TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4786-5p
miRNA Sequence: UGAGACCAGGACUGGAUGCACC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr5------1177
NM_000063chr61123 --1311 --
NM_000084chrX45091 4679 2611 257 14297 14319 --
NM_000088chr17--11253 ----
NM_000089chr71824 ------
NM_000104chr222005 1079 --1399 --
NM_000108chr741659 1409 493 417 ------
NM_000109chrX42116 1950 832 118 ------
NM_000110chr11796 ------
NM_000112chr545098 4962 4573 4135 35549 1962 211 --11985
NM_000138chr1521760 1011 ------
NM_000158chr31142 ------
NM_000163chr522105 655 11699 11721 --
NM_000165chr621067 432 ------
NM_000168chr742537 2327 2050 686 --1481 23002 2309
NM_000176chr533316 520 149 ------
NM_000188chr101233 ------
NM_000208chr1984040 1264 1100 828 502 493 221 57 1257 --11162
NM_000214chr202392 253 --1292 --
NM_000217chr1233965 3309 764 --1347 1737
NM_000230chr72575 272 ----1710
NM_000242chr1022120 1946 12631 ----
NM_000245chr721470 47 ----1715
NM_000248chr353080 2536 2464 1081 1033 ------
NM_000252chrX21305 1235 ------
NM_000259chr1565478 4374 2481 1751 1380 579 ------
NM_000264chr91433 12551 ----
NM_000266chrX1280 ------
NM_000286chr17------164
NM_000289chr121103 ------
NM_000310chr111231 ------
NM_000314chr101459 ------
NM_000321chr1321611 1130 --11438 --
NM_000332chr676501 4690 4609 2659 1315 425 114 26567 1741 44882 1708 1162 864 --
NM_000337chr535883 4153 2007 24314 224 14825 --
NM_000346chr1711886 ------
NM_000362chr2233651 2347 205 ------
NM_000368chr944291 1893 1347 446 ------
NM_000378chr11----2440 181 --
NM_000386chr171701 ----1664
NM_000390chrX11120 12299 --2318 51
NM_000406chr421053 270 --22682 1227 --
NM_000408chr223237 766 ------
NM_000427chr1----1178 --
NM_000429chr1031783 1406 454 ----127
NM_000430chr1732827 2624 2590 ----1704
NM_000439chr51619 --22535 721 --
NM_000448chr1162863 2758 2311 2079 376 27 1998 1369 --
NM_000450chr121748 86 ------
NM_000451chrX31851 1671 739 11459 1402 --
NM_000452chr1311366 ----1142
NM_000459chr9------1241
NM_000461chr321665 611 --2745 522 --
NM_000484chr212678 346 --2752 216 --
NM_000522chr71873 ------
NM_000523chr22427 216 ------
NM_000530chr12969 887 ------
NM_000533chrX21548 160 --2795 473 11625
NM_000544chr6_cox_hap153186 2372 2338 1288 981 ------
NM_000555chrX37556 5892 5245 25114 2188 35136 4786 1907 --
NM_000586chr4187 ----1183
NM_000598chr7--11373 1171 --
NM_000599chr253933 3186 2796 494 233 13799 13065 --
NM_000600chr71393 ------
NM_000601chr7----1347 --
NM_000610chr1142951 2449 2095 978 ------
NM_000615chr1132410 2288 963 --21922 1144 --
NM_000617chr12158 --22306 1503 --
NM_000618chr1265672 5318 4858 4205 1623 401 --11178 15509
NM_000618chr1265672 5318 4858 4205 1623 401 --11178 15509
NM_000633chr1834893 2103 1509 --11076 --
NM_000693chr1541763 606 518 420 11730 ----
NM_000719chr1274656 1671 1285 1025 882 763 716 15647 34977 1076 911 --
NM_000767chr191967 1413 1435 --
NM_000801chr202740 308 ------
NM_000807chr4150 ------
NM_000809chr488965 6419 3549 3310 2119 1501 1275 984 39133 6245 5895 37045 5786 3221 --
NM_000813chr544211 1352 831 199 24236 3405 1515 --
NM_000814chr1523475 607 23224 1433 ----
NM_000826chr41205 ------
NM_000827chr51399 ------
NM_000829chr112928 87 ------
NM_000831chr156290 5758 4302 724 214 36159 5050 4713 26071 1154 --
NM_000833chr1611108 --1402 --
NM_000839chr31459 ------
NM_000855chr111226 ------
NM_000865chr6------1204
NM_000875chr1597061 6396 6181 6116 5632 4324 2194 1008 806 35114 1157 757 15954 15354
NM_000891chr1733535 2858 2610 ----1142
NM_000899chr1222779 1371 23104 271 1419 --
NM_000901chr452430 2259 644 562 401 ------
NM_000924chr12122 --21351 1267 --
NM_000926chr1149392 8607 7784 73 ------
NM_000945chr232005 1745 1415 ------
NM_000950chrX63618 3566 3284 3048 2992 231 11426 13269 --
NM_000956chr142968 309 ------
NM_000958chr521297 1205 ------
NM_000983chr131570 447 66 --11105 --
NM_001001132chr211404 ------
NM_001001323chr1232290 1077 347 22603 2145 12278 --
NM_001001330chr1011246 ------
NM_001001331chr342569 843 465 366 11679 12476 1500
NM_001001342chr1021225 367 --21402 1038 --
NM_001001389chr1142951 2449 2095 978 ------
NM_001001390chr1142951 2449 2095 978 ------
NM_001001391chr1142951 2449 2095 978 ------
NM_001001392chr1152997 2495 2141 1877 1024 ------
NM_001001394chr21612 ------
NM_001001395chr1232181 2070 753 1982 ----
NM_001001419chr584357 4064 4009 3959 3264 2085 1954 1008 ------
NM_001001420chr584357 4064 4009 3959 3264 2085 1954 1008 ------
NM_001001433chr2042549 2386 2019 424 ------
NM_001001481chr832745 2318 768 ------
NM_001001520chr191184 ------
NM_001001556chr1521235 198 --1406 --
NM_001001560chr223609 517 235 ------
NM_001001664chr221018 164 ----12695
NM_001001669chr511963 22194 1911 12346 1899
NM_001001852chr221176 ------
NM_001001890chr2163296 3263 3117 2995 2967 541 11096 ----
NM_001001928chr2288348 8204 5931 3236 2583 1926 1453 259 13022 22826 2732 16511
NM_001001974chr1022137 91 ------
NM_001001995chrX11323 1203 ----
NM_001002032chr172593 57 ------
NM_001002243chr22908 793 ------
NM_001002257chr263449 3361 2676 2389 992 759 --13245 --
NM_001002259chr12190 ------
NM_001002295chr102894 245 ------
NM_001002838chrX21543 1239 ------
NM_001002843chr1531030 872 272 1261 ----
NM_001002860chr1443809 3417 1484 1450 1108 13056 --
NM_001002876chr221404 ------
NM_001003652chr18108458 7382 6246 5776 3117 2837 1656 1377 1112 656 1127 13431 --
NM_001003681chr2232076 1426 49 ------
NM_001003688chr421110 486 ------
NM_001003694chr31606 --1106 --
NM_001003698chr62613 67 ----1626
NM_001003699chr62613 67 ----1626
NM_001003712chr1221567 71 --21043 77 13423
NM_001003792chr32846 196 --1186 --
NM_001003793chr32846 196 --1186 --
NM_001003810chr41331 ------
NM_001003940chr1532850 1534 356 --11007 --
NM_001003942chr1532850 1534 356 --11007 --
NM_001003943chr1532854 1538 360 --11011 --
NM_001004065chr933936 3890 248 --12735 --
NM_001004127chr131686 ------
NM_001004128chr1--1575 3501 478 48 --
NM_001004317chr633354 1412 1018 ------
NM_001004342chr1135091 5053 4837 4455 4262 4123 3937 3745 1903 1895 1863 1725 959 --26020 3813 --
NM_001004360chr231964 1767 1507 --1232 --
NM_001004419chr1254025 3792 1635 844 358 ----12805
NM_001005242chr12----2517 230 --
NM_001005386chr222376 1554 --1603 --
NM_001005404chr1723920 3318 --13237 --
NM_001005463chr1022451 1933 11908 11027 --
NM_001005473chr525041 2418 --16169 --
NM_001005505chr321820 143 --1405 --
NM_001005609chrX23822 2485 --11486 --
NM_001005743chr1451150 1084 1070 897 437 ------
NM_001005744chr1451150 1084 1070 897 437 ------
NM_001005745chr1451150 1084 1070 897 437 ------
NM_001005751chr102209 157 ----178
NM_001005845chr821629 1427 --131 --
NM_001005861chr31741 ------
NM_001005910chr31455 ------
NM_001005911chr31455 ------
NM_001006610chr161917 --11008 --
NM_001006612chrX1114 ------
NM_001006613chrX1114 ------
NM_001006614chrX1114 ------
NM_001006618chr9----1232 --
NM_001006624chr131975 499 489 11659 ----
NM_001007024chr1783595 3277 2874 2691 474 457 366 50 1337 ----
NM_001007025chr1783595 3277 2874 2691 474 457 366 50 1337 ----
NM_001007067chr821068 203 ----1971
NM_001007068chr821068 203 ----1971
NM_001007069chr821068 203 ----1971
NM_001007070chr821068 203 ----1971
NM_001007099chr12619 246 ------
NM_001007100chr12619 246 ------
NM_001007246chr2121666 774 ------
NM_001007257chr1--1399 ----
NM_001007277chr11----11116 --
NM_001007466chr675108 5087 4959 4927 4263 4246 146 ----13257
NM_001007553chr11825 ------
NM_001007559chr1841810 1537 1428 160 --11833 1537
NM_001007793chr10----121 --
NM_001008222chrX2459 235 --1122 1339
NM_001008239chr1843051 2788 1325 809 1340 23734 928 12602
NM_001008388chr41372 ----159
NM_001008408chr7105804 5777 5115 4880 4857 4583 4230 1500 307 98 ------
NM_001008495chr832176 1758 459 ------
NM_001008528chr171661 1696 1222 --
NM_001008540chr21435 ------
NM_001008541chr10------11971
NM_001008541chr10------11971
NM_001008701chr1942730 2093 584 199 11902 32973 2816 2736 --
NM_001008708chr21409 ------
NM_001008726chr1441578 1422 156 144 --11526 --
NM_001008738chr512647 --12017 --
NM_001008895chr1351342 1264 969 335 303 ------
NM_001009554chr474180 4036 3779 3118 1569 1466 500 ------
NM_001009554chr474180 4036 3779 3118 1569 1466 500 ------
NM_001009566chr131410 1179 26 ------
NM_001009899chr356272 5098 4706 685 563 22168 1522 65255 4077 2520 2190 1544 893 --
NM_001009909chr1121183 253 22573 1063 12595 --
NM_001009960chr722814 855 --1878 --
NM_001009993chr253685 3068 2895 1621 766 11058 --1192
NM_001010852chr6149 ------
NM_001010853chr632307 2148 1233 --1723 --
NM_001010854chr141503 ------
NM_001010867chr176334 6053 5739 1906 1477 499 72 --35468 5365 119 22196 892
NM_001010888chrX64314 4078 3691 3366 1799 995 ----2628 605
NM_001010895chr91102 --11996 --
NM_001010898chr12927 885 --11249 --
NM_001010924chr1031107 1024 796 ------
NM_001010927chr61425 ------
NM_001010932chr7----1347 --
NM_001010971chr12742 211 ------
NM_001011537chr331852 1754 1522 12384 1380 --
NM_001011538chr42676 233 ------
NM_001011551chrX2347 172 ------
NM_001011553chr71308 ------
NM_001011666chr764946 2340 2125 2016 1020 889 25189 4189 --21556 297
NM_001011713chr1411452 --11066 --
NM_001011885chr1541501 712 496 430 ------
NM_001012267chr921806 219 --1540 11527
NM_001012393chr1121512 1303 13648 12040 --
NM_001012398chr16------1360
NM_001012420chr153475 335 176 ------
NM_001012423chr153475 335 176 ------
NM_001012478chr191507 ------
NM_001012751chr1031908 1358 576 ------
NM_001012756chr1922661 1133 --32895 2677 2550 --
NM_001012761chr532509 2475 22 ------
NM_001013398chr7--11373 1171 --
NM_001013415chr431560 1394 1345 ------
NM_001013438chr32764 627 ------
NM_001013439chr31610 ------
NM_001013615chr11417 21009 241 156 1441
NM_001013620chr1248242 6075 2102 392 13018 13040 15967
NM_001013622chr481202 872 376 314 252 190 129 67 1438 11128 --
NM_001013635chr12145 ------
NM_001013699chr12154 ------
NM_001013843chr151315 ------
NM_001014431chr14179 ------
NM_001014432chr14179 ------
NM_001014797chr1057948 7404 6080 2873 1540 17181 22255 2041 18220
NM_001015053chr1721506 104 ----2577 378
NM_001017371chr21313 --11224 --
NM_001017395chr353198 3073 2838 2407 886 --23183 820 --
NM_001017396chr23807 729 675 11713 --11736
NM_001017405chr41957 1166 ----
NM_001017424chr111666 --1522 --
NM_001017425chr111666 --1522 --
NM_001017440chr786567 6248 5791 5658 1664 1450 580 224 --35755 2941 2291 --
NM_001017926chr811596 ----1617
NM_001017969chr9--1236 ----
NM_001017977chr12145 103 ------
NM_001017999chr142289 521 314 289 ------
NM_001017999chr142289 521 314 289 ------
NM_001018000chr142289 521 314 289 ------
NM_001018000chr142289 521 314 289 ------
NM_001018001chr142289 521 314 289 ------
NM_001018054chr121439 85 ------
NM_001018064chr911695 ----11546
NM_001018065chr914787 --44656 2332 370 306 25759 4767
NM_001018066chr914787 --44656 2332 370 306 25759 4767
NM_001018067chr154275 3846 661 430 408 ------
NM_001018068chr154275 3846 661 430 408 ------
NM_001018069chr154275 3846 661 430 408 ------
NM_001018074chr533316 520 149 ------
NM_001018075chr533316 520 149 ------
NM_001018076chr533316 520 149 ------
NM_001018077chr533316 520 149 ------
NM_001018090chr1572832 2694 750 684 658 645 245 ------
NM_001018091chr1572942 2804 860 794 768 755 355 ------
NM_001018102chr1572832 2694 750 684 658 645 245 ------
NM_001018108chr1562050 1733 1418 800 718 289 --1901 11998
NM_001018111chr71753 11561 43844 3586 2672 1615 --
NM_001020658chr121210 348 1586 ----
NM_001020658chr121210 348 1586 ----
NM_001024024chr143186 175 164 ------
NM_001024070chr143182 171 160 ------
NM_001024094chr533316 520 149 ------
NM_001024226chr131061 386 101 ------
NM_001024227chr131061 386 101 ------
NM_001024228chr131061 386 101 ------
NM_001024649chr511832 ------
NM_001024660chr31429 1501 --125
NM_001024808chr1252830 2675 1792 603 498 ------
NM_001024937chr171109 ------
NM_001024948chr183173 2791 2399 1301 1246 1233 1127 619 --2539 425 --
NM_001025076chr1054335 4242 2025 862 708 --21254 446 1813
NM_001025077chr1045693 5600 2220 2066 11235 22612 1804 12171
NM_001025105chr521225 1003 ------
NM_001025108chr242730 2721 1637 276 12917 136 12940
NM_001025201chr21650 --1513 --
NM_001025203chr211119 ------
NM_001025204chr211119 ------
NM_001025266chr344039 3493 1124 582 13907 23929 1796 --
NM_001025366chr6135 11533 ----
NM_001025366chr6135 11533 ----
NM_001025367chr6135 11533 ----
NM_001025367chr6135 11533 ----
NM_001025368chr6135 11533 ----
NM_001025368chr6135 11533 ----
NM_001025369chr6151 11549 ----
NM_001025369chr6151 11549 ----
NM_001025370chr6135 11533 ----
NM_001025370chr6135 11533 ----
NM_001025579chr17134 ----1314
NM_001025580chrX43682 589 303 73 11096 ----
NM_001025595chr441249 1104 1037 177 ------
NM_001029858chr643153 2594 2229 2201 --1535 --
NM_001029864chr2041890 909 317 116 1751 --1652
NM_001030007chr1663609 3313 3071 2928 2870 323 11253 11304 --
NM_001030055chr1424249 3565 --23934 790 --
NM_001030059chr10177 ------
NM_001031679chr1242927 2572 2335 1195 --1333 12310
NM_001031680chr121878 593 --1115 1840
NM_001031685chr12929 780 ------
NM_001031695chr2264548 4047 2066 1614 1598 1419 --1502 --
NM_001031700chr432377 551 51 --12106 --
NM_001031702chr32230 83 ----1190
NM_001031710chr7188 ------
NM_001031712chr61385 ------
NM_001031716chr23143 126 108 ------
NM_001031717chr32629 279 ------
NM_001031723chr4------165
NM_001031732chr432940 2811 453 --23228 2590 --
NM_001031804chr1632940 1465 1400 ------
NM_001032280chr611049 ------
NM_001032282chr8--2263 200 --2381 40
NM_001032283chr12----133 1872
NM_001032284chr12----133 1872
NM_001032288chr2021214 370 1462 1523 --
NM_001032289chrX2907 202 ------
NM_001032363chr1----21893 266 2807 205
NM_001032363chr1----21893 266 2807 205
NM_001032380chr1031992 359 113 ------
NM_001032393chrX2705 577 ------
NM_001032394chr6----12633 --
NM_001032395chr6----12500 --
NM_001033044chr151805 1391 1152 699 345 --1511 --
NM_001033047chr432627 2346 2046 ------
NM_001033056chr151805 1391 1152 699 345 --1511 --
NM_001033057chr321767 1296 ------
NM_001033059chr631826 1610 315 ------
NM_001033117chr374882 4672 4631 4587 4298 3715 3384 --14692 --
NM_001033506chr112387 106 ------
NM_001033507chr121897 1279 --11567 --
NM_001033557chr221360 396 ------
NM_001033578chr812211 ------
NM_001033756chr6--11467 ----
NM_001033756chr6--11467 ----
NM_001034845chr441433 1416 1054 112 ------
