TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4781-3p
miRNA Sequence: AAUGUUGGAAUCCUCGCUAGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX43053 893 228 51 --1603 --
NM_000081chr141766 1713 233 220 ------
NM_000084chrX66340 5548 5311 2486 2194 547 26619 4548 1312 --
NM_000109chrX32558 2549 1909 12607 ----
NM_000115chr1372537 2265 1725 1691 678 649 639 22128 259 1660 --
NM_000138chr15112563 2477 2239 1917 1867 1855 862 830 821 505 307 22254 1068 ----
NM_000151chr1741890 1843 1203 33 ------
NM_000153chr1441373 616 306 213 11574 1235 11141
NM_000167chrX41397 495 278 60 1727 ----
NM_000217chr1255018 3775 1221 1112 485 --24699 1325 --
NM_000245chr762256 2026 1715 1663 1613 461 ------
NM_000252chrX1333 1305 --1118
NM_000259chr15146290 6224 5876 5747 4266 4049 2457 2380 2333 1909 1779 1074 520 313 15912 11138 --
NM_000264chr952480 2148 1092 1069 1047 1345 12953 --
NM_000267chr1783381 3362 2853 2760 2247 695 639 37 ------
NM_000314chr1072867 2794 2213 2045 978 839 744 --23180 2206 --
NM_000325chr44629 617 273 219 ----1509
NM_000329chr13869 647 354 2732 687 ----
NM_000332chr6116052 4666 4600 4416 2797 2633 2329 1583 1249 1172 524 16279 --1616
NM_000337chr5136531 5951 5469 5432 5034 4587 4324 4020 2512 2390 1947 1692 1243 2403 34 36285 6007 327 14869
NM_000351chrX74217 4197 2850 1617 1322 390 157 --24280 3543 23153 441
NM_000362chr2253473 3222 3038 1090 420 --13411 --
NM_000368chr984719 3465 1800 1622 1304 547 357 328 --12980 --
NM_000390chrX32325 2274 1273 22209 438 11337 --
NM_000393chr282100 1925 1911 1741 1723 1613 762 122 ------
NM_000408chr262623 1378 1205 560 460 27 --22252 824 --
NM_000439chr562525 2508 2409 2063 1980 1572 --11909 --
NM_000448chr1162339 2289 2226 2163 1148 548 --12010 --
NM_000461chr374041 3633 3608 3286 1317 673 271 --23521 589 --
NM_000480chr112333 165 11470 --11609
NM_000489chrX73423 2921 2096 1369 1214 963 591 12552 ----
NM_000493chr621040 142 1174 1245 1717
NM_000495chrX1135 ----11137
NM_000503chr871513 1497 1378 1196 619 352 57 ------
NM_000538chr1341770 1764 490 224 --21127 533 --
NM_000555chrX167770 7351 7157 7050 5258 2655 2505 2378 1569 1341 945 873 580 543 242 81 26076 1264 --1802
NM_000599chr264514 4395 3809 1659 1371 578 --1811 --
NM_000610chr1172802 2311 1100 731 487 296 189 --33048 2711 2471 --
NM_000618chr1284373 2449 2432 2315 1543 1392 1301 110 11840 44707 2474 2198 162 --
NM_000618chr1284373 2449 2432 2315 1543 1392 1301 110 11840 44707 2474 2198 162 --
NM_000633chr1884624 4318 4218 3565 2043 1061 837 768 --13372 --
NM_000663chr16103046 3023 2764 2708 2501 2170 1909 1132 315 42 12104 12373 --
NM_000719chr1274910 4637 4486 2553 2271 979 736 11520 25904 5785 --
NM_000726chr241105 1034 480 220 ----186
NM_000793chr1494559 4491 4466 4361 3595 1951 270 143 81 21879 873 ----
NM_000813chr5115579 5220 5185 4975 4177 3748 2184 1457 824 666 325 64584 4374 3570 3412 1643 906 1886 --
NM_000814chr15154192 3891 3759 3569 3520 3351 3332 3244 2701 1515 1295 1077 986 892 387 1155 ----
NM_000826chr442128 1609 790 333 12245 22576 385 --
NM_000827chr562476 2405 2191 2118 1603 137 ------
NM_000831chr196050 4850 4653 4087 1798 1526 980 848 160 24520 2017 25214 4942 --
NM_000838chr642092 1895 1705 816 ----11696
NM_000866chr361750 1422 1237 747 708 229 21298 354 ----
NM_000868chrX71898 1775 1658 1636 881 857 324 1644 ----
NM_000875chr15137015 6804 6462 6348 6079 5822 5545 5357 4936 4843 2324 1601 190 26381 6200 15371 --
NM_000901chr472138 1947 1915 1744 425 114 86 ------
NM_000950chrX43484 2265 754 306 ----11257
NM_000961chr2053996 3567 3556 1278 479 --11342 --
NM_000990chr1153517 2605 801 310 182 13686 ----
NM_001001389chr1172802 2311 1100 731 487 296 189 --33048 2711 2471 --
NM_001001390chr1172802 2311 1100 731 487 296 189 --33048 2711 2471 --
NM_001001391chr1172802 2311 1100 731 487 296 189 --33048 2711 2471 --
NM_001001392chr1172848 2357 1146 777 533 342 235 --33094 2757 2517 --
NM_001001396chr164470 4440 4031 3038 1508 200 24207 3345 ----
NM_001001419chr595115 4269 4079 3560 3360 3304 1328 294 135 --11390 --
NM_001001420chr595115 4269 4079 3560 3360 3304 1328 294 135 --11390 --
NM_001001433chr2011209 1389 12171 13056
NM_001001481chr883112 2994 2392 2215 910 657 558 548 22650 2224 1480 --
NM_001001664chr234113 2747 639 13433 11249 --
NM_001001665chr2102595 2524 1251 1170 669 606 515 410 290 47 22912 368 12659 --
NM_001001668chr1994249 3968 3235 2750 2591 656 592 459 47 --24029 2673 12855
NM_001001890chr2193495 3054 3003 2733 1457 1163 1087 1014 274 --12807 --
NM_001001971chr1021322 1086 1308 1871 --
NM_001002860chr1483932 3875 3143 1848 1590 1379 920 64 ------
NM_001003652chr18188274 8080 7692 6885 6788 6534 5502 5451 5258 2902 2161 1975 1745 1645 1392 1075 1068 891 35890 5687 776 --12216
NM_001003674chr18106729 5208 4517 4426 2796 2039 1673 1524 1201 981 16873 46216 4509 866 738 --
NM_001003675chr18106729 5208 4517 4426 2796 2039 1673 1524 1201 981 16873 46216 4509 866 738 --
NM_001003679chr152118 1448 612 405 50 1137 --11889
NM_001003712chr122356 95 1830 --11542
NM_001003760chr683452 3325 3314 2708 2274 993 224 96 32794 2682 576 12297 --
NM_001003800chr973766 2748 2688 2584 1427 842 58 1455 133 --
NM_001003940chr1592866 2406 1395 1384 1218 881 824 623 477 21022 156 1903 --
NM_001003942chr1592866 2406 1395 1384 1218 881 824 623 477 21022 156 1903 --
NM_001003943chr1592870 2410 1399 1388 1222 885 828 627 481 21026 160 1907 --
NM_001003945chr971978 1925 1713 1693 1686 1568 138 --1161 1584
NM_001004317chr663883 3621 3249 3072 1169 222 1698 13502 11135
NM_001004329chr1261441 975 561 208 101 49 ------
NM_001004342chr1136118 5237 4650 4278 4102 3877 3803 3692 2375 1695 1584 1470 291 ------
NM_001004346chr431170 1055 261 --1406 --
NM_001004360chr22616 418 1653 11899 --
NM_001004419chr1283786 3475 1202 839 661 531 191 167 14511 13394 23984 3049
NM_001004441chr561523 1394 1177 1058 450 386 ------
NM_001005375chrY31614 505 442 ----11623
NM_001005386chr242468 2280 2242 838 ------
NM_001005404chr17124291 4234 3697 3523 3285 2823 2789 1671 1560 1425 1294 836 ------
NM_001005463chr1062615 2203 1976 756 663 173 --2709 34 --
NM_001005473chr576358 6241 5634 5220 4802 4069 1659 22027 284 34991 4841 433 15731
NM_001005746chr241105 1034 480 220 ----186
NM_001005747chr241105 1034 480 220 ----186
NM_001006600chr511520 --22055 1650 --
NM_001007023chr1494559 4491 4466 4361 3595 1951 270 143 81 21879 873 ----
NM_001007024chr1784254 3785 3618 2866 1643 1346 196 108 --12706 --
NM_001007025chr1784254 3785 3618 2866 1643 1346 196 108 --12706 --
NM_001007097chr9105108 3606 3517 3468 3190 1745 1554 1393 1114 698 11062 ----
NM_001007214chr151778 1579 1533 1403 285 --11841 --
NM_001007466chr684948 4442 4288 1331 924 660 575 204 23615 3541 34861 485 75 --
NM_001008225chr7--2667 189 --1115
NM_001008392chr353132 3079 2315 724 592 1449 13492 12495
NM_001008401chr1971307 1196 1173 1055 367 295 27 ------
NM_001008660chr1171486 1428 1305 1191 574 387 69 ------
NM_001008925chr442826 2793 2639 887 1309 13326 --
NM_001009183chr143427 133 122 ------
NM_001009899chr386475 5772 5499 4897 4143 2459 1935 442 14097 14274 --
NM_001009959chr232015 1855 517 22291 2208 --12518
NM_001009960chr7102501 2450 2401 2335 2041 2016 474 463 132 50 --21770 639 --
NM_001010861chr151730 1118 483 248 211 --1505 --
NM_001010888chrX44260 3138 1523 1161 14252 21231 162 13896
NM_001010891chr5126873 6795 4670 4322 2356 2253 2059 1960 1623 1600 655 628 ------
NM_001010942chr1231116 327 58 --294 68 --
NM_001011513chr453822 2893 1170 556 82 23368 3072 21232 620 --
NM_001011666chr7136411 5964 5651 5543 4523 4290 2397 2322 2088 2079 1657 1412 995 15215 --16592
NM_001011708chr272676 2523 2225 2161 1922 1004 645 ------
NM_001011713chr143463 223 145 --1387 --
NM_001012393chr11125193 4260 4094 3995 3689 1929 1841 1181 1090 939 673 312 34046 578 409 14545 11779
NM_001012398chr1641048 904 700 147 1750 ----
NM_001012420chr1542394 608 468 374 12502 ----
NM_001012755chrX53931 3759 1502 747 257 34301 4053 927 ----
NM_001013620chr1297826 7648 6759 6594 6050 5798 5620 1423 509 58118 5683 5604 5180 2284 --15540
NM_001014797chr10127784 6151 6094 6044 5938 5561 2978 2724 2358 2046 2006 1342 ----21821 77
NM_001015877chrX32942 2373 265 --2722 582 --
NM_001015880chr1021449 221 --1355 11568
NM_001018064chr961841 1638 1631 680 418 122 ----134
NM_001018065chr9186062 5888 5420 4808 4387 4247 4036 2294 2222 1658 1528 1178 1114 1081 1036 513 287 116 ------
NM_001018066chr9186062 5888 5420 4808 4387 4247 4036 2294 2222 1658 1528 1178 1114 1081 1036 513 287 116 ------
NM_001018067chr134283 3402 1979 44410 1972 1901 1805 --13908
NM_001018068chr134283 3402 1979 44410 1972 1901 1805 --13908
NM_001018069chr134283 3402 1979 44410 1972 1901 1805 --13908
NM_001018090chr1532827 2701 884 32118 1831 231 ----
NM_001018091chr1542937 2811 1797 994 32228 1941 341 ----
NM_001018102chr1532827 2701 884 32118 1831 231 ----
NM_001018111chr793868 3811 3695 3279 3240 2608 2480 468 25 12909 --11491
NM_001024218chr144807 677 571 119 --1749 --
NM_001024649chr542095 1165 279 249 1229 12057 --
NM_001024948chr153184 2817 2202 502 68 148 ----
NM_001025076chr1075664 4963 2195 1776 1153 451 418 14311 13929 --
NM_001025077chr1067022 6321 2511 1809 1776 74 15669 15287 --
NM_001025079chr364148 3550 3066 1486 1037 639 1891 ----
NM_001025108chr273922 3264 1650 960 124 92 53 --13859 13741
NM_001025201chr23626 606 551 ----1534
NM_001025233chr1272472 2170 2001 1864 634 526 360 22187 1972 11063 --
NM_001025266chr384775 4518 4495 3125 3113 865 722 120 13645 1897 --
NM_001025389chr112333 165 11470 --11609
NM_001025390chr112333 165 11470 --11609
NM_001025580chrX84319 4197 3324 3302 3211 1217 1044 138 1234 13709 23961 1560
NM_001025780chr91241 2358 67 --11329
NM_001029858chr673317 2807 2754 2428 1179 1033 161 2815 396 22112 984 --
NM_001029875chr531134 911 474 3854 769 582 1992 --
NM_001030007chr1663470 3080 3061 2961 479 288 ------
NM_001030055chr1433630 3287 2931 --13899 --
NM_001031679chr1273493 3262 3088 2892 2782 1152 706 23131 976 1768 --
NM_001031684chr241507 952 261 179 ------
NM_001031695chr2284974 4493 4362 4097 3621 1798 1557 64 ------
NM_001031700chr452397 2041 1868 1007 848 2987 445 1232 --
NM_001031732chr463318 2623 2255 1345 1014 568 11201 33001 2367 1480 23355 959
NM_001031812chr582284 2269 2234 2138 1750 1491 610 552 ------
NM_001032282chr851297 1192 515 276 98 ------
NM_001032394chr662742 1792 1738 730 543 353 ------
NM_001032395chr652609 1659 597 410 220 ------
NM_001033045chr264228 4060 3689 3089 1709 1287 24164 2783 34100 949 442 --
NM_001033112chr52703 665 ----1656
NM_001033117chr384508 3791 3340 1953 326 254 238 208 23135 624 1264 --
NM_001033576chr1742480 2153 863 558 1121 --12568
NM_001033578chr852341 2154 2077 1780 627 11658 2691 319 1370
NM_001033659chr1731578 1293 486 1551 --11640
NM_001033723chr861981 1895 1078 1009 675 319 ----12740
NM_001034837chr53800 617 521 --1164 1530
NM_001034838chr53800 617 521 --1164 1530
NM_001034841chr1685344 4921 4827 2149 1473 850 610 234 --2808 791 12213
