TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4786-3p
miRNA Sequence: UGAAGCCAGCUCUGGUCUGGGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr83462 380 354 1227 ----
NM_000044chrX1161 ------
NM_000051chr1153441 2263 1159 812 135 11063 12620 11152
NM_000063chr6----1311 --
NM_000084chrX126929 5555 5091 4679 4627 2611 2351 2135 949 444 257 202 25610 4297 15880 --
NM_000088chr17--11253 11144 --
NM_000089chr71824 --1325 --
NM_000090chr2--1668 ----
NM_000092chr223899 397 13703 --1259
NM_000093chr921947 102 12400 1626 --
NM_000108chr721409 417 --11481 --
NM_000109chrX42116 1950 1922 118 --1558 --
NM_000110chr121107 796 ------
NM_000112chr555098 4573 1615 458 217 25549 211 15122 --
NM_000125chr643318 1716 1421 1392 --2695 122 --
NM_000138chr1531760 1024 199 --22412 929 --
NM_000141chr101203 --11117 --
NM_000158chr31142 ------
NM_000163chr522105 655 11699 1361 --
NM_000165chr621067 293 11204 ----
NM_000167chrX2203 152 ------
NM_000168chr732327 2050 686 --22427 481 23002 2309
NM_000176chr543316 2644 520 149 ------
NM_000188chr101233 ------
NM_000189chr221752 1566 11994 32238 2158 100 --
NM_000208chr1964040 828 502 493 221 57 1257 14306 --
NM_000214chr2041664 1568 392 134 ------
NM_000217chr1274737 4682 4298 3965 3309 2028 262 --2798 347 --
NM_000222chr441916 730 607 303 --31942 1587 53 --
NM_000230chr711143 --157 1710
NM_000237chr8--21867 685 --11699
NM_000245chr731470 337 47 ----1715
NM_000248chr353080 2536 2464 1186 1033 ----1881
NM_000252chrX11235 --1994 --
NM_000264chr931242 433 241 --1573 --
NM_000266chrX2929 280 --123 --
NM_000286chr17------164
NM_000289chr121103 ------
NM_000310chr121231 872 ----1832
NM_000314chr1022253 459 12981 ----
NM_000330chrX32268 1796 649 11837 22110 413 --
NM_000332chr676501 4690 4545 2659 2594 1315 114 46567 6151 5982 273 44882 2846 1882 864 --
NM_000337chr532007 1590 857 24314 224 --45800 5653 4133 53
NM_000338chr1521102 274 ------
NM_000346chr1721886 712 ------
NM_000362chr2243651 3394 1297 205 --13202 --
NM_000368chr964430 4291 4044 1893 1645 446 --24200 1403 --
NM_000378chr11----1440 1860
NM_000390chrX11120 ------
NM_000391chr1131109 290 26 ------
NM_000393chr221698 1563 ------
NM_000399chr1031176 471 123 ------
NM_000406chr433049 1053 270 11932 32682 2519 1227 1539
NM_000408chr21766 --12712 --
NM_000427chr1----1178 --
NM_000428chr1422573 111 1739 ----
NM_000430chr1742827 2624 2590 416 ----13017
NM_000448chr1192863 2311 2079 1296 485 376 189 66 27 2998 101 13102 --
NM_000449chr12339 307 1197 ----
NM_000452chr1321438 1366 --11928 1142
NM_000459chr9------1241
NM_000461chr331670 785 611 --34070 745 446 --
NM_000489chrX1485 --11079 --
NM_000522chr71873 ------
NM_000523chr22427 216 ------
NM_000525chr1131302 1077 629 ------
NM_000530chr11969 --2756 378 --
NM_000533chrX11548 --1795 11625
NM_000544chr6_cox_hap143186 2372 2338 981 12261 ----
NM_000555chrX57682 7556 5245 4863 1605 15114 25484 1907 15255
NM_000586chr4187 ----1183
NM_000598chr721534 993 1419 1171 --
NM_000599chr253933 3902 2796 494 233 13799 13741 --
NM_000600chr71393 ------
NM_000601chr7----1347 --
NM_000610chr1142951 2095 1011 978 --22638 291 --
NM_000615chr1132288 1102 963 --12215 --
NM_000617chr12158 --12306 --
NM_000618chr1244858 4205 1623 401 --24697 1178 --
NM_000618chr1244858 4205 1623 401 --24697 1178 --
NM_000620chr1222034 138 11711 2156 124 --
NM_000633chr1834893 2103 1509 11389 1450 --
NM_000693chr1521763 518 31730 647 117 --11491
NM_000719chr1294656 1671 1285 1025 882 763 716 306 24 15647 32172 2133 911 --
NM_000721chr122676 517 --1292 11652
NM_000738chr112280 211 --1110 --
NM_000767chr191967 1413 ----
NM_000793chr1464658 3883 3717 1385 955 96 ------
NM_000801chr2031126 740 308 --1989 --
NM_000806chr5--11519 ----
NM_000807chr4150 ------
NM_000809chr4138965 8417 8182 6419 3676 3549 3310 3142 2119 1501 1275 1166 984 36866 6245 5895 47045 6603 5786 2227 --
NM_000813chr554211 4042 1352 1230 199 14236 1515 --
NM_000814chr1543600 3475 607 549 23224 1433 1557 --
NM_000826chr41205 1666 22587 587 --
NM_000827chr521676 399 --22433 1789 --
NM_000829chr111928 ------
NM_000831chr146290 5707 1692 214 36159 5050 188 ----
NM_000833chr1611108 1157 1402 --
NM_000836chr191265 ------
NM_000839chr31459 ----1491
NM_000841chr62966 122 ------
NM_000855chr111226 ------
NM_000870chr541484 399 147 108 --11285 --
NM_000875chr1597061 6396 6181 6107 5632 4654 2349 1008 843 15114 14471 15354
NM_000891chr1733535 2610 1066 ----1142
NM_000895chr12----1107 --
NM_000899chr1222779 1371 --13364 13692
NM_000901chr442430 2171 644 401 --11697 1673
NM_000921chr122624 442 ------
NM_000924chr121318 --11351 --
NM_000926chr1199392 8607 8282 8038 7956 7881 7784 7341 1985 15740 12374 12499
NM_000944chr431651 816 650 --11777 --
NM_000945chr242005 1745 1725 1415 --1267 1377
NM_000950chrX43566 3284 3048 2992 22252 1426 23009 486 --
NM_000956chr142968 309 ------
NM_000958chr511297 --1137 --
NM_000964chr1731373 510 46 ------
NM_000983chr171570 1407 1221 447 369 127 66 --11105 --
NM_001001132chr212537 404 11443 1273 --
NM_001001323chr1222290 1077 --22571 2278 13032
NM_001001330chr1021246 1186 ------
NM_001001331chr352569 2430 1076 843 366 ------
NM_001001344chrX32443 2178 423 ------
NM_001001389chr1142951 2095 1011 978 --22638 291 --
NM_001001390chr1142951 2095 1011 978 --22638 291 --
NM_001001391chr1142951 2095 1011 978 --22638 291 --
NM_001001392chr1142997 2141 1057 1024 --22684 337 --
NM_001001394chr22685 612 ------
NM_001001395chr1242181 2070 996 753 1982 1800 --
NM_001001419chr574357 4009 3959 3264 2085 1954 1008 --11760 --
NM_001001420chr574357 4009 3959 3264 2085 1954 1008 --11760 --
NM_001001433chr2042549 2386 2019 424 --23028 1291 --
NM_001001481chr842745 2521 2318 768 1781 ----
NM_001001484chr10----21665 623 --
NM_001001520chr191184 ------
NM_001001549chr732127 1080 283 11866 ----
NM_001001550chr732127 1080 283 11866 ----
NM_001001555chr732127 1080 283 11866 ----
NM_001001556chr1521235 198 --21133 406 --
NM_001001557chr82492 360 --1332 --
NM_001001560chr222609 517 ------
NM_001001664chr253451 2839 2669 1018 164 ----12695
NM_001001852chr221176 ------
NM_001001890chr2173985 3263 3117 2995 2967 1515 541 ------
NM_001001928chr2258348 2652 2583 1926 1453 13022 12732 --
NM_001001974chr10291 60 --11900 --
NM_001001995chrX21803 1323 1203 ----
NM_001002032chr17157 ------
NM_001002243chr21793 ------
NM_001002257chr283449 3361 2676 2389 992 970 759 270 ------
NM_001002259chr12190 ------
NM_001002265chr101803 --1128 --
NM_001002266chr101803 --1128 --
NM_001002838chrX21543 1239 ----11267
NM_001002843chr1521030 272 1483 ----
NM_001002860chr1474715 3809 3417 3289 3281 1665 1450 31270 613 108 ----
NM_001002876chr221404 --1165 --
NM_001003652chr18138458 7382 6246 5899 5776 3117 3045 2837 1656 1377 1112 905 656 18445 --16142
NM_001003678chr11--190 ----
NM_001003679chr121532 627 --1275 --
NM_001003681chr2242076 1426 546 49 11306 ----
NM_001003688chr421110 486 1990 ----
NM_001003694chr31606 ------
NM_001003698chr62613 67 ----1626
NM_001003699chr62613 67 ----1626
NM_001003712chr1234066 1567 71 --11043 13423
NM_001003760chr612908 ----1151
NM_001003792chr31846 --172 --
NM_001003793chr31846 --172 --
NM_001003800chr92894 676 --1479 --
NM_001003810chr41331 ------
NM_001003940chr1582850 2720 2713 2483 1426 497 484 356 --21092 1007 13803
NM_001003942chr1582850 2720 2713 2483 1426 497 484 356 --21092 1007 13803
NM_001003943chr1582854 2724 2717 2487 1430 501 488 360 --21096 1011 13807
NM_001004065chr933936 3890 248 --13384 22715 1403
NM_001004106chr51240 ------
NM_001004127chr132686 178 --1249 --
NM_001004304chr1233269 2957 2164 --22427 601 --
NM_001004308chrX1451 --11486 --
NM_001004317chr674050 3354 3108 1412 1018 820 311 ----14146
NM_001004342chr185599 4837 4455 4262 3937 3745 1895 1311 35467 5231 301 25270 641 14522
NM_001004360chr231964 1739 1507 --1232 --
NM_001004419chr1231635 857 844 ------
NM_001004439chr151176 --1112 --
NM_001005266chr152756 195 --1618 --
NM_001005267chr152756 195 --1618 --
NM_001005268chr152756 195 --1618 --
NM_001005269chr152756 195 --1618 --
NM_001005375chrY1128 11537 21392 1369 --
NM_001005386chr232376 759 284 ------
NM_001005404chr1733920 3345 828 --33237 1097 220 --
NM_001005463chr1022451 1933 11908 12289 --
NM_001005473chr522418 1756 14675 16169 --
NM_001005505chr311820 --21360 405 --
NM_001005609chrX33822 3693 644 12944 11486 11275
NM_001005739chr22579 264 ------
NM_001005743chr1441150 1070 897 437 ------
NM_001005744chr1441150 1070 897 437 ------
NM_001005745chr1441150 1070 897 437 ------
NM_001005751chr102209 157 ------
NM_001005781chr2------1101
NM_001005861chr32965 741 ------
NM_001005910chr31455 ------
NM_001005911chr31455 ------
NM_001006600chr5----1478 --
NM_001006610chr162917 850 ------
NM_001006612chrX1114 ------
NM_001006613chrX1114 ------
NM_001006614chrX1114 ------
NM_001006617chr9----1218 --
NM_001006618chr9----1232 --
NM_001006619chr9----1218 --
NM_001006620chr9----1218 --
NM_001006621chr9----1218 --
NM_001006624chr111975 11659 ----
NM_001007023chr1464658 3883 3717 1385 955 96 ------
NM_001007024chr1743595 2874 2691 366 --13730 12763
NM_001007025chr1743595 2874 2691 366 --13730 12763
NM_001007067chr821068 203 ------
NM_001007068chr821068 203 ------
NM_001007069chr821068 203 ------
NM_001007070chr821068 203 ------
NM_001007156chr1511579 ----11777
NM_001007226chr1711376 ------
NM_001007227chr1711376 ------
NM_001007228chr1711376 ------
NM_001007229chr1711376 ------
NM_001007230chr1711376 ------
NM_001007246chr2131926 1666 774 ------
NM_001007257chr1--1399 ----
NM_001007277chr11----11116 --
NM_001007466chr665108 5087 4959 4927 4492 4263 --14518 --
NM_001007538chr1341475 1449 1226 1204 1610 --1117
NM_001007546chr211236 ------
NM_001007553chr121057 825 ------
NM_001007559chr1841810 1428 795 160 1177 ----
NM_001007565chr3----1331 --
NM_001007793chr10----121 --
NM_001008239chr1853051 2788 1325 1294 809 1340 --12602
NM_001008408chr765115 4880 4583 4230 4096 4019 15334 35605 4128 1018 15637
NM_001008495chr842176 1758 847 459 ----1746
NM_001008528chr171661 --1222 --
NM_001008529chr1741302 1268 880 93 ------
NM_001008540chr21435 ------
NM_001008541chr10------11971
NM_001008541chr10------11971
NM_001008564chr13----11876 --
NM_001008566chr221427 --1333 --
NM_001008701chr1952093 2046 1016 584 199 1359 52826 2816 2736 2573 2152 --
NM_001008703chr6143 ------
NM_001008704chr6143 ------
NM_001008708chr21409 ------
NM_001008726chr1441578 1422 1194 144 --11526 1263
NM_001008895chr1331264 969 335 ------
NM_001009552chr8----148 --
NM_001009554chr474180 4036 3779 3118 1569 1466 500 --32949 1258 977 --
NM_001009554chr474180 4036 3779 3118 1569 1466 500 --32949 1258 977 --
NM_001009565chr21437 ------
NM_001009566chr121410 26 ------
NM_001009880chr2254275 4248 3832 3263 1301 13905 34618 894 559 --
NM_001009899chr366272 5098 4706 3960 576 563 22168 1522 14591 --
NM_001009909chr1121183 258 22573 1063 13326 --
NM_001009960chr732814 2461 2198 2631 42 12272 --
NM_001010852chr62143 49 ------
NM_001010853chr632307 2148 1233 ------
NM_001010854chr141503 ------
NM_001010861chr132047 869 729 ----11073
NM_001010867chr146334 4764 2579 440 --31743 805 119 1892
NM_001010888chrX44314 3366 1799 995 ----1605
NM_001010891chr525486 437 25274 2693 26436 423 15704
NM_001010895chr91102 --11996 --
NM_001010898chr12927 885 --12945 1626
NM_001010923chr621640 490 ------
NM_001010924chr1031107 1024 796 ------
NM_001010927chr61425 ------
NM_001010932chr7----1347 --
NM_001010971chr13742 277 211 ------
NM_001010986chrX1786 --11977 1225
NM_001010989chr162199 31 ------
NM_001010990chr162199 31 ------
NM_001011513chr423261 1662 --13927 1168
NM_001011537chr321852 1522 12384 ----
NM_001011538chr41676 ------
NM_001011551chrX1172 ------
NM_001011553chr71308 ------
NM_001011645chrX1161 ------
NM_001011666chr764946 2340 2125 1171 1020 889 14189 22355 122 1297
NM_001011713chr1411452 ------
NM_001011885chr152712 430 ------
NM_001012267chr91219 ----11527
NM_001012393chr1143875 1512 1303 89 23648 3431 21732 1393 --
NM_001012398chr16------1360
NM_001012420chr152475 335 --1185 12003
NM_001012423chr152475 335 --1185 12003
NM_001012426chr612736 --11042 --
NM_001012427chr612736 --11042 --
NM_001012478chr192507 43 ------
NM_001012751chr1021908 1358 ------
NM_001012761chr522509 22 --21927 932 --
NM_001012968chrX32661 2650 1749 ----12769
NM_001012980chrX2158 39 170 ----
NM_001013398chr721534 993 1419 1171 --
NM_001013399chr611109 1897 ----
NM_001013415chr441560 1394 1345 127 1235 ----
NM_001013438chr32764 755 ------
NM_001013439chr32610 601 ------
NM_001013622chr481202 872 376 314 252 190 129 67 1438 ----
NM_001013635chr12145 11003 ----
NM_001013693chr111009 --1924 --
NM_001013693chr111009 --1924 --
NM_001013699chr122411 54 ------
NM_001013843chr151315 ------
NM_001014431chr14179 ------
NM_001014432chr14179 ------
NM_001014435chr163148 84 51 ------
NM_001014797chr1068026 7948 7404 6080 5136 2775 --27317 2041 18220
NM_001014839chr1----1132 1880
NM_001014841chr1----1132 1880
NM_001015053chr1711161 129 1161 1378
NM_001015877chrX21965 1006 ----13042
NM_001015881chrX--11006 11120 --
NM_001015887chr311272 --11551 --
NM_001017369chr41956 --1300 --
NM_001017371chr21313 1486 ----
NM_001017395chr373198 3008 2838 2734 2407 1113 318 --32544 820 528 --
NM_001017405chr41957 1166 ----
NM_001017424chr1----1522 --
NM_001017425chr1----1522 --
NM_001017440chr746567 5658 487 224 11790 86038 5755 5361 3298 2328 825 678 505 16561
NM_001017916chr1721432 251 --31598 809 633 --
NM_001017917chr1721432 251 --31598 809 633 --
NM_001017923chr142507 62 ------
NM_001017926chr8----21439 1427 1617
NM_001017928chr3195 ------
NM_001017969chr91177 1236 ----
NM_001017977chr12145 103 ------
NM_001017995chr564704 3764 3005 2933 744 378 --14173 44856 1113 465 47
NM_001017999chr132289 314 289 11599 ----
NM_001017999chr132289 314 289 11599 ----
NM_001018000chr132289 314 289 11599 ----
NM_001018000chr132289 314 289 11599 ----
NM_001018001chr132289 314 289 11599 ----
NM_001018054chr151439 1335 897 380 85 --1906 --
NM_001018057chr113365 128 89 1185 1308 --
NM_001018064chr931982 1695 578 --1327 11546
NM_001018065chr914787 --22332 370 --
NM_001018066chr914787 --22332 370 --
NM_001018067chr155035 3846 661 430 408 ------
NM_001018068chr155035 3846 661 430 408 ------
NM_001018069chr155035 3846 661 430 408 ------
NM_001018074chr543316 2644 520 149 ------
NM_001018075chr543316 2644 520 149 ------
NM_001018076chr543316 2644 520 149 ------
NM_001018077chr543316 2644 520 149 ------
NM_001018108chr1561964 1733 820 800 718 289 ------
NM_001020658chr121210 348 1586 ----
NM_001020658chr121210 348 1586 ----
NM_001020825chr51119 ------
NM_001023567chr152823 335 ------
NM_001023587chr31141 192 ----
NM_001024024chr141164 ------
NM_001024070chr141160 ------
NM_001024094chr543316 2644 520 149 ------
NM_001024226chr13386 162 101 ----1352
NM_001024227chr13386 162 101 ----1352
NM_001024228chr13386 162 101 ----1352
NM_001024372chr811822 --21994 594 --
NM_001024649chr531832 794 333 ----1727
NM_001024660chr32429 194 1501 1365 125
NM_001024688chr831785 1672 193 ----1580
NM_001024808chr1262830 2675 1792 603 498 381 --1889 --
NM_001024809chr1731373 510 46 ------
NM_001024847chr322227 414 1986 ----
NM_001024937chr173109 94 61 ------
NM_001024948chr163173 2791 2399 1301 1233 1127 12233 2539 425 --
NM_001025076chr1054335 2025 976 862 708 --1446 26227 813
NM_001025077chr1085693 4977 4865 4773 2334 2220 2066 1006 11235 11804 27585 2171
NM_001025079chr313140 --1416 --
NM_001025105chr521225 1003 --1509 --
NM_001025108chr252730 2721 1637 1150 276 ------
NM_001025201chr21650 --2708 513 --
NM_001025203chr211119 ------
NM_001025204chr211119 ------
NM_001025266chr354374 3965 1772 1124 582 34712 4014 3907 24273 878 13701
NM_001025366chr6135 11533 ----
NM_001025366chr6135 11533 ----
NM_001025367chr6135 11533 ----
NM_001025367chr6135 11533 ----
NM_001025368chr6135 11533 ----
NM_001025368chr6135 11533 ----
NM_001025369chr6151 11549 ----
NM_001025369chr6151 11549 ----
NM_001025370chr6135 11533 ----
NM_001025370chr6135 11533 ----
NM_001025579chr1711069 ----1314
NM_001025580chrX33682 3072 303 11096 --14191
NM_001025595chr451249 1104 1037 644 177 --11480 --
NM_001025596chr111463 ------
NM_001025603chr12339 307 1197 ----
NM_001029858chr653153 2594 2229 2201 1074 --2771 535 --
NM_001029875chr522656 92 ------
NM_001029882chr1----147 --
NM_001029882chr1----147 --
NM_001029989chr15----2611 200 --
NM_001030006chr1742344 2153 1054 259 --1285 --
NM_001030007chr1653609 3313 3071 2870 1083 ----23586 1599
NM_001030055chr1424249 3565 --11149 --
NM_001030059chr10177 ------
NM_001031679chr1232927 2582 2335 12417 1284 --
NM_001031685chr12929 780 ------
NM_001031690chr71270 13059 1591 --
NM_001031695chr2265177 4548 4047 2142 2066 821 --15382 --
NM_001031700chr462377 2286 2047 998 551 51 ----12063
NM_001031702chr33344 83 27 1145 --1190
NM_001031710chr7188 ------
NM_001031711chr52455 361 --1409 --
NM_001031712chr61385 ------
NM_001031716chr23143 126 108 ------
NM_001031717chr32717 279 2896 174 ----
NM_001031723chr4------165
NM_001031732chr432940 681 453 --22795 2590 --
NM_001031804chr1652940 2690 1465 1400 1039 --11431 --
NM_001032280chr611049 ------