NM_001034852chr1442038 1739 1442 1316 ----1170
NM_001035260chr1011284 ------
NM_001037132chr722126 363 --11475 --
NM_001037133chr722126 363 --11475 --
NM_001037164chr74601 289 83 46 --1195 --
NM_001037174chr232060 1724 79 --11847 --
NM_001037332chr512168 --21823 192 --
NM_001037333chr512168 --21823 192 --
NM_001037339chr111286 ------
NM_001037340chr111286 ------
NM_001037341chr111286 ------
NM_001037341chr111286 ------
NM_001037535chrX1236 --21470 1059 --
NM_001037536chrX1236 --21470 1059 --
NM_001037540chrX1236 --21470 1059 --
NM_001037631chr221083 886 ------
NM_001039029chr1221991 794 ------
NM_001039091chrX11355 --2917 211 --
NM_001039348chr21951 --1230 --
NM_001039349chr21951 --1230 --
NM_001039350chr721564 618 ------
NM_001039457chr1149 ------
NM_001039479chr1432034 1776 1615 ------
NM_001039538chr233566 3258 1133 ----12687
NM_001039547chr356616 5941 5870 1805 38 16878 27220 3156 22829 600
NM_001039574chr11276 ------
NM_001039577chr134198 4060 985 ------
NM_001039580chr423133 993 ----1970
NM_001039590chrX22810 1497 11204 13572 13667
NM_001039591chrX22810 1497 11204 13572 13667
NM_001039618chr1124163 3941 12157 21655 1648 --
NM_001039690chr1632363 848 446 --21604 488 1786
NM_001039762chr10--11893 ----
NM_001039840chrX74801 4560 2086 602 492 436 145 --180 --
NM_001039916chr121469 ------
NM_001039917chr121469 ------
NM_001039918chr121469 ------
NM_001039919chr121469 ------
NM_001039920chr121469 ------
NM_001039960chr121503 --11121 --
NM_001040057chr71503 ------
NM_001040135chr71751 ------
NM_001040142chr232209 1721 212 ------
NM_001040143chr232209 1721 212 ------
NM_001040144chr1632363 848 446 --21604 488 1786
NM_001040146chr1632363 848 446 --21604 488 1786
NM_001040153chr13--1726 ----
NM_001040157chr432729 876 348 --12517 2900 632
NM_001040158chr5----2424 142 --
NM_001040159chr411295 1406 11376 --
NM_001040181chr31184 --1930 --
NM_001040182chr31184 --1930 --
NM_001040183chr31184 --1930 --
NM_001040197chr1132 --122 --
NM_001040199chr31184 --1930 --
NM_001040200chr31184 --1930 --
NM_001040202chr432343 1975 1027 ------
NM_001040214chr6--11964 1835 --
NM_001040284chr1624732 4360 --23949 1241 11010
NM_001040402chr433185 2871 886 13194 1398 23250 2779
NM_001040429chr1323131 2315 --1195 --
NM_001040708chr83395 368 152 1724 ----
NM_001040709chr11462 1267 22346 114 1841
NM_001040876chr431274 379 363 --1522 --
NM_001042355chr1675032 4256 1762 1342 621 440 221 ------
NM_001042388chr181359 ------
NM_001042404chr11246 --11376 --
NM_001042412chr1675032 4256 1762 1342 621 440 221 ------
NM_001042413chr943043 916 519 206 --12698 1495
NM_001042414chr13186 ------
NM_001042425chr611049 ------
NM_001042453chrX21260 347 ------
NM_001042465chr102245 43 ------
NM_001042466chr102245 43 ------
NM_001042473chr1011406 ------
NM_001042498chrX21044 339 --1120 --
NM_001042506chrX31122 295 129 ------
NM_001042537chrX12242 --12358 1818
NM_001042552chr12934 563 --1586 --
NM_001042555chr1244592 4053 988 834 ------
NM_001042599chr246393 2370 2257 645 --35736 2693 77 --
NM_001042601chr362938 881 818 802 480 243 --1835 --
NM_001042603chr1265145 4144 1713 1696 249 74 12060 14021 11475
NM_001042604chr344221 3328 3196 551 --14089 13019
NM_001042681chr142419 2383 2096 195 ----11809
NM_001042682chr142419 2383 2096 195 ----11809
NM_001042682chr142419 2383 2096 195 ----11809
NM_001043318chr1463471 3354 2805 1505 678 128 --12828 --
NM_001043351chr111940 --11610 --
NM_001044385chr253110 2760 865 859 309 --24017 2486 --
NM_001046chr522806 1966 11861 11025 --
NM_001071775chr1311440 ------
NM_001078chr11600 ------
NM_001083621chr153368 3350 3224 1500 1094 24523 1408 ----
NM_001094chr171807 --1871 --
NM_001099678chr335580 5493 238 --14331 --
NM_001107chr14140 ------
NM_001109977chr41773 ------
NM_001113490chrX33554 939 845 ------
NM_001128chr1663609 3313 3071 2928 2870 323 11253 11304 --
NM_001144chr161974 ----1132
NM_001148chr431811 1388 1369 --11691 --
NM_001151chr4172 ------
NM_001159chr2----1229 --
NM_001173chr1424249 3565 --23934 790 --
NM_001177chr1211995 ------
NM_001186chr2122192 2150 ----1534
NM_001187chr21--1446 148 --
NM_001192chr16------1197
NM_001197chr22----1402 --
NM_001198chr632386 2292 566 --22037 120 --
NM_001200chr201785 ------
NM_001204chr236793 6215 832 ----1287
NM_001206chr91284 --11186 --
NM_001219chr7--11456 11740 158
NM_001222chr1011708 --11415 11738
NM_001237chr44861 325 213 152 ------
NM_001237chr44861 325 213 152 ------
NM_001256chr1722376 2203 ------
NM_001259chr741664 1254 1009 905 --14623 --
NM_001261chr93953 234 210 --1436 --
NM_001262chr11322 ------
NM_001270chr51955 ------
NM_001271chr1563090 2988 2731 2203 762 57 1816 1717 --
NM_001273chr121361 ------
NM_001277chr112891 300 ------
NM_001299chr191425 ------
NM_001304chr1773692 3251 3208 3072 1140 1079 901 ------
NM_001305chr7----1776 --
NM_001316chr201172 --137 --
NM_001326chr111389 ------
NM_001332chr511108 ------
NM_001346chr32627 393 22418 1863 22634 539 11050
NM_001351chr33356 63 40 ------
NM_001356chrX32516 969 203 12335 ----
NM_001362chr141697 ------
NM_001364chr1134761 3738 223 --11547 --
NM_001383chr17159 --1287 1189
NM_001386chr822253 311 ------
NM_001387chr523119 1083 ------
NM_001389chr211536 --1475 --
NM_001391chr1811114 1425 ----
NM_001396chr2111067 12615 3817 743 323 --
NM_001399chrX23822 2485 --11486 --
NM_001400chr121314 1252 ------
NM_001406chr1731415 381 70 ------
NM_001408chr111537 ------
NM_001412chrX53701 2913 2476 1126 145 --11015 --
NM_001417chr1241515 1453 666 300 --11353 --
NM_001418chr112620 566 ------
NM_001418chr112620 566 ------
NM_001419chr1924038 3903 ------
NM_001420chr1932500 1225 265 12970 ----
NM_001426chr2----1531 --
NM_001427chr71433 2277 27 21933 1724 --
NM_001429chr222884 148 --1764 --
NM_001438chr11554 --12464 --
NM_001440chr862425 2183 1013 1003 637 311 --11987 12773
NM_001448chrX1134 ------
NM_001452chr61546 ------
NM_001453chr621443 285 --11454 --
NM_001482chr151140 ------
NM_001494chr101507 ------
NM_001495chr81151 --11031 --
NM_001541chr112160 129 ------
NM_001609chr1031015 812 161 --1481 24344 952
NM_001614chr171642 ------
NM_001614chr171642 ------
NM_001616chr233076 3051 2404 ------
NM_001621chr72487 27 ------
NM_001621chr72487 27 ------
NM_001634chr631826 1610 315 ------
NM_001650chr1823200 1319 ------
NM_001655chr11--1545 21930 1578 --
NM_001658chr131061 386 101 ------
NM_001660chr34621 186 107 46 ------
NM_001662chr72398 281 ------
NM_001664chr31666 ----1831
NM_001679chr32289 269 ------
NM_001681chr12----1253 1762
NM_001682chr1232004 791 61 22317 1859 11992 --
NM_001683chr342569 843 465 366 11679 12476 1500
NM_001690chr331989 1832 390 2812 161 1834 --
NM_001695chr853737 2895 767 277 143 13067 34082 3859 3089 --
NM_001699chr191626 2605 311 ----
NM_001701chr92626 257 ------
NM_001709chr1122512 244 --22606 878 12432
NM_001714chr12----1197 --
NM_001723chr61226 ----1206
NM_001731chr121736 ----1267
NM_001740chr161508 ------
NM_001742chr71662 ----1715
NM_001743chr2186 ------
NM_001746chr511832 ------
NM_001754chr2163296 3263 3117 2995 2967 541 11096 ----
NM_001755chr1641887 1767 718 205 11606 1741 --
NM_001759chr1295293 4823 4408 3837 1938 1930 1678 1643 1009 25216 685 23465 48 --
NM_001788chr71308 ------
NM_001792chr182928 21 ------
NM_001799chr51184 ------
NM_001806chr1932494 369 191 ------
NM_001810chr202620 599 ------
NM_001822chr21650 --1513 --
NM_001829chr42839 150 2903 655 ----
NM_001830chrX23967 1265 1989 12453 --
NM_001842chr9178 ------
NM_001845chr132473 443 --11106 --
NM_001859chr953381 2771 1097 905 387 --23441 1580 --
NM_001892chr521225 1003 ------
NM_001895chr2011257 1937 1774 --
NM_001904chr31104 ------
NM_001920chr122742 601 ------
NM_001923chr11--1447 ----
NM_001924chr11361 ------
NM_001936chr721564 618 ------
NM_001938chr111480 ------
NM_001949chr612475 ------
NM_001962chr52597 44 ------
NM_001964chr51750 ------
NM_001977chr411689 ----1332
NM_001992chr512088 ------
NM_001993chr11164 ------
NM_001995chr41933 --1597 --
NM_001999chr531479 1472 547 ------
NM_002006chr415517 --14570 12072
NM_002010chr13--155 ----
NM_002015chr1383021 2977 2599 2437 2086 948 668 377 ------
NM_002017chr1121033 401 ------
NM_002024chrX11614 ------
NM_002025chrX59191 9046 7885 2988 2101 --39253 7516 6878 29062 373
NM_002026chr22856 280 ------
NM_002040chr2133114 2114 836 ------
NM_002044chr1521235 198 --1406 --
NM_002051chr102894 245 ------
NM_002056chr21803 1655 ----
NM_002061chr111659 ------
NM_002063chrX31148 365 134 ------
NM_002065chr151805 1391 1152 699 345 --1511 --
NM_002104chr51180 ------
NM_002106chr41318 ------
NM_002114chr6150 ------
NM_002126chr1743800 3555 3407 311 23707 2683 12575 --
NM_002128chr1312106 ------
NM_002130chr53426 294 207 ------
NM_002131chr61364 --11305 --
NM_002138chr41331 ------
NM_002140chr91308 ------
NM_002147chr172670 152 ----1146
NM_002148chr21629 ------
NM_002151chr191279 ------
NM_002156chr21171 ----1148
NM_002158chr233217 139 132 ------
NM_002211chr10192 ------
NM_002214chr734942 4880 603 --15273 --
NM_002222chr311057 --1878 --
NM_002235chr1221085 1053 ------
NM_002241chr132062 503 455 --134 12867
NM_002242chr221504 1321 11273 ----
NM_002245chr12572 445 ------
NM_002264chr354973 3761 3493 701 560 --1772 --
NM_002265chr172772 366 1461 ----
NM_002266chr172183 92 ------
NM_002267chr1311738 ------
NM_002268chr341498 1349 727 709 ------
NM_002270chr534746 4136 1564 --14388 --
NM_002271chr1322181 66 --12468 --
NM_002285chr242730 2721 1637 276 12917 136 12940
NM_002293chr132366 1816 940 --12377 --
NM_002296chr111465 --1325 --
NM_002334chr1112009 ------
NM_002356chr652355 2287 1055 753 77 ------
NM_002358chr4147 ------
NM_002359chr1743435 3004 1666 27 --12946 --
NM_002360chr732390 977 759 ----12666
NM_002372chr5155 ------
NM_002374chr233566 3258 1133 ----12687
NM_002376chr141480 ------
NM_002387chr541402 1219 840 309 21857 525 31879 1658 509 --
NM_002395chr6139 --1213 --
NM_002397chr511405 ------
NM_002401chr1721634 1557 21987 1962 ----
NM_002408chr141656 1187 191 --
NM_002449chr52251 51 --1854 --
NM_002455chr1128 ------
NM_002473chr2231342 1074 909 ------
NM_002480chr121191 ------
NM_002481chr197872 7620 7555 6927 6742 5339 3198 3118 2998 --25576 1602 --
NM_002482chr13579 171 126 ------
NM_002486chr94787 428 293 71 11870 1485 --
NM_002499chr1521579 974 ----1551
NM_002500chr211024 ------
NM_002519chr1121452 1146 ------
NM_002520chr51206 ------
NM_002522chr172560 144 ----13509
NM_002524chr11820 ------
NM_002536chrX1253 ------
NM_002545chr1121512 1303 13648 12040 --
NM_002547chrX34046 3323 1329 1414 14083 --
NM_002569chr1511443 ------
NM_002578chrX1306 ------
NM_002581chr934869 3866 1422 ------
NM_002583chr122250 171 ------
NM_002585chr12248 67 ------
NM_002586chr611039 ------
NM_002588chr51516 ------
NM_002590chr131527 169 ----
NM_002594chr2021778 1708 --12270 1393
NM_002595chr1231697 1543 213 ------
NM_002600chr111286 ------
NM_002601chr21370 ------
NM_002605chr1511195 ------
NM_002607chr721209 121 1377 ----
NM_002613chr1634980 3504 3282 13958 24249 752 --
NM_002628chr321028 483 ------
NM_002629chr101614 ------
NM_002642chr1----1250 --
NM_002648chr611246 ------
NM_002655chr823870 799 ------
NM_002657chr2021417 148 1356 11142 --
NM_002670chr321003 358 ------
NM_002687chr142818 493 ------
NM_002698chr1922213 1052 ----1133
NM_002699chr131237 1224 548 ------
NM_002706chr22643 40 ------
NM_002707chr21273 ------
NM_002709chr232641 904 352 ------
NM_002714chr631096 1047 714 ------
NM_002725chr133744 3581 3302 13281 1249 --
NM_002731chr152205 967 480 296 128 ------
NM_002732chr92316 52 ------
NM_002734chr1721717 624 --1437 --
NM_002738chr161764 ------
NM_002740chr332109 964 229 1857 12421 --
NM_002745chr2263289 3129 3022 888 299 142 --13419 --
NM_002748chr151774 ------
NM_002750chr10------1218
NM_002758chr17148 ------
NM_002765chrX11355 --2917 211 --
NM_002778chr102245 43 ------
NM_002787chr73577 538 108 ------
NM_002814chrX1631 ------
NM_002823chr22567 529 ------
NM_002826chr11696 1879 4805 782 602 352 --
NM_002827chr2011683 ------
NM_002835chr71185 ------
NM_002840chr111225 ------
NM_002844chr62949 873 --11283 1310
NM_002851chr71773 ----1621
NM_002858chr121233 207 ------
NM_002874chr921003 251 1293 --1369
NM_002886chr344510 4173 1922 393 14186 23704 3310 --
NM_002891chr15------175
NM_002892chr14192 ------
NM_002902chr15----2523 148 --
NM_002906chr112371 187 ----1323
NM_002940chr431274 379 363 --1522 --
NM_002955chr62613 67 ----1626
NM_002958chr31741 ------
NM_002971chr311027 ------
NM_002979chr12619 246 ------
NM_002998chr81262 11618 --1372
NM_003011chr921658 130 --11088 --
NM_003017chr61178 ------
NM_003026chr91370 --1285 --
NM_003030chr311399 --11371 --
NM_003031chr161917 --11008 --
NM_003069chrX1260 ------
NM_003070chr91327 ------
NM_003076chr1221147 246 1147 2333 85 --
NM_003079chr17279 60 ------
NM_003081chr202986 244 --1186 --
NM_003099chr1541496 546 415 310 25776 587 ----
NM_003100chr51122 ------
NM_003106chr31895 --1711 --
NM_003108chr276874 5568 2451 1156 1104 805 465 --16123 --
NM_003111chr21313 --11224 --
NM_003112chr732196 1985 1295 11281 ----
NM_003115chr11380 ------
NM_003130chr721203 1052 ------
NM_003131chr611480 --12197 --
NM_003137chr6--2896 429 ----
NM_003144chr642061 1617 197 28 ----22206 257
NM_003150chr1722258 507 --11824 12096
NM_003155chr8187 --22849 529 --
NM_003156chr11----1345 11294
NM_003178chr321985 305 --11589 --
NM_003185chr201344 ------
NM_003189chr152767 2181 1235 976 246 --23254 2542 --
NM_003199chr1853751 3677 2024 1828 815 1156 --1793
NM_003202chr52643 113 --11760 --
NM_003204chr1711373 ------
NM_003216chr2233082 2942 574 --11310 --
NM_003220chr611049 ------
NM_003221chr634169 3281 1016 --23882 2949 --
NM_003223chr164759 689 671 118 1616 ----
NM_003234chr312047 --52419 1683 479 346 47 --
NM_003239chr141146 ------
NM_003246chr1521893 1395 --1247 --
NM_003253chr2131616 1551 573 --11641 1586
NM_003255chr1762050 1983 1893 985 717 53 --12193 --
NM_003256chr31403 ------
NM_003257chr152982 894 ------
NM_003262chr323307 567 24602 241 --14329
NM_003269chr6----11021 --
NM_003272chr12574 125 ------
NM_003274chr2162908 2736 2219 972 927 676 1388 ----
NM_003286chr20145 ------
NM_003298chr355946 4025 3921 3914 2295 11194 2755 124 --
NM_003304chr331301 1109 257 ----11272
NM_003305chr41147 ------
NM_003337chr51643 ------
NM_003338chr101234 ------
NM_003339chr511629 ------
NM_003342chr1743314 2019 1190 42 13330 13086 --