NM_001037132chr761465 1386 863 301 264 256 --22000 22 --
NM_001037133chr761465 1386 863 301 264 256 --22000 22 --
NM_001037174chr251702 1652 1613 1506 752 --1410 --
NM_001037317chr151730 1118 483 248 211 --1505 --
NM_001037553chr2164263 1972 1747 1728 1274 63 14737 1206 --
NM_001039395chr942171 1931 995 660 --21910 202 11591
NM_001039538chr273539 3499 3142 2938 2286 571 530 --21471 1077 13136
NM_001039547chr3107407 7344 5574 5510 5368 5044 3169 2988 2088 787 25433 803 47469 6401 6034 1220 12023
NM_001039569chr2123375 2921 1299 1163 1094 754 697 354 272 264 134 27 1155 32984 2091 1227 --
NM_001039585chr131426 317 60 11192 --13832
NM_001039590chrX53984 649 466 427 111 33172 2791 164 ----
NM_001039591chrX53984 649 466 427 111 33172 2791 164 ----
NM_001039618chr11145362 4839 4783 4650 4528 3607 2204 1514 1486 947 840 786 352 185 21672 879 24430 2095 --
NM_001039693chr2144156 4007 3767 3475 3371 3270 3209 2890 2500 1652 1402 744 376 190 --23146 2559 13614
NM_001039762chr1082236 1940 1842 1569 880 693 663 155 ------
NM_001039840chrX85508 4072 2221 2103 1256 1052 638 616 11943 24445 705 --
NM_001039937chr1394142 3406 3264 3166 1618 1500 1314 1157 850 ----1734
NM_001040100chr361116 1061 891 880 326 251 ------
NM_001040108chr1483131 2732 2432 2423 1262 1039 695 83 1813 ----
NM_001040152chr7103876 3586 3185 1522 1373 1342 743 485 461 212 1898 1388 --
NM_001040159chr421359 85 11039 --11022
NM_001040284chr16125754 5032 4879 4722 3879 3775 2215 1957 1765 696 644 572 14050 13887 --
NM_001040429chr1322588 786 23404 3022 11430 --
NM_001040445chr2115272 5101 4940 4167 4102 3898 3770 2268 755 617 334 13721 ----
NM_001040450chr1542388 692 650 344 1467 32741 1128 1065 --
NM_001040453chr1542388 692 650 344 1467 32741 1128 1065 --
NM_001040665chr754442 1789 1744 740 341 23338 206 23141 186 14083
NM_001040708chr85844 794 440 352 265 --166 --
NM_001040712chr993286 3052 1230 1222 1211 856 452 108 45 13126 --1890
NM_001042357chr104412 303 211 160 ------
NM_001042358chr104412 303 211 160 ------
NM_001042360chr104412 303 211 160 ------
NM_001042361chr104443 334 242 191 ------
NM_001042363chr104412 303 211 160 ------
NM_001042364chr104443 334 242 191 ------
NM_001042365chr104443 334 242 191 ------
NM_001042387chr104443 334 242 191 ------
NM_001042389chr104412 303 211 160 ------
NM_001042390chr104412 303 211 160 ------
NM_001042392chr104412 303 211 160 ------
NM_001042393chr104443 334 242 191 ------
NM_001042395chr104412 303 211 160 ------
NM_001042396chr104443 334 242 191 ------
NM_001042397chr104443 334 242 191 ------
NM_001042413chr931520 828 599 --21649 1411 --
NM_001042473chr1041833 1562 302 178 1334 ----
NM_001042492chr1783381 3362 2853 2760 2247 695 639 37 ------
NM_001042494chr15133656 3621 3512 3391 1524 1389 1325 890 831 797 359 289 213 --21453 1089 --
NM_001042495chr15133656 3621 3512 3391 1524 1389 1325 890 831 797 359 289 213 --21453 1089 --
NM_001042496chr15133656 3621 3512 3391 1524 1389 1325 890 831 797 359 289 213 --21453 1089 --
NM_001042497chr15133656 3621 3512 3391 1524 1389 1325 890 831 797 359 289 213 --21453 1089 --
NM_001042533chr372749 2719 2642 2283 1278 1112 114 1474 ----
NM_001042555chr12124810 4038 3886 3500 3131 1797 1217 1163 450 378 289 218 34124 3461 3061 1443 11360
NM_001042599chr2137527 6068 3003 2681 2095 1549 1281 1162 1148 882 634 543 488 1501 ----
NM_001042603chr12105167 5047 4689 4668 3250 1997 1274 1002 949 321 21258 184 1224 --
NM_001042604chr334502 3838 794 1967 53865 1936 1768 1555 727 --
NM_001043318chr1463745 3111 2572 1591 879 418 --23286 3248 --
NM_001044385chr293631 3601 3444 3373 3174 1280 531 237 135 ------
NM_001044722chr582284 2269 2234 2138 1750 1491 610 552 ------
NM_001044723chr582284 2269 2234 2138 1750 1491 610 552 ------
NM_001046chr562544 2336 2147 2020 882 83 ------
NM_001048183chr173780 3245 1197 757 224 90 27 --32336 1261 821 --
NM_001083620chr442126 1608 789 332 12243 22574 384 --
NM_001096chr171162 1668 2231 149 --
NM_001099678chr3126373 6364 6170 6012 5658 4703 4164 2294 1407 842 701 597 32340 1547 201 25691 4830 --
NM_001100108chr1128376 8269 7351 6366 6083 5765 5504 5443 3233 2609 2500 1650 1557 16147 --
NM_001106chr3139738 8817 8284 8248 7900 7105 6757 2575 2007 1879 1294 705 93 --13782 1207
NM_001123chr104825 613 251 179 1789 ----
NM_001128chr1663470 3080 3061 2961 479 288 ------
NM_001146chr872334 2231 921 514 471 111 95 ------
NM_001148chr472201 2118 850 680 392 215 120 32022 1542 582 2277 40 --
NM_001167chrX36044 2680 2581 34670 2448 153 36108 4114 611 --
NM_001173chr1433630 3287 2931 --13899 --
NM_001186chr2173123 2661 2463 2417 1258 834 90 1320 22262 873 --
NM_001204chr276235 5530 4915 4855 1741 1390 561 35837 5665 4749 35562 5288 2326 --
NM_001206chr951059 1007 393 199 135 1898 22498 627 --
NM_001219chr731448 558 247 --1507 11863
NM_001256chr1742651 775 190 177 ------
NM_001259chr7125648 5502 5197 4774 4295 2406 2150 2096 1993 1375 1280 610 14830 ----
NM_001270chr551077 870 277 157 59 ------
NM_001304chr1753659 3490 3306 2959 2906 23395 416 --23118 29
NM_001310chr1242750 646 249 185 32361 809 632 138 1554
NM_001346chr372865 2384 2220 2139 219 204 186 --11901 --
NM_001364chr11104595 4449 3627 1577 1571 1248 1189 813 370 304 164 11732 --
NM_001390chr1883468 3237 2847 2720 836 455 164 66 ------
NM_001412chrX43783 3519 2591 1279 23471 962 ----
NM_001419chr1954790 4290 1527 446 328 1857 21277 161 --
NM_001429chr224862 806 322 299 ------
NM_001432chr433800 803 777 --23412 903 13462
NM_001438chr183667 3527 3125 2884 1196 769 108 96 33215 2747 701 1678 --
NM_001491chr652167 1681 1032 533 177 --12231 --
NM_001495chr821243 1083 ----1991
NM_001527chr664873 4843 4715 3644 577 371 14020 ----
NM_001530chr1431124 978 442 ----1338
NM_001609chr1063544 1782 1274 900 641 106 11328 44484 4304 3453 3371 --
NM_001616chr273272 2911 1395 723 635 583 177 12195 1477 --
NM_001621chr742899 2640 2006 896 --22432 2068 --
NM_001621chr742899 2640 2006 896 --22432 2068 --
NM_001649chrX52457 2239 817 520 473 ------
NM_001650chr1853487 3286 2867 1265 1165 13389 14016 13401
NM_001656chr541426 796 623 449 ----1293
NM_001684chr164187 4157 3748 2755 1566 1225 23924 3062 ----
NM_001690chr342119 1732 1673 1025 1964 ----
NM_001693chr841220 824 173 158 1138 ----
NM_001695chr884196 4124 3840 1533 500 154 51 21 ------
NM_001701chr931422 1123 465 11076 11436 --
NM_001709chr1142748 2481 2450 690 22866 638 12051 --
NM_001746chr542095 1165 279 249 1229 12057 --
NM_001754chr2193495 3054 3003 2733 1457 1163 1087 1014 274 --12807 --
NM_001759chr1274860 4374 3940 3810 1180 512 325 1214 ----
NM_001777chr364148 3550 3066 1486 1037 639 1891 ----
NM_001806chr1942961 2679 655 61 1533 --12420
NM_001822chr23626 606 551 ----1534
NM_001830chrX93959 3451 3238 3100 2598 1525 1464 1177 851 13224 23631 629 --
NM_001854chr141525 1089 619 30 11161 ----
NM_001858chr6134973 4665 4567 4475 3780 3727 3670 3446 1663 1125 356 179 34 ----1639
NM_001859chr942440 541 488 151 12505 23320 606 --
NM_001918chr1149066 8518 8334 8090 8031 7699 7570 2288 2191 2153 1645 326 136 67 28928 1577 75977 3374 3049 2452 1709 1308 390 --
NM_001942chr1821278 70 31446 443 377 1276 --
NM_001957chr452250 2166 1928 458 175 11692 1528 --
NM_001969chr1473740 2879 2763 585 445 103 73 ------
NM_001981chr12846 696 130 --11971
NM_001987chr12104041 3746 3364 3164 2992 2917 1026 765 184 32 --21526 793 11507
NM_002006chr4125329 5192 4899 4892 4539 4197 4163 3703 1560 1300 1232 943 25316 1379 25233 2316 14045
NM_002009chr1572816 1725 1108 906 759 485 33 1815 12211 --
NM_002025chrX159206 8312 8191 7915 6467 6352 6326 5759 3540 2011 1877 930 892 540 287 16660 38903 8004 7960 --
NM_002061chr141732 1533 1258 41 1257 21795 1320 --
NM_002158chr243585 3186 3091 2685 22762 458 12890 32599 2570 2333
NM_002210chr243568 3080 654 590 43439 3185 3088 195 ----
NM_002214chr7145719 5647 4989 4547 4398 4276 4069 3865 2173 2066 1966 1601 1012 460 35322 5232 269 23946 638 --
NM_002223chr1262998 2949 2590 936 776 558 1628 13501 23992 1459
NM_002235chr1281401 1312 1119 1046 632 297 181 43 ------
NM_002239chr2----153 1361
NM_002241chr153080 2870 1921 755 214 1491 1850 --
NM_002264chr364158 3928 3691 3254 1164 359 --13569 --
NM_002270chr585508 5292 5027 4459 3610 3453 2281 211 34486 1390 1007 ----
NM_002285chr273922 3264 1650 960 124 92 53 --13859 13741
NM_002293chr162340 1700 764 425 368 25 ----12266
NM_002336chr1254104 3670 751 559 479 11062 44929 4679 1405 466 135
NM_002374chr273539 3499 3142 2938 2286 571 530 --21471 1077 13136
NM_002395chr621181 538 11355 1338 --
NM_002397chr522024 323 31896 1658 408 --1615
NM_002480chr123955 416 379 ----1297
NM_002486chr962532 2425 2077 1744 1683 400 11961 ----
NM_002500chr21807 --1402 1857
NM_002501chr19103753 3234 3080 2998 2729 2711 1664 415 299 273 --23760 3161 --
NM_002515chr1441813 794 679 471 1515 1281 --
NM_002545chr11125193 4260 4094 3995 3689 1929 1841 1181 1090 939 673 312 34046 578 409 14545 11779
NM_002547chrX64276 2979 2654 1190 1033 505 12642 12722 --
NM_002577chr353860 3612 3195 3168 352 13133 ----
NM_002581chr984820 4390 1928 1763 1396 1388 450 34 15406 ----
NM_002594chr2052486 2417 1625 1512 208 12229 ----
NM_002645chr1172829 2559 2144 1977 1232 177 160 ------
NM_002655chr864760 4425 1436 1242 876 751 24557 1895 24219 3571 11510
NM_002662chr361954 1772 1564 732 633 531 --1685 --
NM_002667chr63331 260 80 11200 1941 --
NM_002670chr331416 1217 137 11064 ----
NM_002703chr451556 1515 1198 344 206 ------
NM_002709chr232587 1343 209 13263 ----
NM_002731chr122342 113 22710 1024 2789 408 --
NM_002736chr731594 418 175 42051 617 212 133 1842 --
NM_002737chr17145316 5229 5041 4471 4217 4210 4196 2675 1963 1938 1181 872 604 352 --21915 895 --
NM_002745chr22104495 4286 3726 3720 1789 1492 1061 1053 840 708 14550 --1629
NM_002827chr2041416 1186 459 354 --21779 1462 --
NM_002834chr1263169 2796 1519 1328 256 190 ------
NM_002837chr1264426 1821 1284 1206 787 477 23499 1762 11014 --
NM_002839chr993286 3052 1230 1222 1211 856 452 108 45 13126 --1890
NM_002843chr1162940 2467 958 782 650 76 23252 2375 12226 --
NM_002845chr183481 441 93 ------
NM_002869chr1142001 1475 326 271 21927 229 ----
NM_002874chr931600 864 361 --1657 12471
NM_002886chr384675 4588 4202 3410 1026 718 448 231 ------
NM_002968chr1651066 1050 749 292 127 ------
NM_002973chr123147 135 129 ------
NM_002977chr262548 2321 1313 671 407 158 --22870 864 --
NM_002998chr831381 341 190 1173 --11803
NM_003011chr941707 1235 577 271 --1454 --
NM_003012chr883175 2935 2424 1175 874 351 295 144 12909 ----
NM_003014chr771476 1441 1165 1097 1087 141 102 ------
NM_003022chrX21025 520 21239 207 --11120
NM_003034chr1275733 5656 5009 2880 1808 1116 383 27533 1753 25296 817 --
NM_003043chr3124338 4312 4260 4093 3433 3349 3063 2851 2712 1040 1032 390 13257 23424 49 13307
NM_003108chr286758 6261 6101 5494 5368 1607 1509 1211 24934 1434 14433 --
NM_003112chr783240 3053 2485 1004 788 537 301 147 13142 ----
NM_003128chr282491 2172 2114 2008 575 567 349 73 --2384 55 --
NM_003155chr871894 998 955 560 198 187 163 --2647 171 --