NM_001032282chr82897 167 2263 200 --1381
NM_001032283chr121998 1254 ----
NM_001032284chr121998 1254 ----
NM_001032288chr2021214 1123 1462 1523 --
NM_001032289chrX2907 202 ------
NM_001032293chr17--191 1221 --
NM_001032296chr1322771 2664 --12357 --
NM_001032380chr1021992 113 ------
NM_001032393chrX2700 577 ------
NM_001032394chr61269 --32633 2147 1839 --
NM_001032395chr61136 --32500 2014 1706 --
NM_001032999chr2075234 5179 4478 4449 1667 1372 250 23782 1555 25089 242 --
NM_001033044chr161811 1805 1391 1152 699 535 --1505 --
NM_001033047chr422627 2046 ------
NM_001033049chr2142152 1922 401 323 ------
NM_001033056chr161811 1805 1391 1152 699 535 --1505 --
NM_001033057chr321767 1296 ------
NM_001033059chr651826 1610 1403 372 315 ------
NM_001033087chr2052916 2689 408 377 300 --13128 --
NM_001033112chr51214 --1790 --
NM_001033117chr374882 4631 4587 3880 3715 1588 1140 --34692 288 70 --
NM_001033506chr111106 ------
NM_001033507chr131897 1279 1261 ----172
NM_001033518chr732018 1839 920 --1194 147
NM_001033519chr732018 1839 920 --1194 147
NM_001033520chr732018 1839 920 --1194 147
NM_001033557chr211360 ------
NM_001033578chr832211 2088 1941 --1404 --
NM_001033756chr6--11467 ----
NM_001033756chr6--11467 ----
NM_001034845chr451433 1416 1054 1005 112 ------
NM_001034852chr1432038 1316 1272 11281 --1170
NM_001034954chr1033002 1098 864 1388 1791 --
NM_001034955chr1033002 1098 864 1388 1791 --
NM_001034956chr1033002 1098 864 1388 1791 --
NM_001034957chr1033002 1098 864 1388 1791 --
NM_001035254chr942575 1902 1043 925 --1429 --
NM_001035260chr1011284 ------
NM_001035511chr151858 1401 328 299 182 --21652 254 11386
NM_001035512chr151965 1508 435 406 289 --21759 361 11493
NM_001035513chr151965 1508 435 406 289 --21759 361 11493
NM_001037131chr221293 1069 ------
NM_001037132chr732126 640 363 --11475 --
NM_001037133chr732126 640 363 --11475 --
NM_001037164chr72388 83 --11427 --
NM_001037174chr242060 1724 781 79 --11847 --
NM_001037317chr132047 869 729 ----11073
NM_001037332chr522202 556 --21823 192 --
NM_001037333chr522202 556 --21823 192 --
NM_001037334chr181558 --1669 --
NM_001037339chr131286 1181 263 --11418 --
NM_001037340chr131286 1181 263 --11418 --
NM_001037341chr131286 1181 263 --11418 --
NM_001037341chr131286 1181 263 --11418 --
NM_001037535chrX--11177 11059 --
NM_001037536chrX--11177 11059 --
NM_001037540chrX--11177 11059 --
NM_001037582chr41128 1398 153 --
NM_001037631chr241083 953 886 862 ------
NM_001037954chr1113444 --12139 --
NM_001038493chr2--11182 ----
NM_001039029chr1231991 1379 300 ------
NM_001039091chrX11355 --1917 --
NM_001039199chr2064743 4544 3809 3070 1773 916 --24906 1127 23416 3274
NM_001039348chr21951 ------
NM_001039349chr21951 ------
NM_001039350chr721507 618 ------
NM_001039457chr1149 ------
NM_001039479chr1432034 1776 787 ------
NM_001039538chr233566 3289 1133 ----22724 215
NM_001039547chr346616 5941 2907 38 16878 27220 3156 --
NM_001039550chr2----1691 --
NM_001039570chr2254276 4059 3232 3082 677 34490 4233 4028 --11145
NM_001039571chr2254276 4059 3232 3082 677 34490 4233 4028 --11145
NM_001039574chr11276 ------
NM_001039577chr164198 4060 1464 1439 1330 985 ------
NM_001039580chr443133 1591 993 558 11176 ----
NM_001039590chrX23055 1497 ----23667 663
NM_001039591chrX23055 1497 ----23667 663
NM_001039618chr1155590 4364 4163 3941 1464 25109 1090 44238 4034 3889 1655 --
NM_001039690chr1632363 883 647 --21604 286 1239
NM_001039709chr2075234 5179 4478 4449 1667 1372 250 23782 1555 25089 242 --
NM_001039711chr12846 191 ----1367
NM_001039712chr12846 191 ----1367
NM_001039762chr10--11893 ----
NM_001039775chr1135 ------
NM_001039840chrX64560 2086 602 492 436 145 ------
NM_001039916chr123764 469 134 ------
NM_001039917chr123764 469 134 ------
NM_001039918chr123764 469 134 ------
NM_001039919chr123764 469 134 ------
NM_001039920chr123764 469 134 ------
NM_001039937chr1353313 2900 1243 539 178 --22635 838 --
NM_001039960chr121503 --11121 --
NM_001040057chr71503 11086 ----
NM_001040135chr71751 ------
NM_001040142chr232209 1721 212 ------
NM_001040143chr232209 1721 212 ------
NM_001040144chr1632363 883 647 --21604 286 1239
NM_001040146chr1632363 883 647 --21604 286 1239
NM_001040152chr731930 1694 1614 --11968 13888
NM_001040153chr13--1726 ----
NM_001040157chr42876 348 --12517 --
NM_001040158chr51136 --2424 142 --
NM_001040159chr411295 --11376 --
NM_001040172chr541484 399 147 108 --11285 --
NM_001040173chr541484 399 147 108 --11285 --
NM_001040181chr31184 ------
NM_001040182chr31184 ------
NM_001040183chr31184 ------
NM_001040197chr11507 --122 --
NM_001040199chr31184 ------
NM_001040200chr31184 ------
NM_001040202chr432343 1690 1027 ------
NM_001040214chr61919 11964 ----
NM_001040284chr1645960 4909 4360 1361 --33949 1621 1060 24673 314
NM_001040402chr453185 2871 1042 928 886 13194 --23250 2779
NM_001040409chr22836 103 --1744 --
NM_001040429chr1332315 475 121 --22921 195 --
NM_001040439chr1621435 1306 ------
NM_001040440chr52418 156 --1614 --
NM_001040441chr134372 3579 227 ------
NM_001040624chr832760 2560 372 ------
NM_001040625chr832760 2560 372 ------
NM_001040626chr832760 2560 372 ------
NM_001040627chr832760 2560 372 ------
NM_001040628chr832760 2560 372 ------
NM_001040629chr832760 2560 372 ------
NM_001040630chr832760 2560 372 ------
NM_001040708chr821015 152 ------
NM_001040709chr12462 60 1386 22346 178 --
NM_001040712chr923443 1206 --23334 390 --
NM_001040876chr431274 379 363 --1522 --
NM_001042355chr1685032 4547 1762 1342 752 621 440 221 ------
NM_001042357chr103170 118 89 --1555 --
NM_001042358chr103170 118 89 --1555 --
NM_001042360chr103170 118 89 --1555 --
NM_001042361chr103201 149 120 --1586 --
NM_001042363chr103170 118 89 --1555 --
NM_001042364chr103201 149 120 --1586 --
NM_001042365chr103201 149 120 --1586 --
NM_001042387chr103201 149 120 --1586 --
NM_001042388chr181359 ------
NM_001042389chr103170 118 89 --1555 --
NM_001042390chr103170 118 89 --1555 --
NM_001042392chr103170 118 89 --1555 --
NM_001042393chr103201 149 120 --1586 --
NM_001042395chr103170 118 89 --1555 --
NM_001042396chr103201 149 120 --1586 --
NM_001042397chr103201 149 120 --1586 --
NM_001042404chr11246 ------
NM_001042412chr1685032 4547 1762 1342 752 621 440 221 ------
NM_001042413chr93916 519 206 --13087 --
NM_001042414chr13186 ------
NM_001042424chr453286 2411 2381 2144 366 --21093 826 --
NM_001042425chr611049 ------
NM_001042453chrX11260 ------
NM_001042465chr103746 394 43 --1912 --
NM_001042466chr103746 394 43 --1912 --
NM_001042473chr1011406 ------
NM_001042486chr201510 --1158 --
NM_001042506chrX21122 295 ------
NM_001042537chrX32242 2205 927 --12358 1818
NM_001042555chr1264592 4053 3447 988 834 394 --34243 483 335 --
NM_001042599chr257685 6393 2370 1369 645 --25736 2693 1705
NM_001042601chr362938 881 818 802 480 243 --1659 --
NM_001042604chr324221 3196 --14089 24400 3019
NM_001042681chr162419 2383 2096 2090 1962 195 --1524 21809 291
NM_001042682chr162419 2383 2096 2090 1962 195 --1524 21809 291
NM_001042682chr162419 2383 2096 2090 1962 195 --1524 21809 291
NM_001042683chr621273 150 --11149 --
NM_001042749chrX21954 1462 --1259 --
NM_001042750chrX21954 1462 --1259 --
NM_001042751chrX21954 1462 --1259 --
NM_001043318chr1443795 2805 966 128 ------
NM_001043351chr111940 11588 ----
NM_001044385chr263110 2760 865 859 462 309 --24017 2486 --
NM_001046chr522806 1966 11861 11025 --
NM_001050chr1711227 --2102 74 --
NM_001068chr32214 86 ------
NM_001071775chr1321440 168 ------
NM_001078chr11600 ------
NM_001079874chr121918 193 ------
NM_001080418chr11576 --1406 --
NM_001083620chr4--1665 22585 586 --
NM_001083621chr184536 3350 2950 1764 1500 1477 1252 1094 14523 --1294
NM_001094chr173807 719 547 ------
NM_001095chr121464 11958 ----
NM_001099678chr325493 238 ------
NM_001100108chr165380 5198 3080 2488 1065 747 47139 6547 6403 5216 16684 --
NM_001106chr3108427 7498 6455 2691 2672 2653 2369 2318 1716 620 12948 43238 1729 1547 1388 16946
NM_001107chr14140 ------
NM_001109977chr41773 ------
NM_001128chr1653609 3313 3071 2870 1083 ----23586 1599
NM_001130chr192673 197 ------
NM_001146chr81775 1248 32304 1914 1754 --
NM_001148chr441811 1388 1369 838 ------
NM_001151chr4172 ------
NM_001159chr2----2321 229 --
NM_001163chr93990 277 114 ------
NM_001167chrX36657 6494 2455 25672 2047 35796 4600 767 --
NM_001173chr1424249 3565 --11149 --
NM_001177chr1221995 716 ------
NM_001186chr2132192 2150 552 1580 11272 --
NM_001187chr21--1446 ----
NM_001192chr16------1197
NM_001197chr22----1402 --
NM_001198chr642386 2292 566 73 1790 32340 976 120 --
NM_001200chr201785 ------
NM_001204chr246793 6215 4725 832 --17069 --
NM_001206chr91284 --12283 12839
NM_001212chr172227 41 ------
NM_001219chr711952 11456 --158
NM_001222chr1031721 1708 1299 --11415 --
NM_001237chr43325 213 152 --1824 --
NM_001237chr43325 213 152 --1824 --
NM_001241chr222033 951 --1457 --
NM_001241chr222033 951 --1457 --
NM_001256chr1722376 2203 --12178 --
NM_001257chr16----11264 --
NM_001259chr751664 1254 1009 905 52 13954 ----
NM_001261chr92234 210 --1436 --
NM_001262chr11322 --1258 --
NM_001265chr13--1259 1219 --
NM_001270chr51955 ------
NM_001271chr1563090 2221 2203 2072 1025 762 --12585 --
NM_001273chr121361 ------
NM_001277chr114891 409 300 103 ------
NM_001280chr19----1445 1698
NM_001282chr1742344 2153 1054 259 --1285 --
NM_001299chr191425 ------
NM_001304chr1763692 3208 3072 2459 901 564 --1577 1342
NM_001305chr7----2776 286 --
NM_001308chr10136 ------
NM_001316chr202172 56 --2202 37 --
NM_001319chr1911104 ------
NM_001326chr112389 338 ------
NM_001331chr1111934 --21061 921 --
NM_001332chr521108 387 1432 ----
NM_001343chr511485 ----1210
NM_001346chr33627 393 264 11883 22634 539 --
NM_001351chr331343 63 40 11511 ----
NM_001356chrX32516 516 203 12335 ----
NM_001357chr1----1279 --
NM_001362chr142697 258 ------
NM_001364chr1164761 3738 1783 265 218 79 --21547 1039 --
NM_001365chr171512 --1617 --
NM_001383chr17159 --1287 1189
NM_001386chr832253 2128 1708 ------
NM_001387chr533119 2920 1083 ------
NM_001389chr211536 ------
NM_001396chr2111067 ------
NM_001399chrX33822 3693 644 12944 11486 11275
NM_001400chr131314 1252 83 ------
NM_001401chr92383 322 ------
NM_001402chr631996 355 173 ----1794
NM_001406chr172381 70 --1482 --
NM_001408chr121537 1244 1512 11467 --
NM_001412chrX53701 2913 2476 1126 145 ----11387
NM_001418chr112620 566 1500 ----
NM_001418chr112620 566 1500 ----
NM_001419chr1944778 4038 3903 3096 --24579 1379 --
NM_001420chr1942878 2500 361 265 12970 ----
NM_001423chr1221987 503 ------
NM_001426chr2----1531 --
NM_001427chr71464 1277 11933 --
NM_001429chr222884 148 --1764 --
NM_001431chr61281 --1440 --
NM_001438chr1--33467 2958 2789 32464 2264 963 --
NM_001440chr842270 1013 540 311 --11987 --
NM_001448chrX2598 134 ------
NM_001452chr61546 ------
NM_001453chr621123 285 --11454 --
NM_001465chr552011 1727 1505 821 713 ------
NM_001482chr151140 ----1227
NM_001494chr101507 --2671 229 --
NM_001495chr81151 --21031 789 1503
NM_001497chr942643 640 368 232 --1138 --
NM_001498chr641311 516 251 144 ------
NM_001541chr112160 129 ------
NM_001609chr1031015 812 161 --1489 24344 952
NM_001614chr172642 268 ------
NM_001614chr172642 268 ------
NM_001616chr263076 3051 2404 2147 772 556 12703 ----
NM_001621chr732576 487 27 --22963 2319 --
NM_001621chr732576 487 27 --22963 2319 --
NM_001634chr651826 1610 1403 372 315 ------
NM_001642chr11----1430 --
NM_001650chr1843200 2811 2545 1319 --11012 --
NM_001655chr11--1545 31930 1645 1578 --
NM_001658chr13386 162 101 ----1352
NM_001660chr33621 186 107 ------
NM_001662chr73398 345 281 ------
NM_001663chr141437 --1220 --
NM_001664chr31666 1405 --1831
NM_001668chr131733 360 209 21961 454 11399 --
NM_001678chr171280 --21367 1305 --
NM_001679chr31289 ------
NM_001681chr12----1253 1762
NM_001682chr1222004 791 --22285 1992 12746
NM_001683chr352569 2430 1076 843 366 ------
NM_001690chr321989 390 1812 ----
NM_001695chr813737 --14082 --
NM_001699chr19--2605 311 ----
NM_001701chr921050 626 ------
NM_001709chr1132512 522 244 ----12432
NM_001714chr12----1197 --
NM_001723chr61226 ----1206
NM_001730chr13--11445 --1225
NM_001730chr13--11445 --1225
NM_001731chr121736 1607 --1267
NM_001740chr161508 ------
NM_001742chr72662 539 ------
NM_001743chr22220 86 ------
NM_001746chr531832 794 333 ----1727
NM_001753chr7----11699 --
NM_001754chr2173985 3263 3117 2995 2967 1515 541 ------
NM_001755chr1652120 1962 1887 1767 205 ------
NM_001759chr1295293 4823 4408 3901 3272 1938 1930 1678 1009 1685 24524 4268 --
NM_001773chr1----11226 11457
NM_001777chr313140 --1416 --
NM_001788chr71308 ------
NM_001789chr31564 11420 ----
NM_001792chr183928 121 21 2291 82 ----
NM_001799chr51184 ------
NM_001800chr192142 128 ------
NM_001806chr1952494 1172 369 191 35 12438 12905 --
NM_001810chr202620 599 ------
NM_001822chr21650 --2708 513 --
NM_001829chr42839 150 1655 ----
NM_001842chr9178 ------
NM_001845chr1321033 473 --11106 --
NM_001858chr634246 3608 3294 14750 ----
NM_001859chr953381 2470 1097 905 387 --11580 --
NM_001892chr521225 1003 --1509 --
NM_001893chr171401 ----167
NM_001895chr2011257 1937 ----
NM_001904chr31104 ------
NM_001915chr1721432 251 --31598 809 633 --
NM_001920chr121601 ------
NM_001923chr11143 2447 159 ----
NM_001924chr11361 ------
NM_001935chr21293 ------
NM_001936chr721507 618 ------
NM_001938chr111480 --11715 --
NM_001945chr521299 1031 ------
NM_001949chr642958 2475 1143 330 ------
NM_001962chr52597 575 --1233 --
NM_001964chr541142 878 802 750 ------
NM_001967chr3------1186
NM_001969chr1443245 1586 1460 98 11279 --1955
NM_001977chr411689 ------
NM_001982chr122428 145 ------
NM_001991chr1752228 1803 1547 810 711 12189 151 --
NM_001992chr512088 --1749 --
NM_001993chr11164 ------
NM_001995chr41933 --1597 --
NM_001999chr531479 1472 547 ------
NM_002006chr445517 3888 1431 285 --14570 1697
NM_002009chr151431 11896 1854 --
NM_002010chr131185 155 ----
NM_002014chr12------1135
NM_002015chr1373291 3021 2977 2599 2086 948 377 ------
NM_002017chr1121033 401 ------
NM_002023chr131119 58 50 --21262 69 --
NM_002024chrX11614 ------
NM_002025chrX89191 9046 5944 2988 2948 2149 2101 1059 --59253 9104 6964 6878 2954 29062 8848
NM_002026chr22856 280 ------
NM_002040chr2153114 2114 836 636 365 --21951 847 --
NM_002044chr1521235 198 --21133 406 --
NM_002056chr21803 ------
NM_002061chr111659 ------
NM_002063chrX31148 365 134 --1376 --
NM_002065chr161811 1805 1391 1152 699 535 --1505 --
NM_002069chr71733 --1362 --
NM_002074chr12588 418 --11514 --
NM_002080chr162924 375 1952 11010 --
NM_002082chr51203 ------
NM_002092chr453437 1230 747 503 289 34343 481 363 23926 738 21079 835
NM_002104chr51180 ------
NM_002106chr41318 ------
NM_002114chr6150 ------
NM_002126chr1733555 3407 2861 12683 125 --
NM_002128chr1312106 ------
NM_002130chr52426 294 ------
NM_002131chr62364 358 --21305 405 --
NM_002137chr7--21755 27 ----
NM_002138chr41331 ------
NM_002140chr91308 ------
NM_002148chr21629 ------
NM_002151chr191279 ------
NM_002156chr21171 ----1148
NM_002158chr243217 3210 139 132 ------
NM_002190chr611115 1256 11195 --
NM_002196chr201703 ------
NM_002196chr201703 ------
NM_002198chr5----1286 --
NM_002199chr4134 --142 --
NM_002210chr223058 2670 199 ----
NM_002211chr10192 ------
NM_002214chr744942 4880 3519 603 --25471 5273 --
NM_002222chr311057 --21296 878 --
NM_002230chr1741092 978 248 39 --1849 --
NM_002232chr121388 536 ------
NM_002235chr1241139 1085 1053 57 --11529 --
NM_002241chr152969 2210 2062 503 271 --1931 12867
NM_002245chr12572 445 ------
NM_002264chr374736 4207 3493 962 701 560 253 --1516 --
NM_002265chr172772 366 ------
NM_002266chr172183 92 ------
NM_002267chr1311738 ------
NM_002268chr341498 1349 727 709 ------
NM_002270chr554965 4746 4599 4136 1564 --12189 --
NM_002271chr1341641 953 696 66 --12160 --
NM_002285chr252730 2721 1637 1150 276 ------
NM_002296chr121465 574 --2368 325 --
NM_002334chr1122009 840 ------
NM_002336chr1233206 1709 538 21811 361 14042 11927
NM_002356chr642287 1055 753 77 1736 12697 --
NM_002358chr4147 ------
NM_002359chr1753783 3435 2987 2704 1298 ------
NM_002360chr722371 2135 --12460 12666
NM_002372chr5155 --138 --
NM_002374chr233566 3289 1133 ----22724 215
NM_002375chr311512 --11453 --
NM_002376chr141480 ------
NM_002397chr511405 --1744 --
NM_002401chr1721634 1557 12181 ----
NM_002408chr141656 1187 191 --
NM_002430chr2222271 1615 ------
NM_002442chr1221514 353 ------
NM_002449chr52251 51 --1854 --
NM_002451chr933236 2667 2545 12990 12404 --
NM_002455chr1128 ------
NM_002473chr2221342 909 --1179 --
NM_002480chr121191 --21339 469 --
NM_002481chr1117872 7620 7555 6927 6742 6191 5779 5339 5209 4979 3198 --25670 5194 27549 675
NM_002482chr14579 171 126 118 ------
NM_002485chr831785 1672 193 ----1580
NM_002486chr93428 293 71 11870 1485 --
NM_002499chr1531579 974 537 11699 12444 1551
NM_002500chr211024 ------
NM_002518chr211126 --1101 --
NM_002520chr51206 ------
NM_002522chr1733491 560 144 --1400 13509
NM_002524chr12844 820 ------
NM_002536chrX1253 ------
NM_002541chr711041 --1360 --
NM_002545chr1143875 1512 1303 89 23648 3431 21732 1393 --
NM_002546chr82771 83 ------
NM_002547chrX64046 3404 3188 3077 1329 1169 --24083 1366 11338