NM_003347chr2241676 1552 520 162 --12248 --
NM_003349chr2021214 370 1462 1523 --
NM_003359chr42988 933 21275 294 --1317
NM_003371chr962135 1956 1890 1838 1625 1613 ------
NM_003372chrX124 ------
NM_003375chr10----1169 --
NM_003376chr6135 11533 ----
NM_003376chr6135 11533 ----
NM_003385chr2----1722 --
NM_003390chr1121075 775 ------
NM_003392chr362659 1389 479 160 78 71 ------
NM_003400chr21879 ------
NM_003405chr221539 1524 ----
NM_003406chr841707 1396 352 148 ------
NM_003409chr181543 ----11067
NM_003412chr322573 1083 --1457 --
NM_003440chr121769 ------
NM_003442chr111669 ------
NM_003452chr91878 ------
NM_003453chr132516 185 ------
NM_003458chr333321 2477 1006 --11012 --
NM_003463chr653207 3196 1295 1016 437 ------
NM_003467chr21435 ------
NM_003468chr253011 1537 1462 365 170 ----1384
NM_003470chr1641578 1361 661 313 11313 11586 --
NM_003473chr103887 853 281 ------
NM_003474chr1021605 1476 ------
NM_003478chr1143202 3033 2368 636 11004 1464 --
NM_003482chr1222441 2357 ------
NM_003489chr2113094 13134 1791 --
NM_003535chr6123 ------
NM_003557chr121635 1213 11532 ----
NM_003558chr9------1476
NM_003559chr1753206 3011 2876 2635 2440 --11594 --
NM_003566chr125984 863 614 89 72 ----11069
NM_003574chr18105380 4950 4766 4361 4001 3537 2027 966 691 291 ----15111
NM_003583chr1223300 1190 --23480 3051 12597
NM_003589chr1351342 1264 969 335 303 ------
NM_003590chr222848 350 --21426 630 --
NM_003597chr251852 374 220 135 103 ------
NM_003603chr43497 432 102 --11589 --
NM_003618chr221286 1113 ------
NM_003620chr171953 1755 ----
NM_003622chr1212495 32460 2437 992 1625 --
NM_003626chr11----11234 --
NM_003629chr132950 2515 1083 --33453 3034 1255 --
NM_003630chr61645 ------
NM_003633chr51224 ----12197
NM_003644chr1734442 4337 1292 12295 21860 1556 --
NM_003659chr231090 1065 117 ------
NM_003662chrX2138 23 ------
NM_003663chr333243 3064 267 ------
NM_003671chr943575 1223 846 296 ------
NM_003672chr11476 ------
NM_003679chr132477 2321 818 1679 ----
NM_003693chr172717 652 1551 1573 --
NM_003701chr132980 211 ------
NM_003713chr11234 ------
NM_003714chr522538 2388 1190 ----
NM_003735chr51516 ------
NM_003736chr51516 ------
NM_003744chr1451150 1084 1070 897 437 ------
NM_003750chr101790 ----1930
NM_003757chr11382 ------
NM_003759chr423013 2783 ------
NM_003763chr2042549 2386 2019 424 ------
NM_003772chr111135 ------
NM_003774chr1243209 3174 2436 544 13183 1247 --
NM_003783chr11188 ------
NM_003787chr1811715 ----189
NM_003791chr162623 86 ------
NM_003795chr6----1438 --
NM_003816chr821243 1041 ------
NM_003819chr11264 ------
NM_003822chr142959 2413 2017 1980 ------
NM_003825chr1531365 530 233 ----11535
NM_003829chr94890 839 769 102 ------
NM_003842chr831631 266 38 12159 52181 1815 1723 1589 614 --
NM_003861chr1432727 1920 449 --12217 --
NM_003873chr1011783 ----1220
NM_003884chr341779 1567 290 61 ----11235
NM_003885chr1762600 2483 2302 1706 699 375 ------
NM_003887chr22643 186 ------
NM_003893chr101320 ------
NM_003902chr12210 108 ------
NM_003916chrX21132 385 ------
NM_003930chr711791 ----12393
NM_003934chr941159 497 314 308 ------
NM_003953chr122512 329 ------
NM_003955chr1721385 400 ------
NM_003957chr1121011 771 ------
NM_003971chr17150 ------
NM_003972chr101212 ------
NM_003980chr61934 --11323 1344
NM_003994chr1222779 1371 23104 271 1419 --
NM_004006chrX42116 1950 832 118 ------
NM_004007chrX42116 1950 832 118 ------
NM_004009chrX42116 1950 832 118 ------
NM_004010chrX42116 1950 832 118 ------
NM_004011chrX42116 1950 832 118 ------
NM_004012chrX42116 1950 832 118 ------
NM_004013chrX42116 1950 832 118 ------
NM_004014chrX42116 1950 832 118 ------
NM_004015chrX42116 1950 832 118 ------
NM_004016chrX42030 1864 746 32 ------
NM_004017chrX42116 1950 832 118 ------
NM_004018chrX42030 1864 746 32 ------
NM_004020chrX42116 1950 832 118 ------
NM_004021chrX42030 1864 746 32 ------
NM_004022chrX42030 1864 746 32 ------
NM_004023chrX42030 1864 746 32 ------
NM_004024chr12544 67 ------
NM_004027chr2195 ------
NM_004028chr1823200 1319 ------
NM_004041chr11----183 --
NM_004047chr1149 ------
NM_004050chr1442460 2192 1755 1722 ------
NM_004056chr81700 ------
NM_004061chr51200 --1160 --
NM_004067chr741505 1047 247 218 ------
NM_004079chr112325 ----11861
NM_004080chr71118 ------
NM_004087chr341620 432 372 125 ------
NM_004093chr1342894 2660 836 329 ------
NM_004096chr1021584 505 ------
NM_004100chr6----12209 1201
NM_004105chr21951 --1230 --
NM_004113chr31439 ------
NM_004114chrX21043 982 ------
NM_004124chr1433579 3430 1404 --32427 2320 527 13509
NM_004136chr151385 ----12242
NM_004145chr192352 306 ------
NM_004152chr191235 ------
NM_004161chr221289 227 ------
NM_004169chr171129 ------
NM_004171chr11109509 9355 7868 6489 6422 6077 3701 3471 2609 1627 12134 22156 1853 --
NM_004181chr41310 --1279 --
NM_004187chrX11201 ------
NM_004205chr112538 532 ------
NM_004229chrX21852 354 ------
NM_004232chr1823815 2598 --13472 --
NM_004235chr92697 621 ----1670
NM_004236chr151148 1570 ----
NM_004238chr21215 ------
NM_004242chr61415 ------
NM_004244chr121386 ------
NM_004261chr11778 ------
NM_004268chr113828 334 276 ------
NM_004272chr511632 ------
NM_004274chr1433073 2041 805 ------
NM_004281chr10192 ------
NM_004311chr101434 ----13008
NM_004316chr1231059 884 784 ------
NM_004319chr12552 68 12860 --11987
NM_004329chr1021345 230 ------
NM_004337chr83669 541 60 ------
NM_004342chr712118 ------
NM_004343chr191137 ------
NM_004346chr42521 22 ------
NM_004349chr811111 ------
NM_004350chr121878 593 --1115 1840
NM_004359chr191503 ------
NM_004364chr1951132 1055 1038 368 59 ------
NM_004368chr192868 320 --2891 370 --
NM_004378chr151217 ------
NM_004380chr1652480 1969 1870 661 205 --1193 --
NM_004385chr5197 ----1488
NM_004392chr1342280 1814 1641 933 --12332 12607
NM_004397chr1144302 3337 2633 246 --12725 1583
NM_004411chr71666 ------
NM_004415chr61555 ------
NM_004417chr51137 ------
NM_004423chr312642 ------
NM_004432chr932161 1508 433 ----1886
NM_004439chr41154 ------
NM_004440chr611805 --11500 --
NM_004441chr32973 854 ------
NM_004449chr21------1305
NM_004451chr111733 ------
NM_004454chr352127 1947 1923 246 71 ------
NM_004458chrX148 ------
NM_004459chr172361 226 ------
NM_004464chr434124 1489 1077 --24161 366 --
NM_004481chr131814 960 125 --2647 450 --
NM_004491chr1934265 2996 436 --11287 --
NM_004497chr192586 266 ------
NM_004498chr151295 ------
NM_004516chr1921006 103 ------
NM_004519chr81205 ------
NM_004523chr10--2490 379 11591 --
NM_004535chr2021469 1444 ------
NM_004537chr1231432 1113 41 --1436 --
NM_004543chr21105 ------
NM_004549chr1111483 11382 21532 603 11405
NM_004560chr92653 417 --1905 1848
NM_004566chr1032427 1934 251 12413 ----
NM_004571chr2123352 1206 --21268 475 --
NM_004575chr411528 --11505 --
NM_004586chrX34873 4832 1905 13872 14052 --
NM_004596chr191215 ------
NM_004598chr533082 1045 94 --13089 --
NM_004612chr934574 1557 1305 11315 11519 1292
NM_004622chr222478 2163 --21919 1823 --
NM_004630chr1131206 1113 804 --148 --
NM_004631chr121439 85 ------
NM_004634chr31606 --1106 --
NM_004643chr141580 ------
NM_004654chrY1137 147 ----
NM_004660chrY1196 ------
NM_004663chr1511451 --1333 11017
NM_004666chr61524 --1213 --
NM_004686chr831187 731 72 ------
NM_004687chr171553 1582 ----
NM_004701chr152157 55 ------
NM_004703chr1711587 12110 11886 --
NM_004718chr22146 23 ------
NM_004719chr122349 104 ------
NM_004725chr1031135 201 193 --11242 --
NM_004726chrX75422 4293 4207 4120 1397 1117 650 14874 24968 440 --
NM_004730chr541505 1422 404 185 --1537 --
NM_004734chr132921 262 ------
NM_004736chr142183 414 189 33 ------
NM_004742chr341808 1621 1410 325 ------
NM_004747chr1021018 348 --1430 --
NM_004760chr712103 --1565 --
NM_004774chr1733045 3016 2027 --11996 --
NM_004788chr1121061 878 --164 --
NM_004796chr1422182 1676 --11897 --
NM_004805chr21298 1492 1954 --
NM_004815chr144001 3689 3520 717 --24819 4152 --
NM_004822chr1743649 3103 2694 1345 12526 33211 2564 2465 11595
NM_004827chr44721 713 392 249 ------
NM_004834chr253179 3145 2707 2116 388 ----12418
NM_004845chrX43609 1294 708 145 13156 --23179 1101
NM_004849chr641622 1252 407 255 ----1171
NM_004857chr1423714 2907 24769 1673 31695 599 362 12985
NM_004859chr171607 ------
NM_004867chrX----1454 --
NM_004871chr1783595 3277 2874 2691 474 457 366 50 1337 ----
NM_004872chr1------175
NM_004879chr11----1994 --
NM_004887chr5--11124 ----
NM_004893chr5----2424 142 --
NM_004896chr1021199 619 ------
NM_004897chr101141 ------
NM_004904chr764946 2340 2125 2016 1020 889 25189 4189 --21556 297
NM_004922chr1011014 ------
NM_004924chr194985 925 341 230 --11042 --
NM_004969chr101547 ----1458
NM_004972chr9--11038 1741 --
NM_004973chr641701 1576 300 125 ------
NM_004976chr1153461 1551 1471 1319 1003 34580 3206 2053 24185 209 --
NM_004985chr1233294 424 206 --12749 --
NM_004992chrX37943 7033 1483 --25693 1213 --
NM_004992chrX37943 7033 1483 --25693 1213 --
NM_005010chr722126 363 --11475 --
NM_005016chr121232 ------
NM_005028chr1021961 1898 ------
NM_005036chr2288348 8204 5931 3236 2583 1926 1453 259 13022 22826 2732 16511
NM_005045chr71627 ------
NM_005054chr2124 --21731 1362 --
NM_005056chr1265389 4388 1957 1940 493 318 --14265 21719 81
NM_005063chr1023251 1472 --2794 362 --
NM_005067chr31964 ------
NM_005068chr611304 ----21176 541
NM_005076chr141049 843 718 110 --14229 13622
NM_005077chr92487 412 ------
NM_005086chr1221256 167 ----11565
NM_005087chr31610 ------
NM_005088chrX2720 616 --1695 --
NM_005095chr111812 --1525 --
NM_005096chrX1345 1472 2223 202 --
NM_005099chr1--21110 965 2987 169 --
NM_005105chr121417 456 --11640 --
NM_005119chr131242 987 831 ------
NM_005121chr1783401 3367 3255 3248 1370 915 866 550 1795 ----
NM_005131chr18178 ------
NM_005134chr181359 ------
NM_005153chr161837 ------
NM_005156chr9125084 4940 4696 4137 3992 3484 1412 1271 1199 955 919 191 --1214 --
NM_005157chr921931 1397 --11580 --
NM_005160chr2276790 6290 5786 5422 2605 2266 842 46351 6305 739 47 ----
NM_005163chr14179 ------
NM_005180chr10----2268 214 --
NM_005184chr1921536 341 ------
NM_005188chr1177639 5575 2840 1830 1220 737 204 15042 27749 5064 --
NM_005197chr1444757 1552 1451 116 13951 --145
NM_005207chr2293564 3506 3275 2882 2754 2501 2413 508 288 1765 --21412 788
NM_005214chr221046 849 ------
NM_005224chr191599 --1715 --
NM_005230chr121112 ------
NM_005235chr246393 2370 2257 645 --35736 2693 77 --
NM_005238chr1142832 2781 2705 962 ----1637
NM_005240chr12645 176 ------
NM_005254chr151952 ------
NM_005257chr1821068 482 ------
NM_005259chr211248 ----11126
NM_005261chr8----1100 --
NM_005264chr101924 ------
NM_005268chr11221 ------
NM_005273chr71309 ------
NM_005274chr1124 ------
NM_005281chr11708 ------
NM_005313chr151208 ------
NM_005329chr1632236 2175 2126 ------
NM_005336chr2161 ------
NM_005342chrX1166 ------
NM_005349chr41587 --190 --
NM_005354chr191489 ------
NM_005359chr1855851 4254 4238 1732 1501 14642 34300 2490 2293 1588
NM_005375chr63877 859 27 --11006 11022
NM_005378chr2191 ------
NM_005381chr22395 171 --1122 --
NM_005387chr112676 140 ------
NM_005397chr71753 11561 43844 3586 2672 1615 --
NM_005398chr101468 --125 --
NM_005399chr134045 3546 701 14100 --11022
NM_005400chr241062 600 565 83 ------
NM_005406chr1811041 ------
NM_005426chr12929 780 ------
NM_005430chr121767 ------
NM_005433chr1822164 1836 ------
NM_005436chr1013413 ----21154 786
NM_005443chr42191 146 --1493 --
NM_005455chr141767 1655 1220 1202 ------
NM_005474chr1721506 104 ----2577 378
NM_005475chr121900 1184 ----
NM_005477chr152730 290 --22211 980 1812
NM_005477chr152730 290 --22211 980 1812
NM_005487chr2232076 1426 49 ------
NM_005494chr72601 477 ------
NM_005502chr913306 --22176 453 --
NM_005506chr432302 1840 353 12171 --12194
NM_005512chr111456 1217 1106 --
NM_005539chr102533 224 11374 ----
NM_005542chr721412 1294 --11400 --
NM_005562chr111207 ------
NM_005563chr12795 605 --1214 --
NM_005576chr151225 ------
NM_005578chr334394 3732 1079 ------
NM_005585chr151387 ------
NM_005587chr151957 ------
NM_005596chr985809 5455 4798 4746 3944 2235 1090 462 11828 14309 --
NM_005599chr12309 184 --21519 994 --
NM_005602chr31956 ------
NM_005610chr12655 74 ------
NM_005625chr821068 203 ----1971
NM_005626chr1------1435
NM_005627chr62991 311 --1623 --
NM_005637chr1841810 1537 1428 160 --11833 1537
NM_005638chrX21725 253 ------
NM_005647chrX22504 562 1894 2294 232 --
NM_005655chr8--2263 200 --2381 40
NM_005656chr2131262 1168 55 ------
NM_005657chr15122 ------
NM_005662chr81390 --1365 --
NM_005665chr124293 3650 1689 1711 --
NM_005667chr22325 81 ------
NM_005668chr51551 189 --1874
NM_005688chr321170 444 ----1499
NM_005715chr622679 209 --1669 --
NM_005721chr2183 ------
NM_005722chr222376 1554 --1603 --
NM_005730chr1253550 2842 2463 820 591 --12626 --
NM_005736chr102514 497 ------
NM_005737chr242716 1083 796 625 --22850 2094 --
NM_005738chr74601 289 83 46 --1195 --
NM_005740chr223915 107 85 1894 ----
NM_005746chr71108 ------
NM_005748chr1263137 3126 3064 2573 1245 603 --1205 --
NM_005756chrX2237 184 --1207 --
NM_005759chr231740 134 44 --13757 --
NM_005762chr191127 ------
NM_005766chr1341382 1155 1079 959 ------
NM_005786chr181124 ------
NM_005789chr1722109 61 ------
NM_005795chr232751 1896 195 ------
NM_005801chr172744 737 ------
NM_005813chr242100 757 513 247 ------
NM_005822chr621717 1468 ----1440
NM_005832chr31215 ------
NM_005839chr13675 348 38 ----1884
NM_005840chrX36572 6519 408 17319 26559 1432 --
NM_005841chr41386 ------
NM_005869chr51125 ------
NM_005880chr1651244 1183 611 556 116 ------
NM_005882chr41957 1166 ----
NM_005895chr1253753 3505 2714 1296 1044 23552 741 33073 1082 763 --
NM_005898chr1131961 1223 451 ------
NM_005900chr421110 486 ------
NM_005901chr18108458 7382 6246 5776 3117 2837 1656 1377 1112 656 1127 13431 --
NM_005902chr1554087 3430 1734 998 938 ----1859
NM_005903chr584357 4064 4009 3959 3264 2085 1954 1008 ------
NM_005904chr181134 ------
NM_005907chr621279 464 ------
NM_005909chr51752 --24057 3405 --
NM_005920chr163154 2969 2927 1082 939 530 --11042 --
NM_005922chr61499 ------
NM_005923chr61515 ------
NM_005933chr1142910 2783 500 195 12091 ----
NM_005935chr431739 987 285 23231 1897 14136 --
NM_005937chr1743310 2810 2651 1449 --13148 11067
NM_005941chr824040 1060 --13653 --
NM_005955chr155236 2138 2034 878 374 --33970 2057 335 --
NM_005962chr10------11971
NM_005962chr10------11971