NM_003161chr1793408 3366 3002 2513 2282 2216 1162 445 244 ------
NM_003178chr362072 1796 1432 1400 806 246 ------
NM_003182chr7----3525 186 155 --
NM_003182chr7----3525 186 155 --
NM_003189chr1103323 3223 3209 3085 3069 2931 2869 836 459 375 --12235 --
NM_003199chr1895319 4291 3627 3492 1691 1423 982 545 160 33553 1126 237 25436 1405 --
NM_003221chr641217 929 773 194 --43896 1208 1175 835 --
NM_003262chr394913 3961 3856 1828 1760 1662 793 662 645 --32071 908 375 --
NM_003269chr63983 406 78 1838 ----
NM_003285chr12501 457 1101 2153 29 --
NM_003298chr3115568 5523 5003 4007 3790 2168 1289 1257 977 874 455 15932 ----
NM_003319chr24893 680 614 333 1360 ----
NM_003337chr551363 1307 1300 1273 70 11428 ----
NM_003338chr1051827 1229 765 510 58 1619 ----
NM_003339chr531279 1110 557 --21347 200 --
NM_003340chr451412 1229 1119 423 409 --1344 --
NM_003342chr1763129 2925 2742 736 273 180 ------
NM_003373chr1031653 1419 250 21618 642 21814 1527 1580
NM_003387chr272500 2479 2457 2041 2007 892 526 1628 ----
NM_003392chr353756 3627 3421 2829 521 33788 3174 1429 --13235
NM_003410chrX42636 980 483 221 ------
NM_003412chr352335 1048 924 139 65 11988 23159 628 --
NM_003423chr1962520 2455 879 590 461 242 42449 1782 1767 667 11794 --
NM_003439chr752961 2273 897 470 96 23093 335 22338 423 --
NM_003468chr293426 3410 3241 3120 1708 1644 1337 1048 709 ------
NM_003474chr1042336 2246 1556 23 22321 1669 ----
NM_003478chr1172321 1344 1195 862 499 209 22 11070 ----
NM_003489chr21102094 1354 1309 1208 1177 1067 1002 773 440 175 1618 23057 2263 --
NM_003566chr1263404 2599 1345 1274 989 629 --138 --
NM_003574chr1875182 4790 4093 3892 3524 1799 888 1578 15209 --
NM_003583chr1263791 3105 3067 2450 271 41 ----13508
NM_003590chr253463 3175 2502 1107 195 --1165 --
NM_003607chr1104337 3927 3660 3277 1352 1267 851 597 264 181 ------
NM_003615chr343359 3186 1310 462 --13487 --
NM_003616chr143396 102 91 ------
NM_003617chr144457 3546 1718 737 24584 1911 24250 3977 --
NM_003629chr152852 1028 658 611 291 11019 13203 1595
NM_003640chr951195 1143 1123 518 27 --11449 --
NM_003677chr1232146 1936 1863 22029 1465 ----
NM_003750chr104942 852 773 711 ------
NM_003759chr454114 3603 2688 2616 331 34203 4156 1532 11524 14180
NM_003762chr141344 1003 441 179 ------
NM_003763chr2011209 1389 12171 13056
NM_003783chr151027 949 293 239 168 1985 ----
NM_003816chr851511 1272 452 213 137 ------
NM_003822chr193149 2770 2419 2331 2264 1996 954 510 296 ----12585
NM_003829chr931202 1018 857 1990 1179 --
NM_003861chr143848 754 161 --32350 1840 155 --
NM_003873chr1062403 1718 1704 996 925 153 12262 ----
NM_003895chr2162121 1741 1346 755 601 583 ------
NM_003913chr684013 3834 3626 1700 550 517 425 100 1924 --24004 370
NM_003930chr752357 2051 1576 773 703 22304 307 1808 --
NM_003939chr1073973 3887 3722 3448 3323 1538 70 23481 1568 34096 2816 531 12701
NM_003941chr731789 549 267 11878 1854 --
NM_003948chr442278 2262 1916 1899 12447 ----
NM_003980chr631428 356 266 11457 ----
NM_003983chr1664474 3867 3700 1584 800 46 ----13786
NM_004006chrX32558 2549 1909 12607 ----
NM_004007chrX32558 2549 1909 12607 ----
NM_004009chrX32558 2549 1909 12607 ----
NM_004010chrX32558 2549 1909 12607 ----
NM_004011chrX32558 2549 1909 12607 ----
NM_004012chrX32558 2549 1909 12607 ----
NM_004013chrX32558 2549 1909 12607 ----
NM_004014chrX32558 2549 1909 12607 ----
NM_004015chrX32558 2549 1909 12607 ----
NM_004016chrX32472 2463 1823 12521 ----
NM_004017chrX32558 2549 1909 12607 ----
NM_004018chrX32472 2463 1823 12521 ----
NM_004020chrX32558 2549 1909 12607 ----
NM_004021chrX32472 2463 1823 12521 ----
NM_004022chrX32472 2463 1823 12521 ----
NM_004023chrX32472 2463 1823 12521 ----
NM_004028chr1853487 3286 2867 1265 1165 13389 14016 13401
NM_004035chr1735151 3191 605 12069 33800 3507 1802 --
NM_004079chr121140 871 21961 937 1237 --
NM_004081chrY31614 505 442 ----11623
NM_004087chr342052 1637 643 578 11958 11751 --
NM_004094chr1442877 1205 196 138 ------
NM_004096chr106516 422 369 104 75 66 11709 ----
NM_004098chr1051307 1282 1245 233 35 --1942 --
NM_004100chr651806 891 759 672 352 --12491 --
NM_004130chr33593 518 485 ----1261
NM_004136chr1563171 2494 1165 1129 358 217 1145 ----
NM_004162chr341099 838 201 171 11085 ----
NM_004171chr1179567 9120 8337 6769 6601 6407 1393 46818 3383 2958 791 29627 1087 12843
NM_004232chr1863542 3367 2535 988 925 792 22644 576 --13160
NM_004274chr1441231 1122 684 613 1523 1504 --
NM_004293chr953798 2903 966 924 918 --13417 --
NM_004319chr162886 1243 1177 973 717 118 ----1878
NM_004323chr962604 2500 1993 1745 969 224 42680 2666 2651 1034 ----
NM_004331chr852303 2225 283 226 149 1377 ----
NM_004338chr18106729 5208 4517 4426 2796 2039 1673 1524 1201 981 16873 46216 4509 866 738 --
NM_004342chr772329 2244 1926 873 847 311 125 --22036 790 --
NM_004379chr251542 1419 1205 700 181 --11286 --
NM_004384chr582284 2269 2234 2138 1750 1491 610 552 ------
NM_004392chr1352661 725 629 595 436 --12198 --
NM_004397chr1153879 3252 1320 516 372 13143 12815 --
NM_004412chr1045840 5425 4511 1951 31178 857 355 15462 --
NM_004423chr362564 1989 1732 733 572 335 22542 951 --11797
NM_004438chr282967 2953 2936 2882 2294 1302 1054 130 ------
NM_004441chr331036 268 247 --11252 --
NM_004449chr2121306 502 ----1402
NM_004485chr174202 3906 3834 1259 385 113 92 --23374 1446 --
NM_004501chr133702 1496 211 53442 3056 2556 1281 394 13597 13788
NM_004540chr216824 818 596 340 243 222 ------
NM_004586chrX65405 4125 3639 3623 1985 1190 --31577 1514 446 1935
NM_004598chr573053 2965 2469 2069 829 388 287 --12867 --
NM_004612chr964486 4296 4028 3791 3670 497 ------
NM_004654chrY3879 545 455 --1111 --
NM_004670chr1021449 221 --1355 11568
NM_004673chr151347 1123 1011 463 316 ------
NM_004681chrY1681 --1515 1582
NM_004726chrX105541 5033 4922 4827 4523 4070 3691 2159 1428 971 24144 3760 ----
NM_004731chr1251849 1760 1607 1579 668 --11917 --
NM_004734chr1363121 2722 2488 2475 2334 1203 --12590 --
NM_004742chr341365 1359 1235 1160 --11537 --
NM_004744chr463807 3510 3165 3064 2415 259 173 1562 --
NM_004748chr1554044 4024 3898 3695 570 23112 1299 11383 13062
NM_004756chr1971464 1422 1350 1064 140 115 104 11533 1159 --
NM_004760chr732296 837 497 1597 ----
NM_004788chr1142611 1810 1047 816 ----22210 956
NM_004791chr133761 274 191 1223 ----
NM_004801chr23353 329 213 --1226 --
NM_004807chr262378 2294 2279 1879 1730 189 ------
NM_004808chr1083367 3208 2139 1364 1078 746 553 504 --23001 2782 1809
NM_004840chrX41976 1929 731 238 --11829 --
NM_004845chrX72556 1514 1283 1218 1022 947 451 --1991 --
NM_004850chr241382 363 346 205 ----21630 1605
NM_004857chr14104464 4352 4323 4172 3687 3529 3483 3198 1036 665 23379 239 23857 397 --
NM_004859chr1762688 1977 1142 482 281 92 22765 921 11160 --
NM_004863chr1454688 4553 2003 1939 342 --24752 1610 13400
NM_004866chr584562 4128 3838 3385 1134 849 437 103 1737 14190 --
NM_004867chrX4443 268 63 52 ------
NM_004871chr1784254 3785 3618 2866 1643 1346 196 108 --12706 --
NM_004898chr452376 1082 1003 193 94 12122 ----
NM_004904chr7136411 5964 5651 5543 4523 4290 2397 2322 2088 2079 1657 1412 995 15215 --16592
NM_004929chr851458 1358 1087 1029 554 21156 254 ----
NM_004985chr1264246 3827 3438 1360 1132 1046 ------
NM_004992chrX158121 8031 7859 7763 7375 6223 5582 3366 2931 2703 1664 765 270 197 34 ------
NM_004992chrX158121 8031 7859 7763 7375 6223 5582 3366 2931 2703 1664 765 270 197 34 ------
NM_005010chr761465 1386 863 301 264 256 --22000 22 --
NM_005028chr1062176 1763 1654 646 624 323 1871 2801 187 --
NM_005044chrX73139 3109 2840 2779 1700 823 528 11259 24313 1741 --
NM_005056chr12115411 5291 4933 4912 3494 2241 1518 1246 1193 565 181 21502 428 1468 --
NM_005095chr131937 1758 485 --11828 --
NM_005116chr2064126 3690 3358 1738 1421 714 --44479 2952 1026 661 --
NM_005121chr1763598 2582 831 801 232 127 2843 366 12611 --
NM_005126chr342313 2047 1479 855 32133 1816 326 --12284
NM_005135chr15133656 3621 3512 3391 1524 1389 1325 890 831 797 359 289 213 --21453 1089 --
NM_005156chr955358 5019 4987 4434 348 ------
NM_005160chr2286085 5767 5434 5234 4762 1817 1312 1121 36471 6463 1563 15736 --
NM_005171chr1231234 426 275 ----11031
NM_005188chr1165184 3021 2036 1353 810 540 --26628 2428 --
NM_005197chr14135850 5740 5557 4693 4595 4128 2128 1759 1229 357 351 81 49 11627 15938 --
NM_005233chr342485 2049 1795 111 1963 ----
NM_005235chr2137527 6068 3003 2681 2095 1549 1281 1162 1148 882 634 543 488 1501 ----
NM_005256chr114925 343 277 250 ------
NM_005257chr18--1532 --1921
NM_005259chr271370 1275 1194 968 563 272 55 1508 ----
NM_005264chr102775 22 ----1788
NM_005271chr1041180 1042 302 128 ------
NM_005277chr431882 1636 627 --1281 --
NM_005284chr65483 472 336 42 29 ------
NM_005324chr1731518 1507 546 11686 2809 794 --
NM_005328chr82761 177 ----1803
NM_005339chr443946 1344 579 417 33588 3034 1501 156 --
NM_005347chr941567 1472 1391 330 --21190 1115 11104
NM_005370chr192230 95 --11265 11228
NM_005385chr352610 1980 1023 285 91 ------
NM_005397chr793868 3811 3695 3279 3240 2608 2480 468 25 12909 --11491
NM_005399chr174299 4163 3158 1475 775 716 621 --13841 --
NM_005402chr751858 1663 1404 1207 97 --11719 --
NM_005406chr18--11209 --11163
NM_005436chr1083898 3884 3274 3195 3151 3014 1201 449 --1749 --
NM_005440chr1761030 969 821 517 441 214 ----1807
NM_005458chr951649 868 762 753 254 --11753 12073
NM_005475chr1292842 2797 2787 2660 2489 2341 651 421 26 13164 23070 718 --
NM_005476chr92985 429 1949 1491 11338
NM_005497chr1795980 5499 5157 5142 4255 2240 2223 1669 991 --35563 5221 4317 --
NM_005502chr972652 2315 2071 2033 814 670 583 --2924 625 --
NM_005504chr1295072 4823 4478 4062 2616 2161 2005 1119 256 26011 4762 ----
NM_005578chr3104063 4023 3469 3120 2013 1681 927 866 789 706 34527 4160 3185 --13315
NM_005584chr132544 136 --1658 --
NM_005595chr14701 692 682 211 ------
NM_005596chr995768 5646 5005 4756 4684 1744 1352 515 244 34721 404 348 ----
NM_005639chr1271693 1671 1178 638 458 224 110 ------
NM_005655chr851297 1192 515 276 98 ------
NM_005664chr1531050 735 256 21079 674 ----
NM_005665chr1104891 4129 3981 1835 1585 1419 1133 1127 377 252 14571 11072 --
NM_005668chr5114557 3134 2880 1676 1595 1534 1461 1195 271 93 24 13868 24094 956 --
NM_005715chr652515 2492 2436 1944 1010 --1991 --
NM_005722chr242468 2280 2242 838 ------
NM_005746chr732736 2006 231 ------
NM_005748chr1273400 2758 2705 1363 1128 298 196 1356 12632 --
NM_005779chr573481 3201 1090 993 736 457 370 --11280 --
NM_005780chr134790 783 661 107 1720 ----
NM_005808chr353132 3079 2315 724 592 1449 13492 12495
NM_005832chr341398 1241 1111 372 ------
NM_005840chrX77288 6446 6265 4976 2289 304 48 27043 7013 1686 --
NM_005862chr35829 728 419 352 252 11002 ----
NM_005901chr18188274 8080 7692 6885 6788 6534 5502 5451 5258 2902 2161 1975 1745 1645 1392 1075 1068 891 35890 5687 776 --12216
NM_005903chr595115 4269 4079 3560 3360 3304 1328 294 135 --11390 --
NM_005909chr584248 4039 3866 3468 3440 2849 1098 505 21612 1336 22885 819 --
