2338 2153 1968 1789 1179 1111 404 303 --16417 --
NM_152263chr1126009 5233 4783 4599 4421 4271 3743 1946 1903 1223 669 378 25291 407 1689 --
NM_152275chr231654 1534 720 12254 21999 1676 11809
NM_152330chr1492336 1874 1065 686 597 576 461 199 182 1282 ----
NM_152332chr1452163 2101 804 618 145 1684 1785 --
NM_152409chr54866 804 718 430 --11366 22343 1161
NM_152556chr771819 493 419 253 217 198 176 --1127 --
NM_152609chr13899 380 286 1167 1998 1961
NM_152624chr5147230 7202 7026 6978 6095 5912 5902 5034 4557 2825 2241 1596 1121 32 36362 5318 4858 26375 1581 --
NM_152629chr983062 2768 2743 2614 1637 1223 576 120 22513 1066 --13780
NM_152636chr11133079 2851 2712 2554 2125 1894 1212 1117 643 416 341 269 61 ------
NM_152641chr1282834 2608 2502 2282 1814 367 301 256 --31051 633 102 --
NM_152754chr793379 2981 1317 1292 1236 846 667 631 492 --33598 2799 728 --
NM_152756chr594161 1519 1327 1321 1219 838 575 350 102 12898 23694 777 23798 685
NM_152774chr782709 2331 2319 1882 1799 849 748 274 ------
NM_152787chrX63281 1427 1307 483 271 216 23473 499 23663 205 --
NM_152826chr15136079 5345 4939 4894 4695 2338 2153 1968 1789 1179 1111 404 303 --16417 --
NM_152836chr821568 100 1758 --11311
NM_152837chr821568 100 1758 --11311
NM_152838chr2061365 611 404 386 336 157 1175 --21156 1043
NM_152903chr1392714 2297 2098 2053 1826 988 942 899 356 --22270 788 --
NM_152996chr182062 2034 1717 1579 1430 737 621 329 --21755 1377 11373
NM_153035chr192856 2776 2656 2541 2183 2140 2118 218 141 32715 2428 2062 23257 2353 --
NM_153042chr63666 502 259 1251 --1741
NM_153188chr535428 4758 4068 11945 24947 1552 15530
NM_153207chr1273644 2615 2525 1473 1077 1016 559 --21574 1374 14028
NM_153260chr1521181 203 ----31535 336 33
NM_153365chr431711 328 181 32376 545 512 12740 12343
NM_153367chr1053975 3852 1289 1071 842 --22538 664 12999
NM_153371chr13112396 2357 2275 2245 2228 2167 1573 859 676 352 235 21640 918 11987 --
NM_153456chr13125640 5131 5018 4830 1847 1411 1251 1132 1085 987 918 342 22370 1575 11622 1317
NM_153607chr563120 2721 2459 1089 400 222 --32296 2205 782 --
NM_153619chr15123321 3051 2851 2816 2663 2554 2392 2346 1102 318 123 102 --13075 1210
NM_153689chr252387 1662 1536 940 208 11984 --11504
NM_153810chr10114809 4032 3314 3112 1584 1533 915 736 713 417 341 14763 ----
NM_170606chr761257 1223 736 442 186 82 --31833 229 221 11647
NM_170706chr173846 3297 3065 3014 2757 1241 930 34339 3831 862 12873 13096
NM_170710chr413036 1363 12407 12292
NM_170740chr673137 2730 2590 740 478 379 98 --33481 557 242 --
NM_170751chr61357 1958 3462 409 329 11438
NM_170752chr61357 1958 3462 409 329 11438
NM_171998chrX32257 891 331 22442 1762 2654 66 1987
NM_172071chr187174 5791 5748 2854 2846 2465 1590 1086 --36679 2120 704 --
NM_172373chr1361234 499 358 348 337 193 1517 11299 1954
NM_173214chr1685894 5191 3034 2033 1638 796 711 259 37242 6189 5700 15225 12994
NM_173468chr4135659 5422 4940 4807 4611 4351 4179 2407 2143 1770 1756 858 425 11409 45580 1947 992 561 --
NM_173470chrX52648 2224 804 38 31 12700 32509 1093 924 --
NM_173505chr184271 112 30 22 --2892 356 --
NM_173511chr273959 3475 2976 2596 2573 2444 1139 --23771 2911 22989 471
NM_173582chr11145405 4849 4179 2194 1944 1674 1498 1162 1123 948 917 731 279 46 26066 1819 11714 --
NM_173602chr12102978 2837 2566 1455 1396 1294 808 317 157 52 ------
NM_173642chr1198730 8600 7805 7733 7540 7136 7048 6407 5670 3355 2947 2538 2378 1801 1719 1208 876 800 98 37486 3288 527 17610 --
NM_173654chr372276 2224 1827 1779 838 793 61 2815 134 1304 11688