NM_002556chr1131930 1887 1740 --21524 861 --
NM_002569chr1521443 445 ------
NM_002570chr15----1280 --
NM_002572chr11----1399 --
NM_002576chr1141157 1113 363 251 ------
NM_002578chrX1306 ------
NM_002581chr954802 3866 1422 1255 725 13951 ----
NM_002583chr122250 171 ------
NM_002585chr12248 67 ------
NM_002586chr621039 65 ------
NM_002588chr521235 516 --11761 --
NM_002590chr131527 169 ----
NM_002595chr1221697 1543 ----1385
NM_002600chr131286 1181 263 --11418 --
NM_002601chr21370 ------
NM_002603chr8----1212 --
NM_002605chr1511195 ------
NM_002607chr711209 --1879 --
NM_002608chr2221577 1168 --1588 --
NM_002609chr541531 746 169 82 ------
NM_002613chr1653504 3282 1940 1257 1193 --44249 3993 3688 1876 25260 2065
NM_002616chr17142 ------
NM_002628chr321028 483 ------
NM_002629chr101614 ------
NM_002642chr1----1250 --
NM_002648chr611246 --11079 --
NM_002655chr835011 3870 1486 24718 1890 --15334
NM_002656chr631077 128 109 ------
NM_002657chr2043679 1417 1336 148 21538 356 --13789
NM_002667chr6--1202 ----
NM_002670chr31358 ------
NM_002677chr832909 1893 716 --2722 28 --
NM_002687chr1431069 818 493 ------
NM_002693chr15173 ------
NM_002698chr1922509 2213 ------
NM_002699chr131237 1224 548 ------
NM_002706chr22643 40 ------
NM_002707chr21273 ----1126
NM_002709chr253198 2843 2641 904 352 ----1834
NM_002714chr621096 888 --173 1258
NM_002716chr1143405 3057 2563 584 12309 12912 --
NM_002719chr1411904 --22348 441 12338
NM_002725chr1----1249 --
NM_002726chr64446 433 167 49 ------
NM_002731chr172866 2205 1005 967 480 427 296 ------
NM_002732chr9152 ------
NM_002734chr1731965 1717 624 12120 1437 --
NM_002736chr71633 21416 171 ----
NM_002738chr162764 408 ----11013
NM_002745chr2273289 3129 3022 888 299 142 101 --23419 158 --
NM_002747chr181214 21813 279 1530 --
NM_002748chr151774 ------
NM_002755chr15144 1597 1214 --
NM_002756chr173854 703 685 ------
NM_002758chr172490 48 ------
NM_002765chrX11355 --1917 --
NM_002778chr103746 394 43 --1912 --
NM_002779chr101375 --2515 410 --
NM_002787chr72577 108 ------
NM_002791chr141158 ------
NM_002806chr142275 43 ------
NM_002814chrX1631 ------
NM_002821chr62654 218 ------
NM_002823chr22567 529 ------
NM_002827chr2021683 554 1503 11409 --
NM_002835chr71185 ------
NM_002839chr923443 1206 --23334 390 --
NM_002840chr111225 --11014 --
NM_002843chr1112855 --11133 --
NM_002844chr62949 505 ----1310
NM_002849chr12167 --1710 --
NM_002850chr1911211 --1785 --
NM_002851chr71773 ------
NM_002855chr1143502 1021 638 568 13334 1175 1237
NM_002857chr12933 550 11747 1226 12701
NM_002858chr121233 207 1278 ----
NM_002865chr8------1103
NM_002867chr11467 ------
NM_002869chr1132157 341 86 ------
NM_002874chr932230 1830 1003 1293 1433 1369
NM_002881chr211421 ------
NM_002891chr15------175
NM_002892chr14192 ------
NM_002893chrX1107 --2360 115 --
NM_002897chr21726 --1765 --
NM_002902chr15----1523 --
NM_002906chr1132322 371 187 --1729 1323
NM_002907chr12137 --1421 --
NM_002918chr191731 --2391 73 --
NM_002924chr1------1404
NM_002938chr4----11381 --
NM_002940chr431274 379 363 --1522 --
NM_002941chr3------1632
NM_002942chr31570 --11337 --
NM_002955chr62613 67 ----1626
NM_002958chr32965 741 ------
NM_002959chr163469 2924 1783 1108 497 277 22885 2762 ----
NM_002971chr311027 ------
NM_002977chr243256 2227 1329 261 --1427 22840 2482
NM_002998chr821449 262 ------
NM_002999chr2041719 1577 1358 23 ------
NM_003001chr151965 1508 435 406 289 --21759 361 11493
NM_003011chr9----21088 583 --
NM_003017chr61178 --11211 --
NM_003030chr311399 --11371 --
NM_003031chr162917 850 ------
NM_003034chr1277017 6856 6547 5802 1995 394 164 ----1435
NM_003043chr331501 618 31 ----13904
NM_003045chr1344639 3279 3133 617 --35064 4667 607 --
NM_003069chrX1260 ------
NM_003070chr91327 --1695 --
NM_003071chr31472 ------
NM_003076chr1211147 ------
NM_003079chr173125 79 60 ------
NM_003081chr201986 ------
NM_003099chr1594784 4456 4007 1496 1186 1134 546 415 310 ------
NM_003100chr51122 ------
NM_003101chr121625 409 1117 11024 11096
NM_003106chr31895 ------
NM_003107chr631889 653 471 12035 21000 138 --
NM_003108chr277171 6874 5568 5438 1156 1104 805 --36123 5665 2658 --
NM_003110chr171963 ------
NM_003111chr21313 1486 ----
NM_003112chr712196 --1118 12178
NM_003115chr11380 ------
NM_003128chr222660 583 ------
NM_003130chr731203 1052 1031 ------
NM_003131chr621763 501 --32197 1797 1607 --
NM_003137chr622017 1722 1896 ----
NM_003139chr111658 --1799 --
NM_003144chr632061 1617 197 ----22206 598
NM_003150chr1732258 2042 507 ------
NM_003155chr82151 87 --12849 --
NM_003156chr11----1345 --
NM_003157chr32666 57 --2636 207 --
NM_003161chr1733202 2518 1285 ------
NM_003178chr31305 --11589 --
NM_003179chrX11069 ----1890
NM_003185chr201344 --11103 --
NM_003188chr61536 ------
NM_003189chr142181 2068 1235 750 2824 63 1169 12557
NM_003193chr11195 ------
NM_003199chr1854014 3751 3677 2024 815 1156 13903 --
NM_003200chr1962262 1904 915 860 598 462 183 12032 --
NM_003202chr51643 --11760 --
NM_003204chr1711373 --1693 --
NM_003211chr12----21750 602 --
NM_003216chr2223082 2942 1913 32725 2458 1294 --
NM_003217chr1211630 1336 1130 21258 193
NM_003220chr611049 ------
NM_003221chr654169 3795 3491 1046 1016 --22949 93 --
NM_003234chr3----31683 479 47 --
NM_003239chr141146 ------
NM_003242chr322227 414 1986 ----
NM_003246chr1511893 --3652 247 105 1779
NM_003247chr611404 --183 --
NM_003253chr2151721 1616 1560 1551 242 --11641 --
NM_003255chr1761983 1893 1053 278 240 53 ------
NM_003256chr31403 ------
NM_003257chr152982 894 ------
NM_003262chr321436 567 14602 34172 3540 321 --
NM_003269chr6----11021 --
NM_003272chr11125 ------
NM_003274chr2152908 2736 2569 2219 676 ------
NM_003286chr202962 45 ------
NM_003298chr376213 5946 4025 3914 2500 2129 1054 11194 35604 5305 124 --
NM_003305chr41147 --123 --
NM_003337chr51643 ------
NM_003338chr101234 ------
NM_003339chr521629 602 --11392 --
NM_003342chr1733314 1190 909 1503 32865 2653 1142 --
NM_003345chr16141 ------
NM_003349chr2021214 1123 1462 1523 --
NM_003359chr42988 933 1294 ----
NM_003371chr962135 1956 1890 1838 1660 1625 ------
NM_003372chrX124 ------
NM_003375chr10181 --1169 --
NM_003376chr6135 11533 ----
NM_003376chr6135 11533 ----
NM_003385chr21744 --1722 --
NM_003387chr221899 257 --11958 --
NM_003390chr112775 177 1345 ----
NM_003392chr372746 2659 1389 835 160 78 71 ------
NM_003400chr21879 --1795 --
NM_003404chr201645 ----11320
NM_003405chr221539 1524 ----
NM_003406chr831396 352 148 ----1291
NM_003410chrX1814 1736 2628 567 --
NM_003412chr342573 1938 339 333 --12454 --
NM_003420chr3----1258 --
NM_003432chr5----2492 485 --
NM_003440chr121769 ------
NM_003442chr111669 ----1788
NM_003452chr92936 878 ------
NM_003453chr132516 185 --1693 --
NM_003455chr1131708 1579 231 --41669 1456 1211 497 --
NM_003457chr17--191 1221 --
NM_003463chr663207 3196 1295 1016 437 81 ------
NM_003467chr21435 ------
NM_003472chr61303 --11151 --
NM_003473chr102887 853 ------
NM_003474chr1031605 1476 956 1495 2587 517 --
NM_003478chr1123033 636 --1464 --
NM_003482chr1222441 2357 ------
NM_003483chr1212138 --12153 --
NM_003488chr172403 226 --1823 1964
NM_003489chr2113094 --2843 791 --
NM_003498chr1642013 853 174 128 --11044 --
NM_003505chr73619 380 100 ------
NM_003507chr2------12010
NM_003535chr6123 ------
NM_003557chr121635 1213 ------
NM_003558chr9------1476
NM_003559chr1711335 1124 31594 1353 1199 --
NM_003563chr1711376 ------
NM_003566chr124984 863 614 89 ----12385
NM_003574chr1895275 4766 4001 3537 1777 966 691 291 133 14673 ----
NM_003576chr1322771 2664 --12357 --
NM_003583chr1253646 3300 2577 2387 1190 ------
NM_003589chr1331264 969 335 ------
NM_003590chr212848 1189 21426 630 13253
NM_003595chr221427 --1333 --
NM_003597chr23374 220 135 ------
NM_003603chr43497 432 102 11848 12019 --
NM_003607chr164210 3360 1224 1187 819 392 22738 1264 11371 --
NM_003615chr323350 473 --33827 3659 3461 --
NM_003617chr154242 4084 4049 3933 3916 --14312 --
NM_003618chr221286 1113 ------
NM_003622chr12--22437 992 1625 --
NM_003626chr111370 --21234 1123 --
NM_003629chr142252 1285 1083 998 23077 607 11255 --
NM_003630chr61645 ------
NM_003633chr51224 --12027 --
NM_003634chr222782 85 --1434 --
NM_003636chr121389 95 ------
NM_003637chr131137 458 275 1177 ----
NM_003644chr1765713 5592 4746 4337 1901 383 24703 857 21860 542 --
NM_003659chr231090 1065 117 ------
NM_003663chr333243 3064 267 --12616 --
NM_003670chr33589 436 296 --1406 --
NM_003671chr943575 1223 846 481 ------
NM_003672chr12661 476 1737 ----
NM_003693chr172717 126 1551 ----
NM_003701chr132980 211 ------
NM_003713chr11234 ------
NM_003714chr512388 22925 2650 21094 774 --
NM_003722chr332686 2264 466 ----1189
NM_003735chr521235 516 --11761 --
NM_003736chr521235 516 --11761 --
NM_003743chr22422 323 --1304 1543
NM_003744chr1441150 1070 897 437 ------
NM_003749chr1331529 782 431 ------
NM_003750chr101790 ------
NM_003757chr11382 --1398 --
NM_003759chr443013 2783 974 533 ------
NM_003763chr2042549 2386 2019 424 --23028 1291 --
NM_003766chr17137 ------
NM_003768chr111284 --11571 --
NM_003772chr112135 62 ------
NM_003774chr1253209 3174 2551 2436 544 ------
NM_003783chr11188 ------
NM_003787chr1811715 ------
NM_003791chr16186 ------
NM_003795chr6----1438 --
NM_003800chr641577 721 559 99 ------
NM_003816chr821243 1041 --11448 --
NM_003819chr11264 ------
NM_003822chr142959 2949 2017 1980 1227 1852 --
NM_003825chr1531365 530 233 --11024 11535
NM_003829chr93890 839 769 ----1361
NM_003842chr842332 1631 266 38 12159 --1896
NM_003860chr11----1372 --
NM_003861chr1452776 2727 2343 1920 193 ------
NM_003872chr23858 846 832 ------
NM_003873chr1031783 930 123 ----1220
NM_003877chr12------1836
NM_003884chr341779 1567 290 61 ------
NM_003885chr1772600 2483 2302 1706 699 612 375 ------
NM_003887chr22643 186 ------
NM_003893chr102400 320 ------
NM_003902chr12210 108 ------
NM_003913chr6--13963 --1340
NM_003916chrX21132 385 ------
NM_003924chr4--11301 2237 115 --
NM_003927chr181768 --181 --
NM_003930chr722362 1791 ------
NM_003932chr2221831 176 ------
NM_003934chr951159 497 372 314 308 ------
NM_003941chr722368 1740 ------
NM_003948chr442323 2106 459 99 12583 --11874
NM_003953chr122512 329 ----11158
NM_003955chr1721385 400 ------
NM_003957chr1131094 1011 771 ------
NM_003958chr653298 2834 2496 494 418 11091 12503 --
NM_003966chr543066 2900 2882 275 183 32152 1103 22 12907
NM_003971chr17150 ------
NM_003972chr102412 212 ------
NM_003980chr621335 934 --1235 --
NM_003981chr151202 --132 --
NM_003982chr14138 ------
NM_003994chr1222779 1371 --13364 13692
NM_004006chrX42116 1950 1922 118 --1558 --
NM_004007chrX42116 1950 1922 118 --1558 --
NM_004009chrX42116 1950 1922 118 --1558 --
NM_004010chrX42116 1950 1922 118 --1558 --
NM_004011chrX42116 1950 1922 118 --1558 --
NM_004012chrX42116 1950 1922 118 --1558 --
NM_004013chrX42116 1950 1922 118 --1558 --
NM_004014chrX42116 1950 1922 118 --1558 --
NM_004015chrX42116 1950 1922 118 --1558 --
NM_004016chrX42030 1864 1836 32 --1472 --
NM_004017chrX42116 1950 1922 118 --1558 --
NM_004018chrX42030 1864 1836 32 --1472 --
NM_004020chrX42116 1950 1922 118 --1558 --
NM_004021chrX42030 1864 1836 32 --1472 --
NM_004022chrX42030 1864 1836 32 --1472 --
NM_004023chrX42030 1864 1836 32 --1472 --
NM_004024chr1167 11308 ----
NM_004027chr2195 ------
NM_004028chr1843200 2811 2545 1319 --11012 --
NM_004035chr1745058 3841 1261 452 14499 11046 --
NM_004041chr111131 --183 --
NM_004047chr1149 ------
NM_004050chr1432460 1755 708 ------
NM_004056chr81700 ------
NM_004061chr51200 --1160 --
NM_004067chr731505 1047 247 ------
NM_004079chr122325 630 ------
NM_004080chr71118 ------
NM_004081chrY1128 11537 21392 1369 --
NM_004086chr141673 1213 ----
NM_004087chr331620 432 372 --11542 --
NM_004089chrX--11006 11120 --
NM_004093chr1352894 2660 836 396 329 --12857 --
NM_004096chr1011584 ------
NM_004105chr21951 ------
NM_004112chr1711660 --2648 602 --
NM_004113chr31439 ------
NM_004114chrX31043 982 461 --1837 --
NM_004117chr621544 56 --1656 --
NM_004124chr1433579 3430 1404 1682 22427 527 13509
NM_004136chr1522204 385 --13009 12242
NM_004145chr192352 306 ------
NM_004152chr191235 ------
NM_004156chr8----148 --
NM_004161chr221289 227 ------
NM_004162chr32801 383 11029 ----
NM_004169chr172642 129 --1235 --
NM_004170chr91399 ------
NM_004171chr11108259 7868 7485 6489 6422 6077 5843 3471 3082 1627 29268 2134 29213 6785 --
NM_004180chr2------1601
NM_004181chr41310 --1279 --
NM_004183chr11----1727 --
NM_004187chrX11201 ----11131
NM_004205chr113538 532 180 ------
NM_004209chr161285 --2947 841 --
NM_004215chr8--1456 ----
NM_004229chrX21852 354 ------
NM_004232chr1813815 --13472 12522
NM_004235chr92697 621 ----1670
NM_004236chr151148 1570 ----
NM_004238chr21215 ------
NM_004241chr101729 --1764 --
NM_004242chr61415 ------
NM_004244chr121386 ------
NM_004261chr11778 ------
NM_004263chr221516 239 --21697 1144 --
NM_004268chr1131150 334 276 ------
NM_004272chr511632 ------
NM_004273chr1064626 4333 3553 1557 1344 1332 --23074 1854 --
NM_004274chr1433073 2262 805 ------
NM_004281chr10192 ------
NM_004290chr5----11140 11059
NM_004311chr103845 434 331 1502 1895 13008
NM_004316chr1231059 884 784 --1220 --
NM_004319chr11552 ----21987 216
NM_004321chr263423 2913 2726 1209 1094 603 --12649 12870
NM_004326chr1--1397 1353 --
NM_004329chr1021345 230 ------
NM_004331chr842285 954 917 261 12383 ----
NM_004337chr842082 541 76 60 --11740 --
NM_004342chr712118 ------
NM_004343chr191137 ------
NM_004346chr42521 22 ------
NM_004349chr811111 ----11007
NM_004359chr191503 --1126 --
NM_004364chr1951132 1055 1038 368 59 --1212 --
NM_004367chr61383 --31756 1750 1111 --
NM_004368chr192868 320 --1370 --
NM_004373chr122173 48 ------
NM_004378chr151217 ------
NM_004380chr1631969 661 205 ------
NM_004385chr5197 --1526 1488
NM_004392chr1332280 1814 933 --12332 12607
NM_004393chr322073 237 ------
NM_004395chr51671 --1225 --
NM_004397chr1134302 3337 246 --14165 1583
NM_004411chr71666 ------
NM_004415chr61555 --1169 --
NM_004417chr51137 ------
NM_004420chr1131765 695 87 1640 32173 2063 1801 --
NM_004423chr342642 2033 968 913 --22105 651 --
NM_004429chrX2466 162 --1128 --
NM_004432chr952161 2040 1508 433 354 ----1886
NM_004433chr11676 11741 ----
NM_004437chr143469 2305 588 284 ------
NM_004438chr2----1469 --
NM_004439chr41154 ------
NM_004440chr621805 1258 ------
NM_004441chr331147 973 854 --2860 98 --
NM_004451chr112733 534 ------
NM_004454chr352127 1947 1923 246 71 ------
NM_004457chr21405 ------
NM_004458chrX148 1458 ----
NM_004459chr172361 226 ------
NM_004463chrX2481 178 ------
NM_004464chr444124 3213 1489 1077 --24161 366 11453
NM_004468chr1125 ------
NM_004481chr132242 1094 815 --2647 450 --
NM_004491chr1964265 3498 2996 2857 2683 212 14105 ----
NM_004497chr192586 266 ------
NM_004498chr151295 ------
NM_004501chr1----22521 760 --
NM_004504chr252966 2654 2646 2479 2134 ------
NM_004515chr1--169 ----
NM_004516chr1931006 502 103 --2864 117 --
NM_004519chr81205 ------
NM_004523chr10--1490 11591 --
NM_004535chr2011469 ------
NM_004537chr1211432 --1436 --
NM_004543chr21105 ------
NM_004549chr11--11382 21532 603 --
NM_004550chr11137 ------
NM_004566chr1022427 251 12413 1806 --
NM_004575chr421528 263 --21661 1505 --
NM_004586chrX34873 4832 1905 23872 3498 13645 --
NM_004588chr1163571 3160 3006 2731 963 402 1928 23363 974 1373
NM_004593chr31615 ------
NM_004596chr191215 --1201 --
NM_004598chr543082 1072 1045 248 --1553 --
NM_004612chr964732 4665 4546 1592 1557 1305 14082 ----
NM_004622chr232163 1889 1665 ------
NM_004630chr1151206 1138 1113 956 804 ------
NM_004631chr151439 1335 897 380 85 --1906 --
NM_004634chr31606 ------
NM_004643chr141580 ------
NM_004654chrY1137 ------
NM_004660chrY1196 ------
NM_004663chr1511451 ----21017 205
NM_004686chr821187 72 --11675 11770
NM_004687chr171553 1582 11808 --
NM_004690chr6------1684
NM_004701chr152157 55 ------
NM_004703chr1711587 12110 12210 --
NM_004705chr112809 22 ------
NM_004718chr24168 146 97 23 ------
NM_004719chr122349 104 ------
NM_004725chr102201 193 --11242 --
NM_004726chrX54713 4293 4207 4120 1117 14874 22169 440 --
NM_004730chr551730 1422 815 404 185 ------
NM_004734chr131262 ------
NM_004736chr14414 372 189 33 ------
NM_004737chr221936 1324 ----
NM_004742chr331410 420 325 ------
NM_004744chr421176 177 12696 --1671
NM_004747chr1021086 348 11620 1430 --
NM_004748chr1532578 849 188 ------
NM_004760chr722103 1902 --1565 11626
NM_004762chr17------11613
NM_004765chr16----146 --
NM_004772chr511517 ------
NM_004774chr1733045 2027 928 --21996 127 --
NM_004775chr18--1618 ----
NM_004776chr2032317 2027 1038 --42408 1209 848 232 21180 503
NM_004788chr112878 201 --22232 64 --
NM_004789chr9186 ------
NM_004796chr1421676 373 --1603 1916
NM_004798chr2023378 1245 13497 --12901
NM_004801chr2----1549 --
NM_004805chr21298 --1226 --
NM_004815chr154001 3689 3520 1346 717 --44152 4026 3845 1291 2752 709
NM_004822chr1721119 101 --22465 1250 11595
NM_004824chr621198 345 --1481 --
NM_004831chr191859 ------
NM_004834chr273179 3145 2700 2576 2248 2116 388 --22724 2527 --
NM_004839chr151627 1474 ----
NM_004840chrX42027 815 529 467 --193 --
NM_004841chr11759 ------