NM_005935chr474959 4580 4555 2084 847 317 152 --1907 --
NM_005941chr873911 3521 3005 2601 1637 1588 653 33450 1000 681 ----
NM_005955chr195524 5018 4925 4221 4144 3732 1543 1384 738 11399 24447 2070 --
NM_005966chr22623 277 --11988 12296
NM_005996chr1251149 1122 1116 445 290 --1266 --
NM_006007chr984216 3448 2965 1445 1097 1005 818 643 2468 327 1973 --
NM_006016chr661981 1486 1455 329 275 187 11917 1883 --
NM_006037chr284885 3969 3287 1884 1815 1449 1389 968 ------
NM_006060chr7114109 3860 3525 3514 3325 1666 1609 1494 1202 921 520 34200 4001 86 43904 3073 1274 1188 --
NM_006080chr722779 205 174 12062 --
NM_006095chr493589 3436 3091 3049 1504 1336 1298 982 970 --1449 --
NM_006106chr1163130 2487 951 401 386 123 ------
NM_006108chr1142280 2086 1976 635 21722 1462 11673 --
NM_006158chr821443 556 1114 --1489
NM_006162chr1871772 1204 1115 1092 670 209 30 --1575 --
NM_006180chr961841 1638 1631 680 418 122 ----134
NM_006195chr951094 885 874 282 237 1343 ----
NM_006203chr564944 4655 3577 1518 1398 362 11502 13484 15484
NM_006206chr482877 2636 2348 2332 795 705 347 314 ----11148
NM_006226chr241206 1082 978 216 ------
NM_006256chr161989 1877 1771 715 652 86 --11071 --
NM_006282chr2083848 3772 3726 3692 1424 1318 322 83 11506 ----
NM_006283chr874701 4054 1725 1271 922 836 24 13809 21671 1334 --
NM_006287chr282389 2071 2050 1876 1078 1069 140 22 12582 1800 --
NM_006294chr8----1496 1458
NM_006298chr652215 1341 1233 707 37 12241 23436 626 12805
NM_006306chrX35565 1276 930 --23892 2011 --
NM_006315chr473757 3593 3412 546 461 168 154 --24326 2829 --
NM_006320chr461002 799 711 442 277 111 1738 ----
NM_006345chr451282 1075 886 429 192 11194 ----
NM_006380chr1774166 3951 3652 1523 700 640 195 --14356 --
NM_006393chr103973 408 180 1799 1454 1475
NM_006420chr2082762 2420 2310 2213 1120 1077 703 47 13146 ----
NM_006457chr453822 2893 1170 556 82 23368 3072 21232 620 --
NM_006469chr12104 27 --1506 --
NM_006482chr1263791 3105 3067 2450 271 41 ----13508
NM_006489chr1441813 794 679 471 1515 1281 --
NM_006504chr1082680 2450 1006 879 437 409 344 290 ------
NM_006520chrX71403 1392 1315 195 156 128 110 --1432 --
NM_006538chr283842 3158 2913 1247 1093 1042 66 56 12738 11620 --
NM_006544chr14165965 5792 5615 5175 4788 4754 4736 3779 2246 1990 1919 1792 1688 893 577 457 25460 356 33729 2422 113 --
NM_006546chr17136101 6009 5863 5323 4258 2115 1851 1595 1560 1293 1253 607 203 ------
NM_006547chr73694 489 64 --21876 496 --
NM_006548chr341789 1180 702 50 ----1328
NM_006561chr1075664 4963 2195 1776 1153 451 418 14311 13929 --
NM_006595chr114535 490 80 70 1800 --1461
NM_006599chr16137945 7656 6886 6780 5789 3319 3183 2721 2498 2124 547 540 193 37434 6143 470 11477 --
NM_006614chr382688 2578 2513 1446 1403 1111 633 125 --12521 --
NM_006624chr1032138 1524 199 22114 609 1749 --
NM_006625chr11769 1810 --1382
NM_006625chr11769 1810 --1382
NM_006625chr11769 1810 --1382
NM_006626chr961775 922 815 293 152 72 12539 --11072
NM_006628chr1574164 4152 4111 3048 2870 562 276 1213 14226 --
NM_006646chr1383055 2758 2325 2264 2200 709 501 253 1317 ----
NM_006654chr12124810 4038 3886 3500 3131 1797 1217 1163 450 378 289 218 34124 3461 3061 1443 11360
NM_006717chr962855 2819 2458 2187 1060 127 13329 ----
NM_006721chr104825 613 251 179 1789 ----
NM_006750chr16148026 7914 7573 7277 7077 6893 5594 5106 2738 2322 1768 1702 1130 1069 18020 26404 5829 --
NM_006754chr731174 307 58 21251 109 1490 --
NM_006827chr1472833 2305 678 293 171 86 43 1917 ----
NM_006873chr263563 2932 2471 1337 1137 1034 32409 2324 766 ----
NM_006874chr451159 1040 916 832 410 --1311 --
NM_006895chr262201 2078 2026 1701 1479 139 1232 1708 --
NM_006902chr182903 2541 2282 768 147 85 76 52 ------
NM_006920chr231461 321 71 11334 12043 --
NM_006922chr241783 1607 1032 190 22344 1672 11840 --
NM_006924chr1733864 2959 827 14347 21368 150 --
NM_006940chr1251552 1390 1210 377 207 ------
NM_006948chr2142388 313 212 119 ------
NM_006981chr952925 2766 1204 310 281 --12317 --
NM_007007chr12104289 4141 3694 3039 1744 1086 526 499 383 71 13898 24455 903 --
NM_007023chr241090 744 726 416 ------
NM_007030chr5105193 4930 4060 3949 3568 1615 1078 428 417 180 14907 11572 --
NM_007038chr21136031 5207 5189 5078 4785 4222 3943 2134 1817 1018 997 988 117 45467 5326 4591 203 24917 4074 --
NM_007050chr20118065 7880 7319 7267 6632 6178 5482 3093 2563 1175 1049 --47176 1805 1300 644 --
NM_007054chr553972 3525 1198 475 180 --21262 515 --
NM_007073chr653331 3054 2941 441 65 ------
NM_007106chr1342733 2621 2257 1084 12133 22698 71 --
NM_007114chr362693 1292 1229 774 184 74 3846 446 406 11284 --
NM_007146chr1752857 554 322 233 48 2676 626 12872 --
NM_007150chrX21821 796 --51997 1793 1535 826 166 --
NM_007159chr331737 402 315 ------
NM_007166chr1171486 1428 1305 1191 574 387 69 ------
NM_007172chr2232051 1145 147 13271 12043 --
NM_007176chr1451745 1295 1255 1247 175 --11558 --
NM_007195chr1863645 3299 2969 2710 2426 1325 1261 11028 --
NM_007249chr13168975 8345 8318 8092 6708 6493 3722 2658 2331 2086 1806 1736 1583 1388 488 480 33444 2566 1753 57874 7251 1339 1103 631 16988
NM_007292chr1735151 3191 605 12069 33800 3507 1802 --
NM_007347chr1552988 2882 2593 527 468 1934 ----
NM_007358chr141851 1697 721 147 11879 12026 --
NM_007375chr162661 2486 2141 2064 514 261 ------
NM_012069chrX82620 2510 2414 1736 1067 970 778 425 ------
NM_012072chr2064495 3139 1098 850 844 537 ----13740
NM_012081chr523507 3477 11195 42864 2438 1470 737 --
NM_012089chr14967 633 518 25 ------
NM_012095chr1083524 3028 2765 1264 1218 906 348 130 --13092 --
NM_012096chr342440 1229 484 215 ------
NM_012097chr251702 1652 1613 1506 752 --1410 --
NM_012104chr1132724 2515 1125 --43424 3000 1324 512 --
NM_012104chr1132724 2515 1125 --43424 3000 1324 512 --
NM_012137chr152766 1946 1014 614 156 12302 --12004
NM_012141chr1394142 3406 3264 3166 1618 1500 1314 1157 850 ----1734
NM_012164chr9107389 6856 6513 6168 5817 5722 2591 2034 1716 201 25545 1289 15017 --
NM_012193chr1154812 3772 1508 785 699 1513 34622 161 51 --
NM_012199chr184625 4589 3810 3708 1183 887 524 168 13562 14463 --
NM_012214chr2105625 5431 4658 4323 4202 2481 1759 1563 1351 1290 --12323 --
NM_012234chr363010 2563 2299 1368 567 230 1412 13228 --
NM_012238chr104587 439 340 192 --140 --
NM_012252chr735167 4754 3397 35046 438 270 15359 --
NM_012262chr184650 4613 4407 4235 3404 3347 1560 671 11428 14811 --
NM_012287chr334387 2919 1565 --11686 --
NM_012288chr685563 4808 3885 2206 2088 1389 1164 869 --11453 --
NM_012294chr773411 3294 2810 2803 469 330 299 14006 1314 --
NM_012297chr462645 2339 1812 797 502 445 ------
NM_012300chr572550 1964 1630 1615 1559 648 399 --1162 --
NM_012309chr1184186 3828 3199 1890 1723 1492 1073 157 14892 2278 247 --
NM_012316chr134644 4559 4084 14706 --15022
NM_012334chr584202 4170 3922 1392 1207 907 619 316 23573 2929 14107 13240
NM_012338chr72492 284 11006 --1404
NM_012347chr642493 2144 1182 511 22308 743 1733 1851
NM_012382chr594370 3623 3268 3125 2921 2849 1599 1159 826 ------
NM_012395chr753422 3245 2147 804 84 13132 ----
NM_012399chr2211903 2673 361 --1474
NM_012419chr62503 63 1452 1545 --
NM_012425chr10112516 2487 2335 2218 1875 1101 1020 989 220 48 32 ------
NM_012465chr1042924 2208 751 178 ----13435
NM_012471chrX41513 1507 515 34 --11370 11406
NM_013231chr1463500 3455 2911 973 956 839 ------
NM_013255chr7117556 7143 5980 5952 5375 2538 2492 2365 1735 1594 816 26342 6036 12666 12413
NM_013257chr852341 2154 2077 1780 627 11658 2691 319 1370
NM_013261chr433302 2293 555 13098 1850 22369 1253
NM_013269chr1283713 3402 1129 766 588 458 118 94 14438 13321 23911 2976
NM_013281chr2061489 1329 1271 1182 986 571 ------
NM_013309chr1582116 1772 1046 921 720 637 470 331 11900 1832 --
NM_013322chr741575 1319 1154 1087 11669 11352 --
NM_013341chr272676 2523 2225 2161 1922 1004 645 ------
NM_013372chr1593366 2989 2975 2284 2125 860 731 691 430 --124 --
NM_013386chr141609 1541 682 43 --11309 --
NM_013402chr1172603 2087 1939 1907 1877 1845 685 --12707 --
NM_013411chr172522 2227 1911 812 669 536 272 ----12823
NM_013437chr82395 44 21079 569 --11182
NM_013447chr1951196 1112 382 268 126 21290 220 1687 --
NM_013943chr162387 2338 2061 1237 656 60 --12487 --
NM_013989chr1494559 4491 4466 4361 3595 1951 270 143 81 21879 873 ----
NM_013995chrX21033 382 21895 728 2886 58 --
NM_013996chr7----3525 186 155 --
NM_013996chr7----3525 186 155 --
NM_013997chr7----3525 186 155 --
NM_013997chr7----3525 186 155 --
NM_013998chr7----3525 186 155 --
NM_013998chr7----3525 186 155 --
NM_014000chr1031653 1419 250 21618 642 21814 1527 1580
NM_014016chr351567 1454 1303 1208 639 --11251 --
NM_014028chr653316 2823 2463 722 179 12170 1365 1329
NM_014048chr1675030 4834 4616 3826 3780 1789 1691 43449 3353 666 203 11637 --
NM_014057chr951432 1384 1108 224 58 ------
NM_014112chr865256 5247 5115 5046 1723 605 24784 1229 1120 14770
NM_014141chr795248 4660 4510 4188 3242 1955 1517 764 615 14527 1423 --
NM_014154chr331514 530 24 --1275 --
NM_014155chr1187192 7066 6557 6076 1089 571 479 47 32924 2300 1661 --16574
NM_014157chr1663810 3755 3697 1155 407 384 23159 1054 3712 634 244 --
NM_014181chr232315 1794 335 1494 21114 399 --
NM_014191chr123910 886 877 ----2959 318
NM_014211chr551322 648 594 450 39 ------
NM_014223chr15234 226 181 167 34 1281 ----
NM_014238chr1761659 1523 1381 486 359 48 ------
NM_014240chr353705 1367 653 394 364 --23769 250 1457
NM_014243chr432148 1802 685 21677 664 ----
NM_014280chr1----1904 193
NM_014309chr2284964 4483 4352 4087 3611 1788 1547 54 ------
NM_014331chr4107696 7207 6635 6381 6065 5606 5276 1377 912 894 56884 5395 2865 1124 307 11440 --
NM_014372chr121803 1497 12058 11444 --
NM_014381chr1483131 2732 2432 2423 1262 1039 695 83 1813 ----
NM_014382chr331350 1325 308 --11406 --
NM_014445chr342319 2277 1518 603 --22312 618 --
NM_014458chr14886 536 414 118 11212 ----
NM_014469chr113788 215 47 ------
NM_014554chr1252264 2001 1887 1592 726 --11435 1431
NM_014571chr1112811 2719 2694 2329 2165 1215 1194 682 653 626 312 --13015 --
NM_014592chr53800 617 521 --1164 1530
NM_014615chr1633635 3054 2793 --22976 1161 --
NM_014634chr22112997 2917 2892 2507 2431 1174 414 341 302 124 75 ------
NM_014636chr984145 3733 3520 3411 3099 2683 1526 1129 ------
NM_014660chr741112 940 452 216 ------
NM_014666chr541338 1024 1014 1005 1294 ----
NM_014682chr851644 931 403 121 36 1918 ----
NM_014701chr1563473 3151 3022 2225 118 74 ------
NM_014707chr74916 764 741 393 11660 --11758
NM_014733chr552103 1988 330 167 57 ------
NM_014746chr224226 524 13445 23085 1580 --
NM_014749chr14--1850 2341 122 --
NM_014755chr284160 3966 3124 2865 2800 2699 1389 882 --13110 --
NM_014766chr753088 2594 857 210 59 --13610 --
NM_014787chr152427 2085 551 280 99 --1925 --
NM_014797chr652602 2410 727 553 216 12076 22056 1244 12665
NM_014810chr163547 3109 1278 1149 584 257 ----12724
NM_014824chr1131925 607 275 ----21679 782
NM_014826chr1104337 3927 3660 3277 1352 1267 851 597 264 181 ------
NM_014829chr542359 1541 454 247 ------
NM_014832chr1341980 1929 1367 461 1419 1768 --