NM_173666chr551185 1158 311 199 172 ----1869
NM_173672chr6132403 2157 2002 1981 1849 1735 930 748 623 548 488 265 259 --1858 --
NM_173694chrX62573 2169 1992 677 430 281 2605 114 --31858 557 526
NM_173812chr1231479 404 256 ----21392 1316
NM_173822chr231640 810 420 ----11560
NM_173829chr5156150 5675 5630 5537 5289 5266 4775 4349 4342 4129 3844 1727 832 645 434 24253 766 ----
NM_173854chr182337 1854 1845 1672 590 515 445 437 --11902 --
NM_175623chr12167143 7032 7000 6976 6923 6602 5479 5445 2462 2425 2140 883 791 601 440 331 --21873 1097 27064 2991
NM_175624chr12167238 7127 7095 7071 7018 6697 5574 5540 2557 2520 2235 978 886 696 535 426 --21968 1192 27159 3086
NM_175625chr12167238 7127 7095 7071 7018 6697 5574 5540 2557 2520 2235 978 886 696 535 426 --21968 1192 27159 3086
NM_175736chr12177556 7429 7169 6292 6283 6219 6160 6141 5804 5187 5062 2161 2136 2019 960 597 38 15894 15966 --
NM_175884chr741360 1094 481 421 ----21386 1083
NM_175907chr18102816 2268 1907 1827 1135 778 744 715 463 59 ----22198 1025
NM_175921chr564101 3458 3064 1492 1322 29 --14094 13013
NM_177424chr132057 771 763 1559 12115 21781 1565
NM_177438chr1494172 4006 3584 3196 2949 2741 1706 466 116 1862 1809 2154 142
NM_177452chr1472258 1745 1729 1568 950 790 106 --1352 11944
NM_177974chr1542102 384 368 314 1811 31858 431 122 --
NM_178011chr1042452 2227 565 451 --13156 1229
NM_178140chr552309 2084 1808 803 53 11869 1465 1745
NM_178151chrX137253 7236 6814 6731 5401 3114 3070 2790 2784 1735 1319 1076 22 27425 30 46448 5321 1167 646 15917
NM_178152chrX137253 7236 6814 6731 5401 3114 3070 2790 2784 1735 1319 1076 22 27425 30 46448 5321 1167 646 15917
NM_178153chrX137253 7236 6814 6731 5401 3114 3070 2790 2784 1735 1319 1076 22 27425 30 46448 5321 1167 646 15917
NM_178505chr1093294 3208 3144 3029 2998 1043 624 447 167 13577 ----
NM_178566chr971838 1769 1728 1670 1495 1268 69 21635 1337 ----
NM_178585chr4103114 3053 2444 2325 2049 1315 1260 972 874 170 --22455 1066 --
NM_181077chr1572257 2210 1951 1807 1455 922 640 1678 22246 392 --
NM_181265chr413036 1363 12407 12292
NM_181354chr851746 1517 1306 246 183 ----11095
NM_181361chr3------21095 1022
NM_181443chr2041139 932 399 365 32523 2341 594 --12240
NM_181481chr18166893 6568 5568 5529 5093 4553 4444 2826 2047 1413 1295 1228 1190 363 308 266 16127 15105 --
NM_181482chr18166893 6568 5568 5529 5093 4553 4444 2826 2047 1413 1295 1228 1190 363 308 266 16127 15105 --
NM_181483chr18166893 6568 5568 5529 5093 4553 4444 2826 2047 1413 1295 1228 1190 363 308 266 16127 15105 --
NM_181504chr593736 1353 994 679 657 607 532 407 101 1863 23664 964 24200 1035
NM_181523chr593736 1353 994 679 657 607 532 407 101 1863 23664 964 24200 1035
NM_181524chr593736 1353 994 679 657 607 532 407 101 1863 23664 964 24200 1035
NM_181659chr20113336 3093 2976 2823 2778 2686 2231 2077 936 645 235 1398 33043 2314 1051 --
NM_181659chr20113336 3093 2976 2823 2778 2686 2231 2077 936 645 235 1398 33043 2314 1051 --
NM_181672chrX32049 1608 218 ----21656 135
NM_181673chrX32049 1608 218 ----21656 135
NM_181723chr872228 2190 1951 1876 715 539 478 --1667 --
NM_181787chr883804 3720 3301 2930 571 394 161 145 31155 877 87 13774 --
NM_181789chr1563035 2906 2703 2189 1148 67 --1813 22433 553
NM_181836chr531992 1057 630 42686 2280 2237 1909 12660 1711
NM_182515chr19126038 5836 5377 5238 4186 2592 2077 1468 1402 1048 639 326 22165 1333 45050 4263 1903 1320 --
NM_182898chr7115897 5732 5673 4638 4367 4052 4035 2642 1939 466 77 15874 11354 15764
NM_182899chr7115897 5732 5673 4638 4367 4052 4035 2642 1939 466 77 15874 11354 15764