NM_004857chr1412907 34769 3981 1673 33840 599 362 13088
NM_004859chr1742716 1137 607 243 ----12966
NM_004863chr1455244 4010 3484 3417 925 --35017 3663 3517 --
NM_004866chr523271 463 --1638 --
NM_004867chrX----1454 --
NM_004871chr1743595 2874 2691 366 --13730 12763
NM_004872chr1------175
NM_004879chr11----1994 --
NM_004887chr51213 11124 ----
NM_004888chr9--1405 ----
NM_004893chr51136 --2424 142 --
NM_004896chr1011199 --1593 --
NM_004897chr101141 --1774 --
NM_004904chr764946 2340 2125 1171 1020 889 14189 22355 122 1297
NM_004905chr12708 129 ------
NM_004922chr1031014 916 869 ------
NM_004924chr191985 --11042 --
NM_004929chr8----11485 1511
NM_004937chr1722382 697 22260 253 12581 --
NM_004947chr311027 --22050 205 --
NM_004958chr12153 42 ------
NM_004965chr21----1708 --
NM_004968chr72572 234 ------
NM_004969chr101547 1390 --1458
NM_004972chr9--11038 1741 --
NM_004973chr661701 1632 1576 342 300 125 --1473 --
NM_004975chr2011008 --1332 1377
NM_004976chr1142075 1471 1319 1003 12053 14185 11408
NM_004985chr1253294 462 424 267 206 ------
NM_004992chrX57943 7033 5717 5393 1040 --32787 2233 1213 1153
NM_004992chrX57943 7033 5717 5393 1040 --32787 2233 1213 1153
NM_004993chr142580 342 --1410 --
NM_004998chr152687 313 --1640 --
NM_004999chr644186 2874 808 136 ------
NM_005003chr16----121 --
NM_005006chr21290 --1837 --
NM_005010chr732126 640 363 --11475 --
NM_005016chr121232 ------
NM_005017chr31252 ------
NM_005028chr1021961 1898 12204 153 --
NM_005030chr16------1278
NM_005036chr2258348 2652 2583 1926 1453 13022 12732 --
NM_005045chr71627 ------
NM_005054chr2124 1407 21731 1362 --
NM_005056chr1293755 3697 3639 3581 1957 1940 1046 493 318 11168 45028 984 586 386 21303 81
NM_005063chr1043251 1418 480 417 13097 12368 --
NM_005067chr32964 289 --2852 149 --
NM_005068chr611304 ----1541
NM_005070chr21211 ------
NM_005076chr153883 3733 3248 1049 110 14093 14229 --
NM_005077chr92487 412 1505 ----
NM_005086chr1231256 558 167 ----11565
NM_005087chr32610 601 ------
NM_005088chrX1720 --1695 --
NM_005093chr2075234 5179 4478 4449 1667 1372 250 23782 1555 25089 242 --
NM_005094chr91182 ------
NM_005095chr111812 ------
NM_005096chrX1345 --2338 159 --
NM_005099chr1--21110 965 1169 --
NM_005109chr362146 2034 1806 785 756 361 ------
NM_005116chr2073317 2779 1493 1324 1306 1072 371 11785 33866 3237 339 24486 3194
NM_005119chr121242 987 1243 ----
NM_005121chr1753401 3255 1370 915 866 ----1374
NM_005124chr6----2868 308 --
NM_005131chr18178 ------
NM_005134chr181359 ------
NM_005151chr181558 --1669 --
NM_005153chr161837 ------
NM_005154chr15----1576 --
NM_005156chr995084 4696 4137 3992 1412 1271 1199 919 191 --1214 --
NM_005157chr911931 11460 11580 --
NM_005160chr2256790 6290 5875 5422 2266 25906 739 25502 4912 --
NM_005163chr14179 ------
NM_005180chr10----2268 214 --
NM_005182chr163148 84 51 ------
NM_005184chr1921536 341 --11376 --
NM_005187chr1621782 437 ----2711 673
NM_005188chr1155318 1830 1220 737 554 27703 5042 57749 7606 2656 2544 1340 --
NM_005190chr611109 1897 ----
NM_005197chr1444757 1552 1451 116 ----145
NM_005207chr2263275 2882 2501 2413 508 400 1765 1486 --
NM_005214chr241046 916 849 825 1456 ----
NM_005219chr551796 1765 1651 1353 362 --1410 --
NM_005225chr2031027 483 25 ------
NM_005230chr121112 ------
NM_005233chr31770 --22123 353 11988
NM_005235chr257685 6393 2370 1369 645 --25736 2693 1705
NM_005238chr1162832 2705 1394 1251 962 273 ----12840
NM_005240chr13645 545 176 ------
NM_005241chr3----1943 --
NM_005254chr151952 ------
NM_005257chr1821319 1068 ------
NM_005259chr211248 ------
NM_005261chr8----1100 --
NM_005264chr103924 223 178 --1876 --
NM_005268chr11221 ------
NM_005273chr71309 --1295 --
NM_005274chr1124 ------
NM_005277chr411690 --11795 --
NM_005279chr2----134 --
NM_005281chr12708 68 ------
NM_005311chr732127 1080 283 11866 ----
NM_005313chr151208 ------
NM_005324chr1752037 1988 628 411 54 ------
NM_005329chr1622236 2126 ------
NM_005336chr2161 ------
NM_005339chr411612 ------
NM_005342chrX1166 ------
NM_005349chr4----190 --
NM_005354chr191489 ------
NM_005359chr1875851 5677 5596 5377 4254 4199 1501 14642 26469 2490 1588
NM_005375chr63877 859 27 --11006 --
NM_005378chr2191 ------
NM_005380chr121251 490 --1271 1116
NM_005381chr22395 171 1412 ----
NM_005387chr112676 524 ------
NM_005388chr91216 --21440 86 11736
NM_005398chr101468 --1199 --
NM_005400chr231062 600 565 ------
NM_005402chr711505 ----1185
NM_005406chr1821041 58 1113 11330 --
NM_005410chr52714 306 --1138 --
NM_005426chr12929 780 ------
NM_005430chr121767 --1992 --
NM_005433chr1811836 12233 11102 --
NM_005436chr1033413 860 71 22651 125 43009 2973 488 330 21154 786
NM_005440chr1733303 888 74 --12843 1562
NM_005442chr31558 ------
NM_005443chr41191 --1580 --
NM_005455chr151767 1655 1293 1220 1202 ------
NM_005458chr922326 1715 ------
NM_005461chr2011815 --31986 1960 353 --
NM_005474chr1711161 129 1161 1378
NM_005475chr1241040 1014 900 726 1184 1201 12857
NM_005479chr1041540 1401 1302 978 --198 --
NM_005487chr2242076 1426 546 49 11306 ----
NM_005494chr71477 ------
NM_005497chr1735778 5481 4707 --23766 2319 1463
NM_005501chr1711183 --1988 --
NM_005502chr9----32176 978 453 --
NM_005506chr452642 2620 2474 2302 1840 12171 --12403
NM_005515chr72657 55 ------
NM_005539chr103533 345 224 11374 ----
NM_005542chr731412 1319 1294 ------
NM_005562chr111207 ------
NM_005563chr12795 605 --1338 --
NM_005576chr151225 ------
NM_005578chr353879 3739 3732 3590 1079 13891 1327 --
NM_005585chr151387 ------
NM_005587chr151957 ------
NM_005595chr11204 ------
NM_005596chr985809 5455 4798 2318 2299 2235 1090 462 11828 25553 4309 --
NM_005599chr12309 184 --11519 --
NM_005602chr31956 ----11226
NM_005604chr6------1800
NM_005610chr12655 74 ------
NM_005625chr821068 203 ------
NM_005626chr1------1435
NM_005637chr1841810 1428 795 160 1177 ----
NM_005639chr12------1721
NM_005647chrX43255 2403 951 562 --42608 1141 294 232 12522
NM_005655chr82897 167 2263 200 --1381
NM_005656chr2131262 1168 55 --1136 --
NM_005657chr15122 ------
NM_005659chr22--1438 159 --
NM_005662chr81390 ------
NM_005664chr1531059 941 410 --1232 --
NM_005665chr144293 3650 1829 63 1689 ----
NM_005667chr22325 81 ------
NM_005668chr51551 34295 2896 89 ----
NM_005678chr152804 289 ------
NM_005688chr331170 444 136 ----1499
NM_005721chr2183 ------
NM_005722chr232376 759 284 ------
NM_005724chr151591 --1136 1610
NM_005730chr1283550 2842 2755 2592 2463 2264 925 820 ------
NM_005736chr102514 497 ------
NM_005737chr252716 1083 947 796 625 --22850 1985 --
NM_005738chr72388 83 --11427 --
NM_005740chr222915 85 ------
NM_005742chr21681 ------
NM_005746chr71108 ------
NM_005748chr1263241 3137 3126 3091 2573 603 --1997 --
NM_005756chrX2237 184 --1207 --
NM_005759chr234560 1740 134 --1526 --
NM_005762chr191127 ------
NM_005766chr1341382 1155 1079 959 --21089 115 --
NM_005779chr543279 2965 2564 885 ------
NM_005786chr181124 ------
NM_005789chr1742109 1828 517 61 ------
NM_005795chr222751 195 --1573 --
NM_005801chr173744 737 537 ------
NM_005813chr242100 1014 513 247 1879 ----
NM_005822chr632163 1717 1468 ------
NM_005826chr12568 79 1258 ----
NM_005828chr1744026 3919 1593 35 ------
NM_005832chr31215 ------
NM_005839chr13675 348 38 ----1884
NM_005840chrX87482 6572 6519 5973 4736 2782 2261 408 17319 36559 5009 1623 --
NM_005841chr42386 262 ------
NM_005869chr52325 125 ------
NM_005871chr10--138 --1128
NM_005880chr1651244 1183 611 556 473 ------
NM_005882chr41957 1166 ----
NM_005898chr1151961 1223 675 451 323 ------
NM_005900chr421110 486 1990 ----
NM_005901chr18138458 7382 6246 5899 5776 3117 3045 2837 1656 1377 1112 905 656 18445 --16142
NM_005902chr1551734 1680 998 938 259 --24161 3279 --
NM_005903chr574357 4009 3959 3264 2085 1954 1008 --11760 --
NM_005904chr181134 ------
NM_005907chr621279 464 ------
NM_005909chr51752 --33405 1310 1217 --
NM_005920chr143447 3154 2969 2531 --12865 --
NM_005922chr61499 ------
NM_005923chr61515 ------
NM_005927chr51920 --1292 --
NM_005933chr1162910 2783 694 626 500 220 12091 12279 --
NM_005935chr435082 3629 580 22056 1897 14136 13529
NM_005937chr1743310 2810 1449 1018 ------
NM_005938chrX3562 298 273 ------
NM_005941chr824040 3963 --11505 12571
NM_005955chr164962 4678 3391 2034 1024 854 --22196 335 --
NM_005962chr10------11971
NM_005962chr10------11971
NM_005966chr211649 ------
NM_005967chr122751 476 1158 ----
NM_005975chr204811 784 778 426 ------
NM_005977chr13----1865 --
NM_005981chr122887 91 1649 ----
NM_005999chr121485 1139 --196 --
NM_006007chr954427 3981 3328 2956 789 13840 13202 --
NM_006011chr1543037 693 346 106 ------
NM_006015chr131266 819 476 --1352 --
NM_006016chr611407 ----11682
NM_006022chr133977 275 176 ------
NM_006030chr311820 --21360 405 --
NM_006033chr1822213 1999 1811 3820 583 312 --
NM_006034chr1142132 1951 185 63 --1464 --
NM_006035chr1421225 1074 ------
NM_006037chr254766 4291 3244 1291 635 ------
NM_006038chr2031530 684 451 156 1559 --
NM_006047chr2063451 1102 773 626 411 303 --22944 123 --
NM_006063chr2137 157 ----
NM_006070chr3----1331 --
NM_006079chr61155 ------
NM_006080chr722825 181 ------
NM_006086chr161241 ------
NM_006089chrX11423 21541 1251 ----
NM_006095chr443706 3317 1004 272 ------
NM_006106chr1152842 1327 993 878 777 ----11236
NM_006108chr1132397 2067 1613 --1564 --
NM_006113chr121918 193 ------
NM_006129chr82529 411 ------
NM_006133chr1122470 758 ------
NM_006135chr11106 ------
NM_006136chr721360 340 ----11129
NM_006141chr1642047 938 264 149 --11724 12802
NM_006154chr1511857 --1653 1264
NM_006157chr112338 83 ------
NM_006158chr81215 --31633 732 208 --
NM_006162chr1811372 ------
NM_006166chr1231856 1680 712 ------
NM_006178chr172421 210 --11415 --
NM_006180chr931982 1695 578 --1327 11546
NM_006183chr121119 ------
NM_006191chr122758 201 --1851 --
NM_006192chr202940 193 ------
NM_006194chr1421213 1125 1860 ----
NM_006195chr9------1300
NM_006202chr1942003 1598 586 468 ------
NM_006203chr555116 3553 1538 1448 336 --34492 4232 3839 --
NM_006224chr171536 --22119 702 --
NM_006235chr1131625 1323 487 11507 ----
NM_006237chr1321661 63 ------
NM_006241chr342405 2002 1836 1505 --11728 --
NM_006243chr12893 818 ----1869
NM_006251chr51296 1687 ----
NM_006252chr185696 4736 2994 2345 2281 1476 616 332 1403 11621 17311
NM_006255chr142965 345 ------
NM_006256chr132366 1778 892 --12772 11853
NM_006259chr41830 ------
NM_006265chr831475 992 622 ------
NM_006267chr221731 1465 ------
NM_006275chr2042067 1997 1665 1527 1407 21894 441 --
NM_006282chr2064553 2899 1491 1465 61 41 13228 1627 1602
NM_006283chr833575 1775 423 --13095 --
NM_006287chr212448 ----1634
NM_006292chr11----1160 --
NM_006296chr2------1112
NM_006310chr1731235 1044 364 --2969 508 --
NM_006311chr17157 ------
NM_006312chr121669 ------
NM_006313chr1211563 --11534 --
NM_006315chr463675 3172 2934 1444 774 537 1377 2946 841 --
NM_006321chr312236 --11374 --
NM_006323chr41135 --1236 --
NM_006325chr122696 151 ------
NM_006328chr112230 108 ------
NM_006330chr81607 --11658 --
NM_006335chr11339 ------
NM_006352chr131447 549 293 ------
NM_006353chr63527 448 227 --21043 98 --
NM_006359chrX32242 2205 927 --12358 1818
NM_006364chr142806 124 ------
NM_006366chr61964 ----11275
NM_006369chr11354 1335 ----
NM_006375chrX31675 555 83 --21576 563 --
NM_006379chr732108 1740 701 1361 ----
NM_006380chr1733890 3704 1072 1765 ----
NM_006386chr223604 542 185 --22289 1543 12130
NM_006389chr111516 --1476 --
NM_006393chr1013198 34504 1784 1388 34540 4391 251 --
NM_006400chr12173 ------
NM_006411chr641011 872 843 665 ------
NM_006420chr2023283 2376 ----12947
NM_006421chr821014 70 ------
NM_006430chr21414 ----1182
NM_006434chr1033002 1098 864 1388 1791 --
NM_006449chr22292 73 --1666 --
NM_006454chr452703 2178 1075 1032 866 12017 ----
NM_006457chr423261 1662 --13927 1168
NM_006460chr171637 --2137 131 --
NM_006464chr274662 3767 1549 946 919 767 222 --34009 1870 281 13113
NM_006469chr111520 ------
NM_006474chr111975 11659 ----
NM_006482chr1253646 3300 2577 2387 1190 ------
NM_006496chr111307 --1642 --
NM_006503chr19143 --1109 --
NM_006526chr2032001 1877 777 ------
NM_006527chr41309 --199 --
NM_006534chr2043446 2988 789 557 --2639 407 --
NM_006538chr264083 3070 1141 1013 895 259 23223 3057 1997 --
NM_006540chr8----1389 --
NM_006544chr1434535 1332 1112 ------
NM_006546chr1776033 5330 4662 2370 1908 1228 764 1801 14422 --
NM_006547chr731927 768 349 --11805 --
NM_006548chr341662 1632 560 243 1254 ----
NM_006551chr11--177 126 --
NM_006552chr11--179 ----
NM_006558chr81337 ------
NM_006560chr111463 ------
NM_006561chr1054335 2025 976 862 708 --1446 26227 813
NM_006565chr161338 --192 --
NM_006570chr9199 ----1394
NM_006572chr1743047 1346 213 158 22320 293 1234 --
NM_006593chr22743 236 ------
NM_006599chr16127973 7596 7321 5620 5160 3016 2900 2879 1926 1833 1652 678 11248 48101 2433 1489 420 1919
NM_006601chr121909 1158 ----
NM_006602chr20------1699
NM_006603chrX21954 1462 --1259 --
NM_006609chr232350 2057 508 ------
NM_006612chr171499 --1414 --
NM_006614chr343638 3554 3117 399 ----12548
NM_006618chr111202 --11315 1576
NM_006624chr1021929 451 --11827 --
NM_006625chr11919 ------
NM_006625chr11919 ------
NM_006625chr11919 ------
NM_006628chr1533416 2915 1678 23627 1132 1315 --
NM_006629chr1822116 1094 ------
NM_006633chr51761 ------
NM_006636chr22836 103 --1744 --
NM_006642chr12230 60 ------
NM_006644chr131447 ------
NM_006654chr1264592 4053 3447 988 834 394 --34243 483 335 --
NM_006662chr162322 26 ------
NM_006667chrX21203 909 ------
NM_006670chr6--1264 ----
NM_006675chr12103249 2959 2925 2424 2173 1017 972 615 485 304 ----23386 3326
NM_006676chr921475 291 ------
NM_006690chr2022182 537 1734 ----
NM_006698chr20----1432 --
NM_006699chr13967 854 80 ------
NM_006703chr61176 ------
NM_006708chr61180 1380 1826 --
NM_006711chr163301 243 176 ------
NM_006713chr51681 --168 --
NM_006717chr942778 2119 975 137 22960 2373 11158 --
NM_006718chr631077 128 109 ------
NM_006722chr353080 2536 2464 1186 1033 ----1881
NM_006724chr61499 ------
NM_006729chrX64855 4706 3489 1494 897 310 --23695 1877 --
NM_006731chr925734 4450 12168 11709 12159
NM_006732chr1911349 --21551 499 --
NM_006734chr611056 --11411 --
NM_006735chr7157 ------
NM_006736chr21295 --21701 471 --
NM_006738chr1584180 3858 1583 1470 1328 1280 797 296 23936 3588 24584 578 12974
NM_006745chr41956 --1300 --
NM_006746chrX--11177 11059 --
NM_006749chr811033 ------
NM_006754chr711159 --1100 --
NM_006758chr211119 ------
NM_006761chr172262 142 ------
NM_006766chr852062 2045 1730 198 133 ------
NM_006769chr1----1491 --
NM_006775chr622946 2155 ------
NM_006777chrX--153 32799 822 626 --
NM_006788chr1811996 1205 1298 --
NM_006790chr51102 ------
NM_006791chr152537 525 ------
NM_006795chr1131536 1381 1369 --1460 --
NM_006805chr51659 21739 1238 ----
NM_006807chr17193 144 ----
NM_006809chr202764 156 1796 1317 --
NM_006812chr122625 54 ------
NM_006814chr2031007 398 30 --22553 875 --
NM_006815chr122948 469 ------
NM_006819chr111285 ------
NM_006826chr21429 --11033 --
NM_006827chr1453316 3112 3083 371 218 ------
NM_006836chr122568 429 --1435 --
NM_006851chr1232769 395 377 12759 22826 53 --
NM_006852chr1712490 12757 ----
NM_006854chr72605 168 11464 21580 1419 --
NM_006861chr1232067 1859 1497 1756 31888 734 337 --
NM_006868chr1823186 2044 22254 1080 22561 120 --
NM_006877chr6------1331
NM_006884chr311399 --11371 --
NM_006885chr1653436 2879 1492 1485 463 --11337 --
NM_006887chr21194 ----1686
NM_006888chr1462799 2772 995 617 472 442 ------
NM_006892chr2021253 1178 --1291 --
NM_006892chr2021253 1178 --1291 --
NM_006915chrX192 --12279 --
NM_006920chr21559 11860 ----
NM_006930chr521813 1331 ------
NM_006939chr1421141 286 ------
NM_006941chr222857 137 ------
NM_006950chrX----1294 --
NM_006959chr192350 338 1382 ----
NM_006963chr1021227 499 ------
NM_006981chr922959 2198 ------
NM_006990chr172378 2346 1628 1609 1559 328 310 --32234 2133 1619 --
NM_006996chr121389 544 ------
NM_006997chr101190 ------
NM_007005chr91309 ------
NM_007006chr1653428 2806 861 571 97 --12236 --
NM_007008chr21889 ------
NM_007009chr7128 ------
NM_007011chr1574577 4353 1918 1686 489 353 202 11423 1509 --
NM_007029chr8199 ------
NM_007030chr575127 3212 1725 1068 706 686 295 ------
NM_007038chr2134567 2254 2217 --15645 14682
NM_007039chr143846 547 186 ----1223
NM_007040chr192158 41 --11067 --
NM_007046chr21376 ------
NM_007050chr2077378 6768 6327 6021 2021 591 214 --57655 5808 5601 2998 1100 --
NM_007064chr32429 194 1501 1365 125
NM_007074chr16------1102
NM_007078chr102829 490 12185 12943 --
NM_007084chr1331446 1248 1215 ----11410
NM_007106chr1332124 795 238 ------
NM_007111chr131735 128 ----
NM_007118chr53832 670 252 ----1864
NM_007122chr1121 ------
NM_007124chr631294 622 327 ------
NM_007125chrY21335 65 ------
NM_007126chr91158 ------
NM_007129chr1331017 396 386 ------
NM_007137chrX54082 3980 3569 1766 620 14013 35043 1259 693 --
NM_007146chr1732818 2184 1955 ------
NM_007158chr121057 825 ------
NM_007159chr331316 1198 289 ------
NM_007170chr12761 694 ------
NM_007173chr111187 ----1169
NM_007174chr1242318 1981 1479 389 --12117 12167
NM_007178chr121422 ------
NM_007197chr121204 --3968 753 342 --
NM_007200chr1584180 3858 1583 1470 1328 1280 797 296 23936 3588 24584 578 12974