NM_014840chr1243268 1016 985 155 --12509 --
NM_014848chr1562495 2201 1088 567 401 160 --21958 762 --
NM_014850chr384508 3791 3340 1953 326 254 238 208 23135 624 1264 --
NM_014860chr251727 926 890 491 45 --11066 --
NM_014862chr1574149 3991 3898 3412 2920 766 365 ----13303
NM_014877chr1796457 6330 5334 4895 4815 2628 2561 1914 495 31381 1314 1187 15292 --
NM_014893chrY62285 2273 2042 1579 264 151 --1319 --
NM_014903chr1222331 739 32261 2045 927 --11630
NM_014906chr17113932 3738 3293 3187 2980 2746 1433 1379 1202 242 38 1638 ----
NM_014920chr6103332 2914 2737 2406 1320 825 793 256 147 109 23668 3397 ----
NM_014924chr1421135 500 11084 21199 190 12647
NM_014934chr13133768 3686 3583 3463 3325 3191 2800 2731 346 243 187 161 35 1613 23249 912 --
NM_014946chr222043 736 1668 --1287
NM_014950chr1451547 1510 1090 272 46 --1547 --
NM_014962chr2042786 2477 1867 175 ----22549 1171
NM_014982chr1474827 3674 3610 3393 1696 816 316 24583 4259 15240 --
NM_014988chr462208 1976 900 701 607 98 12339 22226 1868 --
NM_014989chr661965 1405 550 243 213 27 ------
NM_014991chr472556 2451 2322 2296 2040 476 359 11073 33122 2683 2544 --
NM_015000chr1242763 1976 1207 765 1378 --12678
NM_015026chr1294146 4128 3740 2995 1853 1709 961 445 176 --13106 --
NM_015032chr1352534 2475 2401 461 189 32004 1911 1174 ----
NM_015035chr2095859 5297 4726 4678 4440 2504 2454 1784 364 26411 320 ----
NM_015039chr174021 3881 3541 3245 3091 2686 325 --4443 404 365 287 --
NM_015042chr1541038 728 722 520 --44063 3786 1329 680 11176
NM_015046chr962403 2148 2034 963 400 25 136 12797 1810
NM_015051chr953082 2725 1258 40 33 1994 ----
NM_015064chr1293376 3219 2966 2713 2454 1356 754 509 288 11196 1325 --
NM_015068chr752728 2438 374 225 194 ------
NM_015071chr565142 5121 4989 923 827 128 --24268 184 --
NM_015074chr153872 1608 1464 227 134 1438 23936 1167 --
NM_015092chr1694652 4396 3883 3795 1605 1544 918 782 193 --11267 --
NM_015132chr761923 1849 459 304 295 227 11647 ----
NM_015144chr1683585 3540 3530 3523 2436 1030 610 582 12851 13413 --
NM_015156chr1443944 3343 3058 737 12486 14010 11373
NM_015163chr1462006 1928 1615 1241 230 217 ------
NM_015170chr832349 1795 393 11768 2874 356 1691
NM_015191chr1142585 2155 2053 1090 22137 409 ----
NM_015205chr13105067 4964 4575 4349 1543 1070 994 605 316 253 15044 25129 1987 --
NM_015206chr15103786 3579 3427 3375 2862 2358 1351 1085 560 231 1411 13070 --
NM_015208chr1863895 3834 3035 1371 708 292 11339 13090 --
NM_015236chr461511 1230 1021 324 39 27 ------
NM_015251chr1642146 1726 809 761 21884 826 --1657
NM_015265chr232556 2427 1744 22577 1885 ----
NM_015275chr1252069 1955 1949 658 461 ------
NM_015277chr1831157 338 68 1728 --1606
NM_015278chr653232 3201 2836 737 703 --13305 --
NM_015315chr563363 3155 2475 2394 2216 458 ----12705
NM_015317chr252835 2522 2152 1953 961 --22081 616 --
NM_015336chr1252517 2110 2035 577 147 1255 ----
NM_015339chr203928 290 227 ----1372
NM_015349chr622326 1875 21974 949 12553 --
NM_015365chrX84319 4197 3324 3302 3211 1217 1044 138 1234 13709 23961 1560
NM_015375chr164592 4210 3152 1784 1360 1182 13291 23314 785 --
NM_015429chr351078 715 453 332 223 ------
NM_015436chr442645 2612 2458 706 1128 13145 --
NM_015455chr573750 3528 2857 1649 1030 370 273 --1188 --
NM_015458chr875095 4362 4345 3997 3936 1870 336 1699 ----
NM_015460chr361980 1572 818 369 258 67 ------
NM_015532chr1532827 2701 884 32118 1831 231 ----
NM_015535chr294229 3602 3170 2715 1687 1352 788 426 227 --14047 --
NM_015541chr321421 313 ----1895
NM_015550chr743634 2600 971 24 ------
NM_015560chr352636 1017 923 203 58 ------
NM_015564chr563326 3255 3181 2798 1394 1279 23472 2519 13134 --
NM_015568chr2083883 3563 3191 2914 2679 1386 1069 64 23615 3507 13008 --
NM_015569chr154868 3726 3559 3484 3374 23405 54 ----
NM_015576chr351166 1094 1071 358 86 12414 12441 12248
NM_015578chr1971936 1851 1823 1809 1552 792 115 ------
NM_015605chr104443 334 242 191 ------
NM_015640chr134283 3402 1979 44410 1972 1901 1805 --13908
NM_015646chr1231116 327 58 --294 68 --
NM_015657chr251069 804 682 222 143 1414 ----
NM_015713chr863301 3062 1281 1197 1042 421 --12877 11011
NM_015888chr142635 2094 562 135 13361 13297 --
NM_015906chr184571 4265 3958 3453 3392 3019 1682 1014 13053 ----
NM_015975chrX31555 1201 1139 31329 445 345 ----
NM_016009chr1104805 4453 4271 4120 3702 3387 1147 1087 531 144 --24480 3450 --
NM_016018chr862866 2781 2263 2170 1791 388 1870 ----
NM_016021chr632909 2523 1132 11032 --22435 2337
NM_016023chr842227 1673 1428 133 11978 1404 --
NM_016040chr162406 2031 915 881 850 25 42777 2382 1117 591 ----
NM_016045chr2051525 578 568 253 23 ------
NM_016075chr1352808 2201 892 860 431 1490 1208 --
NM_016076chr153204 2750 2152 2079 2002 22396 1160 12684 --
NM_016083chr673736 3716 1489 1441 895 845 677 --13657 --
NM_016107chr51955 11356 1922 --
NM_016132chr1572893 2403 2222 1148 1068 920 593 23409 830 --12355
NM_016206chr3169031 8924 8458 7227 6907 6787 6509 6032 5973 5434 3259 3207 2107 1871 1189 1068 77731 6410 5629 3234 2576 271 34 16930 --
NM_016224chr642092 1475 847 700 --11407 11641
NM_016248chr1383381 3174 3033 2946 2870 2549 97 57 ------
NM_016252chr22233 63 1621 1693 --
NM_016255chr653310 3136 2677 2606 895 2954 251 ----
NM_016260chr287640 6834 6090 2295 1933 1855 1002 956 35243 904 796 ----
NM_016262chr62557 65 2430 249 ----
NM_016271chr1842295 2255 538 405 --31903 1855 1807 --
NM_016275chr352508 2327 2239 1870 793 --22231 995 --
NM_016281chr124935 432 321 313 ------
NM_016289chr272016 1512 1475 940 750 59 38 ------
NM_016298chr383345 2926 2448 2126 2039 767 557 154 1673 ----
NM_016308chr131885 1583 340 21499 1457 ----
NM_016315chr241191 756 580 440 21503 1405 ----
NM_016322chr943002 2455 681 420 ----1274
NM_016351chr73629 452 232 --1531 --
NM_016356chr652286 876 791 509 130 12582 --12801
NM_016376chr1773933 3775 3631 3537 2675 1373 48 1297 14017 --
NM_016382chr141054 965 160 38 ----11108
NM_016395chr153709 583 142 --11625 --
NM_016436chr2062681 2242 2179 1082 989 750 --12600 --
NM_016442chr552189 1735 1485 294 274 12226 11715 --
NM_016480chr52703 665 ----1656
NM_016488chr1261934 1703 1673 1606 670 53 ------
NM_016513chr6103332 2914 2737 2406 1320 825 793 256 147 109 23668 3397 ----
NM_016530chr1542981 1330 875 133 13132 ----
NM_016531chr4114122 4029 3984 3331 2884 2714 1663 1496 808 786 76 23741 2922 --1309
NM_016544chr263698 3294 2909 2892 2730 419 1907 172 --
NM_016569chr1251149 1122 1116 445 290 --1266 --
NM_016577chr3104514 4250 3868 3554 3462 3195 3067 2866 894 454 --11384 14038
NM_016613chr462397 2041 1868 1093 1007 848 2987 445 1232 --
NM_016622chr272125 2019 1661 1538 849 843 128 ------
NM_016651chr14--11111 --1996
NM_016653chr241002 449 410 339 --11041 --
NM_016950chr421359 85 11039 --11022
NM_016953chr275828 4853 4829 2168 2107 1923 62 15617 1103 11324
NM_017412chr841394 1016 364 96 11243 ----
NM_017415chr564155 4002 3536 3457 2877 2862 14402 14015 --
NM_017420chr1483593 2347 1068 1035 860 795 549 507 12583 1896 1349
NM_017423chr481719 1626 891 881 713 532 168 21 ------
NM_017447chr2183772 3564 1715 1577 1197 712 397 136 13824 ----
NM_017516chr112120 25 --164 --
NM_017548chr352184 1919 1426 225 58 ------
NM_017563chr365974 5243 4091 2432 1263 425 --35788 5725 1312 11740
NM_017577chr351529 1381 476 368 148 21568 418 ----
NM_017580chr1052033 1690 859 698 85 --2361 329 --
NM_017592chr19112807 2792 2710 2126 2093 2087 2014 2001 543 146 126 22498 1931 11951 --
NM_017594chr9102854 2842 2360 944 676 321 257 232 222 164 --12074 --
NM_017628chr4104296 4167 4131 3897 3699 3463 1670 1546 1086 743 21455 670 13707 --
NM_017633chr683916 3622 2719 1169 1160 980 558 314 1917 23923 496 1811
NM_017637chr976738 5998 3531 3174 2681 2060 1133 45938 5712 1743 1042 --26310 3185
NM_017643chr1773055 2901 2666 2591 2256 695 311 ------
NM_017650chr7116000 5572 5508 4750 4706 4600 4451 2426 1800 1093 823 14405 31506 1235 275 --
NM_017658chr1454379 3919 1080 542 535 ------
NM_017666chrX21918 765 2209 199 ----
NM_017671chr2052238 2084 1958 100 31 1109 2276 82 --
NM_017684chr1541928 1461 787 24 11454 ----
NM_017694chr241930 1465 409 140 ------
NM_017712chr1975340 4608 4363 1173 784 655 454 14840 46087 5270 1749 848 14673
NM_017737chr161893 1526 570 444 334 240 ------
NM_017740chr1641247 666 90 72 ------
NM_017745chrX------1692
NM_017753chr92749 227 1849 1726 --
NM_017754chr695006 4430 4090 1844 1474 1168 508 301 48 --11906 --
NM_017769chr1431262 1251 802 1252 22702 2535 --
NM_017831chr1884329 3753 3554 1097 946 626 565 214 13618 24645 4307 --
NM_017919chr985863 4724 4535 4035 3983 1247 908 709 11702 132 11962
NM_017944chr1172898 2313 1145 1087 737 644 115 --1470 --
NM_017946chr761222 1118 1041 1002 388 314 --11285 --
NM_017987chr1051921 1861 431 252 198 12114 21738 524 --
NM_017994chr722673 190 --22357 394 11028
NM_018017chr1072619 2268 2069 1911 1028 220 152 32021 1886 1093 22890 419 2863 470
NM_018036chr14133879 3831 3694 3461 3201 3084 2823 1549 1195 516 327 152 141 2934 452 11626 --
NM_018045chr173127 3040 1932 1079 553 197 47 12115 --1262
NM_018078chr43320 187 90 --1363 --
NM_018084chr273126 3009 2513 2447 2108 1219 1213 12481 13302 --
NM_018085chr1107508 7132 6451 6164 6131 5154 2556 1623 1263 869 --26193 1687 --
NM_018155chr353066 2849 2790 992 480 1637 176 --
NM_018157chr1252617 2485 387 41 27 13257 --2803 142
NM_018184chr331689 1445 429 11517 11886 1844
NM_018243chr4123990 3735 3391 3320 2603 1418 1376 1055 922 824 761 570 ------
NM_018246chr862844 2504 2084 1925 1912 746 2629 215 ----
NM_018247chr642673 2269 883 216 ------
NM_018293chr352938 2290 725 393 264 --1624 --
NM_018299chr883112 2994 2392 2215 910 657 558 548 22650 2224 1480 --
NM_018351chr1244189 3761 3537 1305 33931 3146 1142 32891 1830 1368 --
NM_018362chr1173999 3788 3635 1515 1402 508 151 ------
NM_018364chr132749 1495 1175 11346 ----
NM_018373chr14125950 5613 5322 5190 4818 4398 2592 2284 1199 1112 899 756 25135 814 11372 --
NM_018374chr745261 3245 585 488 34569 4116 3580 14218 --
NM_018403chr374001 3758 3692 3550 3313 649 195 --12843 --
NM_018409chr462738 2549 1318 1146 566 38 ------
NM_018429chr582852 2707 2381 962 802 378 202 65 1664 ----
NM_018439chr1842649 1624 765 118 --1130 1598
NM_018440chr877028 6588 6168 3208 1385 1377 988 1517 48163 6232 6020 1655 12601
NM_018452chr6_random53277 1262 1022 860 794 23390 422 22655 1537 1834
NM_018462chr34886 873 238 67 ----1716
NM_018475chr42605 521 2701 689 --2591 226
NM_018482chr862434 2089 916 408 370 333 1700 ----
NM_018566chr174790 3648 3195 864 417 310 66 54919 1777 1758 1656 1561 24992 3222 14462
NM_018638chr1244872 4656 4526 599 --177 --
NM_018695chr511520 --22055 1650 --
NM_018718chr732250 1541 522 21763 251 --21648 556
NM_018834chr54991 759 381 348 ------
NM_018945chr642737 1223 1198 196 --12868 1412
NM_018947chr784897 4495 4161 3736 3414 3351 1095 597 11408 14225 --
NM_018976chr1252824 2615 2358 2326 1003 ------
NM_018999chr1064804 3880 1625 622 446 436 11539 34128 3844 473 --
NM_019001chr334502 3838 794 1967 53865 1936 1768 1555 727 --