NM_005975chr204811 784 778 426 1199 ----
NM_005977chr13----1865 --
NM_005981chr122887 91 1649 1671 --
NM_005996chr1261522 1464 620 307 300 185 ------
NM_006007chr944427 3981 789 653 13840 23862 3202 13692
NM_006015chr131032 819 476 ------
NM_006022chr132977 275 ------
NM_006030chr321820 143 --1405 --
NM_006035chr1411225 ------
NM_006037chr264766 4291 3446 1834 1797 173 ------
NM_006038chr20--156 ----
NM_006047chr204773 626 411 303 --1123 --
NM_006063chr2137 ------
NM_006079chr61155 --1262 --
NM_006080chr712825 ------
NM_006086chr161241 ------
NM_006089chrX11423 --11816 11447
NM_006106chr1151327 993 878 777 452 --12667 --
NM_006108chr1142397 2067 1526 478 --1843 --
NM_006133chr1112470 ------
NM_006136chr71340 ----11129
NM_006141chr1642047 1093 1075 938 --12447 --
NM_006148chr1742855 2462 537 217 --22440 880 --
NM_006157chr112338 83 ------
NM_006162chr1811372 ------
NM_006166chr1232542 1680 712 --11945 --
NM_006180chr911695 ----11546
NM_006183chr121119 ------
NM_006191chr122758 711 --1186 --
NM_006192chr201940 ------
NM_006195chr9--11086 --1300
NM_006202chr1931685 1598 586 ------
NM_006203chr565470 3449 1538 1448 1334 336 --14492 --
NM_006235chr1121625 1323 11507 11529 --
NM_006237chr1321661 905 11792 ----
NM_006241chr332405 2002 1836 --11728 --
NM_006251chr512243 2687 248 2709 557 --
NM_006252chr175696 4736 2994 2688 2281 616 332 ----17311
NM_006256chr132366 1778 892 ------
NM_006265chr831475 992 622 ------
NM_006311chr17157 ------
NM_006312chr121669 ------
NM_006313chr1211563 ------
NM_006315chr453561 2934 774 537 331 1377 1841 --
NM_006323chr4----1236 --
NM_006328chr112230 108 ------
NM_006330chr8----11658 --
NM_006335chr11339 ------
NM_006352chr121447 549 ------
NM_006359chrX12242 --12358 1818
NM_006364chr142806 124 ------
NM_006375chrX2555 83 --11219 --
NM_006379chr732108 1740 701 ------
NM_006380chr1733890 3704 1072 ----12736
NM_006386chr2251942 1592 604 542 185 --22331 1543 --
NM_006389chr11----1476 --
NM_006400chr122302 73 ------
NM_006407chr321381 1202 ------
NM_006415chr911277 --11144 --
NM_006420chr2023283 2531 ----12947
NM_006421chr821014 70 ------
NM_006460chr1721800 637 --1137 --
NM_006464chr254662 4595 1809 925 919 --12869 13113
NM_006469chr111520 ------
NM_006474chr131975 499 489 11659 ----
NM_006482chr1223300 1190 --23480 3051 12597
NM_006496chr111307 --1642 --
NM_006503chr19----1109 --
NM_006526chr2022001 28 ------
NM_006527chr41309 --199 1552
NM_006534chr2033446 789 760 --1407 --
NM_006540chr8----1389 --
NM_006546chr1735330 4035 2370 1801 12139 --
NM_006551chr11--177 126 --
NM_006552chr11--179 ----
NM_006558chr81337 ------
NM_006561chr1054335 4242 2025 862 708 --21254 446 1813
NM_006566chr181197 --1365 --
NM_006572chr1743047 1346 637 158 ------
NM_006587chr411718 --21166 339 --
NM_006591chr1121742 155 ------
NM_006593chr23743 236 153 ------
NM_006599chr1687973 7596 5620 3016 2900 1926 1652 678 15290 ----
NM_006609chr232404 2057 508 ------
NM_006612chr171499 --1414 --
NM_006614chr333638 3117 3048 ------
NM_006618chr121531 1202 --11315 1576
NM_006624chr1021929 451 ------
NM_006628chr15--13627 24394 3649 --
NM_006629chr1822116 1094 ------
NM_006633chr51761 ------
NM_006642chr1160 ------
NM_006646chr135683 482 437 366 151 --157 --
NM_006654chr1244592 4053 988 834 ------
NM_006667chrX31203 999 909 ------
NM_006670chr6--1264 ----
NM_006675chr1242925 2173 972 615 ----13326
NM_006676chr92377 291 ------
NM_006698chr202982 385 --2432 211 --
NM_006699chr122286 854 ------
NM_006708chr621006 180 1380 21081 826 --
NM_006711chr163301 243 176 --1656 --
NM_006717chr953199 2778 2119 975 137 --12163 --
NM_006722chr353080 2536 2464 1081 1033 ------
NM_006724chr61499 ------
NM_006729chrX64855 3609 3489 2154 1072 897 13972 ----
NM_006731chr945734 4450 1686 1034 --11709 12159
NM_006732chr1911349 --31777 1551 499 --
NM_006735chr7157 ------
NM_006738chr1553858 3459 1583 797 296 --24316 578 --
NM_006746chrX1236 --21470 1059 --
NM_006754chr711159 ------
NM_006758chr211119 ------
NM_006761chr171142 ----1115
NM_006764chr3----178 1458
NM_006766chr862062 2045 1730 988 198 133 ------
NM_006775chr622372 2155 ------
NM_006777chrX12260 153 1690 --
NM_006790chr51102 ------
NM_006791chr151537 ------
NM_006801chr193580 515 167 1141 1570 --
NM_006805chr51659 ------
NM_006807chr17--144 --11098
NM_006812chr121625 ------
NM_006814chr2021007 398 ------
NM_006815chr123966 948 469 ------
NM_006819chr111285 ------
NM_006826chr21429 ------
NM_006827chr1453316 3229 3112 3083 218 --12699 --
NM_006851chr1232769 395 377 12759 ----
NM_006854chr72605 168 11464 11639 --
NM_006856chr123761 352 237 ------
NM_006861chr1252067 1695 1497 659 534 1756 --1622
NM_006868chr1823186 2044 ------
NM_006877chr6------1331
NM_006884chr311399 --11371 --
NM_006885chr1663436 2879 2755 1492 1485 275 ------
NM_006887chr21194 ----1686
NM_006888chr144995 617 472 442 ------
NM_006892chr2011178 ------
NM_006892chr2011178 ------
NM_006920chr21559 ------
NM_006924chr1733684 1390 276 ------
NM_006930chr511331 ------
NM_006939chr1421141 286 ------
NM_006959chr191338 1382 1328 --
NM_006963chr1021227 499 ------
NM_006990chr152378 2346 1559 424 310 1869 ----
NM_006996chr121389 544 --1502 --
NM_006997chr101190 ------
NM_007006chr1643428 861 571 97 ------
NM_007008chr21889 ------
NM_007009chr7128 ------
NM_007010chr173729 377 212 --1235 --
NM_007011chr1574353 2291 1918 1686 837 202 74 11423 --11833
NM_007029chr8199 ------
NM_007038chr2145865 4567 2254 2217 --25645 4667 --
NM_007039chr1452182 1576 846 547 186 ----1223
NM_007040chr19----21067 933 --
NM_007050chr2067118 6160 2490 1859 1261 173 23179 2056 11100 --
NM_007052chrX----166 1559
NM_007054chr543550 3253 2947 1513 12838 --22861 696
NM_007064chr31429 1501 --125
NM_007111chr131735 ------
NM_007118chr53832 691 252 ------
NM_007125chrY21335 65 ------
NM_007126chr91158 ------
NM_007129chr1321017 386 ------
NM_007146chr1722818 1955 ------
NM_007158chr11825 ------
NM_007159chr311198 ------
NM_007170chr12761 694 ------
NM_007173chr1131757 187 35 ------
NM_007174chr1252302 1936 890 521 389 --12117 12167
NM_007178chr121422 ------
NM_007200chr1553858 3459 1583 797 296 --24316 578 --
NM_007202chr171713 ------
NM_007203chr933936 3890 248 --12735 --
NM_007207chr1171 ------
NM_007212chr111683 12017 ----
NM_007218chr81131 --1186 --
NM_007222chr811596 ----1617
NM_007235chr121491 --189 --
NM_007238chr2054866 4695 4611 1293 312 ------
NM_007249chr13108907 8796 7296 3209 2842 2738 2521 2466 1731 159 27532 2057 1733 --
NM_007279chr191507 ------
NM_007313chr921931 1397 --11580 --
NM_007347chr1542420 449 122 42 12030 12443 --
NM_007371chr91680 ------
NM_007372chr172864 281 ------
NM_007374chr141446 ------
NM_007375chr132582 287 111 ------
NM_012081chr512388 ------
NM_012082chr81311 ------
NM_012090chr121106 306 ------
NM_012095chr1011247 --13348 1341
NM_012096chr323329 2303 23111 545 ----
NM_012097chr232060 1724 79 --11847 --
NM_012102chr142419 2383 2096 195 ----11809
NM_012104chr1112424 --23357 2670 11211
NM_012104chr1112424 --23357 2670 11211
NM_012153chr1142601 869 661 639 1476 1966 --
NM_012154chr82873 224 ------
NM_012155chr191205 ------
NM_012156chr2033137 3110 1307 --1886 --
NM_012186chr11748 ------
NM_012193chr1143952 1835 1182 426 24118 1435 14140 --
NM_012197chr941611 1328 1273 1069 1538 ----
NM_012199chr164420 4043 3226 2890 2817 588 --33266 1761 1645 --
NM_012200chr11182 ------
NM_012215chr1041805 1771 381 68 1448 11841 --
NM_012218chr1952353 1969 589 461 211 --1797 --
NM_012223chr23469 459 58 ----1333
NM_012224chr43777 388 293 --1995 --
NM_012234chr353558 3216 2448 800 323 13588 11094 --
NM_012238chr101449 ------
NM_012247chr102419 26 ------
NM_012249chr211374 1254 12226 --
NM_012252chr724156 998 ----11364
NM_012259chr621177 896 ------
NM_012262chr175255 5032 3684 2095 1756 1020 564 --14623 --
NM_012286chrX1525 ------
NM_012290chr211285 ------
NM_012294chr753395 2788 2613 497 189 --1261 --
NM_012300chr52976 381 ------
NM_012301chr741822 1750 802 522 ------
NM_012304chr542192 2176 1935 1649 12439 ----
NM_012307chr181700 ----1327
NM_012308chr1142329 2180 983 640 --22164 1842 --
NM_012309chr1171748 1590 1538 1339 847 616 168 --14235 --
NM_012316chr145416 2100 1666 627 15622 --11208
NM_012317chrX1667 ------
NM_012319chr182838 341 ------
NM_012325chr201573 1534 21615 101 --
NM_012329chr1711361 ------
NM_012347chr622990 1127 --22415 803 --
NM_012382chr521373 692 --23503 230 --
NM_012395chr743391 2890 797 601 ------
NM_012405chr113608 42839 2485 2477 762 12861 --
NM_012406chr123976 254 78 ------
NM_012412chr74868 835 823 219 ------
NM_012419chr61437 --1137 1404
NM_012421chr11184 ------
NM_012426chr161342 ------
NM_012428chr151869 ------
NM_012434chr631213 1191 1110 ------
NM_012446chr51513 ------
NM_012448chr1722055 301 ----11634
NM_012454chr61425 ------
NM_012461chr14----1249 --
NM_012471chrX21909 1385 --31620 562 347 --
NM_012479chr742137 717 700 526 1510 ----
NM_013231chr14----44271 3791 3779 1373 13406
NM_013233chr2------1350
NM_013235chr5----2903 171 --
NM_013236chr221212 ------
NM_013257chr812211 ------
NM_013261chr433706 347 181 --12815 --
NM_013269chr1253952 3719 1562 771 285 ------
NM_013272chr151274 ------
NM_013281chr2011064 ----11399
NM_013286chr351125 781 619 346 89 --13153 --
NM_013293chr71119 ------
NM_013309chr1521731 1648 --12176 --
NM_013313chr2263284 3135 2788 2709 1051 855 ----12372
NM_013322chr721413 301 ------
NM_013346chrX152 ------
NM_013354chr831347 533 309 ------
NM_013357chr81863 ------
NM_013365chr223609 517 235 ------
NM_013371chr11328 ------
NM_013372chr1532653 1209 313 --12524 --
NM_013374chr342143 407 394 349 12708 22409 2062 --
NM_013381chr1242171 1950 893 153 ------
NM_013390chr931744 1564 353 ------
NM_013399chr162289 247 11354 21491 1157 11536
NM_013400chr711089 ------
NM_013423chrX1497 ------
NM_013427chrX1497 ------
NM_013433chr1931672 1576 25 ------
NM_013436chr2148 --1146 --
NM_013437chr81341 1890 --11023
NM_013438chr911714 ------
NM_013446chr761404 1324 956 534 455 28 --1541 --
NM_013448chr141233 ------
NM_013450chr21200 ------
NM_013952chr212361 ------
NM_013953chr212361 ------
NM_013992chr212361 ------
NM_013995chrX22473 180 ------
NM_014005chr532429 1027 937 12054 12076 --
NM_014010chr92495 149 ------
NM_014011chr252601 2458 2119 1888 252 ------
NM_014023chr1031115 974 927 2946 664 ----
NM_014048chr1644823 4238 1983 1595 ------
NM_014071chr201212 ------
NM_014096chr112557 37 ----1564
NM_014106chr1542713 1943 1903 867 --3784 576 30 22762 108
NM_014112chr864734 4386 4078 4007 3899 2091 ------
NM_014117chr1622727 2361 12104 1482 --
NM_014155chr1197029 6058 5343 5237 2637 2563 1807 153 112 11443 56648 2443 1465 1029 325 --
NM_014157chr1643301 3123 1431 225 23405 2561 12449 12584
NM_014212chr121647 ------
NM_014213chr21233 --1165 --
NM_014217chr111666 --1522 --
NM_014231chr1232070 1835 1691 ----1530
NM_014240chr333475 2706 632 --11047 --
NM_014245chr321109 154 ----1920
NM_014250chr2232076 1426 49 ------
NM_014252chr13163 ------
NM_014253chrX42473 886 74 61 ------
NM_014263chr10131 ----11279
NM_014268chr18--1899 11362 --
NM_014279chr91725 --1882 --
NM_014283chr1----1127 --
NM_014286chr932563 2383 1025 23312 3169 11133 --
NM_014294chr811173 1129 ----
NM_014296chr31214 ------
NM_014309chr2264538 4037 2056 1604 1588 1409 --1492 --
NM_014319chr121462 ------
NM_014323chr22--1940 1171 --
NM_014325chr1221803 484 ------
NM_014326chr1521242 591 ------
NM_014331chr477150 6781 6692 6603 5673 2071 381 ----12388
NM_014342chr1111317 11021 --11194
NM_014361chr112185 175 ------
NM_014372chr131296 538 48 ----11435
NM_014374chr711089 ------
NM_014376chr512168 --21823 192 --
NM_014382chr32696 440 ------
NM_014421chr41342 21340 1300 11944 --
NM_014423chr514985 1810 21509 241 14293
NM_014426chr202616 163 ------
NM_014432chr641488 1415 1224 182 ------
NM_014445chr342301 1700 408 150 ----1726
NM_014447chr441248 1103 1036 177 ------
NM_014452chr62227 53 ------
NM_014456chr1031409 687 360 ----1538
NM_014458chr12222 206 ------
NM_014488chr11------1191
NM_014494chr1612229 ------
NM_014504chr741928 1784 559 295 11829 ----
NM_014515chr121107 ------
NM_014552chr211428 ------
NM_014554chr121877 1763 --1352
NM_014572chr1331610 1221 497 ------
NM_014573chr1731806 1443 1240 --1397 --
NM_014574chr1411133 --1990 --
NM_014577chr222907 25 ------
NM_014607chr231622 1451 104 ------
NM_014613chr542938 2264 2131 680 12184 12650 --
NM_014614chr2----1126 --
NM_014615chr163930 876 252 --12503 --
NM_014616chr333373 2727 249 11097 --12500
NM_014630chr1563227 2651 1319 969 729 499 --12932 --
NM_014635chr2----21709 1330 --
NM_014636chr944000 3697 3541 3196 ----23255 1459
NM_014637chr831361 1071 166 --1113 --
NM_014640chr2----1296 --
NM_014646chr1823042 1053 2755 708 ----
NM_014647chr16--168 1763 --
NM_014660chr721148 200 ------
NM_014666chr51984 ------
NM_014667chr342121 678 118 41 --1845 --
NM_014669chr16----1110 --
NM_014671chr721534 633 --11407 --
NM_014676chr121210 348 1586 ----
NM_014682chr822200 1707 ------
NM_014683chr1732036 1460 1354 ------
NM_014686chr1932414 964 639 --12335 --
NM_014707chr72580 130 ------
NM_014715chr111934 ------
NM_014727chr191232 ------
NM_014729chr831573 337 254 ------
NM_014730chr1264927 4281 3369 3211 1220 62 11835 33468 1069 69 --
NM_014730chr1264927 4281 3369 3211 1220 62 11835 33468 1069 69 --
NM_014733chr512039 1468 1415 --
NM_014743chr421075 97 --1509 --
NM_014751chr821780 1716 11456 ----
NM_014755chr224082 3209 ------
NM_014761chr1621161 280 ------
NM_014764chr121838 --2391 302 --
NM_014767chr1052815 2617 2384 961 332 --2453 431 --
NM_014770chr1221197 1081 --11190 --
NM_014774chr163214 2512 2506 2500 2128 500 ------
NM_014779chr32926 284 ------
NM_014784chr13785 282 167 1190 1455 --
NM_014786chr1121185 1179 11216 --11150
NM_014787chr142214 2091 801 397 --32535 406 172 --
NM_014790chr51138 ------
NM_014791chr91228 ------
NM_014810chr153593 2944 1136 745 397 --11394 --
NM_014812chr11246 --11376 --
NM_014813chr11498 ----2458 158
NM_014819chr522441 1775 ----1408
NM_014824chr1141651 1597 1310 282 ------
NM_014827chr1--11503 11074 --
NM_014828chr1412499 --11738 --
NM_014836chr1031992 359 113 ------
NM_014839chr121897 288 ------
NM_014841chr6--1363 ----
NM_014847chr12467 98 ------
NM_014850chr374882 4672 4631 4587 4298 3715 3384 --14692 --
NM_014853chr1721451 500 ------
NM_014858chr1----11069 --
NM_014864chr111368 24380 1376 1935 --