NM_007202chr171713 ------
NM_007203chr933936 3890 248 --13384 22715 1403
NM_007207chr1171 --1667 --
NM_007212chr122098 1683 12017 ----
NM_007218chr81131 ------
NM_007219chr201383 --1862 --
NM_007222chr8----21439 1427 1617
NM_007235chr121491 ------
NM_007246chr41189 ------
NM_007260chr11747 ------
NM_007275chr321135 178 --2803 73 --
NM_007278chr17----2289 137 --
NM_007279chr192507 43 ------
NM_007292chr1745058 3841 1261 452 14499 11046 --
NM_007294chr173975 360 336 --1384 --
NM_007295chr173975 360 336 --1384 --
NM_007296chr173975 360 336 --1384 --
NM_007297chr173975 360 336 --1384 --
NM_007298chr173975 360 336 --1384 --
NM_007299chr173975 360 336 --1384 --
NM_007300chr173975 360 336 --1384 --
NM_007302chr173975 360 336 --1384 --
NM_007303chr173975 360 336 --1384 --
NM_007304chr173975 360 336 --1384 --
NM_007305chr173975 360 336 --1384 --
NM_007308chr4------1242
NM_007313chr911931 11460 11580 --
NM_007347chr1542420 449 122 42 12030 1430 --
NM_007358chr11736 --178 --
NM_007365chr131913 653 494 --1551 --
NM_007371chr91680 ------
NM_007372chr171864 ------
NM_007373chr10----11796 11176
NM_007374chr141446 ----1175
NM_007375chr152634 2582 2032 287 111 --1921 --
NM_012064chr121988 ------
NM_012081chr533693 2939 2388 ------
NM_012082chr81311 ------
NM_012090chr131106 496 306 ------
NM_012095chr1032968 2232 1247 ------
NM_012096chr323329 2303 33711 3111 545 --13431
NM_012097chr242060 1724 781 79 --11847 --
NM_012102chr162419 2383 2096 2090 1962 195 --1524 21809 291
NM_012115chr61528 ------
NM_012141chr1353313 2900 1243 539 178 --22635 838 --
NM_012153chr1162601 2062 1763 923 869 661 --22473 430 --
NM_012154chr82873 224 1309 ----
NM_012155chr191205 ------
NM_012156chr2022248 1375 --22657 886 --
NM_012186chr12748 93 ------
NM_012193chr1144964 4846 1835 228 14118 11965 --
NM_012197chr931611 1328 1273 1538 ----
NM_012199chr154420 4043 3226 2817 588 --64682 3321 3266 2949 1645 1144 --
NM_012200chr11182 ------
NM_012207chr10----11024 --
NM_012215chr1041771 1438 381 224 1448 11783 --
NM_012218chr1972308 1969 823 672 589 461 211 12639 ----
NM_012223chr251060 469 459 105 58 ------
NM_012224chr44777 388 293 53 --1995 --
NM_012234chr363558 3216 2448 816 800 323 --11094 --
NM_012238chr101449 --1687 --
NM_012247chr103419 295 26 ------
NM_012249chr221095 712 22628 254 33593 2226 329 --
NM_012252chr734156 998 90 --13642 --
NM_012257chr7----1941 --
NM_012259chr621177 896 ------
NM_012262chr1115255 5065 5032 4640 3684 2095 1979 1756 1648 1020 564 11783 24623 1995 --
NM_012281chr712196 ----11872
NM_012286chrX1525 ------
NM_012287chr334001 451 117 11426 ----
NM_012288chr655693 5102 4339 3767 3736 22287 1052 44518 637 270 170 12085
NM_012290chr221285 571 ------
NM_012294chr743351 3249 497 189 --1261 --
NM_012297chr4----179 22480 2466
NM_012300chr53976 454 381 1220 11775 12513
NM_012301chr761822 1750 890 802 522 227 11405 ----
NM_012302chr1--1400 ----
NM_012307chr181808 --1818 --
NM_012308chr1152329 2180 983 869 640 --12164 --
NM_012309chr1193737 1590 1538 1487 1374 1164 905 616 509 --14235 --
NM_012316chr185416 5363 5260 2100 1750 1666 818 627 15622 ----
NM_012317chrX1667 ------
NM_012319chr181838 ------
NM_012323chr221626 11139 ----
NM_012325chr201568 --1101 --
NM_012329chr1711361 ----11405
NM_012334chr561795 1759 1473 927 742 111 21669 1139 11463 21782 636
NM_012347chr622990 1127 ------
NM_012382chr521373 692 --23339 772 --
NM_012392chr12574 472 1627 149 --
NM_012395chr743391 3012 2890 601 ------
NM_012405chr133608 3473 3078 33380 2839 2485 31145 749 701 11187
NM_012406chr12178 ------
NM_012412chr74868 835 823 219 ------
NM_012419chr61437 ------
NM_012421chr11184 ------
NM_012425chr1012156 --1281 --
NM_012426chr161342 --2171 76 --
NM_012428chr151869 ------
NM_012431chr7--12626 1222 --
NM_012437chr12475 323 ------
NM_012446chr51513 ------
NM_012448chr1732055 1627 301 --22039 644 11634
NM_012454chr61425 ------
NM_012461chr14----1249 --
NM_012471chrX41909 1385 1361 578 --21620 562 --
NM_012479chr742137 1926 700 526 1668 ----
NM_013230chrY2598 294 ------
NM_013231chr1411527 --34271 1373 663 --
NM_013232chr52375 164 ------
NM_013235chr5----1903 --
NM_013236chr222334 212 ------
NM_013253chr113365 128 89 1185 1308 --
NM_013257chr832211 2088 1941 --1404 --
NM_013261chr433706 347 181 --22815 2429 --
NM_013264chr11189 ------
NM_013267chr12------1420
NM_013269chr1231562 784 771 ------
NM_013272chr151274 ------
NM_013281chr2011064 ------
NM_013282chr1911288 ------
NM_013286chr341125 619 346 89 12980 1979 --
NM_013293chr71119 ------
NM_013316chr7------1694
NM_013322chr71301 ------
NM_013323chr1731210 904 852 ----1417
NM_013346chrX152 ------
NM_013354chr831347 533 309 11475 ----
NM_013357chr81863 1792 1804 --
NM_013365chr222609 517 ------
NM_013371chr11328 ------
NM_013372chr15185 ----13323
NM_013374chr342143 407 394 349 32981 2708 2207 12062 --
NM_013381chr1232171 2094 153 22336 804 ----
NM_013390chr931744 1564 332 ------
NM_013399chr16----11277 11536
NM_013400chr711089 ------
NM_013411chr121984 1090 12071 ----
NM_013423chrX1497 ------
NM_013427chrX1497 ------
NM_013433chr192342 25 ------
NM_013436chr2148 --1146 --
NM_013437chr81341 ----11023
NM_013438chr911714 ------
NM_013443chr921238 974 11135 ----
NM_013446chr731324 534 455 ------
NM_013448chr141233 ------
NM_013450chr21200 1165 ----
NM_013943chr113085 --12741 --
NM_013952chr222361 1736 21666 886 ----
NM_013953chr222361 1736 21666 886 ----
NM_013989chr1464658 3883 3717 1385 955 96 ------
NM_013992chr222361 1736 21666 886 ----
NM_013995chrX22473 180 ------
NM_014005chr521027 937 12054 ----
NM_014011chr252487 2458 1888 252 93 ------
NM_014021chr143229 965 863 439 1526 ----
NM_014023chr102974 62 ------
NM_014038chr72149 124 --2422 87 --
NM_014048chr1664823 4238 3413 2048 1983 1595 21221 972 23648 3239 --
NM_014071chr201212 ------
NM_014089chr13----11876 --
NM_014096chr11137 ------
NM_014106chr1532713 1943 1903 --1391 22762 108
NM_014112chr844734 4386 4078 1192 ------
NM_014117chr1632727 2361 842 --3482 445 188 12144
NM_014154chr341477 1298 1230 365 ------
NM_014155chr1167029 6058 5343 5237 2637 2563 25220 4652 26671 6198 26961 290
NM_014157chr1633123 970 225 33405 2561 1005 23467 1285 --
NM_014170chr31324 ------
NM_014181chr221919 136 22505 2294 1855 --
NM_014182chr121703 ----1631
NM_014190chr42645 103 11203 1738 --
NM_014212chr121647 ------
NM_014213chr21233 --1225 --
NM_014214chr18--1343 ----
NM_014217chr1----1522 --
NM_014231chr1232070 1835 115 ----1530
NM_014232chr1721509 496 ------
NM_014232chr1721509 496 ------
NM_014238chr1741472 1423 455 31 --1461 --
NM_014243chr422066 370 ------
NM_014245chr321109 154 ------
NM_014250chr2242076 1426 546 49 11306 ----
NM_014252chr132300 63 ------
NM_014253chrX42473 886 74 61 1950 ----
NM_014263chr10131 ----11279
NM_014268chr18--1899 11362 --
NM_014279chr91725 --1882 --
NM_014283chr1----1127 --
NM_014284chr1----1132 1880
NM_014286chr943644 2563 1391 1025 23312 3169 22583 2358 --
NM_014289chrX1267 1482 ----
NM_014292chr221441 --41730 1703 1466 246 --
NM_014294chr811173 1129 ----
NM_014296chr32234 214 --126 --
NM_014309chr2265167 4538 4037 2132 2056 811 --15372 --
NM_014319chr122462 344 --31278 571 60 --
NM_014325chr1221803 484 ------
NM_014331chr466781 6692 2589 1359 1205 381 ------
NM_014333chr1122460 2312 ------
NM_014342chr111322 ----11194
NM_014345chr611029 --2343 42 --
NM_014361chr112185 175 ------
NM_014372chr1148 ------
NM_014374chr711089 ------
NM_014376chr522202 556 --21823 192 --
NM_014382chr33696 440 388 --1215 --
NM_014405chr1712344 --1148 --
NM_014415chr31259 --1390 11408
NM_014421chr41342 21340 1300 11944 --
NM_014423chr534985 4055 2177 1810 1241 --
NM_014445chr352430 2301 1700 408 150 ----21720 726
NM_014447chr451248 1103 1036 644 177 --11479 --
NM_014452chr63783 227 53 ------
NM_014456chr1021409 360 11257 ----
NM_014458chr12222 206 ------
NM_014469chr11----2849 290 --
NM_014488chr11------1191
NM_014491chr7----1286 --
NM_014494chr1632315 2229 709 --11547 --
NM_014496chrX----156 --
NM_014504chr742024 1784 559 295 ------
NM_014515chr1231044 136 107 ------
NM_014521chr2--11752 1548 --
NM_014552chr221428 158 ----1410
NM_014554chr1212315 1763 --1352
NM_014572chr1341610 1221 497 204 --1572 --
NM_014573chr1731817 1806 1443 ------
NM_014574chr1411133 ------
NM_014577chr223907 759 666 ------
NM_014604chr171190 --181 --
NM_014607chr221622 1451 ------
NM_014612chr91449 ------
NM_014613chr532938 990 680 12184 ----
NM_014614chr211059 --1126 --
NM_014615chr1661356 1265 930 876 585 252 --22503 2273 --
NM_014616chr333373 2783 249 11097 ----
NM_014630chr1543227 2651 1319 499 --1228 11180
NM_014635chr2--1371 31709 1330 1301 --
NM_014636chr964000 3697 3196 1628 399 35 1162 --33255 1459 799
NM_014637chr861361 1311 1280 1071 1016 166 ------
NM_014640chr2----1296 --
NM_014646chr1813042 --21000 393 --
NM_014647chr16--168 1565 1632
NM_014660chr721148 200 ------
NM_014665chr823684 920 --1110 --
NM_014666chr51984 ------
NM_014667chr341717 1524 118 41 --1845 --
NM_014669chr16----1110 --
NM_014670chr23998 630 118 --11070 --
NM_014671chr721534 633 --1322 --
NM_014676chr121210 348 1586 ----
NM_014679chr1121014 147 21175 134 ----
NM_014682chr821707 894 ------
NM_014683chr1731736 1637 1354 ------
NM_014685chr162199 31 ------
NM_014686chr191639 --1181 12588
NM_014690chr71270 13059 1591 --
NM_014701chr1532555 2389 408 --12806 --
NM_014702chr6----13272 1758
NM_014707chr71580 1244 ----
NM_014709chr2----1254 --
NM_014711chr1611365 1612 ----
NM_014715chr111934 ------
NM_014727chr191232 ------
NM_014729chr83385 337 254 --1644 --
NM_014730chr12115140 4937 4302 4281 3944 3369 3285 3211 2008 1220 62 --35187 3468 69 --
NM_014730chr12115140 4937 4302 4281 3944 3369 3285 3211 2008 1220 62 --35187 3468 69 --
NM_014737chr2023469 3282 13488 11638 --
NM_014738chr171726 ------
NM_014739chr61788 24000 3248 11130 --
NM_014743chr452135 1075 458 414 97 --12162 --
NM_014751chr821780 1716 21621 1456 ----
NM_014755chr224096 4082 12610 ----
NM_014757chr551993 1756 539 504 267 ----11977
NM_014761chr1631161 821 280 --11072 --
NM_014767chr1062815 2751 2617 1397 1348 332 --32594 453 431 --
NM_014770chr1211081 --11190 --
NM_014774chr193214 2994 2512 2506 2500 2346 2128 1173 500 ------
NM_014776chr1242863 2187 2175 211 22108 39 ----
NM_014779chr31926 ------
NM_014781chr83302 221 207 ----1157
NM_014784chr12785 364 1190 1455 --
NM_014786chr1131185 1179 818 --1188 11150
NM_014787chr131063 801 397 --2406 172 1447
NM_014790chr51138 ------
NM_014791chr91228 ------
NM_014803chr1022707 2574 --22560 917 --
NM_014807chr111827 1740 --1731
NM_014810chr143593 1197 1136 745 12733 11394 12480
NM_014812chr11246 ------
NM_014813chr11483 ----1458
NM_014819chr532441 2011 1775 --1313 1408
NM_014824chr1121651 1310 --1417 --
NM_014826chr164210 3360 1224 1187 819 392 22738 1264 11371 --
NM_014827chr1--21503 664 21074 341 --
NM_014828chr1432499 2285 83 --11738 --
NM_014836chr1021992 113 ------
NM_014838chr223897 636 350 1651 ----
NM_014839chr121897 288 --21864 878 --
NM_014841chr611108 1363 11333 --
NM_014847chr13467 98 44 ------
NM_014850chr374882 4631 4587 3880 3715 1588 1140 --34692 288 70 --
NM_014853chr1721451 500 ------
NM_014857chr1----179 --
NM_014858chr1----11069 --
NM_014864chr131368 1245 583 24380 1376 ----
NM_014868chr125821 710 629 131 35 ------
NM_014870chr184536 3350 2950 1764 1500 1477 1252 1094 14523 --1294
NM_014873chr144768 3990 1454 1043 21394 916 --14419
NM_014876chr2252179 1598 761 548 444 --12048 --
NM_014893chrY42209 1590 767 455 ------
NM_014897chr1722165 2060 12655 32053 940 363 --
NM_014899chr532632 1215 210 --22692 635 12905
NM_014902chr201510 --1158 --
NM_014903chr1242384 861 754 654 31681 766 462 ----
NM_014904chr1023803 653 23091 102 1373 21053 705
NM_014906chr1743913 3396 2927 773 ------
NM_014912chr1013479 ------
NM_014914chr221293 1069 ------
NM_014918chr1531101 1058 112 ------
NM_014921chr1952093 2046 1016 584 199 1359 52826 2816 2736 2573 2152 --
NM_014923chr1311869 --1788 --
NM_014926chr31859 --1449 --
NM_014932chr3----170 --
NM_014937chr101496 --131 --
NM_014939chr1811078 --11271 --
NM_014944chr121410 26 ------
NM_014945chr511978 --21234 386 --
NM_014947chr132226 660 255 21105 390 12934 --
NM_014949chr1----21019 996 --
NM_014952chr1531276 469 121 11560 41981 710 581 532 --
NM_014953chr1323352 956 13563 2750 34 --
NM_014961chr422004 1933 --12171 --
NM_014962chr2031979 232 225 ------
NM_014964chr1742397 789 768 110 ------
NM_014969chr12860 103 ------
NM_014974chr10--11160 ----
NM_014978chr1041826 1779 629 527 --11356 --
NM_014988chr43294 188 91 ----12075
NM_014989chr61457 1665 1810 1167
NM_014991chr432419 521 373 ------
NM_014996chr31784 --2700 81 --
NM_014997chr742781 839 688 152 --2988 604 --
NM_015000chr1242541 976 537 493 12855 1322 --
NM_015001chr11261 ------
NM_015002chr1241957 1908 1900 244 11620 ----
NM_015008chr373198 3008 2838 2734 2407 1113 318 --32544 820 528 --
NM_015015chr1931993 681 625 ----1441
NM_015017chr111260 1414 11250 --
NM_015020chr1613521 23108 300 1778 11504
NM_015023chr1183 11285 1172 --
NM_015024chr8145 --11491 --
NM_015026chr1214283 1210 ----
NM_015027chr1621344 154 11822 --11390
NM_015032chr1322675 1920 1324 ----
NM_015035chr2076141 5128 4446 4415 1586 1514 1003 14261 14963 --
NM_015040chr22184 116 --12141 --
NM_015042chr1574022 3930 3811 3799 3063 2706 52 --34311 3885 1465 --
NM_015044chr1643026 2647 2219 2062 --13144 --
NM_015050chr6----21173 80 --
NM_015051chr923277 2884 --11117 --
NM_015052chr73916 397 193 ------
NM_015053chr132334 486 219 21455 39 123 --
NM_015057chr132443 197 ------
NM_015060chr7--1207 1191 --
NM_015063chr19----2367 147 --
NM_015064chr121972 13372 11318 13040
NM_015068chr73782 546 466 --1820 12740
NM_015069chr16--1583 ----
NM_015071chr576492 6395 2401 1962 1770 1181 820 12185 36474 4662 1067 14093
NM_015073chr1921897 393 22123 2105 ----
NM_015074chr161655 1548 721 666 493 108 --21769 354 --
NM_015076chr654448 3491 3273 955 342 22929 802 1975 --
NM_015087chr1322603 2429 --1988 --
NM_015092chr1624351 1373 --14501 --
NM_015093chr621816 1618 ------
NM_015097chr342090 1943 1471 783 ------
NM_015100chr162029 2000 1712 1491 1335 512 --2649 102 1682
NM_015107chrX1239 11946 ----
NM_015110chr912319 12093 1871 11784
NM_015115chr453185 2871 1042 928 886 13194 --23250 2779
NM_015124chr2212037 12020 --11531
NM_015130chr43386 328 116 ------
NM_015132chr7--11799 1272 --
NM_015133chr1621435 1306 ------
NM_015138chr1522152 1881 2523 245 12524 12618
NM_015144chr1623699 1212 13189 1839 --
NM_015150chr33179 113 68 1860 181 --
NM_015155chr1043238 2307 970 133 13050 12731 --
NM_015156chr1443004 2455 1033 618 --13133 --
NM_015161chr162579 158 ----1214
NM_015170chr811658 ----12329
NM_015172chr11189 ------
NM_015176chr121757 108 11425 ----
NM_015178chr82543 326 12681 12597 --
NM_015185chrX32670 2337 843 21866 502 ----
NM_015186chr91310 1383 ----
NM_015192chr2052661 2605 2522 583 525 ------
NM_015193chr821382 1057 --150 --
NM_015199chr342990 811 558 259 ------
NM_015200chr431941 856 789 ------
NM_015202chr16----11152 --
NM_015203chr1162 ------
NM_015206chr1573856 3822 2512 2440 1247 965 144 --1431 11003
NM_015208chr182761 656 --12892 13654
NM_015209chr132289 314 289 11599 ----
NM_015225chr931952 1063 581 ------
NM_015239chr9152 ----1137
NM_015245chr662729 2717 2243 1984 655 609 12099 ----
NM_015247chr1685032 4547 1762 1342 752 621 440 221 ------
NM_015251chr1652103 1927 1820 1482 743 11957 12071 --
NM_015252chr21650 ------
NM_015260chr1921361 1050 ------
NM_015262chr102209 157 ------
NM_015264chr2254275 4248 3832 3263 1301 13905 34618 894 559 --
NM_015265chr2----2664 562 21042 116
NM_015267chr12--11565 11366 11994
NM_015268chr3------2547 102
NM_015270chr1232290 2144 1816 --21911 1538 --
NM_015271chr41253 --43537 2756 2720 1353 --
NM_015272chr1621903 1497 ----21816 1469
NM_015275chr1231393 851 813 11889 1492 --
NM_015278chr652200 902 792 785 742 12711 ----
NM_015282chr212921 --1616 --
NM_015285chr1811613 ----12391
NM_015288chr553817 3574 3022 2658 126 --1975 --
NM_015293chr61226 1631 --1159
NM_015299chr1423056 245 1580 23278 529 12713
NM_015310chr868335 7180 6560 2500 2121 283 17210 12977 --
NM_015315chr522766 2251 1632 13249 --
NM_015317chr23800 637 595 12690 12337 12299
NM_015326chr133009 1965 724 --12705 --
NM_015327chr111226 --21243 1006 --
NM_015328chr742839 2813 2121 951 12499 1547 --
NM_015335chr1242308 1907 630 500 --1298 1488
NM_015336chr1212055 ----11036
NM_015344chr821787 607 ------
NM_015346chr141480 --21560 555 --
NM_015347chr1242527 2317 1837 767 1102 ----
NM_015349chr622064 647 12857 ----
NM_015354chr9--1335 ----
NM_015355chr171680 11604 ----
NM_015358chr2111268 --1996 --
NM_015365chrX33682 3072 303 11096 --14191
NM_015375chr134978 4533 3510 24564 638 23907 623 1276
NM_015382chr14--1130 ----
NM_015385chr1033002 1098 864 1388 1791 --
NM_015387chr241871 784 393 202 1349 11526 --
NM_015396chr31218 ------
NM_015397chr921191 685 --2305 238 --
NM_015435chr8--4977 369 195 106 ----
NM_015441chr11321 ------
NM_015443chr172484 445 ------
NM_015446chr121133 229 ------
NM_015447chr91153 ------
NM_015455chr513636 12539 11074 --
NM_015458chr8105193 5007 4922 3918 3285 2128 1855 911 753 388 1108 --13421