NM_019004chr741952 1946 656 635 21467 445 --11986
NM_019022chr1872973 2943 2767 2697 2660 2559 715 12918 1829 --
NM_019027chr432283 1837 451 --21898 649 --
NM_019035chr472106 2095 2030 1839 1449 739 525 ------
NM_019041chr652470 2064 1749 1602 226 1187 12550 --
NM_019045chrX4964 875 338 198 1855 --182
NM_019050chr442204 2065 1771 268 11686 ----
NM_019072chr532787 531 207 11080 23396 1018 1251
NM_019083chr141665 1640 302 295 11430 ----
NM_019084chr1072532 1943 1579 943 760 684 125 22295 800 ----
NM_019098chr861819 1566 1135 705 532 89 11244 ----
NM_019114chr982219 2191 1984 1678 997 977 699 483 189 ----
NM_019610chr162212 1733 1705 1601 856 216 ------
NM_020062chr203972 903 885 1942 ----
NM_020122chr2126006 5636 5582 5419 4732 4499 4236 3995 2055 1609 1466 867 12271 ----
NM_020123chr1061563 1444 1230 548 343 151 ------
NM_020132chr2164263 1972 1747 1728 1274 63 14737 1206 --
NM_020177chr563363 3130 3020 2680 224 154 --3902 168 85 --
NM_020194chr23582 449 35 --1555 --
NM_020245chr684854 4348 4194 1237 830 566 481 110 23521 3447 24767 391 --
NM_020336chr2021103 340 1353 --12411
NM_020341chr204659 321 260 145 ----11352
NM_020346chr1141304 1291 437 317 --11426 --
NM_020357chr331668 1394 1290 11565 ----
NM_020390chr353806 3406 1973 1362 179 1755 34059 3857 808 --
NM_020420chrY31614 505 442 ----11623
NM_020432chr732042 1819 561 11791 ----
NM_020443chr1126982 6493 5535 5450 5438 5303 5111 4865 1651 1438 690 478 12247 ----
NM_020455chr662742 1792 1738 730 543 353 ------
NM_020456chr1352204 2172 1968 1962 264 1440 ----
NM_020466chr6164840 4663 4642 4294 4285 4189 3956 3692 3567 3549 3223 1698 1677 1642 1411 234 --1392 --
NM_020474chr1831659 489 301 156 --11879
NM_020638chr1252104 1700 1374 241 228 ----1298
NM_020647chr862161 1683 902 590 551 407 1782 21710 514 --
NM_020673chr20117734 7246 6905 6782 6601 5794 5561 5296 4855 1269 323 27106 442 16698 --
NM_020686chr16103046 3023 2764 2708 2501 2170 1909 1132 315 42 12104 12373 --
NM_020699chr155272 4341 3853 3733 1130 24062 4051 13912 --
NM_020704chr732058 1682 47 1892 1710 --
NM_020711chr232015 1855 517 22291 2208 --12518
NM_020717chrX124775 4714 4460 4356 3832 3787 3108 1771 1147 620 362 25 13127 ----
NM_020718chr1666014 5912 2006 1456 550 475 ------
NM_020728chr732636 599 223 --32700 2034 166 --
NM_020734chr1253015 2980 686 601 22 --1824 --
NM_020739chr1554044 4024 3898 3695 570 23112 1299 11383 13062
NM_020742chrX52743 2343 2110 817 482 151 1337 --
NM_020752chr10102910 2862 2668 2628 2402 2316 1034 289 248 172 ----12349
NM_020766chrX44052 1452 1244 171 13165 --11505
NM_020768chr562517 2445 1265 745 624 166 12780 22275 723 --
NM_020772chr1785792 5345 3078 2628 1415 938 473 37 47996 2093 1679 1386 16373 --
NM_020774chr1886236 5357 4501 4001 1843 1622 1148 765 25676 4083 14350 --
NM_020776chr1852742 2662 2350 2207 156 1260 1759 --
NM_020778chr15104360 3713 3268 1771 1655 1281 1188 789 369 32 14127 24895 1752 --
NM_020783chr1862168 1952 1934 1719 1685 227 ------
NM_020801chr562599 2487 1063 803 480 173 11707 32243 1689 192 --
NM_020806chr144807 677 571 119 --1749 --
NM_020821chr1541928 1461 787 24 11454 ----
NM_020841chr122356 95 1830 --11542
NM_020858chr1572335 2122 2112 2027 1473 554 145 --22183 2058 --
NM_020859chr483926 3507 2637 1088 889 669 311 45 1422 13988 --
NM_020868chr22616 418 1653 11899 --
NM_020872chr341582 1344 1273 1189 21706 1234 ----
NM_020918chr1092452 2442 2383 2300 1323 792 684 639 183 --12884 --
NM_020921chr1473136 3051 2306 1337 1274 580 102 --12249 --
NM_020935chr2114109 3848 3688 3656 3648 1711 1265 1192 943 870 26 --13788 --
NM_020940chr1042511 1136 796 300 22724 2378 ----
NM_020948chr143207 3132 2595 2507 13308 ----
NM_020977chr472201 2118 850 680 392 215 120 32022 1542 582 2277 40 --
NM_021033chr1373500 3255 2733 838 542 510 167 --22845 2638 --
NM_021072chr542659 1945 1635 885 ------
NM_021083chrX73490 3368 2949 2693 2413 2395 463 ------
NM_021116chr7168089 7331 7060 7053 6686 6332 6269 5880 5492 3464 2918 1951 1456 1421 301 97 --1750 --
NM_021145chr741095 893 418 406 1858 ----
NM_021183chrX82512 2222 1671 1019 780 761 652 132 12315 ----
NM_021202chr2092979 2900 2650 2508 2252 2220 1173 915 134 --1220 --
NM_021629chr364639 4590 3658 3220 1746 1101 --23874 1810 --
NM_021643chr221749 1279 ----1242
NM_021648chr662399 1815 1739 942 221 70 ------
NM_021722chr73588 411 191 --1490 --
NM_021723chr73629 452 232 --1531 --
NM_021813chr665098 3592 3548 1991 1303 606 12057 1556 --
NM_021815chr2103116 2985 2959 2404 2255 1239 1221 1077 914 522 32885 844 77 12060 --
NM_021911chr5115579 5220 5185 4975 4177 3748 2184 1457 824 666 325 64584 4374 3570 3412 1643 906 1886 --
NM_021912chr15154192 3891 3759 3569 3520 3351 3332 3244 2701 1515 1295 1077 986 892 387 1155 ----
NM_021956chr651481 1216 369 357 258 11426 11288 --
NM_021960chr131745 608 149 ------
NM_021961chr1176743 6055 5815 2660 2502 1804 1762 1751 45199 4734 1821 1162 1420
NM_021964chr3116008 5796 4655 2511 2324 2202 1770 1375 316 174 147 46286 1671 918 383 --22405 2212
NM_022041chr1642605 2422 2274 483 2415 51 12519 --
NM_022048chr1594745 4245 2434 2201 2043 2037 1447 1379 548 --24321 2498 1382
NM_022049chr181848 1787 1597 1377 1371 754 449 430 ------
NM_022068chr184450 246 61 35 ------
NM_022091chr632332 2223 2171 --1583 1777
NM_022166chr1686237 5568 5200 5134 4107 4021 2233 174 11191 35185 4181 2540 --
NM_022458chr763067 2577 1015 1009 993 58 1763 ----
NM_022461chr321204 530 --11416 1162
NM_022474chr1461725 1049 672 252 70 54 22290 796 ----
NM_022476chr1641048 904 700 147 1750 ----
NM_022483chr551683 773 394 298 215 1241 41747 620 494 62 --
NM_022726chr641659 1477 1290 1185 21629 1553 ----
NM_022781chr932180 900 877 13149 2512 255 --
NM_022898chr14104770 4680 4159 3221 3083 1817 1717 878 851 488 11437 13727 --
NM_022912chr263092 2888 1920 757 457 77 21127 135 ----
NM_022918chr1131454 635 276 ----1360
NM_023068chr2081569 1437 1302 1164 443 417 392 350 ------
NM_023923chr173780 3245 1197 757 224 90 27 --32336 1261 821 --
NM_024007chr563164 2956 2088 1023 597 585 11092 12173 --
NM_024052chr1772957 2480 1971 1013 990 949 451 --12368 --
NM_024345chr9125029 5015 4581 3929 3804 2166 1573 876 764 722 217 202 25990 4424 34690 1635 166 --
NM_024408chr153628 3279 3109 2963 750 --1512 11114
NM_024416chr951432 1384 1108 224 58 ------
NM_024524chr393176 2803 2597 2014 1955 1261 1052 331 180 ------
NM_024548chr341749 1566 1194 267 1649 ----
NM_024582chr451137 1074 910 860 250 11107 ----
NM_024590chr431867 1200 72 11677 11288 --
NM_024594chr521353 702 1411 21723 280 --
NM_024607chr873038 2961 1388 1042 981 700 94 --21676 1318 --
NM_024613chr821834 1141 21711 141 --11732
NM_024639chr671996 1166 1034 476 454 191 167 --127 --
NM_024665chr333084 1809 1778 42993 1568 1500 982 23767 3741 --
NM_024713chr1551637 1072 505 290 164 --1588 --
NM_024721chr882564 2377 2188 2078 1974 1922 1006 434 22201 159 ----
NM_024740chr1183630 2781 1449 1126 1099 768 542 87 ------
NM_024749chr151409 798 457 382 326 --2776 62 --
NM_024770chr2106675 6156 5589 5009 4506 2005 1945 1260 738 674 26086 2470 ----
NM_024841chr1132455 1927 1878 --21843 1540 --
NM_024854chr1241434 578 431 204 ------
NM_024884chr1484321 3911 3818 3295 2975 1459 423 362 33376 637 145 ----
NM_024889chr10111202 1187 1165 1151 1136 720 705 661 647 620 160 --1636 --
NM_024947chr399514 9415 7971 7599 7163 7123 3281 2249 985 35937 3640 3035 15963 --
NM_024949chr474840 4437 4206 3977 1850 1620 153 --21287 1025 --
NM_024953chr1232255 392 72 11713 12143 --
NM_024989chr297529 6128 6060 3173 1143 959 945 336 124 26693 6466 --15987
NM_025054chr833292 3126 582 23243 3232 1306 --
NM_025073chr184660 4448 4328 1236 1223 1069 330 149 24742 1783 ----
NM_025134chr1642448 2089 1908 910 1917 --12152
NM_025138chr132941 35 11132 --11378
NM_025146chr332727 852 80 22501 1077 ----
NM_025160chr164081 3831 3597 2691 2665 598 11432 1963 --
NM_025191chr153436 3378 2286 969 777 13155 23102 2337 --
NM_025208chr1162418 2228 2073 1510 579 83 --12218 --
NM_025235chr1052030 369 323 304 144 ------
NM_030579chr1643604 3280 1439 334 1542 23465 1116 --
NM_030621chr1494253 3796 3789 3298 3207 2777 1606 1002 382 21521 168 ----
NM_030625chr1062580 2430 1938 1621 910 899 --1470 --
NM_030627chr583664 2992 1634 1592 1296 610 279 188 21166 371 --11093
NM_030639chrX41801 1486 1433 213 ------
NM_030647chr764810 4740 4049 3990 2502 850 24601 3853 25200 660 --
NM_030648chr4115385 5293 4626 3643 3511 3464 2237 1288 1013 889 205 25061 947 ----
NM_030650chr254039 3733 3304 2948 2861 12618 24103 1268 --
NM_030670chr1242155 2023 1569 558 1550 11587 --
NM_030671chr1242155 2023 1569 558 1550 11587 --
NM_030674chr1245681 4756 3730 946 45873 5122 3926 503 1570 15577
NM_030751chr1071797 1549 1285 1224 745 269 54 ------
NM_030751chr1071797 1549 1285 1224 745 269 54 ------
NM_030806chr1179256 9205 8963 8190 8003 7832 7270 6661 6602 3344 2427 2260 1747 1494 1408 1081 668 29055 8788 ----
NM_030816chr143178 2835 1032 501 1539 --13461
NM_030885chr352302 1938 730 401 83 1845 ----
NM_030918chr175063 4629 4244 4235 1115 745 44 15446 25365 4542 14861
NM_031271chr841524 1324 155 75 11238 1185 --
NM_031427chr1485847 4163 3817 2314 1843 1554 1066 460 15270 45626 4956 4227 1618 --
NM_031435chr1283340 3175 2891 2793 2575 2221 398 112 22259 893 1392 --
NM_031442chrX102724 2509 2430 2415 2256 2052 497 364 151 42 --22212 239 --
NM_031483chr2062771 1297 1164 1008 286 218 33007 835 380 ----
NM_031844chr133702 1496 211 53442 3056 2556 1281 394 13597 13788
NM_031845chr273539 3499 3142 2938 2286 571 530 --21471 1077 13136
NM_031847chr273539 3499 3142 2938 2286 571 530 --21471 1077 13136
NM_031911chr452476 942 858 524 371 1658 ----
NM_032012chr964963 4701 3726 1515 1451 857 --13204 1998
NM_032021chr1131178 1009 107 --11134 1795
NM_032042chr552917 2491 2025 1763 185 ------
NM_032102chr1162047 937 867 405 78 26 --12111 --
NM_032144chr241332 583 176 121 21783 79 ----
NM_032160chr1833181 1328 857 13014 34114 3595 2695 11509
NM_032175chr541771 1651 1633 296 11616 11645 --
NM_032189chr13104869 4766 4377 4151 1345 872 796 407 118 55 24846 1943 24931 1789 --
NM_032199chr1053829 3665 2608 222 40 23546 2486 ----
NM_032208chr273498 2966 972 810 533 283 144 11145 ----
NM_032217chr441162 1045 1025 435 21054 950 ----
NM_032228chr1163569 2882 2773 2443 2437 149 41337 1309 695 352 ----
NM_032291chr111702 2606 396 196 11904
NM_032321chr273090 2629 2602 2149 2135 750 246 ------
NM_032373chr10125561 5214 4842 4584 3985 3922 3769 2204 973 578 112 58 1592 ----
NM_032410chr83983 818 334 144 11012 --
NM_032439chr1031311 510 426 21667 536 ----
NM_032440chr1032020 1162 778 12896 --12466
NM_032446chr543647 3469 3374 3352 23213 805 ----
NM_032457chr483939 3813 3608 2496 1569 1354 603 236 11330 ----
NM_032458chrX43272 2703 595 269 --21052 912 --
NM_032471chr63281 118 100 ----1872
NM_032505chr362075 1756 667 434 403 214 --1946 12413
NM_032510chr1872149 1913 1835 1638 879 519 399 1390 2581 572 --
NM_032521chr2073085 3026 2841 2611 2551 2452 133 --1456 12937