NM_014868chr123821 131 35 ------
NM_014870chr153368 3350 3224 1500 1094 24523 1408 ----
NM_014873chr124768 3990 21394 1228 13237 --
NM_014876chr224761 548 469 444 --12048 1785
NM_014877chr1796625 6546 5648 5543 5307 5257 4960 1760 408 16097 26119 1292 --
NM_014893chrY22209 1590 ------
NM_014897chr1732165 2060 806 12655 23121 363 12678
NM_014899chr512632 --12692 1170
NM_014901chr542125 2096 869 259 1394 ----
NM_014903chr1232384 861 654 --2683 127 --
NM_014904chr1033803 1094 653 23091 102 1373 21053 705
NM_014906chr1742927 2751 773 388 ------
NM_014912chr1023479 132 ------
NM_014918chr1531101 1058 112 ------
NM_014921chr1942730 2093 584 199 11902 32973 2816 2736 --
NM_014923chr132701 225 --12268 --
NM_014926chr31859 ------
NM_014944chr131410 1179 26 ------
NM_014946chr212530 12030 33049 2536 274 --
NM_014949chr1----21019 757 --
NM_014952chr1541816 1370 346 121 --11981 --
NM_014953chr1333615 2884 1305 13563 134 --
NM_014962chr2032663 1979 232 ------
NM_014964chr1742397 789 768 313 11948 21987 1802 --
NM_014969chr11103 --1328 --
NM_014978chr1021826 1779 --1296 --
NM_014988chr441070 440 294 188 ----12075
NM_014991chr442580 2419 521 32 --1595 --
NM_014997chr762341 2212 1189 839 688 152 --11006 --
NM_015000chr1242541 976 537 493 12855 ----
NM_015001chr11261 ------
NM_015002chr1231957 1908 1900 2861 297 ----
NM_015008chr353198 3073 2838 2407 886 --23183 820 --
NM_015017chr111260 1414 ----
NM_015020chr1622865 170 1300 --11504
NM_015023chr1183 --1468 --
NM_015024chr8145 --11491 --
NM_015027chr1631715 1344 437 ----11390
NM_015033chr932960 689 130 11149 --23057 1172
NM_015035chr2086141 6129 4446 4415 4064 2262 1723 1003 --56168 5762 5635 4517 1092 11888
NM_015039chr132830 1174 1025 11575 44165 4044 1664 1361 --
NM_015040chr21184 ------
NM_015042chr1534022 589 354 --1903 --
NM_015044chr1622647 2219 ------
NM_015049chr221114 72 ------
NM_015050chr61908 --11173 --
NM_015053chr152334 486 474 333 219 139 ----
NM_015057chr132443 197 ------
NM_015060chr7--1207 ----
NM_015069chr161600 1583 ----
NM_015071chr556492 2401 1181 862 820 --25270 1067 14093
NM_015073chr1921897 393 22123 2105 --1210
NM_015076chr634448 3491 342 22929 802 22951 975 --
NM_015087chr1312429 --2988 610 --
NM_015092chr1624351 1373 ------
NM_015093chr611816 ------
NM_015097chr352090 1943 1711 783 28 --11728 --
NM_015100chr122029 512 --2649 102 1553
NM_015101chr142259 2095 417 47 ------
NM_015107chrX1239 11946 1520 --
NM_015110chr912319 12093 22115 871 --
NM_015115chr433185 2871 886 13194 1398 23250 2779
NM_015124chr2212037 ----11531
NM_015130chr41328 ----11223
NM_015132chr7----1272 --
NM_015138chr1532152 1881 386 1523 --12618
NM_015155chr1053238 2307 970 397 133 ------
NM_015156chr1463004 2836 2455 1239 1198 1033 ------
NM_015172chr111544 11614 11399 --
NM_015176chr111757 ------
NM_015178chr812155 12681 12597 --
NM_015186chr91310 --1363 --
NM_015192chr2042661 2605 2522 583 ------
NM_015199chr352584 2169 811 558 259 ------
NM_015200chr441941 1021 856 789 ------
NM_015202chr16----11152 --
NM_015203chr1162 ------
NM_015206chr1573856 2537 2440 1247 1069 965 144 ------
NM_015208chr181656 --12892 --
NM_015209chr142289 521 314 289 ------
NM_015234chr621197 103 ------
NM_015239chr9152 ----1137
NM_015245chr632729 1984 655 ------
NM_015247chr1675032 4256 1762 1342 621 440 221 ------
NM_015251chr1631927 1820 1482 11957 ----
NM_015262chr102209 157 ----178
NM_015267chr121683 21565 806 11366 --
NM_015268chr3------1102
NM_015270chr1222295 1816 --11911 --
NM_015271chr433746 1634 1553 --33537 2720 34 --
NM_015272chr1611903 ------
NM_015275chr122851 813 ------
NM_015278chr642625 902 792 785 --12595 --
NM_015284chr141941 1342 531 405 ------
NM_015288chr523022 126 --1975 --
NM_015293chr61226 ------
NM_015299chr1423056 245 --13278 1537
NM_015310chr848335 5457 981 283 27210 5866 28023 3276 --
NM_015314chr72934 123 --12576 --
NM_015315chr522766 2251 1632 ----
NM_015316chr14----128 1101
NM_015317chr23800 637 595 --12857 12299
NM_015326chr133009 1153 605 ----12677
NM_015328chr742839 2813 969 595 12499 11963 12522
NM_015335chr1242308 996 630 500 ----1488
NM_015336chr1212055 ----11036
NM_015347chr1222527 2317 --22298 2187 1189
NM_015354chr91384 1335 ----
NM_015355chr171680 --21375 427 --
NM_015358chr2111268 ------
NM_015365chrX43682 589 303 73 11096 ----
NM_015375chr164978 4683 4533 3510 3273 1794 24564 638 33365 1575 623 --
NM_015387chr22393 202 1349 ----
NM_015396chr31218 ------
NM_015435chr8--1106 --1300
NM_015441chr12335 321 ------
NM_015446chr11129 ----1336
NM_015447chr91153 ------
NM_015455chr523708 1507 12539 ----
NM_015458chr865193 5007 3285 911 753 388 --14323 13421
NM_015460chr362025 1867 829 769 564 192 ------
NM_015461chr18------1238
NM_015464chr7----1974 --
NM_015465chr51581 1296 1202 --
NM_015472chr31158 ------
NM_015472chr31158 ------
NM_015481chr12----21008 952 --
NM_015497chr1521096 1023 ------
NM_015508chr311531 ------
NM_015513chr3191 ------
NM_015514chr141530 178 1426 --
NM_015520chr332465 1994 429 ------
NM_015525chr61943 ------
NM_015532chr1572832 2694 750 684 658 645 245 ------
NM_015534chr11213 1313 ----
NM_015542chr1011036 ------
NM_015550chr7------13178
NM_015553chr634449 1955 846 13658 --14234
NM_015554chr1521977 585 --11834 --
NM_015565chr2121601 255 ------
NM_015569chr113902 24347 1425 ----
NM_015571chr622314 2225 --11055 --
NM_015575chr242467 1362 603 417 --12490 13357
NM_015576chr331997 1847 941 12595 --12460
NM_015578chr191765 ----11510
NM_015602chr131829 1526 1383 ------
NM_015607chr11210 ------
NM_015609chr121082 548 --11901 --
NM_015635chr9--11696 21891 618 --
NM_015640chr154275 3846 661 430 408 ------
NM_015641chr731096 189 47 1172 --1848
NM_015642chr3------1102
NM_015670chr171115 ------
NM_015686chrX----12358 --
NM_015691chrX42198 2032 459 188 --12543 12715
NM_015713chr843585 2283 1312 1227 ------
NM_015716chr171109 ------
NM_015726chr141777 432 318 298 ------
NM_015850chr831858 1627 365 ------
NM_015866chr1--1399 ----
NM_015872chr11339 --21267 457 --
NM_015874chr41587 --190 --
NM_015878chr811497 ------
NM_015879chr1867850 7423 6383 441 258 200 ------
NM_015885chr111836 ------
NM_015892chr1032142 2071 455 ------
NM_015895chr61177 ------
NM_015898chr1952241 1649 575 288 276 11623 1454 --
NM_015902chr81200 ------
NM_015904chr21177 ------
NM_015905chr72394 29 ------
NM_015906chr133258 670 600 1564 34504 3982 3307 --
NM_015912chr821671 22 --12473 --
NM_015932chr133559 154 148 1283 1565 --
NM_015955chr2190 ------
NM_015976chr11244 ------
NM_015986chr17125 --11117 --
NM_016009chr144917 4394 589 524 2428 238 1612 --
NM_016021chr62807 759 --22744 2247 --
NM_016022chr11845 ------
NM_016025chr1631907 559 405 ------
NM_016032chrX2459 235 --1122 1339
NM_016037chr13428 245 91 1978 11000 --
NM_016038chr72180 75 ------
NM_016059chr61337 ------
NM_016061chr22369 35 ------
NM_016075chr1323051 1139 --12514 --
NM_016081chr411603 ------
NM_016083chr613426 --11417 --
NM_016120chrX11167 ----11075
NM_016121chr12999 268 --1432 11133
NM_016131chr23682 614 539 12351 ----
NM_016173chr363778 2826 1031 832 611 337 22839 742 11745 --
NM_016200chr7----1203 --
NM_016205chr431245 517 223 ------
NM_016206chr348679 6427 424 140 16294 27601 2419 --
NM_016217chr653650 3639 1424 1389 188 ------
NM_016224chr61285 --1183 --
NM_016227chr1----1127 --
NM_016240chr831571 1387 518 1609 ----
NM_016248chr1333552 2440 597 ------
NM_016252chr21817 ------
NM_016255chr652753 1334 1153 706 354 ------
NM_016260chr246125 5579 802 405 11133 --14737
NM_016264chr19133 ------
NM_016271chr1822367 1455 ------
NM_016277chr611428 ------
NM_016289chr242176 809 765 302 ------
NM_016303chrX1114 ------
NM_016304chr152745 540 ------
NM_016308chr121644 1599 --11537 --
NM_016315chr211888 ------
NM_016322chr912718 ------
NM_016333chr161485 ------
NM_016337chr141312 ------
NM_016339chr1711227 ------
NM_016374chr11618 ----11446
NM_016374chr11618 ----11446
NM_016396chr1521155 953 ------
NM_016410chr9196 ------
NM_016422chr111861 ----12794
NM_016433chr1231089 331 186 ------
NM_016436chr201863 --1414 --
NM_016441chr221564 1467 126 ----
NM_016470chr201486 ------
NM_016494chr22135 68 ------
NM_016505chr11739 ------
NM_016507chr1732780 2757 2649 --22194 413 --
NM_016522chr1111461 ------
NM_016525chr92863 634 ------
NM_016530chr1553382 2822 1108 946 449 11207 --12547
NM_016531chr453967 3161 2901 614 116 1783 ----
NM_016542chrX21260 347 ------
NM_016545chr11805 ------
NM_016569chr1261522 1464 620 307 300 185 ------
NM_016577chr331245 839 216 ----14263
NM_016603chr531961 1377 244 --11655 11972
NM_016613chr432377 551 51 --12106 --
NM_016621chr1134553 3436 1290 1390 43834 3601 1708 1638 --
NM_016626chr181203 --1184 --
NM_016628chr10125 ------
NM_016631chr211706 --1881 --
NM_016653chr2165 ------
NM_016654chr151952 ------
NM_016823chr171367 ------
NM_016830chr123432 197 53 ------
NM_016936chr1642223 2065 1496 59 ------
NM_016946chr133040 1212 1168 23299 2285 --22308 1020
NM_016950chr411295 1406 11376 --
NM_016952chr112935 641 1632 1413 --
NM_017420chr1413598 1531 11401 --
NM_017431chr2------1700
NM_017447chr2123021 2987 --143 --
NM_017450chr1721172 90 --159 --
NM_017455chr151869 ------
NM_017489chr811189 ------
NM_017522chr121439 85 ------
NM_017546chr2192 ------
NM_017548chr332160 1517 1435 ------
NM_017563chr374289 2468 1284 989 900 854 733 23986 101 11161 --
NM_017569chr13------1260
NM_017575chr1721615 1020 --11129 --
NM_017580chr1052107 1944 895 768 653 ------
NM_017582chr121700 624 --1467 --
NM_017599chr121137 --12066 --
NM_017611chr112557 37 ----1564
NM_017612chr122229 81 ------
NM_017626chr1021555 720 --11684 --
NM_017629chr11301 --21889 105 --
NM_017633chr632565 868 135 1423 ----
NM_017634chr82343 274 ------
NM_017635chr1121440 414 --1577 --
NM_017637chr948328 3746 3555 937 --38681 710 367 --
NM_017638chr1171 ------
NM_017641chr121439 ------
NM_017643chr1712748 12164 ----
NM_017644chr324912 3691 ----14453
NM_017650chr745943 4161 1116 926 --25978 955 13824
NM_017655chr13496 482 104 ----11118
NM_017657chr22908 793 ------
NM_017658chr141577 ------
NM_017660chr192916 57 ----12943
NM_017661chr1531030 872 272 1261 ----
NM_017668chr161533 ------
NM_017672chr15126 ------
NM_017681chrX1730 --1849 --
NM_017709chr141686 963 638 631 ------
NM_017714chr20------1594
NM_017715chr73687 242 122 ------
NM_017719chr331937 941 79 --1161 11930
NM_017730chr31220 ------
NM_017736chr1643104 3022 2136 29 11139 ----
NM_017737chr121882 1500 ------
NM_017742chr181374 11358 21450 190 --
NM_017748chr172732 25 ------
NM_017754chr633164 1339 964 14248 --1330
NM_017769chr1423072 2493 --12721 --
NM_017772chr621715 1561 2305 136 21634 448 --
NM_017778chr81293 --1143 --
NM_017779chr13926 912 564 12391 ----
NM_017786chr81453 ------
NM_017799chr1421855 1502 ------
NM_017801chr342581 1003 947 504 12090 ----
NM_017811chr923091 327 12521 12814 12108
NM_017813chr855054 4410 4238 2134 1382 1816 22157 1270 25426 3857
NM_017822chr122772 172 ------
NM_017848chrX44627 3219 360 185 11167 --11504
NM_017849chr273195 2686 2491 2217 746 556 195 12470 11280 --
NM_017896chr2072753 2397 1379 1226 707 554 439 ------
NM_017907chr111498 --1483 --
NM_017910chr21245 ------
NM_017938chrX1394 ------
NM_017943chr142916 34 --1181 --
NM_017944chr1162876 2015 2000 1926 932 40 ----12587
NM_017964chr21261 --1668 --
NM_017983chr17148 ------
NM_017988chr123924 669 606 ------
NM_017994chr721196 372 --1747 --
NM_018011chr132260 72 ------
NM_018030chr18----180 --
NM_018032chr162990 309 ------
NM_018037chr12116 22 ------
NM_018046chr52627 139 ------
NM_018047chr5----1810 1871
NM_018049chr192102 95 1118 ----
NM_018061chr121176 377 ------
NM_018078chr41306 ----128
NM_018084chr222715 768 ------
NM_018105chr811072 ----1253
NM_018115chr41823 --1758 --
NM_018119chr16------1277
NM_018120chr821403 225 --11528 --
NM_018121chr1042936 2183 2093 1037 1549 ----
NM_018126chr431561 1282 497 ------
NM_018128chr171593 11056 1955 --
NM_018157chr122647 121 --11148 --
NM_018169chr12----1369 --
NM_018172chr1111102 ------
NM_018181chr1831519 1398 1241 1476 ----
NM_018182chr1722234 194 ------
NM_018184chr32571 355 --1329 --
NM_018195chr1141982 679 215 63 ----11400
NM_018206chr162109 66 ------
NM_018208chr121174 953 ------
NM_018221chr21444 ------
NM_018241chr421035 178 ----1958
NM_018243chr41620 23609 741 33443 3056 1611 --
NM_018254chr122419 835 --1977 --
NM_018279chr1222835 803 ------
NM_018287chr1031272 909 477 ------
NM_018293chr372686 2115 1102 579 511 488 386 --1113 --
NM_018299chr832745 2318 768 ------
NM_018313chr322570 357 ------
NM_018314chr111287 ------
NM_018315chr431560 1394 1345 ------
NM_018318chr12----1184 --
NM_018327chr2021534 1355 --1655 --
NM_018328chr2----1453 --
NM_018330chr101417 ------
NM_018360chrX174 ------
NM_018362chr1123797 2662 23363 1244 ----
NM_018364chr143871 2720 2536 396 --1556 --
NM_018373chr1421801 595 15609 25631 1191 --
NM_018374chr774826 3826 1595 1588 1523 1405 1184 14000 ----
NM_018383chr21149 --1449 11438
NM_018416chr1252528 2336 847 792 564 ----12599
NM_018440chr867799 7003 6762 1617 1363 1257 --32833 2024 971 1290
NM_018442chr12145 103 ------
NM_018444chr821945 493 --11896 --
NM_018452chr6_random53525 3304 1531 713 533 ------
NM_018469chr1711180 --11375 --
NM_018482chr831974 217 164 --1328 --
NM_018486chrX2513 23 ------
NM_018490chr1111520 ------
NM_018553chr17----11648 --
NM_018557chr221216 1173 ------
NM_018566chr154146 3704 1932 1926 1039 --21492 846 --
NM_018569chr421524 1148 ------
NM_018584chr111144 ------
NM_018638chr1213840 --11682 --
NM_018640chr1232181 2070 753 1982 ----
NM_018649chr102204 191 ----1532
NM_018650chr121897 86 ------
NM_018652chr151403 --1252 --
NM_018689chr1542527 2056 1906 1868 12255 1409 --
NM_018697chr732383 553 367 ------
NM_018700chr511226 ------
NM_018710chr81104 ------
NM_018711chr1241483 1440 487 427 11006 31452 1028 27 --
NM_018846chr7188 ------
NM_018912chr51516 ------
NM_018913chr51516 ------
NM_018914chr51516 ------
NM_018915chr51516 ------
NM_018916chr51516 ------
NM_018917chr51516 ------
NM_018918chr51516 ------
NM_018919chr51516 ------
NM_018920chr51516 ------
NM_018921chr51516 ------
NM_018922chr51516 ------
NM_018923chr51516 ------
NM_018924chr51516 ------
NM_018925chr51516 ------
NM_018926chr51516 ------
NM_018927chr51516 ------
NM_018928chr51516 ------
NM_018929chr51516 ------
NM_018937chr53729 92 83 1153 ----
NM_018945chr643469 2514 2400 2272 11324 --1439