NM_015460chr332025 1867 829 --21609 253 --
NM_015464chr71328 --1974 --
NM_015472chr31158 ------
NM_015472chr31158 ------
NM_015477chr15------1888
NM_015481chr12--1174 1952 --
NM_015497chr1531096 1023 932 ------
NM_015508chr331531 1368 334 ------
NM_015513chr32529 91 2708 237 ----
NM_015514chr143530 227 133 --1426 --
NM_015520chr322465 1994 ------
NM_015525chr61943 ------
NM_015530chr22323 247 ------
NM_015534chr11213 1313 ----
NM_015535chr223869 2644 13848 1184 --
NM_015542chr1011036 ------
NM_015553chr644449 1955 1619 846 13658 --14234
NM_015554chr1521977 585 22552 630 ----
NM_015565chr2132085 1601 255 --11650 --
NM_015567chr13--1255 1447 --
NM_015568chr202500 307 --23604 2753 --
NM_015569chr111012 34347 1425 213 ----
NM_015570chr71624 ------
NM_015571chr622314 2225 --11055 --
NM_015575chr232709 603 133 --42992 2450 1465 1188 23481 3288
NM_015577chr51138 --1427 21516 321
NM_015578chr19------11510
NM_015602chr131829 1526 1383 --11481 --
NM_015605chr103201 149 120 --1586 --
NM_015607chr11210 ------
NM_015609chr152363 2169 2120 1100 548 --11901 --
NM_015610chr732018 1839 920 --1194 147
NM_015630chr2------1812
NM_015635chr9--11696 21891 618 --
NM_015640chr155035 3846 661 430 408 ------
NM_015642chr3------1102
NM_015657chr22844 381 ----143
NM_015670chr171115 ------
NM_015686chrX1745 --12358 --
NM_015691chrX32815 459 188 2776 740 12783 --
NM_015704chr222117 38 ------
NM_015713chr853585 3521 2283 1312 1227 ------
NM_015716chr173109 94 61 ------
NM_015723chr72721 200 ------
NM_015833chr2142152 1922 401 323 ------
NM_015836chr1129 ----1130
NM_015850chr831858 1627 501 --21784 1695 --
NM_015866chr1--1399 ----
NM_015872chr131722 1182 339 --1457 --
NM_015874chr4----190 --
NM_015878chr821852 1497 --12227 --
NM_015879chr1867423 5922 2884 441 258 200 26777 5587 36099 2751 1400 --
NM_015881chr113365 128 89 1185 1308 --
NM_015885chr111836 ------
NM_015895chr61177 ------
NM_015902chr81200 ------
NM_015904chr22674 177 ------
NM_015905chr72394 29 ------
NM_015906chr131801 1469 600 --33982 3357 1865 --
NM_015912chr832326 1671 321 ------
NM_015955chr2190 ------
NM_015975chrX31195 735 45 1184 ----
NM_015981chr522033 243 12448 33023 2518 1938 --
NM_015986chr17125 ------
NM_015995chr1545434 5117 4233 1710 --14504 --
NM_016003chr732018 1839 920 --1194 147
NM_016009chr154917 4394 1804 589 524 1238 23260 612 --
NM_016022chr11845 ------
NM_016025chr162559 405 1634 11974 1566
NM_016037chr12428 91 1978 ----
NM_016048chr52723 197 --1380 --
NM_016059chr61337 --198 --
NM_016061chr22491 369 1385 11605 --
NM_016073chr15------11148
NM_016075chr1333051 1139 459 --12514 --
NM_016076chr143005 2979 2710 735 --22786 2494 --
NM_016081chr411603 11675 ----
NM_016083chr613426 --11417 --
NM_016120chrX11167 ----11075
NM_016121chr12999 268 ----11133
NM_016131chr252248 1453 682 614 539 12351 ----
NM_016132chr1552938 2503 2280 1319 431 --12635 --
NM_016141chr3----1742 --
NM_016173chr343778 3145 2826 337 23272 742 34448 1733 1481 13796
NM_016200chr7----1203 --
NM_016205chr421245 517 ------
NM_016206chr358679 6959 3021 424 140 --29049 2419 26201 1235
NM_016217chr653650 3639 1424 1389 188 --12338 --
NM_016224chr61285 --1838 --
NM_016227chr1----1127 --
NM_016230chr6----1167 --
NM_016240chr821571 518 ------
NM_016248chr1343552 2528 2440 597 13042 ----
NM_016252chr22817 37 ------
NM_016255chr653016 2753 1334 706 354 ------
NM_016258chr1----1257 --
NM_016260chr235070 405 232 --15969 14737
NM_016264chr19133 ------
NM_016270chr191465 ------
NM_016271chr1832367 1455 150 ----1853
NM_016277chr611428 ----11388
NM_016281chr121778 11084 ----
NM_016284chr161112 1946 1288 --
NM_016287chr111973 11315 11649 --
NM_016289chr252176 809 765 302 201 --11836 --
NM_016303chrX1114 ------
NM_016304chr152745 540 ------
NM_016308chr131843 1644 1599 --11537 --
NM_016315chr211888 --11597 --
NM_016322chr922718 336 ------
NM_016333chr161485 ------
NM_016337chr141312 ------
NM_016339chr1711227 --11611 --
NM_016374chr11270 --1629 21446 475
NM_016374chr11270 --1629 21446 475
NM_016376chr1744276 3543 3128 1198 21344 1003 23707 3002 1437
NM_016395chr1511691 --21369 22 --
NM_016396chr1552371 2168 1155 953 927 ----12973
NM_016410chr9196 ------
NM_016422chr1131252 861 305 --1759 12794
NM_016424chr1721818 68 ----11384
NM_016436chr201863 --31711 637 414 --
NM_016441chr221564 1467 126 ----
NM_016470chr201486 ------
NM_016480chr51214 --1790 --
NM_016488chr1211692 ----1360
NM_016490chr21362 --1301 138
NM_016494chr2168 ------
NM_016505chr11739 --1132 --
NM_016506chr113578 566 162 1450 ----
NM_016507chr1732780 2757 2649 --42194 1962 500 413 --
NM_016516chr22579 264 ------
NM_016522chr1111461 ------
NM_016525chr92863 629 ------
NM_016530chr1563978 3382 2822 1108 946 500 11207 13824 --
NM_016531chr443967 3161 2901 1470 1783 ----
NM_016539chr192466 28 ------
NM_016542chrX11260 ------
NM_016545chr12805 164 ------
NM_016559chr3----1995 --
NM_016577chr343261 1309 839 216 1492 122 24263 3550
NM_016603chr521377 244 --11655 11972
NM_016604chr51284 --1814 --
NM_016613chr462377 2286 2047 998 551 51 ----12063
NM_016621chr1134553 2812 454 1390 43993 3834 3601 3206 --
NM_016626chr181203 1113 ----
NM_016628chr10125 ------
NM_016631chr211706 ------
NM_016653chr2165 ------
NM_016654chr151952 ------
NM_016823chr171367 ------
NM_016836chr21726 --1765 --
NM_016839chr21726 --1765 --
NM_016936chr1642223 2065 1760 1496 --12138 --
NM_016937chrX2344 283 ------
NM_016950chr411295 --11376 --
NM_016952chr1121098 641 1632 ----
NM_017410chr1221167 406 ----1227
NM_017413chrX1555 ------
NM_017420chr1413598 --23522 1401 --
NM_017431chr21121 ----1700
NM_017437chr1452301 2182 1793 286 252 --1195 --
NM_017447chr2133021 2987 1424 --1754 --
NM_017450chr1721172 90 ------
NM_017455chr151869 ------
NM_017456chr17------11613
NM_017482chr241571 1524 1439 176 --11538 11062
NM_017489chr811189 ------
NM_017522chr151439 1335 897 380 85 --1906 --
NM_017546chr22328 92 ------
NM_017548chr322160 1517 ------
NM_017569chr13------1260
NM_017575chr1741615 1218 551 468 --11129 --
NM_017580chr1022107 653 ------
NM_017582chr111700 --11719 --
NM_017583chr1131635 1266 72 11601 ----
NM_017594chr931302 1255 896 12353 ----
NM_017596chr123173 1703 14527 ----
NM_017599chr121137 ------
NM_017611chr11137 ------
NM_017612chr122229 81 ------
NM_017617chr9128 --1647 --
NM_017626chr1021555 720 ------
NM_017629chr11301 ------
NM_017632chr4181 ------
NM_017633chr62868 135 --13616 --
NM_017634chr82343 274 ------
NM_017635chr1121179 414 --2577 451 --
NM_017637chr988625 8328 7714 6796 6178 3746 3555 3358 --38733 8681 2705 --
NM_017638chr1171 ------
NM_017641chr121439 ------
NM_017643chr1712748 12164 ----
NM_017644chr334912 4848 4016 13309 --14453
NM_017650chr755943 4161 1557 1116 926 ------
NM_017655chr12496 104 ----11118
NM_017657chr21793 ------
NM_017658chr1421030 577 --13212 --
NM_017660chr193916 406 245 11307 ----
NM_017661chr1521030 272 1483 ----
NM_017668chr161533 ------
NM_017672chr15126 ------
NM_017686chr111065 ------
NM_017694chr221438 719 ------
NM_017709chr131686 638 631 --21427 93 --
NM_017712chr1975955 5369 4590 2225 2194 2162 645 22537 1957 56204 5617 1742 504 401 --
NM_017714chr20------1594
NM_017719chr331937 941 79 ----11930
NM_017730chr31220 ------
NM_017736chr1663104 3022 2319 2136 876 29 11139 1850 --
NM_017737chr121882 1500 --1372 --
NM_017740chr1641726 1470 1286 261 11714 1531 --
NM_017742chr181374 11358 ----
NM_017747chr5--1105 ----
NM_017748chr172732 25 ------
NM_017752chrX21507 169 11429 --12143
NM_017753chr9----1883 --
NM_017754chr634440 1339 964 14248 24075 1044 1330
NM_017758chr1731306 1120 145 --1942 --
NM_017769chr1423072 2493 --12721 1852
NM_017770chr622854 47 22260 2112 ----
NM_017772chr641715 1561 1310 1231 --1448 --
NM_017778chr81293 --1143 --
NM_017779chr132179 926 564 12391 ----
NM_017786chr82554 453 ------
NM_017799chr1441855 1502 1494 1328 1454 ----
NM_017811chr913091 --12814 --
NM_017813chr865054 4410 4238 3543 2134 1382 1816 11270 25426 3857
NM_017822chr122772 172 ------
NM_017824chr1021862 612 --11708 --
NM_017848chrX53811 1852 1452 1242 360 11167 --11504
NM_017849chr252845 2217 746 556 195 12470 ----
NM_017857chr11----1677 --
NM_017896chr2031226 707 439 --2814 569 --
NM_017907chr111498 ------
NM_017910chr21245 ------
NM_017921chr1721929 1677 ------
NM_017938chrX1394 --139 11742
NM_017943chr142916 34 ------
NM_017944chr1162876 2015 1988 1926 932 40 1949 --12587
NM_017945chr3--11204 --1880
NM_017983chr17148 ------
NM_017987chr1022003 96 1294 ----
NM_017988chr124924 606 320 79 ------
NM_017994chr742320 2025 487 372 22850 846 ----
NM_017998chr911145 --11023 --
NM_018011chr13172 ------
NM_018018chr1211885 1694 ----
NM_018024chr82568 95 ----1585
NM_018028chr192975 70 ------
NM_018030chr18--11119 180 --
NM_018032chr162990 309 ----1730
NM_018036chr1413850 --12956 13175
NM_018037chr12116 22 ------
NM_018046chr52627 139 --1694 --
NM_018049chr192102 95 1118 ----
NM_018061chr11377 --11182 --
NM_018063chr101370 1344 ----
NM_018078chr41306 ------
NM_018084chr232715 1294 768 ------
NM_018092chr16----11245 --
NM_018095chr113578 566 162 1450 ----
NM_018105chr811072 1935 --1253
NM_018113chr121443 1486 ----
NM_018115chr43823 663 522 --1758 --
NM_018116chr1------1550
NM_018119chr16------1277
NM_018120chr821403 225 --11528 --
NM_018121chr1042936 2183 1205 1037 1549 ----
NM_018126chr431561 1282 497 ------
NM_018128chr171593 11056 1955 --
NM_018133chr321540 75 ------
NM_018155chr343240 2863 2622 699 --1580 11389
NM_018157chr1232361 647 121 --11148 --
NM_018167chr14------1370
NM_018169chr121159 --1369 --
NM_018172chr1111102 ------
NM_018178chr131262 269 150 ------
NM_018179chr121203 --1615 --
NM_018181chr1811241 --11899 1774
NM_018182chr1742234 551 226 194 11897 ----
NM_018184chr331586 355 219 ------
NM_018191chr131170 ------
NM_018195chr1161982 1972 1941 679 215 63 ------
NM_018198chr131401 1336 1275 --1474 --
NM_018206chr162109 66 ------
NM_018208chr121174 809 ------
NM_018221chr21444 ------
NM_018240chr12884 49 ----1868
NM_018243chr42801 620 --13443 --
NM_018244chr202850 432 --137 --
NM_018247chr611088 12124 ----
NM_018254chr122419 835 --2977 430 --
NM_018268chr51619 --1350 --
NM_018279chr1222835 803 ------
NM_018287chr102909 477 ------
NM_018293chr382686 2115 812 579 511 488 386 176 12566 ----
NM_018298chr13940 803 395 ----1263
NM_018299chr842745 2521 2318 768 1781 ----
NM_018302chr41497 --12412 12457
NM_018312chr111770 --31906 1864 805 --
NM_018313chr352570 2284 2035 357 335 ------
NM_018314chr111287 ------
NM_018315chr441560 1394 1345 127 1235 ----
NM_018318chr121945 --1184 --
NM_018320chr1141173 1096 329 197 1280 ----
NM_018327chr2021534 1355 ------
NM_018328chr2----1453 --
NM_018330chr101417 ------
NM_018334chr7------1203
NM_018351chr1234630 731 425 --23977 3466 --
NM_018360chrX174 ------
NM_018362chr1133797 3614 2662 13363 12764 --
NM_018363chr10--1326 ----
NM_018364chr142720 2536 396 72 --23852 556 --
NM_018367chr111285 ----1191
NM_018368chr6----1224 --
NM_018371chr81155 --31376 1133 1126 --
NM_018373chr1486396 6106 2418 2040 1801 1622 595 214 25609 1604 11191 21835 1258
NM_018374chr774826 1913 1595 1588 1523 1405 1184 14000 1751 --
NM_018388chrX2937 341 ------
NM_018403chr353857 3619 3149 1564 426 2176 56 11530 --
NM_018416chr1252528 1807 847 792 755 --1888 --
NM_018440chr897799 7129 7003 6762 1925 1617 1363 1257 437 --12833 --
NM_018442chr12145 103 ------
NM_018448chr12----1146 --
NM_018452chr6_random43304 2667 1531 1404 --12771 --
NM_018469chr1711180 --1282 --
NM_018482chr831974 217 164 --2937 310 --
NM_018486chrX2513 23 --1159 --
NM_018489chr11497 --11732 --
NM_018490chr1111520 11224 11446 --
NM_018492chr82546 26 ------
NM_018553chr17--1245 11648 --
NM_018555chr19--1830 142 1688
NM_018557chr231345 1216 1173 ------
NM_018569chr421524 1148 --11558 --
NM_018584chr111144 ------
NM_018602chr15----3419 308 150 --
NM_018638chr1245615 3840 1432 1205 25596 1319 11682 --
NM_018639chr1211255 --1399 1972
NM_018640chr1242181 2070 996 753 1982 1800 --
NM_018649chr102520 204 ----1532
NM_018650chr111897 --22238 1509 --
NM_018652chr151403 ------
NM_018657chr31658 ----1178
NM_018683chr2011293 --11704 --
NM_018688chr83970 312 234 ------
NM_018695chr5----1478 --
NM_018697chr742383 1590 553 367 1667 ----
NM_018700chr511226 ------
NM_018708chr191604 ------
NM_018710chr81104 ------
NM_018715chr132245 2031 2012 ------
NM_018717chr442158 2147 726 534 ------
NM_018719chr711416 11281 31232 1208 362 --
NM_018841chr123562 2492 32447 1274 784 --22591 234
NM_018846chr7188 ------
NM_018898chr52283 220 1633 ----
NM_018899chr52283 220 1633 ----
NM_018900chr52283 220 1633 ----
NM_018901chr52283 220 1633 ----
NM_018902chr52283 220 1633 ----
NM_018903chr52283 220 1633 ----
NM_018904chr52283 220 1633 ----
NM_018905chr52283 220 1633 ----
NM_018906chr52283 220 1633 ----
NM_018907chr52283 220 1633 ----
NM_018908chr52283 220 1633 ----
NM_018909chr52283 220 1633 ----
NM_018910chr52283 220 1633 ----
NM_018911chr52283 220 1633 ----
NM_018912chr521235 516 --11761 --
NM_018913chr521235 516 --11761 --
NM_018914chr521235 516 --11761 --
NM_018915chr521235 516 --11761 --
NM_018916chr521235 516 --11761 --
NM_018917chr521235 516 --11761 --
NM_018918chr521235 516 --11761 --
NM_018919chr521235 516 --11761 --
NM_018920chr521235 516 --11761 --
NM_018921chr521235 516 --11761 --
NM_018922chr521235 516 --11761 --
NM_018923chr521235 516 --11761 --
NM_018924chr521235 516 --11761 --
NM_018925chr521235 516 --11761 --
NM_018926chr521235 516 --11761 --
NM_018927chr521235 516 --11761 --
NM_018928chr521235 516 --11761 --
NM_018929chr521235 516 --11761 --
NM_018937chr53729 296 145 1153 ----
NM_018948chr11934 --1495 --
NM_018951chr73507 199 157 --1349 --
NM_018955chr171132 ------
NM_018959chr193742 274 132 --1490 1708
NM_018970chr72963 683 ------
NM_018976chr1232839 1114 587 11871 ----
NM_018977chrX1983 ------
NM_018979chr1222521 2073 ------
NM_018992chr1651549 1390 1185 626 529 1373 21257 493 --
NM_018993chr202528 286 --31393 1363 1140 1399
NM_018999chr1073492 3014 2998 1878 1261 1058 87 --34324 4299 4055 --
NM_019001chr324221 3196 --14089 24400 3019
NM_019004chr722083 577 --1379 --
NM_019006chr153638 256 135 ------
NM_019027chr412518 --1862 --
NM_019042chr721054 292 --11094 --
NM_019045chrX1691 1217 ----
NM_019050chr41904 21798 560 ----
NM_019053chr101713 --1376 --
NM_019063chr21707 --1113 --
NM_019066chr15----2287 130 --
NM_019072chr531054 421 37 11685 ----
NM_019083chr111439 ------
NM_019084chr1022389 2084 22464 2290 1355 --
NM_019087chr521516 318 11078 --197
NM_019091chr211158 1368 ----
NM_019094chr1253570 2960 1426 323 53 ----12908
NM_019096chr611038 --1779 --
NM_019106chr2232837 1265 527 1345 12594 11200
NM_019114chr992416 2384 2309 2254 2040 2000 437 147 65 --22579 2362 --
NM_019116chr1663391 2742 2536 1384 1275 1224 --23646 2645 --
NM_019555chr31504 ------
NM_019558chr21259 ------
NM_019590chr1021385 177 ------
NM_019592chr9--1205 1602 --
NM_019593chr2042515 2491 1241 97 ------
NM_019597chrX2700 577 ------
NM_019605chr13645 621 482 ------
NM_019610chr121407 305 --11514 --
NM_019843chr22287 78 ------
NM_019849chr191162 ------
NM_019860chr101474 --1610 --
NM_019895chr31184 ------
NM_020039chr121464 11958 ----
NM_020122chr242060 1949 1686 356 14218 14270 --
NM_020123chr1031091 1053 141 199 ----
NM_020144chr731590 851 681 --11430 --
NM_020148chr1853007 2996 2554 2281 88 --43118 2346 1130 259 --
NM_020177chr53744 337 269 --1161 --
NM_020178chr17----1829 --
NM_020179chr11----175 --
NM_020180chr181389 ------
NM_020189chr8129 ------
NM_020193chr11----1341 --
NM_020194chr21616 ------
NM_020205chr143494 3038 1349 1141 12803 ----
NM_020210chr151950 ----134
NM_020211chr1531574 1392 45 11152 ----
NM_020228chr11----12058 --
NM_020231chr32600 123 ------
NM_020235chr31267 ------
NM_020245chr665014 4993 4865 4833 4398 4169 --14424 --
NM_020251chr111131 --183 --
NM_020307chr32387 37 ------
NM_020309chr192724 322 1281 1854 2806 259
NM_020310chr171407 --1881 --
NM_020336chr2093340 2683 2629 2545 2458 1530 1415 1399 300 ----1885
NM_020337chr432901 1051 983 --22408 968 --
NM_020338chr1062838 2391 2302 1419 320 238 ------
NM_020341chr2011458 1222 ----
NM_020342chr232453 873 101 ------
NM_020347chr342172 2092 1918 929 11495 ----
NM_020362chr1----1808 --
NM_020363chrY1128 11537 21392 1369 --
NM_020374chr1221937 1920 ----11618
NM_020378chr191577 ------
NM_020381chr641929 1723 508 347 1723 ----
NM_020382chr1221564 177 ------
NM_020390chr354207 4048 3230 605 233 11113 ----
NM_020420chrY1128 11537 21392 1369 --
NM_020423chr12452 76 --1212 --
NM_020429chr742506 2317 1933 964 --1265 --
NM_020432chr731966 1712 460 ------
NM_020438chr931368 1301 382 ------
NM_020440chr11291 --1513 --
NM_020443chr176136 5064 4735 4335 831 529 317 15300 24819 968 --
NM_020444chr51449 --267 36 --
NM_020445chr71751 ------
NM_020452chr151735 1560 636 537 503 ------
NM_020455chr61269 --32633 2147 1839 --
NM_020456chr1321610 1441 11823 12285 --
NM_020466chr613059 --13076 --
NM_020474chr182764 338 ------
NM_020475chr83399 317 291 1164 ----
NM_020476chr83399 317 291 1164 ----
NM_020477chr83399 317 291 1164 ----
NM_020478chr83462 380 354 1227 ----
NM_020480chr83399 317 291 1164 ----