NM_032622chr441351 1300 1186 231 ------
NM_032638chr371506 1344 357 151 140 114 84 --168 --
NM_032664chr841518 1499 1297 364 ------
NM_032682chr372691 2659 2345 1151 1089 371 280 13337 1349 --
NM_032778chr372749 2719 2642 2283 1278 1112 114 1474 ----
NM_032801chr1182517 2107 1814 1549 646 565 421 162 --1350 --
NM_032804chr1022249 669 1591 1974 12486
NM_032833chr141933 946 718 339 32663 2016 148 ----
NM_032859chr1352781 1047 786 680 485 33766 3707 1432 ----
NM_032873chr1163811 3716 3335 1453 965 850 13935 1594 --
NM_032905chr1051272 1167 895 496 306 11256 ----
NM_032932chr17135824 5523 4996 4695 4580 4516 4384 1987 1783 768 748 590 197 --14245 --
NM_032961chr451388 914 371 54 31 ------
NM_032968chrX94107 3452 3197 2841 1562 1261 1248 602 314 11650 ----
NM_032969chrX94107 3452 3197 2841 1562 1261 1248 602 314 11650 ----
NM_032973chrY74099 3448 3192 1561 1261 602 314 11644 ----
NM_032975chr1883468 3237 2847 2720 836 455 164 66 ------
NM_032980chr1883468 3237 2847 2720 836 455 164 66 ------
NM_033014chr951432 1384 1108 224 58 ------
NM_033020chr184571 4265 3958 3453 3392 3019 1682 1014 13053 ----
NM_033083chr363214 2499 2435 1044 1000 239 ------
NM_033135chr1162418 2228 2073 1510 579 83 --12218 --
NM_033138chr772329 2244 1926 873 847 311 125 --22036 790 --
NM_033139chr772329 2244 1926 873 847 311 125 --22036 790 --
NM_033140chr772329 2244 1926 873 847 311 125 --22036 790 --
NM_033157chr772329 2244 1926 873 847 311 125 --22036 790 --
NM_033181chr673736 3716 1489 1441 895 845 677 --13657 --
NM_033224chr786029 5990 5923 5169 5119 1414 476 236 17193 27040 1217 --
NM_033225chr853033 2656 2282 2097 285 11196 ----
NM_033285chr843111 1172 298 193 21639 244 1473 --
NM_033360chr1264367 3948 3559 1481 1253 1167 ------
NM_033380chrX1135 ----11137
NM_033381chrX1135 ----11137
NM_033389chr1763975 3832 1874 1328 1093 1077 --14593 --
NM_033428chr93495 427 210 41708 814 533 414 ----
NM_033429chr15123271 2926 2607 2528 2366 2041 1149 1116 940 688 595 113 ------
NM_033480chr642493 2144 1182 511 22308 743 1733 1851
NM_033481chr642493 2144 1182 511 22308 743 1733 1851
NM_033503chr1592866 2406 1395 1384 1218 881 824 623 477 21022 156 1903 --
NM_033505chr285390 5345 5105 5041 2369 2166 1087 240 --15606 25654 2448
NM_033551chr563363 3155 2475 2394 2216 458 ----12705
NM_033631chr193911 3901 3334 3011 2864 2631 2616 897 307 --22440 870 --
NM_033637chr1073973 3887 3722 3448 3323 1538 70 23481 1568 34096 2816 531 12701
NM_033644chr572550 1964 1630 1615 1559 648 399 --1162 --
NM_033645chr572550 1964 1630 1615 1559 648 399 --1162 --
NM_033656chr2185793 4335 4286 2264 2055 1465 761 186 ------
NM_052818chr1341711 1473 1456 832 11609 22105 1501 --
NM_052832chr873003 2494 2043 1024 742 730 714 1911 ----
NM_052879chr1234080 1285 1249 23392 210 12596 --
NM_052885chr1254435 3830 3644 520 190 34736 4357 4204 14402 --
NM_052900chr821558 1492 --11288 11111
NM_052904chr651149 476 441 200 192 1315 ----
NM_052905chr261837 1786 1653 744 729 358 11198 ----
NM_052907chr1254311 4096 3077 2703 974 44269 3977 2843 1129 --1942
NM_052932chr1141659 918 515 83 1734 ----
NM_053016chr997321 7225 7106 6677 6613 5581 4996 1440 176 --26730 3080 26566 4898
NM_053023chr1132367 1060 707 --22075 637 --
NM_053042chr473086 2702 2606 2371 2347 1145 665 1856 ----
NM_053064chr1442626 2425 2167 1989 --1676 12443
NM_057175chr442650 1767 745 319 22522 389 1178 --
NM_080546chr931906 1830 312 147 31784 611 571 --
NM_080629chr141525 1089 619 30 11161 ----
NM_080630chr141525 1089 619 30 11161 ----
NM_080759chr1352661 725 629 595 436 --12198 --
NM_080760chr1352661 725 629 595 436 --12198 --
NM_080836chr2064552 3346 2976 1803 1761 131 13576 13920 11622
NM_080867chr1454325 3925 3661 1573 1257 --14533 11906
NM_080872chr863475 3103 3000 766 555 505 --21021 958 11248
NM_130385chr1162092 2068 711 691 433 194 ------
NM_130391chr993286 3052 1230 1222 1211 856 452 108 45 13126 --1890
NM_130392chr993286 3052 1230 1222 1211 856 452 108 45 13126 --1890
NM_130393chr993286 3052 1230 1222 1211 856 452 108 45 13126 --1890
NM_130435chr1082680 2450 1006 879 437 409 344 290 ------
NM_130438chr2183078 2817 2228 2162 2090 287 196 69 ----1444
NM_130831chr352636 1017 923 203 58 ------
NM_130832chr352636 1017 923 203 58 ------
NM_130833chr352636 1017 923 203 58 ------
NM_130834chr352636 1017 923 203 58 ------
NM_130835chr352636 1017 923 203 58 ------
NM_130836chr352636 1017 923 203 58 ------
NM_130837chr352636 1017 923 203 58 ------
NM_133170chr20118065 7880 7319 7267 6632 6178 5482 3093 2563 1175 1049 --47176 1805 1300 644 --
NM_133334chr4136279 5804 5347 5188 4773 4441 4433 3970 2558 1786 1612 1471 410 12437 --1498
NM_133367chr663140 3133 2799 874 785 21 --1925 12845
NM_133370chr463318 2623 2255 1345 1014 568 11201 33001 2367 1480 23355 959
NM_133378chr24893 680 614 333 1360 ----
NM_133432chr24893 680 614 333 1360 ----
NM_133437chr24893 680 614 333 1360 ----
NM_133496chr144009 3373 1559 1496 13253 12774 21087 632
NM_133646chr285496 5020 3817 3733 1508 1040 880 718 24227 269 13881 --
NM_133647chr15133656 3621 3512 3391 1524 1389 1325 890 831 797 359 289 213 --21453 1089 --
NM_134442chr251542 1419 1205 700 181 --11286 --
NM_138270chrX73423 2921 2096 1369 1214 963 591 12552 ----
NM_138286chr1944116 3131 721 217 23426 435 11614 14108
NM_138288chr1441825 568 285 227 31760 454 103 ----
NM_138459chr652781 2762 2681 1352 125 ------
NM_138468chr2115831 5388 5284 4941 4809 4714 4116 2216 1960 1389 319 152 22280 1451 14467
NM_138494chr7102501 2450 2401 2335 2041 2016 474 463 132 50 --21770 639 --
NM_138576chr14104770 4680 4159 3221 3083 1817 1717 878 851 488 11437 13727 --
NM_138621chr283842 3158 2913 1247 1093 1042 66 56 12738 11620 --
NM_138694chr673320 3173 2700 2686 2673 481 319 13637 ----
NM_138713chr16137945 7656 6886 6780 5789 3319 3183 2721 2498 2124 547 540 193 37434 6143 470 11477 --
NM_138714chr16137945 7656 6886 6780 5789 3319 3183 2721 2498 2124 547 540 193 37434 6143 470 11477 --
NM_138731chr1462947 2882 2777 1394 274 63 43923 3824 1009 447 ----
NM_138735chr23353 329 213 --1226 --
NM_138782chr521669 214 11714 11946 --
NM_138959chr1156603 6333 6216 6147 6102 5912 5416 5362 4860 4257 2116 1875 1677 936 823 --1791 --
NM_138971chr1132724 2515 1125 --43424 3000 1324 512 --
NM_138971chr1132724 2515 1125 --43424 3000 1324 512 --
NM_138972chr1132724 2515 1125 --43424 3000 1324 512 --
NM_138972chr1132724 2515 1125 --43424 3000 1324 512 --
NM_138973chr1132724 2515 1125 --43424 3000 1324 512 --
NM_138973chr1132724 2515 1125 --43424 3000 1324 512 --
NM_139136chr123954 360 315 1997 1298 --
NM_139168chr541920 501 115 65 1420 ----
NM_139279chr273572 2464 890 795 688 658 105 12754 ----
NM_144570chr162410 309 12857 32660 2297 472 1498
NM_144571chr495782 5497 4974 2755 2240 2188 1984 302 223 --42266 2023 608 267 11005
NM_144578chr14115496 5109 4266 4192 4113 4048 1890 1449 1262 1183 454 --1694 --
NM_144590chr1052894 2746 2613 2084 2056 11929 --1792
NM_144599chr15113832 2031 1503 1492 1467 1191 966 759 470 305 203 24340 2205 ----
NM_144618chr141237 1164 1106 335 --11299 1359
NM_144632chr252125 1546 855 603 183 1914 --185
NM_144664chr1161830 1614 565 299 241 152 --42582 2106 2067 2030 --
NM_144778chr1362626 2509 2223 2048 859 679 1519 12482 --
NM_144973chr1265027 4351 3627 1724 1663 1572 25278 3381 ----
NM_145049chr54990 886 339 174 ------
NM_145117chr1172688 2221 2020 1189 1126 771 375 13048 22325 1270 --
NM_145173chr19102230 2142 2077 1908 1729 908 902 108 66 60 1497 ----
NM_145175chr231334 1308 1105 --21255 985 11033
NM_145251chr1421021 153 1463 --11615
NM_145259chr296926 6612 6105 5559 5394 4394 1925 1356 139 ----25414 5167
NM_145263chr432349 2336 584 --1449 --
NM_145305chrX3461 203 37 --1421 11312
NM_145307chr1094584 4331 4067 1770 1535 787 237 208 112 --14040 --
NM_145320chr743634 2600 971 24 ------
NM_145321chr743634 2600 971 24 ------
NM_145322chr743634 2600 971 24 ------
NM_145649chr652167 1681 1032 533 177 --12231 --
NM_145655chr652167 1681 1032 533 177 --12231 --
NM_145698chr1041833 1562 302 178 1334 ----
NM_145793chr102775 22 ----1788
NM_145808chr742829 2550 2441 300 12222 ----
NM_147147chr653331 3054 2941 441 65 ------
NM_152261chr1241678 1628 1576 162 11649 ----
NM_152277chr571929 1737 1618 742 667 276 169 --11396 --
NM_152352chr1822461 1951 --12478 --
NM_152388chr293631 3601 3444 3373 3174 1280 531 237 135 ------
NM_152400chr441618 791 654 366 1344 ----
NM_152406chr551467 1103 525 485 360 ------
NM_152407chr532129 767 394 22549 1014 ----
NM_152409chr563187 2854 2702 2504 927 466 --1991 --
NM_152515chr22936 885 1333 --2299 44
NM_152519chr242000 771 663 651 ------
NM_152529chr264228 4060 3689 3089 1709 1287 24164 2783 34100 949 442 --
NM_152542chr442192 2057 610 403 --1674 11882
NM_152586chr103942 852 91 1428 1153 1901
NM_152622chr563111 2357 1285 647 374 272 ------
NM_152624chr575611 5573 4873 2026 747 729 456 24956 1084 11750 --
NM_152629chr931520 828 599 --21649 1411 --
NM_152630chrX41406 1338 1073 185 1353 31450 1197 1017 --
NM_152641chr1232221 2071 1001 12711 1499 1564
NM_152665chr14813 489 400 378 ------
NM_152666chr15843 788 658 636 153 ------
NM_152678chr342428 1825 1056 389 --22630 870 --
NM_152694chrX4855 829 748 154 --154 --
NM_152699chr373614 3359 3050 2807 1487 1095 805 1408 ----
NM_152724chr10112516 2487 2335 2218 1875 1101 1020 989 220 48 32 ------
NM_152756chr543758 1423 1378 589 24158 2962 13440 --
NM_152758chr842144 1155 1125 340 11091 ----
NM_152774chr751919 1796 1735 1683 846 22164 763 ----
NM_152787chrX41127 1057 715 569 22739 1231 --12431
NM_152793chr743895 1469 1191 310 44460 4448 3498 1966 21227 119 --
NM_152835chr142957 1917 268 61 --12791 --
NM_152919chr1951196 1112 382 268 126 21290 220 1687 --
NM_152989chr1251552 1390 1210 377 207 ------
NM_152996chr161908 821 801 712 338 221 1834 ----
NM_152999chr754442 1789 1744 740 341 23338 206 23141 186 14083
NM_153013chr542404 2276 1632 706 12038 12132 --
NM_153182chr372749 2719 2642 2283 1278 1112 114 1474 ----
NM_153184chr341760 720 501 146 21985 243 ----
NM_153188chr585508 5292 5027 4459 3610 3453 2281 211 34486 1390 1007 ----
NM_153262chr142078 1179 971 240 22447 40 156 --
NM_153332chr853019 2442 2218 373 194 12964 ----
NM_153371chr1332062 851 428 31850 1655 1468 1787 --
NM_153426chr44629 617 273 219 ----1509
NM_153427chr44629 617 273 219 ----1509
NM_153456chr1395676 5605 4818 4577 4314 4229 2055 1971 1650 34722 4627 859 31524 1159 869 --
NM_153616chr1572335 2122 2112 2027 1473 554 145 --22183 2058 --
NM_153617chr1572335 2122 2112 2027 1473 554 145 --22183 2058 --
NM_153618chr1572335 2122 2112 2027 1473 554 145 --22183 2058 --
NM_153619chr15103573 3360 3350 3265 2711 2631 2413 2269 1383 205 12486 23421 3296 --
NM_153645chr2232051 1145 147 13271 12043 --
NM_153689chr262350 1796 1668 1620 287 229 2744 550 ----
NM_153748chr123954 360 315 1997 1298 --
NM_153836chr231632 586 468 21519 1426 ----
NM_170665chr1293267 2983 2808 1619 1499 1252 899 316 222 --21309 787 --
NM_170706chr174021 3881 3541 3245 3091 2686 325 --4443 404 365 287 --