NM_018951chr73507 199 157 --1349 --
NM_018955chr171132 ------
NM_018959chr192742 274 ------
NM_018970chr73963 746 683 ------
NM_018976chr1232437 966 587 ------
NM_018977chrX1983 ------
NM_018979chr1222521 2005 ------
NM_018992chr1621549 1365 --21257 493 --
NM_018993chr2021282 528 ------
NM_018999chr1064788 3014 2998 1878 1058 87 --34332 4324 4299 --
NM_019001chr344221 3328 3196 551 --14089 13019
NM_019004chr722083 577 ------
NM_019006chr152638 135 ------
NM_019027chr412518 ------
NM_019050chr42904 893 ------
NM_019053chr101713 ------
NM_019063chr21707 --1113 --
NM_019066chr15----1130 --
NM_019072chr52421 37 11685 ----
NM_019084chr1012084 12290 ----
NM_019087chr511516 11078 ----
NM_019091chr211158 1368 ----
NM_019094chr1263799 3685 3570 2960 1426 323 ----33709 2826 1450
NM_019096chr611038 --2754 353 --
NM_019106chr2222837 507 1345 12113 --
NM_019114chr942309 2040 437 118 --12579 --
NM_019116chr1622536 1224 --23646 2645 --
NM_019555chr31504 11530 ----
NM_019556chrX11224 1554 ----
NM_019557chr11283 ----1354
NM_019558chr21259 ------
NM_019590chr101177 ------
NM_019592chr9--1205 ----
NM_019593chr2032515 2491 1241 11076 ----
NM_019597chrX2705 577 ------
NM_019613chr1731185 1123 930 --1121 --
NM_019624chr121296 1273 ----
NM_019625chr121296 1273 ----
NM_019843chr22178 ------
NM_019849chr191162 ------
NM_019895chr31184 --1930 --
NM_020066chr11834 --1788 --
NM_020116chr421481 1330 ----1634
NM_020122chr232060 1949 356 --24270 1780 --
NM_020123chr1021091 124 ------
NM_020144chr73851 845 681 ------
NM_020177chr53744 337 269 --1161 11224
NM_020189chr8129 ------
NM_020193chr1111327 --31069 341 257 --
NM_020205chr143494 3038 2774 1349 ------
NM_020210chr151950 ------
NM_020231chr33600 520 123 ------
NM_020245chr675014 4993 4865 4833 4169 4152 52 ----13163
NM_020251chr11----183 --
NM_020307chr33387 126 37 ------
NM_020309chr192724 322 --1854 2806 259
NM_020336chr2083340 3307 3249 2545 1530 1415 1399 500 ----1885
NM_020337chr432901 1051 983 ------
NM_020338chr1032838 2391 1479 ------
NM_020342chr22873 184 --1818 --
NM_020347chr342172 2092 1918 929 ------
NM_020348chr1011085 21974 822 42585 2119 607 246 --
NM_020357chr331347 1024 642 ------
NM_020378chr191577 ------
NM_020381chr621929 347 1723 ----
NM_020382chr1221564 177 ------
NM_020416chr462487 1638 1081 657 612 329 12172 ----
NM_020423chr11452 --1212 --
NM_020432chr721966 460 ------
NM_020438chr931368 1301 382 --1328 --
NM_020440chr11291 ------
NM_020443chr196215 6136 5325 4735 2758 2314 831 529 277 16352 14819 --
NM_020444chr51449 --136 --
NM_020445chr71751 ------
NM_020452chr141735 1565 636 503 ------
NM_020455chr6----12633 --
NM_020456chr1311610 11823 --11846
NM_020463chr2------135
NM_020466chr624253 3059 ----13990
NM_020474chr182764 338 ----11890
NM_020532chr21889 ------
NM_020630chr102666 63 ----1683
NM_020638chr1241493 826 811 288 1190 ----
NM_020640chr32514 184 --11443 11909
NM_020644chr11--178 --1741
NM_020647chr821907 1529 ------
NM_020666chr5--1729 1175 --
NM_020673chr2077468 7061 2746 2173 1450 1090 770 26159 5229 56181 5251 2893 1238 404 --
NM_020689chr2031704 1503 454 ------
NM_020693chr111402 ------
NM_020697chr82878 143 --1231 --
NM_020699chr145283 4384 3665 1529 --15447 --
NM_020715chr1411853 1510 1532 1645
NM_020718chr1664111 4091 2377 1900 1410 1341 ----35855 5604 5335
NM_020727chr2163845 3469 2917 2909 325 229 ----12491
NM_020738chr211306 --1201 --
NM_020742chrX----12279 --
NM_020748chr1722161 1393 ------
NM_020752chr1032713 801 754 ------
NM_020760chr231621 598 522 ------
NM_020766chrX1829 ----11582
NM_020772chr1778416 7616 7567 7473 5509 3274 508 ------
NM_020773chr442692 2339 2215 1833 ------
NM_020781chr722949 596 ------
NM_020783chr1822061 537 ------
NM_020796chr552007 1103 979 909 181 --22740 2131 --
NM_020801chr512097 --1759 --
NM_020804chr622258 599 --21846 393 12581
NM_020805chr181238 --1120 --
NM_020808chr12948 71 ------
NM_020809chr1122250 252 ------
NM_020810chr14187 ------
NM_020818chr14137 ------
NM_020824chr10------1118
NM_020841chr1221567 71 --21043 77 13423
NM_020850chr1633184 2727 701 --1366 --
NM_020854chr1831316 1203 218 ------
NM_020858chr1511554 --1366 --
NM_020860chr4185 ------
NM_020868chr231964 1767 1507 --1232 --
NM_020870chr422111 555 22234 1670 --11678
NM_020872chr321196 550 ------
NM_020873chr31217 ------
NM_020886chr11--11005 ----
NM_020899chr171548 21800 527 21728 939 --
NM_020904chr192150 44 --1131 --
NM_020922chrX21543 1239 ------
NM_020925chr11909 ------
NM_020935chr234324 4251 3075 --23566 3027 1191
NM_020940chr1012545 ------
NM_020951chr19121 ----11541
NM_020962chr1552030 1900 1770 609 22 ------
NM_020967chr2031238 1014 283 ----11175
NM_020975chr1041647 636 282 162 ------
NM_020977chr431811 1388 1369 --11691 --
NM_020983chr1222295 1816 --11911 --
NM_020988chr1621285 1251 11110 ----
NM_020993chr1252830 2675 1792 603 498 ------
NM_021005chr15157 ------
NM_021007chr232209 1721 212 ------
NM_021012chr172761 373 1401 ----
NM_021032chr31439 ------
NM_021033chr1363347 3237 2918 2659 1380 1291 13292 1774 --
NM_021038chr333244 3084 2908 ----11092
NM_021069chr43497 432 102 --11589 --
NM_021072chr522196 1688 --22522 2248 --
NM_021079chr17----41173 481 395 210 --
NM_021088chr23807 729 675 11713 --11736
NM_021090chr2244405 3394 1800 1743 ------
NM_021097chr222793 296 ------
NM_021110chr82614 78 ----1533
NM_021111chr921050 75 ------
NM_021116chr7107081 6766 5971 3288 3081 2794 2394 1373 697 671 --28241 1906 --
NM_021120chrX33185 3103 957 --12296 --
NM_021132chr10----11341 1435
NM_021136chr141229 ------
NM_021137chr172442 95 ----12002
NM_021140chrX21137 72 ------
NM_021141chr21845 ----2671 258
NM_021148chr741004 813 807 792 ------
NM_021155chr1931915 1150 762 --22550 785 --
NM_021156chr201983 ----1138
NM_021159chr41621 --1560 --
NM_021174chr82588 493 ----1709
NM_021177chr62287 118 ------
NM_021183chrX21583 166 --12215 --
NM_021215chr2032235 271 203 ------
NM_021220chr20162 ------
NM_021222chr121303 176 1933 1387 --
NM_021238chr1231383 1377 741 1269 --1292
NM_021242chrX1305 --1993 --
NM_021620chr61755 ------
NM_021622chr1022137 91 ------
NM_021631chr8182 ------
NM_021633chr111065 11411 ----
NM_021637chrX11253 ------
NM_021643chr211886 ------
NM_021647chr474180 4036 3779 3118 1569 1466 500 ------
NM_021785chrX155 ------
NM_021809chr205888 714 524 131 50 11573 21595 313 --
NM_021813chr655643 5631 5373 2337 721 21855 128 ----
NM_021814chr611400 ------
NM_021818chr1421244 424 ------
NM_021911chr544211 1352 831 199 24236 3405 1515 --
NM_021912chr1523475 607 23224 1433 ----
NM_021913chr191626 2605 311 ----
NM_021914chr1431893 1815 83 ------
NM_021945chr643118 1297 1259 531 ------
NM_021951chr92198 120 ----1258
NM_021954chr1343456 3101 2731 157 1422 ----
NM_021956chr6----11408 --
NM_021960chr132496 2441 2329 --1570 --
NM_021961chr1165438 5102 5012 3009 2462 1518 --12907 --
NM_021964chr345358 4119 1439 1080 --24327 1838 --
NM_021988chr2021214 370 1462 1523 --
NM_021991chr172795 143 ------
NM_021998chrX11153 187 ----
NM_022041chr162775 129 12714 ----
NM_022048chr1566228 4602 1930 1900 1835 353 15081 1523 --
NM_022051chr11245 ------
NM_022068chr181103 ------
NM_022085chr611011 --1285 --
NM_022091chr622501 2432 ------
NM_022114chr144289 4214 1057 485 --1215 --
NM_022117chrX1149 ------
NM_022123chr141459 ------
NM_022130chr53273 267 72 ----11262
NM_022137chr1442038 1739 1442 1316 ----1170
NM_022166chr1675108 4133 2363 1737 1266 1144 115 11388 --24892 3866
NM_022170chr71163 ------
NM_022351chr832805 2451 606 ------
NM_022373chr7152 --1237 --
NM_022374chr21169 ------
NM_022442chr2021214 370 1462 1523 --
NM_022461chr33335 170 114 ------
NM_022462chr1943378 2675 815 468 22810 1076 23544 1098 1199
NM_022465chr1222841 1899 12425 ----
NM_022467chr191372 --1439 --
NM_022476chr16------1360
NM_022484chr711241 1451 ----
NM_022552chr21998 1930 ----
NM_022574chr742029 1516 1354 348 ------
NM_022658chr122431 158 ------
NM_022719chr2253854 3242 3046 3020 1516 22560 1088 23221 3133 --
NM_022725chr1131542 427 350 ------
NM_022731chr1192 --1239 --
NM_022733chr12943 106 ------
NM_022735chr141827 1398 125 117 ------
NM_022755chr922036 1920 --22594 1799 --
NM_022756chr151311 1283 1031 585 357 1192 ----
NM_022771chr121707 1346 --1950
NM_022776chr321530 1046 --11341 --
NM_022780chr211421 --1208 --
NM_022781chr93811 600 265 ----11278
NM_022784chr151235 ------
NM_022817chr232214 867 673 11509 11531 --
NM_022826chr22827 755 ----11192
NM_022832chr442344 369 179 124 --11894 --
NM_022840chr1811120 1303 128 --
NM_022841chr15----1133 --
NM_022842chr333184 2865 531 12944 12907 --
NM_022843chr1321097 256 ------
NM_022845chr1641841 1721 672 159 11560 1695 --
NM_022875chr51423 ------
NM_022877chr51423 ------
NM_022893chr222623 713 --23095 2224 --
NM_022898chr1444394 4293 4226 601 --24017 3685 14824
NM_022912chr232377 1177 694 ------
NM_022977chrX148 ------
NM_023000chr14192 ------
NM_023001chr14192 ------
NM_023009chr11718 ------
NM_023016chr222388 960 --1686 --
NM_023034chr82189 169 --1226 --
NM_023071chr121272 --1141 --
NM_023076chr1632977 1931 374 1220 12192 12048
NM_023105chr831858 1627 365 ------
NM_023106chr831858 1627 365 ------
NM_023110chr831858 1627 365 ------
NM_023111chr831858 1627 365 ------
NM_023925chr12190 ------
NM_023927chr53980 948 139 1262 ----
NM_023929chr822277 844 ----12725
NM_023943chr31164 ------
NM_024016chr171616 ------
NM_024052chr1742944 2763 2453 2100 --1231 --
NM_024055chr51642 ------
NM_024077chr91589 --1729 --
NM_024085chr22736 658 ------
NM_024092chr1121221 1000 1837 1327 --
NM_024094chr83693 638 253 ------
NM_024095chr1241162 348 258 107 ------
NM_024337chr5------1292
NM_024408chr153621 2940 2649 817 479 12449 1573 --
NM_024415chr5129 ------
NM_024424chr11----2440 181 --
NM_024425chr11----2440 181 --
NM_024426chr11----2440 181 --
NM_024496chr142657 227 ------
NM_024503chr11275 ------
NM_024519chr161269 ------
NM_024523chr721167 1033 --167 --
NM_024524chr33878 617 551 ------
NM_024545chr2173 ------
NM_024546chr1341169 286 274 28 11017 ----
NM_024556chr111399 ------
NM_024561chr132867 56 ------
NM_024569chr122589 406 ------
NM_024586chr1------1552
NM_024617chr93593 584 305 ------
NM_024635chr91247 ----1217
NM_024638chr352350 2068 729 437 428 11673 21810 1695 --
NM_024646chr131418 203 93 --13576 1605
NM_024653chr711356 --1296 --
NM_024665chr343810 1831 751 490 ------
NM_024674chr122298 733 12277 ----
NM_024700chr12288 35 ------
NM_024704chr20----1404 --
NM_024713chr1541434 1133 1036 31 ------
NM_024740chr1133546 1272 103 ----13145
NM_024744chr222481 2150 --12552 11690
NM_024753chr22202 27 ------
NM_024755chr151315 ------
NM_024757chr9----1812 --
NM_024761chr974541 3946 3661 683 523 495 420 ------
NM_024789chr102937 71 2418 281 1924 --
NM_024792chr171236 1270 ----
NM_024814chr72143 126 ------
NM_024824chr141183 ------
NM_024830chr5----1314 --
NM_024835chr171338 ------
NM_024850chr53926 633 315 ------
NM_024896chr952511 2220 1988 768 675 --156 --
NM_024899chr181496 ------
NM_024911chr12341 30 --1122 --
NM_024917chrX3845 153 120 1349 --1372
NM_024923chr321417 277 132 --1402
NM_024941chr521323 379 ------
NM_024944chr211990 --11279 --
NM_024947chr368497 6523 6399 3825 612 78 28472 8244 18702 --
NM_024949chr464880 3673 3328 779 365 93 14660 1559 13651
NM_024953chr1232480 867 408 12687 11953 --
NM_024963chr775751 5717 4523 1872 1688 1569 77 34543 2189 28 ----
NM_024989chr247030 2710 2648 179 12370 27450 477 12393
NM_024993chr211074 ------
NM_024997chr1631331 905 171 ------
NM_025054chr823363 2858 --12992 --
NM_025058chr11735 ------
NM_025061chr191165 --11061 --
NM_025134chr16--12177 ----
NM_025141chr152565 511 ------
NM_025146chr351923 1713 629 611 221 ------
NM_025154chr721205 588 --1350 --
NM_025160chr143541 2959 1325 987 ------
NM_025182chr91219 ------
NM_025184chrX2758 247 ------
NM_025191chr152538 1280 1131 1082 405 ------
NM_025195chr8----11927 --
NM_025203chr22392 238 --2306 136 --
NM_025219chr202642 208 --21505 620 --
NM_025237chr1721451 81 --1470 --
NM_025248chr1742005 986 777 182 ------
NM_025250chr722778 2327 13036 13018 --
NM_025263chr641816 1634 597 381 ------
NM_030567chr51158 ------
NM_030594chr151842 1434 --1443
NM_030621chr1412967 ------
NM_030623chr2161 ------
NM_030625chr1032289 1881 778 11038 1939 --
NM_030629chr1631706 1416 1372 ------
NM_030647chr735833 5725 251 15736 ----
NM_030648chr465084 4515 1467 644 516 355 --15345 11755
NM_030650chr212939 12642 13925 --
NM_030674chr1245078 3978 795 307 22232 1273 21566 473 --
NM_030751chr102695 394 ------
NM_030751chr102695 394 ------
NM_030755chr1442983 1987 203 69 --22439 480 12614
NM_030758chr2221278 1255 --185 --
NM_030762chr1241661 1347 655 102 ------
NM_030775chr121933 ------
NM_030806chr1109183 7239 7097 5710 3155 3051 2452 1890 926 314 11867 ----
NM_030808chr17------1228
NM_030810chr611011 --1285 --
NM_030816chr133404 2547 1200 --12405 --
NM_030820chr61229 --151 --
NM_030881chr2251942 1592 604 542 185 --22331 1543 --
NM_030912chr102154 129 ------
NM_030915chr272040 1897 1525 873 587 350 152 --21964 929 --
NM_030919chr202202 194 --127 --
NM_030920chr121895 129 ------
NM_030937chr121162 1024 ------
NM_030939chr64892 828 796 356 --1339 --
NM_030949chr621080 185 ------
NM_030962chr1121435 444 1242 ----
NM_030964chr552980 2440 2389 1150 263 --1903 13505
NM_030979chr131427 ------
NM_031229chr201528 ------
NM_031244chr631131 817 192 ------
NM_031262chr91251 ------
NM_031263chr91308 ------
NM_031268chr1634980 3504 3282 13958 24249 752 --
NM_031283chr22856 739 --1600 --
NM_031296chr442218 2196 452 189 1976 1998 --
NM_031369chr41331 ------
NM_031370chr41331 ------
NM_031371chr11618 ----11446
NM_031371chr11618 ----11446
NM_031372chr4--11190 174 --
NM_031407chrX--1494 ----
NM_031426chr921872 457 12515 --11991
NM_031445chr242902 2365 1193 976 ------
NM_031453chr1062502 2355 2239 744 334 132 --11703 --
NM_031461chr81207 ------
NM_031465chr12----2911 267 1291
NM_031468chr786567 6248 5791 5658 1664 1450 580 224 --35755 2941 2291 --
NM_031475chr11519 ------
NM_031476chr1652790 847 677 518 240 12244 32623 2266 923 --
NM_031845chr233566 3258 1133 ----12687
NM_031847chr233566 3258 1133 ----12687
NM_031914chr142157 147 295 87 1615 --
NM_031922chr62467 44 ------
NM_031954chr1211163 12050 22072 703 --
NM_031989chr121232 ------
NM_031992chr71163 ------
NM_032017chr121654 205 --11859 --
NM_032047chr332315 839 818 ------
NM_032050chr22--1940 1171 --