NM_020532chr21889 ------
NM_020640chr32514 184 ----11909
NM_020644chr11--178 2972 622 --
NM_020647chr821907 1529 --1212 --
NM_020651chr211490 ------
NM_020666chr5--1729 ----
NM_020673chr2077468 7061 6594 5289 2746 1090 770 26159 5229 35959 404 237 14716
NM_020689chr2031704 1503 454 ------
NM_020693chr111402 ------
NM_020699chr135283 3665 1529 --25447 1878 --
NM_020708chr20----22479 774 --
NM_020717chrX11921 2815 762 ----
NM_020718chr1664710 4364 4111 4091 2377 1900 --14641 25855 5604
NM_020727chr2173845 3469 2917 2909 1284 325 229 1738 13460 --
NM_020734chr122609 353 --12938 --
NM_020739chr1532578 849 188 ------
NM_020742chrX22605 828 --12279 --
NM_020748chr1722161 1393 ------
NM_020752chr1042713 801 754 705 ------
NM_020760chr221621 522 ------
NM_020762chr1211038 --1121 --
NM_020766chrX33777 634 212 ----13686
NM_020771chr611209 --11502 --
NM_020772chr17147633 7616 7585 7567 7473 6019 5509 3405 3274 2458 1637 817 508 70 --1739 --
NM_020773chr432692 2339 2183 ------
NM_020774chr1855984 4697 1609 378 61 12485 1250 --
NM_020781chr753122 2949 826 696 596 --21282 922 12067
NM_020783chr1822061 537 ------
NM_020791chr1711143 ----1368
NM_020796chr532007 1103 181 --12386 --
NM_020801chr532097 1844 1789 --2930 759 --
NM_020804chr642528 2076 599 484 --1393 --
NM_020805chr181238 --1120 --
NM_020808chr13948 297 71 1393 ----
NM_020809chr1132250 252 213 1708 ----
NM_020810chr1423423 87 ------
NM_020818chr14137 ------
NM_020819chr6----1308 --
NM_020824chr10----1690 1118
NM_020839chr31449 ------
NM_020841chr1234066 1567 71 --11043 13423
NM_020850chr1643184 2727 2005 701 --22719 366 --
NM_020858chr1521554 182 ----131
NM_020860chr42116 85 ------
NM_020868chr231964 1739 1507 --1232 --
NM_020870chr422111 555 22234 1670 ----
NM_020871chrX32035 1585 741 ----1507
NM_020872chr331196 1111 550 ------
NM_020873chr32217 200 ------
NM_020886chr1121252 287 11005 ----
NM_020899chr17--21800 527 31567 939 519 --
NM_020922chrX21543 1239 ----11267
NM_020925chr11909 ------
NM_020927chr1632270 2012 36 ----12330
NM_020940chr1012545 ----1196
NM_020951chr19121 ------
NM_020956chr1973685 2893 1913 1835 1757 1679 1400 14220 11003 --
NM_020962chr1562030 1900 1770 1638 609 22 --11007 --
NM_020967chr2051238 1014 844 396 283 ----11175
NM_020971chr191633 --1888 --
NM_020975chr1031647 636 162 ------
NM_020977chr441811 1388 1369 838 ------
NM_020983chr1232290 2144 1816 --21911 1538 --
NM_020988chr1621285 450 11110 ----
NM_020993chr1262830 2675 1792 603 498 381 --1889 --
NM_021005chr15157 ------
NM_021007chr232209 1721 212 ------
NM_021012chr173761 373 269 1401 ----
NM_021025chr5----1353 --
NM_021032chr31439 ------
NM_021033chr1373347 2918 2659 2321 2191 1291 717 13292 --1673
NM_021038chr333244 3084 2908 ----21092 634
NM_021044chr122420 141 ------
NM_021061chr814281 23865 1629 ----
NM_021069chr43497 432 102 11848 12019 --
NM_021079chr1732732 2300 502 23096 130 43262 1173 574 481 --
NM_021090chr2231800 1594 337 ------
NM_021097chr242793 999 296 275 ----1338
NM_021106chr92705 307 ------
NM_021110chr82614 78 ----1533
NM_021111chr921050 75 ------
NM_021120chrX33103 957 799 ------
NM_021132chr10----1980 --
NM_021136chr141229 ------
NM_021140chrX21137 72 ------
NM_021145chr72977 326 ------
NM_021148chr752275 1004 813 807 792 ----11640
NM_021155chr1932544 1915 762 --22550 525 --
NM_021159chr441676 1374 621 65 --1560 --
NM_021174chr82758 478 ----1709
NM_021177chr61118 ------
NM_021183chrX11583 --22215 1960 --
NM_021189chr1----1233 1412
NM_021190chr12468 118 ------
NM_021202chr2011019 ----12813
NM_021215chr2042235 426 271 203 --1459 --
NM_021220chr20162 ------
NM_021222chr121303 176 ------
NM_021238chr1231404 1383 1377 1269 11389 --
NM_021240chr9------1209
NM_021242chrX1305 --1993 --
NM_021620chr61755 ------
NM_021622chr10291 60 --11900 --
NM_021629chr364417 4031 4020 1728 1154 1004 13648 11144 15076
NM_021631chr8182 ------
NM_021637chrX21253 142 ------
NM_021638chr434439 3262 1519 ------
NM_021643chr221886 1393 11649 11340 --
NM_021644chr10----11024 --
NM_021647chr474180 4036 3779 3118 1569 1466 500 --32949 1258 977 --
NM_021785chrX155 ------
NM_021809chr205888 774 714 524 50 11573 32050 1554 313 12140
NM_021813chr675643 5631 2337 2185 1727 1620 721 --11389 --
NM_021814chr611400 --1607 --
NM_021818chr1421244 424 ------
NM_021905chr61422 1135 --135
NM_021911chr554211 4042 1352 1230 199 14236 1515 --
NM_021912chr1543600 3475 607 549 23224 1433 1557 --
NM_021913chr19--2605 311 ----
NM_021914chr1451893 1853 1815 1791 83 ------
NM_021943chr611823 --1400 --
NM_021945chr643118 1297 1126 531 --21420 509 --
NM_021946chrX----1480 --
NM_021949chrX32738 2473 718 ------
NM_021951chr92198 120 ----1258
NM_021954chr1343456 3118 2731 157 ------
NM_021956chr6----11408 --
NM_021960chr142441 2329 1881 564 --1570 --
NM_021961chr1175438 5102 5012 3009 2610 2462 1518 --15678 17180
NM_021964chr355791 4119 1439 1080 465 12020 24327 1838 --
NM_021977chr653814 3530 3288 1085 643 --1562 --
NM_021988chr2021214 1123 1462 1523 --
NM_021998chrX11153 187 11290 --
NM_021999chr13--1119 ----
NM_022041chr162129 105 ------
NM_022048chr1586228 4602 4083 1930 1900 1764 405 353 12065 24570 523 15531
NM_022051chr11245 ------
NM_022068chr181103 ------
NM_022080chr2052763 1948 1111 1078 90 ------
NM_022091chr622501 2432 11941 --1121
NM_022114chr154289 4214 1873 929 485 11342 ----
NM_022117chrX2229 149 ------
NM_022118chr13--1485 ----
NM_022123chr141459 ------
NM_022130chr531340 267 72 --2135 109 11262
NM_022133chr8----11756 --
NM_022137chr1432038 1316 1272 11281 --1170
NM_022138chr621371 470 --1337 1184
NM_022166chr1695438 5408 5108 4843 4133 2363 1737 1266 1144 --22458 1839 --
NM_022170chr751424 1221 467 182 163 ------
NM_022171chr321596 315 --149 --
NM_022307chr72572 234 ------
NM_022340chr312384 --13386 --
NM_022373chr72132 52 ------
NM_022374chr21169 ------
NM_022442chr2021214 1123 1462 1523 --
NM_022459chr13104508 4399 4245 4239 4180 4127 4034 2529 1119 970 16075 1677 --
NM_022461chr32335 170 11447 --11073
NM_022465chr1232841 2111 1899 --1840 --
NM_022467chr191372 --1439 --
NM_022469chr141089 894 809 630 13043 ----
NM_022476chr16------1360
NM_022477chr2021646 365 ------
NM_022484chr711241 1451 ----
NM_022552chr22998 168 1930 ----
NM_022553chr62211 127 ------
NM_022574chr741516 1412 1354 348 --1649 --
NM_022658chr122431 158 ------
NM_022716chr122655 285 11202 ----
NM_022719chr2243473 3242 2914 1516 --23133 668 --
NM_022720chr222567 324 1150 11350 --
NM_022725chr112427 350 ------
NM_022731chr12104 92 ------
NM_022733chr12943 106 ------
NM_022735chr131827 1398 125 --1437 --
NM_022748chr721124 458 --1986 --
NM_022749chr82494 100 1158 21070 202 --
NM_022755chr911920 --22594 2324 --
NM_022771chr122707 375 1346 --1729
NM_022776chr321530 1046 --11222 --
NM_022780chr211421 21630 192 ----
NM_022781chr93811 600 265 --186 22687 1278
NM_022784chr151235 ------
NM_022817chr232214 867 673 11509 2582 380 --
NM_022821chr11169 ------
NM_022824chr531718 753 255 --1192 --
NM_022826chr22827 755 ------
NM_022840chr1811120 --21200 28 --
NM_022841chr15--1535 1133 --
NM_022843chr1321097 256 --11084 --
NM_022845chr1652074 1916 1841 1721 159 ------
NM_022875chr51423 ------
NM_022877chr51423 ------
NM_022893chr222623 713 --13072 --
NM_022898chr1474685 4226 2966 1048 1039 741 601 --11416 14824
NM_022912chr222377 1177 --32719 529 522 --
NM_022970chr101203 --11117 --
NM_022977chrX148 1458 ----
NM_023000chr14192 ------
NM_023001chr14192 ------
NM_023009chr12718 576 ------
NM_023016chr222388 960 22405 2355 1686 --
NM_023034chr82189 169 ------
NM_023037chr131130 ------
NM_023071chr121272 --1141 --
NM_023074chr192867 229 ------
NM_023076chr1622977 1931 1220 11830 12048
NM_023105chr831858 1627 501 --21784 1695 --
NM_023106chr831858 1627 501 --21784 1695 --
NM_023110chr831858 1627 501 --21784 1695 --
NM_023111chr831858 1627 501 --21784 1695 --
NM_023925chr12190 ------
NM_023927chr52980 948 --11171 --
NM_023929chr842309 2277 844 495 ----12091
NM_023940chr44981 647 390 286 ------
NM_023943chr31164 ----1203
NM_024007chr522344 531 ----12871
NM_024016chr171616 --2582 570 --
NM_024019chr41765 --1172 --
NM_024046chr3165 --1242 --
NM_024052chr1752944 2763 2453 2100 685 ------
NM_024055chr51642 ------
NM_024060chr111276 ------
NM_024076chr1931885 1552 313 1530 ----
NM_024077chr92589 66 --2729 244 --
NM_024085chr23970 898 658 ------
NM_024087chrX2670 600 ------
NM_024090chr421895 1624 ------
NM_024092chr1111221 1837 3368 346 290 --
NM_024094chr82693 638 --2885 278 --
NM_024095chr122348 107 --1227 --
NM_024117chr9----1218 --
NM_024293chr22198 41 ------
NM_024295chr8--11403 21306 834 --
NM_024306chr162475 92 ------
NM_024337chr5------1292
NM_024415chr5129 ------
NM_024424chr11----1440 1860
NM_024425chr11----1440 1860
NM_024426chr11----1440 1860
NM_024493chr6--196 ----
NM_024496chr142657 227 ------
NM_024503chr11275 --131 --
NM_024519chr161269 ------
NM_024524chr33878 859 617 ------
NM_024539chrX1151 --11097 --
NM_024545chr2173 ------
NM_024546chr133286 274 28 11017 ----
NM_024551chr122243 122 --1297 --
NM_024551chr122243 122 --1297 --
NM_024556chr111399 --1421 --
NM_024561chr132867 56 ------
NM_024563chr52708 287 --1727 --
NM_024569chr122589 406 ------
NM_024581chr6179 ------
NM_024595chr12859 72 ------
NM_024613chr831672 546 206 --1470 --
NM_024617chr92593 305 1101 ----
NM_024635chr91247 ------
NM_024639chr622678 2079 ------
NM_024645chr82168 85 11574 ----
NM_024653chr711356 --1296 --
NM_024664chr11139 --178 --
NM_024665chr353810 1831 811 751 490 ------
NM_024674chr123099 733 12277 22337 936 --
NM_024700chr14458 355 288 35 ------
NM_024704chr201369 --1404 --
NM_024713chr1531434 1036 31 ------
NM_024721chr812569 12035 ----
NM_024744chr222481 2150 --22552 1651 11690
NM_024751chr422031 212 --11301 --
NM_024753chr2127 ------
NM_024755chr151315 ------
NM_024757chr91120 --1812 --
NM_024761chr964541 3946 3661 660 523 420 ------
NM_024787chr81142 1877 ----
NM_024789chr102937 71 2418 281 1924 --
NM_024792chr172779 236 --1842 --
NM_024812chr811716 --21888 488 --
NM_024814chr71143 ------
NM_024824chr141183 ------
NM_024828chr911586 ------
NM_024830chr51670 --1314 --
NM_024835chr171338 ------
NM_024896chr942511 1988 768 675 --156 --
NM_024899chr182496 106 ------
NM_024911chr11341 --1122 --
NM_024913chr72494 487 ------
NM_024917chrX2845 120 1349 ----
NM_024920chr4----11403 165
NM_024939chr161103 21238 1182 ----
NM_024941chr541323 379 362 24 ------
NM_024944chr212990 82 ------
NM_024947chr388497 6900 6523 6076 3825 3600 2544 612 38472 8244 7493 11737 --
NM_024949chr484880 3828 3673 1296 831 779 365 93 14660 24815 559 --
NM_024953chr1232480 867 493 22687 1005 --12001
NM_024989chr237030 7023 179 37343 7326 2370 1477 --
NM_024991chr1033002 1098 864 1388 1791 --
NM_024993chr221074 599 ------
NM_024997chr1621331 171 11035 ----
NM_025054chr833363 2858 721 ----1970
NM_025058chr11735 ------
NM_025061chr191165 ------
NM_025076chr2----162 --
NM_025079chr1160 ----1504
NM_025083chr1511657 21416 1306 1403 --
NM_025112chr3----195 --
NM_025134chr16--12177 ----
NM_025146chr341923 1713 611 221 ------
NM_025154chr721205 588 ------
NM_025160chr153541 2959 1325 987 60 ------
NM_025182chr91219 ------
NM_025184chrX2758 247 ------
NM_025191chr162912 1280 1131 1082 405 86 23239 102 --11385
NM_025195chr81494 --21927 1603 --
NM_025203chr22317 238 --3510 306 136 1405
NM_025212chr41130 ------
NM_025222chr32822 403 --12047 --
NM_025230chr1411260 1577 1690 --
NM_025237chr1721451 81 --1470 --
NM_025248chr1742010 986 962 182 13243 33081 1983 1251 --
NM_025250chr732969 2778 2041 13036 13018 --
NM_025263chr621634 381 ------
NM_030567chr52158 58 ------
NM_030569chr1062150 1248 1039 719 658 36 ------
NM_030594chr152842 232 --198 1443
NM_030621chr1423354 2967 --14023 --
NM_030623chr2161 ------
NM_030625chr1032289 1881 778 11038 ----
NM_030627chr521656 1115 ------
NM_030629chr1641706 1416 1372 1328 ------
NM_030637chr14------1740
NM_030640chr121624 --1936 --
NM_030645chr131422 1076 24 --2449 336 --
NM_030647chr735833 5725 868 15736 ----
NM_030648chr465084 4515 4308 2026 1708 355 11530 1511 11755
NM_030650chr212939 13665 23925 2809 --
NM_030660chr142580 342 --1410 --
NM_030664chr10----21665 623 --
NM_030674chr1235078 4845 4156 23942 2232 2473 299 14513
NM_030751chr102695 394 ------
NM_030751chr102695 394 ------
NM_030753chr172244 227 ------
NM_030755chr1442983 1987 203 69 ------
NM_030758chr2221278 1145 --11471 --
NM_030762chr1231931 1661 655 --11978 --
NM_030766chr122282 92 1205 ----
NM_030774chr11137 --11316 --
NM_030775chr122933 221 ------
NM_030791chr14192 ------
NM_030805chr21412 --11028 --
NM_030806chr1108566 7382 7239 7097 6983 6746 2837 2452 1890 314 11867 1675 --
NM_030808chr171983 ----1228
NM_030809chr1211697 ----11882
NM_030816chr133404 2547 1200 --12405 --
NM_030877chr20----179 --
NM_030881chr223604 542 185 --22289 1543 12130
NM_030884chr311512 --11453 --
NM_030915chr242040 1802 152 120 ------
NM_030918chr114164 15230 34288 1669 499 --
NM_030919chr202202 194 --127 --
NM_030920chr121895 129 --11441 --
NM_030937chr121162 1024 ------
NM_030939chr64892 828 796 356 ------
NM_030949chr641558 1121 1080 185 --11109 --
NM_030963chr61574 ------
NM_030964chr573028 2664 2440 2389 1150 263 206 ----13505
NM_030978chr92464 304 ------
NM_030979chr131427 ------
NM_030981chr11----1111 --
NM_031216chr182780 236 ------
NM_031229chr201528 ------
NM_031243chr7--21755 27 ----
NM_031244chr621131 192 ------
NM_031262chr91251 ------
NM_031263chr91308 ------
NM_031268chr1653504 3282 1940 1257 1193 --44249 3993 3688 1876 25260 2065
NM_031283chr22856 179 --1600 --
NM_031284chr15173 ------
NM_031296chr432218 2196 189 1976 --11960
NM_031309chr82920 242 ------
NM_031369chr41331 ------
NM_031370chr41331 ------
NM_031371chr11270 --1629 21446 475
NM_031371chr11270 --1629 21446 475
NM_031407chrX--1494 ----
NM_031409chr61383 --31756 1750 1111 --
NM_031411chr52283 220 1633 ----
NM_031412chr12----1235 --
NM_031426chr93724 457 296 --12693 11991
NM_031427chr1443662 2154 1914 784 24352 1415 25812 1320 --
NM_031445chr242915 2857 2365 976 1931 ----
NM_031453chr1052502 2355 744 334 132 1986 11703 --
NM_031459chr1----11636 --
NM_031461chr821549 207 ------
NM_031465chr12----2911 267 --
NM_031468chr746567 5658 487 224 11790 86038 5755 5361 3298 2328 825 678 505 16561
NM_031475chr11519 ------
NM_031476chr1662790 2578 847 677 518 43 12244 12623 --
NM_031483chr2032827 2207 1327 ------
NM_031844chr1----22521 760 --
NM_031845chr233566 3289 1133 ----22724 215
NM_031847chr233566 3289 1133 ----22724 215
NM_031849chr52283 220 1633 ----
NM_031857chr52283 220 1633 ----
NM_031860chr52283 220 1633 ----
NM_031892chrX1247 ------
NM_031922chr62467 44 ------
NM_031954chr1241163 664 364 263 12050 1563 --
NM_031989chr121232 ------
NM_031992chr751424 1221 467 182 163 ------
NM_032012chr994922 3974 3291 570 454 398 283 248 220 --14852 --
NM_032013chr2021646 365 ------
NM_032023chr102926 512 1319 ----
NM_032041chr832760 2560 372 ------
NM_032047chr322315 818 ------
NM_032052chr22--21325 306 ----
NM_032088chr521235 516 --11761 --
NM_032092chr521235 516 --11761 --
NM_032102chr1162797 2654 1234 1158 942 304 ------
NM_032105chr1108005 7753 7688 7060 6875 6324 5912 5472 5342 5112 --25803 5327 27682 808
NM_032109chr51549 ------
NM_032121chrX32736 2215 833 --11971 --
NM_032124chr181382 ------
NM_032128chr421019 400 ------
NM_032131chr61121 ------
NM_032138chr132529 108 ------
NM_032139chr192991 107 2444 317 ----
NM_032144chr231174 1168 191 ------
NM_032153chr3112741 2676 2307 2252 2240 2218 1842 1802 796 482 201 --11071 --
NM_032156chr12190 ------
NM_032160chr1823490 1154 --12994 --
NM_032175chr521757 178 11158 11304 11364
NM_032181chr2----1283 --
NM_032182chr1021143 567 ------
NM_032199chr1052983 2726 1469 1418 72 --32882 1516 1322 12441
NM_032208chr232893 2609 369 11306 21137 784 1874
NM_032217chr431119 296 122 --21032 884 --
NM_032221chr2022056 625 ------
NM_032229chr1311016 ------
NM_032233chr142859 139 --1851 --
NM_032236chr12868 690 ------
NM_032268chr1643196 882 553 527 12298 ----
NM_032271chr1621435 88 --126 --
NM_032281chr1942878 2500 361 265 12970 ----
NM_032283chr111277 --1141 --
NM_032288chr321852 1522 12384 ----
NM_032291chr12215 77 ------
NM_032295chr71241 ------
NM_032312chr21674 ------
NM_032317chr731677 1381 1339 ------
NM_032320chr113647 164 135 ------
NM_032352chr143419 280 256 ------
NM_032353chr172150 49 ------
NM_032373chr1044646 4443 3862 477 ------
NM_032403chr521235 516 --11761 --
NM_032410chr82308 179 ------
NM_032420chr52909 232 ------
NM_032427chr111430 ------
NM_032430chr191295 --1422 --
NM_032432chr431501 1030 228 --199 --
NM_032433chr192475 104 --1383 11007
NM_032434chr221387 548 --11170 --
NM_032439chr101336 --11049 --
NM_032440chr1022073 890 ------
NM_032446chr521349 712 23689 3523 ----
NM_032452chr1421434 274 --128 --
NM_032457chr41486 --13240 13041
NM_032458chrX22295 1336 ----13372
NM_032491chr122403 220 ----11308
NM_032499chr1541636 1538 614 296 ------
NM_032523chr2----189 --
NM_032538chr622609 2058 1873 ----
NM_032547chr411276 ----196
NM_032557chr41739 ------
NM_032558chr911460 --1310 --
NM_032562chr10125 ------
NM_032569chr16----2683 350 --