NM_183376chr1582578 2406 2285 842 170 131 82 41 --1247 2761 276
NM_194282chr4103017 2861 2602 2358 2336 1961 1152 819 353 38 1405 23050 419 --
NM_194283chr584121 3829 3153 2811 1324 734 320 283 --22583 757 --
NM_194286chr12175444 4943 4917 4629 4451 3947 3829 2165 1819 1708 1335 1150 1104 710 663 655 374 14183 14488 --
NM_194314chr185576 5485 5466 5024 2217 2080 952 936 ------
NM_194317chr282463 2102 1736 886 875 819 607 445 ----11702
NM_194434chr1881907 1759 1455 1260 853 831 502 319 --25304 5260 --
NM_198181chr1532893 2594 931 1688 32630 2187 478 22926 693
NM_198270chrX93502 3089 2672 2614 2477 1206 1114 160 66 --1819 1547
NM_198320chr12105023 3909 3853 3321 2054 1789 1637 1075 590 337 ----1668
NM_198465chrX72689 2387 2325 2182 1856 787 757 ----1143
NM_198503chr171887 1864 1729 1691 1540 943 594 21658 530 1367 --
NM_198549chr183024 2239 2138 978 747 585 255 162 --22918 90 --
NM_198581chr2156981 6870 6847 6804 5938 4777 2597 2450 2367 1761 1685 1035 643 622 428 11812 24860 1961 --
NM_198900chr12177556 7429 7169 6292 6283 6219 6160 6141 5804 5187 5062 2161 2136 2019 960 597 38 15894 15966 --
NM_198904chr561862 1712 1413 1378 562 353 ----1420
NM_198968chr13134027 3744 3028 2840 2789 1464 1431 1424 1188 847 588 503 120 23722 664 ----
NM_199072chr772705 2600 2506 2485 1109 931 695 22365 1060 ----
NM_199229chr261668 1639 1198 1090 289 58 1149 21348 1302 11296
NM_199320chr4132913 2696 2043 2012 1948 1852 1179 1134 1085 761 206 146 82 ------
NM_199320chr4132913 2696 2043 2012 1948 1852 1179 1134 1085 761 206 146 82 ------
NM_199324chr493438 2719 2499 1041 843 706 451 212 30 ------
NM_199421chr14104882 4328 4157 3967 3919 1984 1199 1128 921 627 21788 1759 13583 --
NM_199436chr292930 2884 2694 2553 2481 2379 101 82 26 ----1971
NM_199461chr1073614 3513 3375 2966 2501 1364 1034 42609 1138 676 398 13478 --
NM_199462chr1104329 4240 4071 3747 3730 3646 1997 1068 763 563 14791 31108 990 955 --
NM_199478chrX71718 1459 1250 675 593 495 390 --21920 1404 --
NM_201432chr17135920 5649 5294 4761 4584 4239 2020 1530 628 480 437 431 273 11845 24978 2339 --
NM_201433chr17135920 5649 5294 4761 4584 4239 2020 1530 628 480 437 431 273 11845 24978 2339 --
NM_203327chr2063649 3267 3211 3126 2982 2877 23372 3290 13437 13039
NM_203446chr2172954 2836 2378 2275 825 804 316 1854 32044 2033 954 --
NM_203458chr193448 3316 3296 2880 1143 1137 698 658 395 11488 13354 1538
NM_203459chr182412 2113 2053 1982 970 855 171 67 21632 783 12072 --
NM_203487chr1341207 1106 537 204 ----21730 298
NM_203504chr452550 2492 2220 519 448 12151 1182 12367
NM_203505chr452550 2492 2220 519 448 12151 1182 12367
NM_206853chr673938 3923 3588 3488 3320 3025 292 23810 3510 13419 24137 2551
NM_206854chr6105199 5184 4849 4749 4581 4286 1553 856 429 417 35071 4771 24 14680 25398 3812
NM_206855chr6126164 6149 5814 5714 5546 5251 2518 1821 1394 1382 834 818 36036 5736 989 15645 26363 4777
NM_206866chr2153079 3024 2535 854 387 2804 294 22497 2209 --
NM_206907chr593208 2992 2277 2159 2066 1201 1123 386 173 13322 22592 889 --
NM_206909chr8188348 8212 7656 6914 6411 5912 5377 5344 3252 3038 2880 2859 2429 1591 1118 470 463 255 26388 2012 22161 1689 21900 1356
NM_207299chr95987 898 824 389 214 ----1338
NM_207304chr1342579 2096 2059 235 22465 269 --22230 803
NM_207380chr15143657 3264 3148 3052 2947 2744 2732 2707 2634 1205 1160 869 683 461 13213 ----
NM_207406chr486526 6354 5349 4348 1542 1003 552 141 ----16322
NM_213589chr2174972 4526 3722 3598 1962 1776 1696 1621 1126 1102 682 637 618 546 487 454 302 34448 4314 1814 ----