NM_032052chr22--21325 306 1556 --
NM_032088chr51516 ------
NM_032092chr51516 ------
NM_032102chr1131234 942 304 ------
NM_032121chrX42736 2215 833 666 --31971 856 525 --
NM_032124chr181382 ------
NM_032128chr421019 259 ------
NM_032131chr61121 --1488 --
NM_032138chr132529 108 ------
NM_032139chr191991 2444 317 ----
NM_032144chr231174 1168 1156 ------
NM_032153chr382403 2252 2240 2218 2105 1842 1802 482 ------
NM_032156chr12190 ------
NM_032160chr1843668 3302 1154 452 ----13826
NM_032181chr21217 --1283 --
NM_032199chr1073374 2983 1469 1418 1280 1194 680 --21516 1322 12441
NM_032208chr242893 2609 1251 369 ------
NM_032217chr41296 --1884 --
NM_032221chr2032056 1742 625 1171 --11268
NM_032229chr1311016 ------
NM_032233chr142859 139 ------
NM_032236chr12963 868 ------
NM_032268chr1673243 3196 2103 882 553 527 466 ------
NM_032271chr1621435 88 --280 26 --
NM_032281chr1932500 1225 265 12970 ----
NM_032288chr331852 1754 1522 12384 1380 --
NM_032291chr12215 77 ------
NM_032295chr71241 ------
NM_032312chr21674 ------
NM_032320chr113647 287 164 ------
NM_032352chr143419 280 256 --11125 --
NM_032373chr1044646 4443 3862 477 --14192 --
NM_032403chr51516 ------
NM_032427chr111430 ------
NM_032430chr19----1422 --
NM_032433chr191104 --1383 11007
NM_032440chr1032822 2073 890 ----1772
NM_032446chr533681 2540 712 --11083 13514
NM_032449chr122258 926 --21837 453 --
NM_032457chr41486 --23240 890 13041
NM_032458chrX12295 11204 ----
NM_032491chr122403 220 ----11308
NM_032499chr1521636 296 ------
NM_032523chr2----189 --
NM_032538chr632837 2609 2058 ------
NM_032558chr911460 ------
NM_032562chr10125 ------
NM_032564chr112691 142 ------
NM_032578chr1011014 --175 --
NM_032581chr761447 354 339 219 183 79 ------
NM_032590chr1221130 445 --1194 --
NM_032631chr191184 ------
NM_032632chr142664 628 ------
NM_032638chr32380 219 11180 11075 --
NM_032642chr121933 ------
NM_032646chr1721355 42 ------
NM_032682chr322271 1230 --1837 --
NM_032687chr8127 ------
NM_032711chr1743435 3004 1666 27 --12946 --
NM_032800chr122203 753 --22266 104 --
NM_032804chr103656 452 338 ------
NM_032812chr10134 ------
NM_032826chr724847 1750 11186 1331 14050
NM_032842chr721372 409 1573 ----
NM_032846chr142985 71 11500 ----
NM_032875chr172596 337 ------
NM_032892chr151284 ------
NM_032900chr1023814 1467 ------
NM_032905chr1021192 162 ------
NM_032906chr41661 --1145 --
NM_032927chr4121 --1232 --
NM_032932chr1796156 5395 5387 5178 4185 1766 1705 1670 1614 1636 --11317
NM_032941chr12137 ------
NM_032949chr131527 169 ----
NM_032978chr1811114 1425 ----
NM_032979chr1811114 1425 ----
NM_032981chr1811114 1425 ----
NM_032982chr732490 1825 88 --21902 1644 --
NM_032991chr42521 22 ------
NM_033012chr132980 211 ------
NM_033020chr133258 670 600 1564 34504 3982 3307 --
NM_033023chr721185 97 1353 ----
NM_033027chr32325 133 ------
NM_033030chr22588 227 ------
NM_033044chr121106 306 ------
NM_033067chr11645 ------
NM_033071chr61226 ------
NM_033081chr20--1383 1143 --
NM_033117chr91260 --140 --
NM_033138chr712118 ------
NM_033139chr712118 ------
NM_033140chr712118 ------
NM_033143chr434455 1820 1408 12849 24492 697 12872
NM_033157chr712118 ------
NM_033161chr941680 1384 730 477 ------
NM_033181chr613426 --11417 --
NM_033211chr51517 ------
NM_033222chr9149 11298 ----
NM_033224chr787923 6985 6387 2625 2560 2484 661 492 16787 26809 3078 --
NM_033285chr843998 3148 567 36 --127 13531
NM_033290chrX53424 3135 509 436 286 --12922 11433
NM_033300chr121439 85 ------
NM_033309chr16153 ------
NM_033315chr1722124 2056 ------
NM_033326chr11----1854 1118
NM_033331chr943575 1223 846 296 ------
NM_033360chr1233415 545 327 --12870 --
NM_033389chr1734511 560 428 --3693 434 343 14742
NM_033394chr221420 1223 ------
NM_033430chr444119 3666 1320 344 --14154 --
NM_033437chr444119 3666 1320 344 --14154 --
NM_033480chr622990 1127 --22415 803 --
NM_033481chr622990 1127 --22415 803 --
NM_033496chr101233 ------
NM_033497chr101233 ------
NM_033498chr101233 ------
NM_033500chr101233 ------
NM_033503chr1532850 1534 356 --11007 --
NM_033505chr235961 2390 617 15716 34553 4530 512 1342
NM_033512chr822914 562 ----22902 2484
NM_033551chr522766 2251 1632 ----
NM_033624chr1231957 1908 1900 2861 297 ----
NM_033632chr431560 1394 1345 ------
NM_033642chrX21043 982 ------
NM_033644chr52976 381 ------
NM_033645chr52976 381 ------
NM_044472chr13477 283 253 ------
NM_052818chr1321996 188 12178 ----
NM_052832chr831937 668 265 --22737 2288 --
NM_052869chr1721355 42 ------
NM_052879chr1243826 3332 276 181 ------
NM_052885chr1234265 3527 1404 ------
NM_052886chr842108 1719 1603 147 --11901 --
NM_052898chr821880 267 --1165 --
NM_052905chr211365 --21880 339 --
NM_052911chr18------2740 314
NM_052932chr113547 225 62 ------
NM_052937chr82816 340 ------
NM_052948chr191110 ------
NM_052950chr131236 ------
NM_052953chr3167 ------
NM_052954chr2121825 537 ------
NM_053002chr32960 187 --1922 --
NM_053016chr967513 7458 2014 1924 1452 702 1353 1405 --
NM_053024chr311350 ------
NM_053025chr311715 ------
NM_053026chr311715 ------
NM_053027chr311715 ------
NM_053028chr311715 ------
NM_053031chr311715 ------
NM_053032chr311715 ------
NM_053043chr7105804 5777 5115 4880 4857 4583 4230 1500 307 98 ------
NM_053056chr1131095 975 916 ------
NM_053281chrX----1356 --
NM_054016chr1158 ------
NM_054016chr1158 ------
NM_054016chr1158 ------
NM_058170chr111425 ----11182
NM_058172chr41278 ------
NM_058246chr711231 ------
NM_078474chr152565 511 ------
NM_078626chr11322 ------
NM_080546chr9----11659 --
NM_080594chr163301 243 176 --1656 --
NM_080597chr18----180 --
NM_080599chr1011036 ------
NM_080617chr201958 --1103 --
NM_080647chr221454 ------
NM_080664chr14--2490 128 1512 --
NM_080666chr1441578 1422 156 144 --11526 --
NM_080682chr11600 ------
NM_080723chr61375 ------
NM_080738chr12605 122 1423 ----
NM_080743chr622076 684 --1167 --
NM_080759chr1342280 1814 1641 933 --12332 12607
NM_080760chr1342280 1814 1641 933 --12332 12607
NM_080764chr2242270 1100 1046 197 1322 1513 --
NM_080836chr2074658 4378 3983 901 496 386 168 1681 --13958
NM_080867chr1454715 4661 3141 740 219 --13776 --
NM_080872chr843717 3522 3352 3126 ------
NM_080927chr353359 3195 2296 2262 1023 12556 --1646
NM_100264chr10125 ------
NM_100486chr10125 ------
NM_130387chr3156 ------
NM_130434chr151400 ------
NM_130436chr2111067 12615 3817 743 323 --
NM_130439chr10------11971
NM_130439chr10------11971
NM_130440chr111225 ------
NM_130459chr921633 521 ------
NM_130469chr141809 ------
NM_130797chr721564 618 ------
NM_130798chr1531365 530 233 ----11535
NM_130808chr31392 ------
NM_130811chr202986 244 --1186 --
NM_133170chr2067118 6160 2490 1859 1261 173 23179 2056 11100 --
NM_133264chr1723040 1463 ----12926
NM_133265chrX33554 939 845 ------
NM_133370chr432940 2811 453 --23228 2590 --
NM_133372chr512647 --12017 --
NM_133433chr51712 ------
NM_133445chr983770 3137 1427 1131 393 319 189 116 ------
NM_133468chr721698 473 22213 1735 ----
NM_133476chr121469 ------
NM_133496chr123210 2883 23094 868 44109 3116 890 211 --
NM_133503chr122742 601 ------
NM_133504chr122742 601 ------
NM_133505chr122742 601 ------
NM_133506chr122742 601 ------
NM_133507chr122920 779 ------
NM_133650chr61226 ------
NM_134269chr221322 ------
NM_134270chr221151 ------
NM_138288chr1422133 1679 21591 1419 --22035 1442
NM_138357chr101713 ------
NM_138395chr23450 412 327 ------
NM_138426chr712060 ------
NM_138444chr1334116 3508 860 1695 ----
NM_138459chr633170 2457 1461 ------
NM_138473chr1234610 4191 1294 ------
NM_138494chr722814 855 --1878 --
NM_138576chr1444394 4293 4226 601 --24017 3685 14824
NM_138609chr5----2424 142 --
NM_138610chr5----2424 142 --
NM_138638chr1431893 1815 83 ------
NM_138713chr1687973 7596 5620 3016 2900 1926 1652 678 15290 ----
NM_138714chr1687973 7596 5620 3016 2900 1926 1652 678 15290 ----
NM_138730chr61440 ------
NM_138731chr1413746 --13656 --
NM_138736chr1654160 2837 2578 1466 449 1567 23916 2848 12952
NM_138970chr1422182 1676 --11897 --
NM_138971chr1112424 --23357 2670 11211
NM_138971chr1112424 --23357 2670 11211
NM_138972chr1112424 --23357 2670 11211
NM_138972chr1112424 --23357 2670 11211
NM_138973chr1112424 --23357 2670 11211
NM_138973chr1112424 --23357 2670 11211
NM_139014chr652227 2138 1557 1527 923 --192 --
NM_139015chr1231733 1242 60 --11369 --
NM_139035chrX1260 ------
NM_139045chr91327 ------
NM_139046chr10------1218
NM_139047chr10------184
NM_139049chr10------184
NM_139071chr1221147 246 1147 2333 85 --
NM_139131chr112676 140 ------
NM_139135chr131032 819 476 ------
NM_139166chr8------142
NM_139167chr82534 73 ------
NM_139168chr521272 265 --11410 11589
NM_139169chr10----12293 --
NM_139201chr121627 ------
NM_139207chr1222106 1787 ------
NM_139211chr4181 ------
NM_139212chr4181 ------
NM_139245chr321526 555 --2204 55 1136
NM_139276chr1722258 507 --11824 12096
NM_139279chr253316 2991 2173 1323 517 1942 23466 985 --
NM_139286chr91182 ------
NM_139312chr10131 ----11279
NM_139321chr201167 --33732 3602 411 --
NM_144571chr472637 2535 1994 1186 676 647 111 --11026 1351
NM_144576chr12169 ------
NM_144578chr1431609 612 233 ----24918 86
NM_144579chr232387 539 451 22117 988 22832 2028 --
NM_144582chr231743 1037 593 --1847 22304 1796
NM_144586chr2----1490 --
NM_144595chr13--1726 ----
NM_144636chr34666 560 152 144 --1535 --
NM_144642chr3--178 ----
NM_144660chr10----1337 --
NM_144664chr1142468 1953 448 194 --1920 1325
NM_144667chr121864 --2953 31 1197
NM_144723chr51671 1859 1148 --
NM_144728chr1171 ------
NM_144729chr1171 ------
NM_144732chr19----21067 933 --
NM_144767chr1553858 3459 1583 797 296 --24316 578 --
NM_144775chr1764001 3921 1331 1030 437 266 ------
NM_144778chr1332570 636 288 ------
NM_144949chr252601 2458 2119 1888 252 ------
NM_144963chr8--1610 22509 1941 --
NM_144979chr41104 --1211 --
NM_145010chr1041945 1557 1492 623 --11896 --
NM_145055chr1843051 2788 1325 809 1340 23734 928 12602
NM_145176chr643273 393 262 113 21140 1074 ----
NM_145203chr131241 ------
NM_145206chr101330 --1188 --
NM_145251chr141195 ------
NM_145259chr255964 5813 4526 2087 833 15042 1571 --
NM_145274chr172979 811 1152 ----
NM_145284chrX31952 1645 198 ------
NM_145285chr101672 ------
NM_145296chr192751 327 --1743 --
NM_145307chr1033390 1519 1416 ------
NM_145309chr112914 52 1355 --1938
NM_145313chr1021494 454 --1439 --
NM_145320chr7------13178
NM_145321chr7------13178
NM_145322chr7------13178
NM_145341chr1031409 687 360 ----1538
NM_145350chr1731463 1398 25 11297 11319 --
NM_145351chr1732603 2538 560 12437 22459 375 --
NM_145648chr122257 25 ------
NM_145686chr253179 3145 2707 2116 388 ----12418
NM_145687chr253179 3145 2707 2116 388 ----12418
NM_145690chr841707 1396 352 148 ------
NM_145698chr1011406 ------
NM_145739chr2----189 --
NM_145753chr321363 1161 ------
NM_145793chr101924 ------
NM_145800chrX2770 705 ------
NM_145802chrX2719 654 ------
NM_145808chr733066 2065 1078 ------
NM_145861chr12605 122 1423 ----
NM_145891chr1631463 288 196 ------
NM_145892chr1631463 288 196 ------
NM_145893chr1641585 410 318 59 ------
NM_145899chr61364 --11305 --
NM_145901chr61364 --11305 --
NM_145902chr61364 --11305 --
NM_145903chr61364 --11305 --
NM_145904chr61364 --11305 --
NM_145905chr61364 --11305 --
NM_147150chr933936 3890 248 --12735 --
NM_147156chr101446 --1328 --
NM_147164chr9178 ------
NM_147189chr842241 819 67 33 --11458 --
NM_147202chr932628 1098 205 ----1795
NM_148174chr811497 ------
NM_148904chr1------1552
NM_148905chr1------1552
NM_148906chr1------1552
NM_148907chr1------1552
NM_148908chr1------1552
NM_148909chr1------1552
NM_148918chr171129 ------
NM_148921chr1742397 789 768 313 11948 21987 1802 --
NM_148955chr1541496 546 415 310 25776 587 ----
NM_152227chr202616 163 ------
NM_152238chr11244 ------
NM_152259chr151923 ------
NM_152261chr122535 185 ------
NM_152263chr145548 4411 3816 2349 25752 2328 --15982
NM_152265chr13493 255 241 ------
NM_152267chr2232420 1947 742 --1693 --
NM_152271chr821039 743 --1976 193
NM_152275chr21786 --1230 --
NM_152277chr531956 729 533 ------
NM_152292chr442276 2214 1538 786 --11917 --
NM_152298chr13579 171 126 ------
NM_152300chr173729 377 212 --1235 --
NM_152305chr341479 600 520 123 ------
NM_152332chr1422718 440 --11943 --
NM_152383chr2196 ------
NM_152387chr21238 ------
NM_152388chr253110 2760 865 859 309 --24017 2486 --
NM_152407chr582878 2390 2310 2303 2296 2289 1315 328 12353 --1174
NM_152408chr5269 26 ----144
NM_152409chr533366 126 66 13099 ----
NM_152414chr821297 192 ------
NM_152424chrX31013 252 148 13992 11816 --
NM_152431chr111399 ------
NM_152437chr1212194 ------
NM_152440chr122926 71 21025 26 ----
NM_152441chr124703 203 180 96 ------
NM_152448chr151514 --1566 --
NM_152493chr131246 485 460 ------
NM_152520chr21824 ------
NM_152527chr2--2432 28 ----
NM_152556chr732479 997 97 ------
NM_152563chr1111102 ------
NM_152594chr15----11967 --
NM_152608chr142238 808 247 200 1673 1695 --
NM_152609chr121178 360 --1223 2952 443
NM_152622chr53943 534 503 ------
NM_152624chr5105180 5159 4925 4814 2759 2712 2530 2488 2390 1719 27045 5565 ----
NM_152629chr943043 916 519 206 --12698 1495
NM_152636chr1123054 2744 ----12909
NM_152641chr1252316 1074 991 545 438 ------
NM_152665chr12459 222 ------
NM_152692chrX2347 172 ------
NM_152699chr33704 462 49 1360 33112 2897 2312 22451 199
NM_152704chr133683 208 151 ----2969 694
NM_152707chr101348 ------
NM_152715chr11169 ------
NM_152729chr651289 1275 520 431 133 ------
NM_152731chr61902 --1267 --
NM_152734chr623771 1886 11472 14588 --
NM_152737chr641809 819 265 147 ------
NM_152744chr753461 3265 3192 1222 317 ------
NM_152745chr71903 ------
NM_152756chr514243 13005 ----
NM_152758chr822244 152 23062 1964 ----
NM_152772chr121382 ------
NM_152787chrX52704 1558 1394 796 174 ----13100
NM_152789chr71503 ------
NM_152793chr731805 1262 218 --13196 --
NM_152826chr1541496 546 415 310 25776 587 ----
NM_152829chr731096 189 47 1172 --1848
NM_152835chr122705 952 ------
NM_152838chr204773 626 411 303 --1123 --
NM_152857chr62728 715 ------
NM_152858chr62728 715 ------
NM_152888chr8177 ----1809
NM_152896chr92743 645 ------
NM_152903chr1352822 2406 2177 448 128 ------
NM_152924chr1574353 2291 1918 1686 837 202 74 11423 --11833
NM_152994chr21248 ------
NM_153020chr611073 ------
NM_153050chr2244405 3394 1800 1743 ------
NM_153051chr2244405 3394 1800 1743 ------
NM_153184chr331704 1277 308 ------
NM_153188chr534746 4136 1564 --14388 --