NM_032578chr10----175 --
NM_032590chr1231130 445 69 ------
NM_032595chr1711011 --11284 --
NM_032631chr191184 ------
NM_032632chr142664 628 ------
NM_032642chr122933 221 ------
NM_032682chr342336 2271 1265 1230 12911 ----
NM_032687chr8127 ------
NM_032689chr1911532 --199 --
NM_032711chr1753783 3435 2987 2704 1298 ------
NM_032728chr91873 ------
NM_032737chr1952443 1720 619 583 406 --171 --
NM_032741chr641011 872 843 665 ------
NM_032800chr12753 526 --22266 104 --
NM_032804chr104656 452 338 232 ------
NM_032808chr151725 1322 1625 --
NM_032812chr102305 34 ------
NM_032817chr1062150 1248 1039 719 658 36 ------
NM_032833chr142449 1789 926 449 --12593 --
NM_032838chr1931084 504 35 ------
NM_032840chr1231081 286 82 ------
NM_032875chr172596 337 --1221 --
NM_032892chr151284 ------
NM_032900chr1043814 2578 1467 1163 23381 286 32537 1306 1258 --
NM_032905chr1031192 950 162 ------
NM_032918chr122266 117 ------
NM_032932chr1745387 5178 2252 1270 1636 32265 2163 1555 --
NM_032941chr12137 ------
NM_032949chr131527 169 ----
NM_032982chr732490 1825 88 ------
NM_032991chr42521 22 ------
NM_032998chr12846 191 ----1367
NM_033012chr132980 211 ------
NM_033016chr2221577 1168 --1588 --
NM_033020chr131801 1469 600 --33982 3357 1865 --
NM_033023chr711185 --1855 --
NM_033027chr34908 478 208 133 11194 1381 --
NM_033030chr22588 227 ----11387
NM_033044chr131106 496 306 ------
NM_033067chr11645 ------
NM_033071chr61226 1631 --1159
NM_033081chr20----1143 --
NM_033089chr2021458 1014 --1470 --
NM_033116chr14----2233 90 --
NM_033117chr91260 ------
NM_033121chr122511 268 ------
NM_033132chr1321697 193 ------
NM_033133chr1733298 1070 487 --31415 1325 1196 --
NM_033138chr712118 ------
NM_033139chr712118 ------
NM_033140chr712118 ------
NM_033143chr444455 3544 1820 1408 12849 24492 697 11784
NM_033157chr712118 ------
NM_033161chr951680 1573 1384 477 258 --1497 11515
NM_033181chr613426 --11417 --
NM_033211chr52517 272 ------
NM_033222chr921204 49 ------
NM_033224chr766985 6651 6387 2484 1889 661 16787 27247 1424 16947
NM_033225chr8------1101
NM_033259chr31717 ------
NM_033274chr541076 696 548 172 ------
NM_033285chr853998 3148 1684 567 36 1916 24069 27 13531
NM_033290chrX73656 3424 2962 1357 509 496 286 2189 82 12922 11433
NM_033300chr151439 1335 897 380 85 --1906 --
NM_033309chr16153 ------
NM_033310chr113192 64 35 ------
NM_033315chr1722124 651 --1206 --
NM_033326chr1111899 --12340 --
NM_033331chr943575 1223 846 481 ------
NM_033360chr1253415 583 545 388 327 ------
NM_033364chr321967 284 ------
NM_033387chr932511 2232 2189 --1998 --
NM_033389chr1734511 1831 428 --33629 434 343 --
NM_033394chr241546 1516 1420 1223 --1281 --
NM_033421chr2011563 1556 21323 1283 --
NM_033425chr1113444 --12139 --
NM_033430chr434119 3666 344 --14154 --
NM_033437chr434119 3666 344 --14154 --
NM_033480chr622990 1127 ------
NM_033481chr622990 1127 ------
NM_033496chr101233 ------
NM_033497chr101233 ------
NM_033498chr101233 ------
NM_033500chr101233 ------
NM_033503chr1582850 2720 2713 2483 1426 497 484 356 --21092 1007 13803
NM_033505chr246470 6354 1928 617 15716 35799 534 512 1342
NM_033512chr842914 2004 1900 395 --32237 784 550 12484
NM_033551chr522766 2251 1632 13249 --
NM_033624chr1241957 1908 1900 244 11620 ----
NM_033626chrX--11568 11375 --
NM_033631chr133001 613 497 12674 1400 11384
NM_033632chr441560 1394 1345 127 1235 ----
NM_033642chrX31043 982 461 --1837 --
NM_033644chr53976 454 381 1220 11775 12513
NM_033645chr53976 454 381 1220 11775 12513
NM_044472chr12477 253 ----1290
NM_052828chr611426 --1387 11366
NM_052832chr821937 265 --12737 --
NM_052834chr1811613 ----12391
NM_052854chr111508 ------
NM_052875chr11----12175 --
NM_052877chr11110 --149 --
NM_052879chr1293955 3826 3575 3482 3332 3316 455 276 181 --12586 --
NM_052885chr1253527 1679 1404 1274 470 ------
NM_052886chr862108 1719 1603 1414 399 147 --11901 --
NM_052896chr132526 2478 2427 1380 ----
NM_052898chr841880 1192 734 224 ------
NM_052905chr221365 1176 --1339 --
NM_052910chr1311399 ------
NM_052911chr181663 ----1740
NM_052932chr112225 62 ------
NM_052937chr82816 340 --22009 1823 --
NM_052948chr191110 ------
NM_052950chr132428 236 ------
NM_052953chr3167 ------
NM_052954chr2121825 537 ----1832
NM_052978chr1441414 480 184 170 ------
NM_053002chr33960 890 187 --1922 --
NM_053016chr997458 6595 6320 2960 2014 1924 1703 1452 702 1353 35372 585 405 --
NM_053023chr1112080 1588 11032 --
NM_053024chr311350 ------
NM_053025chr311715 --1654 --
NM_053026chr311715 --1654 --
NM_053027chr311715 --1654 --
NM_053028chr311715 --1654 --
NM_053031chr311715 --1654 --
NM_053032chr311715 --1654 --
NM_053043chr765115 4880 4583 4230 4096 4019 15334 35605 4128 1018 15637
NM_053056chr1131095 975 916 ------
NM_053064chr141992 --22343 2278 --
NM_053281chrX----2356 290 --
NM_053283chr12--146 ----
NM_054016chr131916 1613 58 ------
NM_054016chr131916 1613 58 ------
NM_054016chr131916 1613 58 ------
NM_057159chr92383 322 ------
NM_057169chr1242863 2187 2175 211 22108 39 ----
NM_057170chr1242863 2187 2175 211 22108 39 ----
NM_057175chr41867 1445 ----
NM_057749chr8--1890 ----
NM_058170chr121425 325 ----11182
NM_058172chr41278 ------
NM_058241chr221933 851 --1357 --
NM_058241chr221933 851 --1357 --
NM_058246chr721231 389 --11218 1334
NM_078626chr11322 --1258 --
NM_079421chr192142 128 ------
NM_080415chr17----1831 --
NM_080546chr91926 1933 21659 232 --
NM_080594chr163301 243 176 ------
NM_080597chr18--11119 180 --
NM_080599chr1011036 ------
NM_080617chr202958 931 --1103 --
NM_080647chr221454 ------
NM_080654chr1131294 125 35 ------
NM_080664chr1412006 2490 128 ----
NM_080666chr1441578 1422 1194 144 --11526 1263
NM_080669chr1741258 1131 771 648 ----13299
NM_080670chr51681 --1377 --
NM_080676chr2052916 2689 408 377 300 --13128 --
NM_080682chr11600 ------
NM_080723chr61375 ------
NM_080743chr632452 2076 684 12321 ----
NM_080759chr1332280 1814 933 --12332 12607
NM_080760chr1332280 1814 933 --12332 12607
NM_080764chr2263009 2788 1100 1046 219 197 --1747 --
NM_080792chr2022286 1935 ----12211
NM_080836chr20134738 4658 4446 4378 4217 3983 1687 1525 1318 693 496 386 168 14208 ----
NM_080867chr1444661 4288 3141 219 --13281 11153
NM_080872chr823522 3126 --1461 13023
NM_080881chr51671 --1225 --
NM_080927chr383359 3195 2369 2296 2262 1023 903 402 12556 ----
NM_100264chr10125 ------
NM_100486chr10125 ------
NM_130387chr3151 --1851 --
NM_130391chr923443 1206 --23334 390 --
NM_130392chr923443 1206 --23334 390 --
NM_130393chr923443 1206 --23334 390 --
NM_130434chr151400 ------
NM_130436chr2111067 ------
NM_130439chr10------11971
NM_130439chr10------11971
NM_130440chr111225 --11014 --
NM_130459chr921633 521 ------
NM_130466chr1241384 735 379 279 11899 ----
NM_130468chr152769 104 ----140
NM_130469chr142809 670 ------
NM_130795chr92705 307 ------
NM_130797chr721507 618 ------
NM_130798chr1531365 530 233 --11024 11535
NM_130808chr31392 ------
NM_130811chr201986 ------
NM_130846chr12167 --1710 --
NM_133170chr2077378 6768 6327 6021 2021 591 214 --57655 5808 5601 2998 1100 --
NM_133264chr1723040 1463 --33761 3404 1062 --
NM_133330chr453286 2411 2381 2144 366 --21093 826 --
NM_133331chr453286 2411 2381 2144 366 --21093 826 --
NM_133334chr454236 4066 1921 1433 306 --35988 1861 988 --
NM_133335chr453286 2411 2381 2144 366 --21093 826 --
NM_133370chr432940 681 453 --22795 2590 --
NM_133433chr51712 --1360 --
NM_133445chr931131 393 319 ------
NM_133468chr732452 1698 473 22213 937 ----
NM_133476chr123764 469 134 ------
NM_133477chr452431 2128 2069 1253 108 ------
NM_133499chrX----1364 --
NM_133503chr121601 ------
NM_133504chr121601 ------
NM_133505chr121601 ------
NM_133506chr121601 ------
NM_133507chr122779 66 ------
NM_133631chr3------1632
NM_133638chr511313 ----1197
NM_133642chr221936 1324 ----
NM_133650chr61226 1631 --1159
NM_134269chr221322 ------
NM_134270chr221151 ------
NM_134427chr92705 307 ------
NM_138270chrX1485 --11079 --
NM_138288chr1411679 21419 374 11793 --
NM_138292chr1153441 2263 1159 812 135 11063 12620 11152
NM_138300chr11432 21164 648 199 --
NM_138319chr15----1280 --
NM_138357chr101713 ------
NM_138370chr22715 626 ------
NM_138395chr23450 412 327 ------
NM_138415chr2231693 1655 1228 --1293 --
NM_138426chr712060 --22474 821 12453
NM_138440chr161567 ------
NM_138444chr1323508 3028 ------
NM_138457chr612736 --11042 --
NM_138459chr623170 2457 ------
NM_138473chr1231294 1190 1066 --1593 14199
NM_138479chr141937 1677 1289 775 --11734 --
NM_138485chr31324 ------
NM_138494chr732814 2461 2198 2631 42 12272 --
NM_138576chr1474685 4226 2966 1048 1039 741 601 --11416 14824
NM_138609chr51136 --2424 142 --
NM_138610chr51136 --2424 142 --
NM_138621chr264083 3070 1141 1013 895 259 23223 3057 1997 --
NM_138638chr1451893 1853 1815 1791 83 ------
NM_138713chr16127973 7596 7321 5620 5160 3016 2900 2879 1926 1833 1652 678 11248 48101 2433 1489 420 1919
NM_138714chr16127973 7596 7321 5620 5160 3016 2900 2879 1926 1833 1652 678 11248 48101 2433 1489 420 1919
NM_138730chr61440 ------
NM_138731chr1433746 3665 3413 --13656 --
NM_138735chr2----1549 --
NM_138736chr1624160 1466 11158 ----
NM_138795chr11597 --1295 --
NM_138927chr211282 ------
NM_138959chr175623 5540 4777 4344 1297 1150 656 26036 2398 11635 122
NM_138970chr1421676 373 --1603 1916
NM_139014chr632227 1557 923 --3606 463 92 --
NM_139015chr1241733 1618 1242 60 ------
NM_139035chrX1260 ------
NM_139045chr91327 --1695 --
NM_139057chr1512844 22332 408 3954 472 194 --
NM_139062chr171483 --151 1149
NM_139071chr1211147 ------
NM_139131chr112676 524 ------
NM_139135chr131266 819 476 --1352 --
NM_139167chr82534 73 ------
NM_139168chr511272 --11410 11589
NM_139169chr101414 --12293 1426
NM_139177chr17----2619 59 --
NM_139201chr121627 ------
NM_139207chr1212106 ------
NM_139211chr4181 ----1222
NM_139212chr4181 ----1222
NM_139244chr6------1159
NM_139245chr331526 1368 555 --1204 --
NM_139276chr1732258 2042 507 ------
NM_139279chr283316 2991 2859 2579 2173 1396 1323 1068 --23466 1009 --
NM_139283chr1222166 1584 --22350 936 1498
NM_139286chr91182 ------
NM_139312chr10131 ----11279
NM_139321chr201167 --23732 3602 --
NM_139323chr201645 ----11320
NM_144488chr92705 307 ------
NM_144489chr92705 307 ------
NM_144571chr485958 2637 2535 1994 1186 676 647 111 --35924 5517 1026 1351
NM_144576chr122521 69 ------
NM_144578chr1464964 3404 1877 1609 612 233 ----24918 86
NM_144581chr14125 ------
NM_144582chr252612 2259 1715 1703 389 --2847 111 11796
NM_144586chr2----1490 --
NM_144595chr13--1726 ----
NM_144599chr1525236 3774 --151 --
NM_144600chr1631473 623 568 1412 ----
NM_144632chr22610 341 --21709 1604 --
NM_144633chr3----1331 --
NM_144636chr33666 633 560 --1535 --
NM_144642chr3--178 11117 --
NM_144644chr4----122 --
NM_144660chr10----1337 --
NM_144664chr1142611 1953 448 194 12165 11576 21015 325
NM_144721chr43987 566 517 ----1353
NM_144723chr52773 671 --2621 148 --
NM_144728chr1171 --1667 --
NM_144729chr1171 --1667 --
NM_144732chr192158 41 --11067 --
NM_144767chr1584180 3858 1583 1470 1328 1280 797 296 23936 3588 24584 578 12974
NM_144775chr1754001 3921 1331 437 266 --33956 3405 1685 --
NM_144778chr1332570 636 288 ------
NM_144949chr252487 2458 1888 252 93 ------
NM_144963chr81433 2714 276 42509 2245 2082 1941 --
NM_144967chrX----1278 --
NM_144979chr41104 --1211 --
NM_145021chr101803 --1128 --
NM_145052chrX3986 769 381 1400 1798 --
NM_145055chr1853051 2788 1325 1294 809 1340 --12602
NM_145109chr173854 703 685 ------
NM_145166chr321994 1848 22185 887 ----
NM_145175chr2----21329 1023 11191
NM_145176chr643273 875 262 113 11074 13011 --
NM_145203chr132731 241 ------
NM_145206chr1021075 330 --1188 --
NM_145251chr141195 ------
NM_145259chr275964 5818 5791 4526 2746 2087 833 15042 ----
NM_145274chr171979 1152 1652 --
NM_145284chrX42385 1952 1645 198 ----11766
NM_145285chr102672 131 ------
NM_145296chr192751 108 --1828 --
NM_145307chr1011519 --13755 --
NM_145309chr112914 52 1355 ----
NM_145313chr1021494 454 ------
NM_145331chr61536 ------
NM_145341chr1021409 360 11257 ----
NM_145351chr1752603 2012 1680 560 196 12437 ----
NM_145647chr81162 --1174 --
NM_145648chr122918 25 ------
NM_145686chr273179 3145 2700 2576 2248 2116 388 --22724 2527 --
NM_145687chr273179 3145 2700 2576 2248 2116 388 --22724 2527 --
NM_145690chr831396 352 148 ----1291
NM_145698chr1011406 ------
NM_145739chr2----189 --
NM_145753chr321363 1161 --1408 --
NM_145793chr103924 223 178 --1876 --
NM_145799chrX22813 51 22002 538 22937 1158 --
NM_145800chrX3963 770 705 ------
NM_145802chrX3912 719 654 ------
NM_145808chr743066 1099 1078 205 ------
NM_145891chr161288 ------
NM_145892chr161288 ------
NM_145893chr161410 ------
NM_145899chr62364 358 --21305 405 --
NM_145901chr62364 358 --21305 405 --
NM_145902chr62364 358 --21305 405 --
NM_145903chr62364 358 --21305 405 --
NM_145904chr62364 358 --21305 405 --
NM_145905chr62364 358 --21305 405 --
NM_145912chr2264575 3453 3396 3211 290 192 23814 1677 --1971
NM_147150chr933936 3890 248 --13384 22715 1403
NM_147156chr1021414 446 ------
NM_147164chr9178 ------
NM_147175chrX1830 --1598 --
NM_147189chr832241 819 240 --41790 1458 360 161 --
NM_147202chr932628 2415 1919 ------
NM_147223chr22605 506 --1487 1726
NM_147233chr22422 323 --1304 1543
NM_148174chr821852 1497 --12227 --
NM_148894chr4178 --11231 1970
NM_148898chr7----1286 --
NM_148899chr7----1286 --
NM_148918chr172642 129 --1235 --
NM_148921chr1742397 789 768 110 ------
NM_148955chr1594784 4456 4007 1496 1186 1134 546 415 310 ------
NM_152244chr1731210 904 852 ----1417
NM_152259chr151923 --1584 --
NM_152261chr1232182 535 185 --1139 --
NM_152263chr145548 4590 4411 3816 25752 2328 14792 --
NM_152265chr13493 255 241 ----1579
NM_152267chr2242420 1947 742 728 --2693 76 --
NM_152271chr831039 817 743 ----2366 93
NM_152275chr21786 --135 --
NM_152277chr52533 199 ------
NM_152280chr133350 746 528 1418 23018 731 --
NM_152289chr1931705 1123 1062 ------
NM_152292chr452276 2214 1883 1538 786 --11837 11715
NM_152298chr14579 171 126 118 ------
NM_152305chr341890 1479 600 123 ----11813
NM_152335chr15------1623
NM_152344chr171546 ----160
NM_152353chr19137 ------
NM_152374chr121716 1220 --11270 11195
NM_152375chr142471 1028 934 580 12340 --22254 1787
NM_152383chr2196 1429 --158
NM_152387chr21238 ------
NM_152388chr263110 2760 865 859 462 309 --24017 2486 --
NM_152407chr572878 2530 2310 2303 2296 2289 1315 1548 --1130
NM_152408chr5169 ------
NM_152409chr543366 126 101 66 13099 ----
NM_152410chr62167 126 ------
NM_152414chr811297 ------
NM_152424chrX54271 4140 1383 252 148 13992 --13786
NM_152431chr111399 ------
NM_152437chr1222194 2020 ------
NM_152440chr122747 299 21025 26 ----
NM_152441chr125703 203 180 139 96 ------
NM_152448chr151514 --1566 1388
NM_152450chr1521486 262 ------
NM_152470chr1811311 --1725 --
NM_152493chr121246 485 --11461 --
NM_152520chr23824 352 175 1219 ----
NM_152527chr2--2432 28 ----
NM_152538chr311272 --11551 --
NM_152549chr52418 156 --1614 --
NM_152556chr732479 997 97 1776 ----
NM_152563chr1111102 ------
NM_152594chr1511491 --11967 --
NM_152608chr142238 808 247 200 1673 ----
NM_152609chr12487 360 ----1443
NM_152622chr53943 534 503 ------
NM_152624chr595488 5180 5159 2759 2712 2488 2390 2155 1489 27045 1211 27403 6533 --
NM_152629chr93916 519 206 --13087 --
NM_152636chr1133054 2744 958 ----12909
NM_152641chr1252316 1074 991 545 438 --12468 --
NM_152652chr16----2282 222 --
NM_152660chr11166 ------
NM_152665chr12459 222 --11313 --
NM_152685chr51386 ------
NM_152692chrX1172 ------
NM_152699chr353568 744 704 462 49 1360 11114 32626 2451 199
NM_152704chr133739 683 208 ----1694
NM_152707chr101348 ------
NM_152713chr11------1217
NM_152715chr11169 ------
NM_152724chr1012156 --1281 --
NM_152731chr621016 902 --1267 --
NM_152734chr655386 5100 3771 1886 1754 24912 1591 24588 734 --
NM_152737chr641809 819 265 147 ----12017
NM_152744chr783461 3265 1222 675 588 317 267 185 --11080 12257
NM_152745chr72903 317 ------
NM_152749chr7173 --1386 --
NM_152756chr514243 13005 ----
NM_152758chr822457 152 23062 1964 ----
NM_152772chr122382 322 ------
NM_152787chrX53640 2704 1558 796 684 12958 1131 --
NM_152789chr71503 11086 ----
NM_152793chr743600 1805 1262 218 --23857 3196 --
NM_152826chr1594784 4456 4007 1496 1186 1134 546 415 310 ------
NM_152835chr11952 ------
NM_152836chr8----11756 --
NM_152837chr8----11756 --
NM_152838chr2063451 1102 773 626 411 303 --22944 123 --
NM_152857chr62728 715 ------
NM_152858chr62728 715 ------
NM_152860chr1231189 1151 262 1397 1206 --
NM_152878chr221626 11139 ----
NM_152888chr8----1692 1809
NM_152896chr92743 645 --136 --
NM_152902chr12652 432 1157 --11495
NM_152924chr1574577 4353 1918 1686 489 353 202 11423 1509 --
NM_152994chr21248 ------
NM_153020chr611073 ------
NM_153029chr1673163 3043 1409 1347 1233 979 516 --33902 2945 2515 --
NM_153050chr2231800 1594 337 ------
NM_153051chr2231800 1594 337 ------
NM_153184chr331704 1277 308 ------
NM_153188chr554965 4746 4599 4136 1564 --12189 --
NM_153207chr1243223 857 711 298 ------
NM_153208chr162820 635 ------
NM_153211chr18191 ------
NM_153215chr31875 ------
NM_153228chr17----193 --
NM_153260chr15------1277
NM_153267chr91219 ------
NM_153270chrX178 --1113 --
NM_153350chr162511 367 ----