NM_170709chr852341 2154 2077 1780 627 11658 2691 319 1370
NM_170719chr132941 35 11132 --11378
NM_170731chr1142748 2481 2450 690 22866 638 12051 --
NM_170732chr1142748 2481 2450 690 22866 638 12051 --
NM_170733chr1142748 2481 2450 690 22866 638 12051 --
NM_170734chr1142748 2481 2450 690 22866 638 12051 --
NM_170735chr1142748 2481 2450 690 22866 638 12051 --
NM_172058chr871513 1497 1378 1196 619 352 57 ------
NM_172059chr871513 1497 1378 1196 619 352 57 ------
NM_172060chr871513 1497 1378 1196 619 352 57 ------
NM_172070chr242231 1607 301 58 ------
NM_172071chr157479 6506 2973 2163 971 15589 ----
NM_172103chr651806 891 759 672 352 --12491 --
NM_172105chr651806 891 759 672 352 --12491 --
NM_172387chr1851725 1157 1068 623 162 --1528 --
NM_172388chr1871772 1204 1115 1092 670 209 30 --1575 --
NM_172389chr1871772 1204 1115 1092 670 209 30 --1575 --
NM_173076chr251069 804 682 222 143 1414 ----
NM_173082chr631378 1225 552 --1176 --
NM_173167chr1742480 2153 863 558 1121 --12568
NM_173198chr952925 2766 1204 310 281 --12317 --
NM_173200chr952925 2766 1204 310 281 --12317 --
NM_173214chr16137945 7656 6886 6780 5789 3319 3183 2721 2498 2124 547 540 193 37434 6143 470 11477 --
NM_173468chr455211 4450 1741 640 448 1492 14168 15850
NM_173469chr153419 396 301 1375 158 --
NM_173511chr273875 3855 3739 3408 674 580 264 --1362 --
NM_173576chr1042148 2058 321 269 21998 1514 1283 --
NM_173602chr1283745 3531 3410 3261 660 557 436 198 --13063 --
NM_173607chr1452060 1804 1565 1510 1381 22086 1572 ----
NM_173631chr1941164 1156 849 283 --11107 149
NM_173642chr1148128 7537 7307 6510 5582 3270 3172 2798 1583 806 518 208 127 21 36949 3399 3193 --11930
NM_173683chr851591 604 132 118 90 ------
NM_173822chr241910 1855 801 312 12143 ----
NM_174916chr1522280 2071 1468 1600 --
NM_175061chr741876 1814 398 39 2573 538 ----
NM_175607chr341454 1222 1067 44 1319 ----
NM_175612chr341454 1222 1067 44 1319 ----
NM_175624chr12117337 7003 6146 6079 5261 2616 2536 2479 2470 2214 1455 32913 2412 1201 26303 5325 17697
NM_175625chr12117337 7003 6146 6079 5261 2616 2536 2479 2470 2214 1455 32913 2412 1201 26303 5325 17697
NM_175733chr1181981 1879 1856 1432 1424 712 660 84 ----1376
NM_175736chr12126483 5873 5552 5374 5211 4894 4888 3147 2158 1486 1314 866 ------
NM_175854chr1372686 2578 2116 1796 1723 459 48 --11964 --
NM_175907chr1862881 2826 2537 2464 1810 882 11976 12166 --
NM_176081chr1045840 5425 4511 1951 31178 857 355 15462 --
NM_176083chr1045840 5425 4511 1951 31178 857 355 15462 --
NM_176812chr20----1275 1682
NM_176814chr761096 575 501 426 343 202 ------
NM_176823chr173782 3282 3103 1215 804 213 189 --22970 1294 --
NM_177424chr151896 1640 1467 720 458 192 ----
NM_177438chr1494253 3796 3789 3298 3207 2777 1606 1002 382 21521 168 ----
NM_177553chr114925 343 277 250 ------
NM_177925chr1273013 2200 1032 932 759 148 37 12097 ----
NM_177968chr261990 1929 1838 565 379 294 11458 1108 --
NM_177985chr251702 1652 1613 1506 752 --1410 --
NM_177990chr204659 321 260 145 ----11352
NM_178010chr1251552 1390 1210 377 207 ------
NM_178011chr1023043 2895 32268 1218 779 22875 2744 --
NM_178037chr1293376 3219 2966 2713 2454 1356 754 509 288 11196 1325 --
NM_178038chr1293376 3219 2966 2713 2454 1356 754 509 288 11196 1325 --
NM_178151chrX167770 7351 7157 7050 5258 2655 2505 2378 1569 1341 945 873 580 543 242 81 26076 1264 --1802
NM_178152chrX167770 7351 7157 7050 5258 2655 2505 2378 1569 1341 945 873 580 543 242 81 26076 1264 --1802
NM_178153chrX167770 7351 7157 7050 5258 2655 2505 2378 1569 1341 945 873 580 543 242 81 26076 1264 --1802
NM_178509chr17104114 3964 3236 3039 2995 2578 1124 663 574 56 ------
NM_178539chr1251986 1588 1339 681 549 ------
NM_178585chr472556 2451 2322 2296 2040 476 359 11073 33122 2683 2544 --
NM_178812chr841546 1514 1423 1265 ------
NM_178815chr1092789 2072 1014 882 820 677 438 358 85 ------
NM_181054chr1421270 1124 ----1484
NM_181332chrX52743 2343 2110 817 482 151 1337 --
NM_181354chr851133 549 447 257 92 21586 1564 ----
NM_181358chr173758 3623 2978 2790 1690 1118 111 ----13138
NM_181361chr341398 1241 1111 372 ------
NM_181442chr203928 290 227 ----1372
NM_181443chr2042786 2477 1867 175 ----22549 1171
NM_181457chr251304 852 541 314 117 --11007 --
NM_181458chr261437 985 447 250 166 128 --11140 --
NM_181459chr231203 440 213 --1906 --
NM_181460chr241250 487 260 63 --1953 --
NM_181481chr18106729 5208 4517 4426 2796 2039 1673 1524 1201 981 16873 46216 4509 866 738 --
NM_181482chr18106729 5208 4517 4426 2796 2039 1673 1524 1201 981 16873 46216 4509 866 738 --
NM_181483chr18106729 5208 4517 4426 2796 2039 1673 1524 1201 981 16873 46216 4509 866 738 --
NM_181504chr573697 3408 2995 2764 1610 1189 651 ------
NM_181521chr16107240 7104 5957 4500 1618 1544 1392 878 501 372 --36819 2571 1333 --
NM_181523chr573697 3408 2995 2764 1610 1189 651 ------
NM_181524chr573697 3408 2995 2764 1610 1189 651 ------
NM_181670chr1241505 1459 1290 1268 --11247 --
NM_181672chrX21319 715 174 11724 11356
NM_181673chrX21319 715 174 11724 11356
NM_181701chr941539 1447 671 172 ------
NM_181705chr585365 4752 4583 4126 3535 2169 1869 870 --44979 4414 3910 1933 --
NM_181723chr83663 316 61 31910 1626 606 ----
NM_181782chr621890 27 32008 683 368 22310 1631 --
NM_181794chr63281 118 100 ----1872
NM_181795chr63281 118 100 ----1872
NM_181838chr531279 1110 557 --21347 200 --
NM_181886chr451412 1229 1119 423 409 --1344 --
NM_181887chr451412 1229 1119 423 409 --1344 --
NM_181888chr451412 1229 1119 423 409 --1344 --
NM_181889chr451412 1229 1119 423 409 --1344 --
NM_181890chr451412 1229 1119 423 409 --1344 --
NM_181891chr451412 1229 1119 423 409 --1344 --
NM_181892chr451459 1276 1166 470 456 --1391 --
NM_181893chr451412 1229 1119 423 409 --1344 --
NM_182493chr16155289 4849 4450 3998 3902 3746 3361 2001 1718 1702 1522 1209 1146 981 528 --13399 --
NM_182607chrX5690 222 210 116 22 ----1199
NM_182715chr731174 307 58 21251 109 1490 --
NM_182757chr693181 2481 2422 1287 1267 1186 1007 875 150 1367 13148 --
NM_182762chr7115782 5177 4671 4431 4406 4261 2475 2010 1473 871 434 --21391 560 --
NM_182763chr131734 597 138 ------
NM_182767chr1262084 1933 1846 1787 1514 134 21769 805 11688 --
NM_182898chr7136411 5964 5651 5543 4523 4290 2397 2322 2088 2079 1657 1412 995 15215 --16592
NM_182899chr7136411 5964 5651 5543 4523 4290 2397 2322 2088 2079 1657 1412 995 15215 --16592
NM_182918chr2121306 502 ----1402
NM_182948chr122342 113 22710 1024 2789 408 --
NM_182964chr1172688 2221 2020 1189 1126 771 375 13048 22325 1270 --
NM_183004chr1473740 2879 2763 585 445 103 73 ------
NM_183416chr151944 819 807 458 161 ------
NM_194247chr263863 3485 3249 3169 1743 389 23232 1364 11689 --
NM_194278chr1463745 3111 2572 1591 879 418 --23286 3248 --
NM_194285chr1162734 2454 2356 2110 852 461 --12798 --
NM_194291chr872755 2409 830 675 330 240 69 ------
NM_194314chr164380 3479 1917 1599 1028 458 23744 840 --14393
NM_194328chr932180 900 877 13149 2512 255 --
NM_194329chr932180 900 877 13149 2512 255 --
NM_194330chr932180 900 877 13149 2512 255 --
NM_194332chr932180 900 877 13149 2512 255 --
NM_194434chr1875182 4790 4093 3892 3524 1799 888 1578 15209 --
NM_197941chr562957 2383 2347 1882 300 156 ----12174
NM_198123chr821558 1492 --11288 11111
NM_198124chr821558 1492 --11288 11111
NM_198128chr1842295 2255 538 405 --31903 1855 1807 --
NM_198196chr392404 2317 2152 1891 1830 916 464 380 147 ------
NM_198268chr173758 3623 2978 2790 1690 1118 111 ----13138
NM_198269chr173758 3623 2978 2790 1690 1118 111 ----13138
NM_198270chrX43349 1087 897 876 12974 22230 626 --
NM_198273chr542331 2310 866 71 --13163 --
NM_198281chr483027 2764 2630 2556 2151 1369 1078 545 ------
NM_198391chr2061489 1329 1271 1182 986 571 ------
NM_198569chr652609 1659 597 410 220 ------
NM_198581chr2107377 7173 2708 2209 1647 1418 973 552 365 273 32159 1156 782 ----
NM_198715chr186205 5598 5086 4573 1361 954 869 563 --11741 --
NM_198793chr364144 3546 3062 1482 1033 635 1887 ----
NM_198830chr171162 1668 2231 149 --
NM_198859chr385166 4818 4684 4437 4176 3966 1712 936 --13752 --
NM_198889chr441162 1045 1025 435 21054 950 ----
NM_198896chr1142001 1475 326 271 21927 229 ----
NM_198900chr12126483 5873 5552 5374 5211 4894 4888 3147 2158 1486 1314 866 ------
NM_198904chr532030 812 415 11895 12121 --
NM_198935chr2062876 2833 2730 2537 924 379 12845 12597 --
NM_198947chr114790 334 146 35 ------
NM_198968chr13133768 3686 3583 3463 3325 3191 2800 2731 346 243 187 161 35 1613 23249 912 --
NM_198990chr753035 2567 2502 2101 582 --1182 12615
NM_199000chr751975 783 405 326 79 1755 ----
NM_199044chr152211 975 632 474 328 22947 2086 12651 --
NM_199072chr73855 515 96 33169 2639 1222 ----
NM_199188chr1234080 1285 1249 23392 210 12596 --
NM_199189chr54991 759 381 348 ------
NM_199190chr1234080 1285 1249 23392 210 12596 --
NM_199324chr443019 1140 565 27 11382 13228 --
NM_199421chr1454325 3925 3661 1573 1257 --14533 11906
NM_199436chr222043 736 1668 --1287
NM_199462chr164592 4210 3152 1784 1360 1182 13291 23314 785 --
NM_201280chr621361 1111 3611 254 105 11175 --
NM_201591chr431882 1636 627 --1281 --
NM_201592chr431882 1636 627 --1281 --
NM_201999chr451159 1040 916 832 410 --1311 --
NM_203327chr2064126 3690 3358 1738 1421 714 --44479 2952 1026 661 --
NM_203382chr561628 1458 1197 1166 1155 456 ------
NM_203391chrX41397 495 278 60 1727 ----
NM_203394chr1241958 1735 905 354 ------
NM_203406chr552427 2400 1986 937 468 22593 2281 ----
NM_203446chr2142931 2551 2156 213 --11987 --
NM_203459chr152017 1879 641 579 87 11678 ----
NM_203504chr462645 2339 1812 797 502 445 ------
NM_203505chr462645 2339 1812 797 502 445 ------
NM_205860chr193149 2770 2419 2331 2264 1996 954 510 296 ----12585
NM_206594chr183667 3527 3125 2884 1196 769 108 96 33215 2747 701 1678 --
NM_206595chr183667 3527 3125 2884 1196 769 108 96 33215 2747 701 1678 --
NM_206853chr633109 1359 567 --12793 --
NM_206854chr684370 3319 1828 1252 1076 667 594 487 --24054 200 --
NM_206855chr695335 4284 4196 2217 2041 1632 1559 1452 230 --25019 1165 --
NM_206866chr2173123 2661 2463 2417 1258 834 90 1320 22262 873 --
NM_206876chr232587 1343 209 13263 ----
NM_207012chr1083524 3028 2765 1264 1218 906 348 130 --13092 --
NM_207015chr382405 2328 2274 1726 1580 921 675 449 ------
NM_207299chr92749 227 1849 1726 --
NM_207303chr1064014 1632 1085 1067 982 769 1810 34146 2914 243 --
NM_207304chr1372513 2396 2110 1935 1026 746 566 1406 12369 --
NM_207325chr1971919 1711 1645 1615 1391 525 315 ------
NM_207366chr792300 2175 2159 1785 1679 1471 550 527 181 --11656 --
NM_207404chr362271 2150 1758 906 698 639 ------
NM_207406chr4126434 6121 5404 4817 4740 4711 4597 2624 2431 2002 1874 559 11428 25766 1688 --
NM_207445chr1571504 1423 1313 749 612 356 196 11605 ----
NM_207517chr1531955 1767 420 11730 ----
NM_212554chr1061620 1594 1584 1531 74 28 --21469 479 --
NM_212558chr964022 3729 3334 875 791 666 23491 2825 ----
NM_213606chr1032391 1803 863 22251 134 11865 --
NM_213651chr141609 1541 682 43 --11309 --
NM_213654chr331514 530 24 --1275 --