NM_153207chr1223223 857 --1945 --
NM_153208chr162820 635 ------
NM_153255chr6134 1828 ----
NM_153267chr92371 219 ------
NM_153354chr52359 292 ------
NM_153365chr422315 1822 ----12145
NM_153367chr1042945 2917 1483 1249 1249 11446 --
NM_153371chr1342324 827 327 85 1660 2682 163 170
NM_153449chr121491 ------
NM_153464chr192599 228 ------
NM_153607chr532427 2197 2153 --12475 --
NM_153616chr1511554 --1366 --
NM_153617chr1511554 --1366 --
NM_153618chr1511554 --1366 --
NM_153619chr1512792 --1176 --
NM_153634chr1211347 ----1113
NM_153649chr111940 --11610 --
NM_153689chr23853 598 238 --11526 --
NM_153715chr73507 199 157 --1349 --
NM_153747chr1----1250 --
NM_153757chr4151 --1266 --
NM_153758chr11328 ------
NM_153759chr21998 1930 ----
NM_153810chr1034593 3543 149 --23593 504 1406
NM_153815chr15------175
NM_153816chr61396 ------
NM_153827chr171109 ------
NM_153828chr21889 ------
NM_170606chr71328 1316 ----
NM_170663chr171109 ------
NM_170665chr122516 372 1120 34088 3690 1816 14597
NM_170686chr722949 596 ------
NM_170706chr132830 1174 1025 11575 44165 4044 1664 1361 --
NM_170707chr13890 174 124 ------
NM_170708chr13890 174 124 ------
NM_170709chr812211 ------
NM_170711chr192918 615 ------
NM_170731chr1122512 244 --22606 878 12432
NM_170732chr1122512 244 --22606 878 12432
NM_170733chr1122512 244 --22606 878 12432
NM_170734chr1122512 244 --22606 878 12432
NM_170735chr1122512 244 --22606 878 12432
NM_170739chr111221 ------
NM_170750chrX1777 ------
NM_172071chr117459 26211 5700 16399 --
NM_172103chr6----12209 1201
NM_172105chr6----12209 1201
NM_172127chr43620 455 446 ------
NM_172128chr43576 411 402 ------
NM_172164chr13579 171 126 ------
NM_172169chr1011708 --11415 11738
NM_172170chr1011708 --11415 11738
NM_172171chr1011708 --11415 11738
NM_172173chr1011708 --11415 11738
NM_172373chr1321367 96 ------
NM_172387chr1811325 ------
NM_172388chr1811372 ------
NM_172389chr1811372 ------
NM_173054chr71627 ------
NM_173065chr11442 13104 23126 1261 --
NM_173075chr42723 238 --11514 --
NM_173083chr111093 --1382 --
NM_173156chr132157 2130 1450 ------
NM_173163chr161189 ------
NM_173165chr16170 ------
NM_173214chr1687973 7596 5620 3016 2900 1926 1652 678 15290 ----
NM_173359chr351568 365 186 119 42 156 ----
NM_173454chr1511195 ------
NM_173468chr455074 1256 823 667 243 15120 1323 13683
NM_173469chr151425 ------
NM_173470chrX42336 1992 1028 303 --1419 --
NM_173471chr311064 ------
NM_173475chr16------11659
NM_173491chr521210 24 ----1960
NM_173495chrX42251 719 486 479 136 ----
NM_173510chr2222131 242 12146 21032 665 --
NM_173511chr222875 919 21593 239 12927 --
NM_173582chr1176328 6291 5555 4445 2332 572 188 --11964 --
NM_173595chr1255253 4293 3880 3454 1601 --11790 --
NM_173602chr1283540 3296 3123 2951 2942 1481 1342 1329 ------
NM_173631chr1931170 501 201 ------
NM_173642chr169130 7505 6724 6673 3378 171 17996 13218 --
NM_173681chr711562 1376 --11761
NM_173683chr821568 43 ------
NM_173808chr124390 313 1542 14195 11529
NM_173809chr1021225 367 --21402 1038 --
NM_173825chr332813 1182 430 --12727 --
NM_173830chr6166 ------
NM_173848chr83602 207 75 ------
NM_173854chr142309 926 424 387 --12052 --
NM_173872chr43771 373 82 2835 587 ----
NM_174890chr101570 ------
NM_174907chr3147 ------
NM_174911chr811438 1796 ----
NM_174934chr1163396 2444 1435 1209 1104 298 --1658 --
NM_174937chr102548 136 ------
NM_174978chr141207 ------
NM_175077chr202416 40 1931 ----
NM_175566chr112185 175 ------
NM_175607chr3--11195 11132 1653
NM_175610chr152982 894 ------
NM_175612chr3--11195 11132 1653
NM_175629chr21998 1930 ----
NM_175634chr811111 ------
NM_175635chr811111 ------
NM_175636chr811111 ------
NM_175748chr1472149 1571 1320 846 604 596 487 1823 ----
NM_175848chr2011178 ------
NM_175848chr2011178 ------
NM_175849chr2011178 ------
NM_175849chr2011178 ------
NM_175850chr2011178 ------
NM_175850chr2011178 ------
NM_175852chr132188 952 416 11036 12477 --
NM_175854chr1342353 2216 1013 868 ------
NM_175856chr5------2632 129
NM_175861chr1275952 5120 4960 4249 3858 1285 268 --36020 4629 1479 --
NM_175873chr54948 422 371 300 ------
NM_175884chr731339 932 353 --1397 --
NM_176812chr202771 170 --1586 --
NM_176863chr1722109 61 ------
NM_177398chr121897 1279 --11567 --
NM_177399chr121897 1279 --11567 --
NM_177401chr1931306 1123 528 --1186 11399
NM_177414chr11234 ------
NM_177438chr1412967 ------
NM_177559chr2011257 1937 1774 --
NM_177560chr2011257 1937 1774 --
NM_177966chr321305 518 --1541 --
NM_177968chr231588 1434 812 ------
NM_177969chr22643 40 ------
NM_177983chr21273 ------
NM_177985chr232060 1724 79 --11847 --
NM_177996chr2033137 3110 1307 --1886 --
NM_178123chr21676 ------
NM_178126chr17133 1630 --1653
NM_178135chr42877 117 11090 11112 --
NM_178140chr532235 1076 926 22547 1827 22120 1955 --
NM_178151chrX37556 5892 5245 25114 2188 35136 4786 1907 --
NM_178152chrX37556 5892 5245 25114 2188 35136 4786 1907 --
NM_178153chrX37556 5892 5245 25114 2188 35136 4786 1907 --
NM_178161chr101301 ------
NM_178177chr33696 84 68 ------
NM_178313chr211508 ----1119
NM_178496chr3159 --11403 --
NM_178539chr1221840 1570 --11532 --
NM_178568chr17--198 ----
NM_178578chr2021007 398 ------
NM_178585chr442580 2419 521 32 --1595 --
NM_178812chr831468 561 273 ------
NM_180989chr13------1895
NM_181093chr11452 ------
NM_181332chrX----12279 --
NM_181351chr1132410 2288 963 --21922 1144 --
NM_181358chr134196 3656 897 ----13805
NM_181361chr31215 ------
NM_181443chr2032663 1979 232 ------
NM_181453chr2----21709 1330 --
NM_181457chr21264 ----31251 135 43
NM_181458chr21397 --145 31384 268 176
NM_181459chr21163 ----21150 34
NM_181460chr21210 ----21197 81
NM_181504chr553458 3287 1562 444 245 --14027 --
NM_181521chr1696982 6325 5124 2757 2645 2582 2277 1142 140 1249 ----
NM_181523chr553458 3287 1562 444 245 --14027 --
NM_181524chr553458 3287 1562 444 245 --14027 --
NM_181532chrX--1239 ----
NM_181575chr21140 ------
NM_181659chr2033446 789 760 --1407 --
NM_181659chr2033446 789 760 --1407 --
NM_181672chrX----1272 1405
NM_181673chrX----1272 1405
NM_181701chr921914 153 31977 1809 255 --21672 116
NM_181702chr8----1100 --
NM_181706chr111371 12037 1969 1839
NM_181711chr121684 ------
NM_181807chr111351 ------
NM_181836chr512405 ------
NM_181838chr511629 ------
NM_181876chr462487 1638 1081 657 612 329 12172 ----
NM_182314chrX2555 83 --11219 --
NM_182472chr41154 ------
NM_182485chr443418 2451 1411 1128 ------
NM_182488chr13----1930 --
NM_182492chr22--1263 143 --
NM_182493chr1614470 25326 1747 34986 1919 677 --
NM_182498chr192329 283 ------
NM_182501chr232993 2492 300 --22527 122 --
NM_182503chr675477 5450 5339 5051 3980 1962 1327 15082 14203 --
NM_182543chr10154 ------
NM_182551chr263449 3361 2676 2389 992 759 --13245 --
NM_182557chr1142211 2172 607 383 --21689 450 --
NM_182565chr171102 ------
NM_182641chr172361 226 ------
NM_182646chr443418 2451 1411 1128 ------
NM_182648chr141233 ------
NM_182691chr711451 ------
NM_182692chr711451 ------
NM_182715chr711159 ------
NM_182763chr132485 2430 2318 --1559 --
NM_182765chr1032046 1846 1633 ------
NM_182830chr142881 367 ------
NM_182894chr1421642 298 ----1663
NM_182898chr764946 2340 2125 2016 1020 889 25189 4189 --21556 297
NM_182899chr764946 2340 2125 2016 1020 889 25189 4189 --21556 297
NM_182907chr632386 2292 566 --22037 120 --
NM_182918chr21------1305
NM_182920chr311291 --11229 --
NM_182947chr121295 ------
NM_182948chr152205 967 480 296 128 ------
NM_182961chr61226 ------
NM_182972chr132595 1937 966 --32139 1850 652 --
NM_182978chr181707 ------
NM_182983chr191279 ------
NM_183043chr13----1865 --
NM_183044chr13----1865 --
NM_183227chr611428 ------
NM_183237chr321171 216 ----1982
NM_183353chrX11167 ----11075
NM_183377chr171807 --1871 --
NM_183397chr2055090 4919 4835 1517 536 ------
NM_183416chr161670 734 646 552 444 123 ------
NM_183419chr8--1106 --1300
NM_183422chr132977 275 ------
NM_194247chr244188 3868 749 271 --23429 1702 13024
NM_194248chr23972 777 657 ------
NM_194250chr22327 129 ------
NM_194278chr1463471 3354 2805 1505 678 128 --12828 --
NM_194282chr41254 22994 1136 11158 --
NM_194283chr542980 1517 617 151 --11045 14036
NM_194286chr1246193 6187 5243 1209 14211 26157 835 14408
NM_194291chr822585 2053 --1646 --
NM_194314chr144349 3574 2209 664 --1252 --
NM_194322chr23972 777 657 ------
NM_194328chr93811 600 265 ----11278
NM_194329chr93811 600 265 ----11278
NM_194330chr93811 600 265 ----11278
NM_194332chr93811 600 265 ----11278
NM_194434chr18105380 4950 4766 4361 4001 3537 2027 966 691 291 ----15111
NM_194442chr111465 --1325 --
NM_197968chr132516 185 ------
NM_197970chr22588 227 ------
NM_197977chr91878 ------
NM_198066chr1422850 2154 22622 2599 12334 --
NM_198074chr11215 ------
NM_198081chr642536 2271 2219 376 12358 2262 130 --
NM_198128chr1822367 1455 ------
NM_198158chr353080 2536 2464 1081 1033 ------
NM_198159chr353080 2536 2464 1081 1033 ------
NM_198177chr353080 2536 2464 1081 1033 ------
NM_198178chr353080 2536 2464 1081 1033 ------
NM_198181chr153563 421 275 ------
NM_198182chr211428 ------
NM_198186chr92495 149 ------
NM_198187chr92495 149 ------
NM_198215chr10----11382 --
NM_198216chr20189 ------
NM_198225chr1031992 359 113 ------
NM_198236chr13785 282 167 1190 1455 --
NM_198243chr151153 1217 1227 --
NM_198268chr134196 3656 897 ----13805
NM_198269chr134196 3656 897 ----13805
NM_198270chrX53252 3027 2235 1335 168 --13327 --
NM_198273chr512466 1134 ----
NM_198279chrX11209 ----1291
NM_198336chr721324 1206 --11312 --
NM_198390chr1631706 1416 1372 ------
NM_198391chr2011064 ----11399
NM_198504chr33878 821 70 ------
NM_198549chr142818 2589 377 298 ------
NM_198560chr312978 ------
NM_198567chr51537 ------
NM_198569chr6----12500 --
NM_198581chr235895 1437 71 26603 5031 15907 15682
NM_198597chr1011014 ------
NM_198859chr334310 3638 3203 --11550 --
NM_198880chr31220 ------
NM_198883chr1128 ------
NM_198889chr41296 --1884 --
NM_198901chr721203 1052 ------
NM_198925chr151950 ------
NM_198990chr722822 250 12140 ----
NM_199040chr1263799 3685 3570 2960 1426 323 ----33709 2826 1450
NM_199044chr132901 498 195 12767 12291 --
NM_199072chr732405 2001 171 11075 ----
NM_199138chr133683 208 151 ----2969 694
NM_199144chr2021214 370 1462 1523 --
NM_199160chr91620 11440 ----
NM_199181chr20----126 --
NM_199185chr51206 ------
NM_199188chr1243826 3332 276 181 ------
NM_199190chr1243826 3332 276 181 ------
NM_199203chr2021214 370 1462 1523 --
NM_199205chr82588 493 ----1709
NM_199245chr1242476 2241 2097 1723 ----1936
NM_199262chr1741642 837 569 499 ------
NM_199320chr412339 ------
NM_199320chr412339 ------
NM_199324chr443313 2984 1098 935 --12332 --
NM_199327chr41386 ------
NM_199329chr112557 37 ----1564
NM_199421chr1454715 4661 3141 740 219 --13776 --
NM_199436chr212530 12030 33049 2536 274 --
NM_199440chr21171 ----1148
NM_199454chr144289 4214 1057 485 --1215 --
NM_199459chr101380 ------
NM_199462chr164978 4683 4533 3510 3273 1794 24564 638 33365 1575 623 --
NM_199478chrX21548 160 --2795 473 11625
NM_199482chr22393 202 1349 ----
NM_201348chr133744 3581 3302 13281 1249 --
NM_201413chr212678 346 --2752 216 --
NM_201414chr212678 346 --2752 216 --
NM_201432chr1734442 4337 1292 12295 21860 1556 --
NM_201433chr1734442 4337 1292 12295 21860 1556 --
NM_201436chr74868 835 823 219 ------
NM_201516chr74924 891 879 275 ------
NM_201517chr74868 835 823 219 ------
NM_201520chr1741564 1188 700 211 11699 --1457
NM_201568chr132157 2130 1450 ------
NM_201569chr132157 2130 1450 ------
NM_201599chrX1345 1472 2223 202 --
NM_201624chr111260 1414 ----
NM_201632chr52643 113 --11760 --
NM_201634chr52742 212 --11859 --
NM_201995chr114777 684 211 137 ------
NM_201998chr114842 749 276 202 ------
NM_203283chr41587 --190 --
NM_203284chr41587 --190 --
NM_203301chr1431713 1477 173 --11256 --
NM_203304chr191608 ------
NM_203307chr191102 11358 11380 --
NM_203341chr11851 ------
NM_203346chr2161 ------
NM_203349chr1521831 1488 ----11933
NM_203350chr141662 1550 1115 1097 ------
NM_203351chr1721634 1557 21987 1962 ----
NM_203390chr841550 1437 575 160 ------
NM_203394chr121243 11816 ----
NM_203399chr12795 605 --1214 --
NM_203401chr12795 605 --1214 --
NM_203437chr22908 793 ------
NM_203444chr121296 1273 ----
NM_203459chr122393 403 ----12472
NM_203463chr264818 4182 4064 3737 618 298 --34872 4395 1198 --
NM_203499chr172864 281 ------
NM_205768chr121447 549 ------
NM_205833chrX2853 577 --2726 689 --
NM_205842chr2148 --1146 --
NM_205860chr142959 2413 2017 1980 ------
NM_206594chr11554 --12464 --
NM_206595chr11554 --12464 --
NM_206839chr151537 ------
NM_206852chr141229 ------
NM_206853chr62999 161 --12902 1366
NM_206854chr611422 11280 14163 11627
NM_206855chr622387 863 12245 15128 --
NM_206857chr141229 ------
NM_206860chr101190 ------
NM_206861chr101190 ------
NM_206862chr101190 ------
NM_206866chr2122192 2150 ----1534
NM_206876chr232641 904 352 ------
NM_206907chr512243 2687 248 2709 557 --
NM_206909chr848335 5457 981 283 27210 5866 28023 3276 --
NM_207009chr101366 ------
NM_207012chr1011247 --13348 1341
NM_207043chr11695 ----12184
NM_207044chr11695 ----12184
NM_207047chr11695 ----12184
NM_207111chr742432 1075 657 125 ------
NM_207116chr742432 1075 657 125 ------
NM_207171chr122029 512 --2649 102 1553
NM_207292chr333244 3084 2908 ----11092
NM_207293chr333244 3084 2908 ----11092
NM_207294chr333244 3084 2908 ----11092
NM_207295chr333244 3084 2908 ----11092
NM_207296chr333244 3084 2908 ----11092
NM_207297chr333269 3109 2933 ----11117
NM_207304chr1332457 523 175 ------
NM_207337chr121169 1782 ----
NM_207343chr111361 ------
NM_207371chr103216 114 69 11061 ----
NM_207396chr12587 85 1284 --21217 307
NM_207406chr455826 5542 2465 1501 978 14191 22301 2118 --
NM_207422chrX178 --1401 11414
NM_207442chr1421001 974 1950 ----
NM_207520chr21889 ------
NM_207521chr21889 ------
NM_207577chr1142874 954 347 147 --2799 566 --
NM_207645chr1111022 --1116 --
NM_207647chr942388 2362 1730 507 12216 ----
NM_207660chr141183 ------
NM_207661chr141183 ------
NM_207662chr141183 ------
NM_212460chr74601 289 83 46 --1195 --
NM_212469chr112891 300 ------
NM_212471chr1721717 624 --1437 --
NM_212472chr1721717 624 --1437 --
NM_212474chr22856 280 ------
NM_212475chr22856 280 ------
NM_212476chr22856 280 ------
NM_212478chr22856 280 ------
NM_212482chr22856 280 ------
NM_213594chr122403 220 ----11308
NM_213609chr321014 988 ------
NM_213648chr52643 113 --11760 --
NM_213662chr1722352 601 --11918 12190