TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4787-3p
miRNA Sequence: GAUGCGCCGCCCACUGCCCCGCGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51954 ------
NM_000037chr842052 1844 819 127 ------
NM_000038chr5--1594 ----
NM_000052chrX--13197 ----
NM_000081chr131809 1503 1251 ------
NM_000109chrX1511 12271 ----
NM_000125chr623530 325 ------
NM_000135chr1621008 283 ------
NM_000168chr71559 1318 ----
NM_000210chr21792 ------
NM_000217chr1245216 3267 1471 464 25294 1052 11494 --
NM_000222chr412058 ------
NM_000245chr721444 642 ------
NM_000252chrX1945 11018 ----
NM_000259chr1564832 4785 4779 4737 3955 1049 1986 ----
NM_000276chrX1568 ------
NM_000280chr111861 ------
NM_000284chrX1170 ------
NM_000291chrX1238 1251 ----
NM_000314chr101658 ------
NM_000332chr666464 6443 6359 6042 396 372 26897 6840 --1170
NM_000335chr31890 --11559 --
NM_000396chr1151 ------
NM_000428chr14--12513 ----
NM_000430chr1722810 905 11063 ----
NM_000444chrX1111 ------
NM_000461chr334622 3994 3015 ------
NM_000474chr71185 ------
NM_000484chr211279 ------
NM_000522chr711075 ------
NM_000538chr133674 167 135 ------
NM_000599chr233426 1434 1283 1761 ----
NM_000618chr1211388 15035 ----
NM_000618chr1211388 15035 ----
NM_000626chr17129 ------
NM_000684chr1011283 ------
NM_000794chr5----1430 --
NM_000813chr511342 11801 ----
NM_000816chr51580 ------
NM_000817chr21820 ------
NM_000826chr421854 108 12273 22238 1884 --
NM_000827chr511775 --11622 --
NM_000829chr112331 167 ------
NM_000837chr82393 356 ------
NM_000838chr612432 21065 349 1686 --
NM_000868chrX11822 1315 ----
NM_000875chr1536085 5255 4526 ------
NM_000891chr1712412 ------
NM_000901chr412093 ------
NM_000902chr332722 2699 1173 ------
NM_000933chr2041283 1228 398 375 ------
NM_000944chr421912 1530 --1845 --
NM_000945chr2--11874 ----
NM_000990chr1143664 3639 2870 94 ------
NM_001001323chr1212507 ------
NM_001001331chr312084 ------
NM_001001396chr1--12825 ----
NM_001001438chr211358 ------
NM_001001481chr81150 --1161 --
NM_001001484chr1032398 2227 2054 ------
NM_001001890chr212524 57 13382 ----
NM_001002009chr7139 ------
NM_001002010chr7139 ------
NM_001002032chr171651 ------
NM_001002033chr171751 ------
NM_001002243chr21896 ------
NM_001003652chr1848607 8337 5587 2608 ------
NM_001003674chr1836408 1694 805 15265 ----
NM_001003675chr1836408 1694 805 15265 ----
NM_001003683chr2126 ------
NM_001003712chr1233918 2499 1030 ------
NM_001003800chr923504 1321 13722 ----
NM_001004304chr1232590 2571 142 ------
NM_001004346chr411190 ------
NM_001004356chr421539 943 ------
NM_001004358chr421539 943 ------
NM_001004360chr22273 190 1671 ----
NM_001004419chr122950 740 1912 ----
NM_001004722chr22437 33 ------
NM_001005209chr2----1632 --
NM_001005242chr1211582 ------
NM_001005375chrY150 ------
NM_001005386chr211815 --12035 --
NM_001005404chr1744473 3040 1729 409 14218 11069 13645
NM_001005473chr516020 ------
NM_001005732chr211605 ------
NM_001005733chr211562 ------
NM_001005739chr21193 ------
NM_001005782chr2------11024
NM_001006600chr5--1491 ----
NM_001006933chrX1193 ------
NM_001007024chr1744374 3996 3292 1606 ------
NM_001007025chr1744374 3996 3292 1606 ------
NM_001007099chr11218 ------
NM_001007100chr11218 ------
NM_001007237chr112541 --22651 97 --
NM_001007246chr2111306 ------
NM_001007553chr1----1268 --
NM_001008239chr1823783 488 ------
NM_001008407chr721316 427 ------
NM_001008408chr7175 ----14571
NM_001008564chr1321899 1787 1490 ----
NM_001008701chr1933011 1074 297 ------
NM_001008783chr6--132 ----
NM_001008925chr4------13032
NM_001009184chr82393 356 ------
NM_001009899chr345558 1928 824 60 ------
NM_001010867chr186522 4371 2568 2559 2534 2369 1106 21 --15429 --
NM_001010888chrX14525 14144 ----
NM_001010924chr1011205 167 1264 --
NM_001010977chr13--1104 ----
NM_001011537chr322255 1973 ------
NM_001011538chr43982 768 128 ------
NM_001011666chr746556 5108 2497 1315 14242 ----
NM_001011713chr14----11088 --
NM_001012329chr122029 2021 ------
NM_001012393chr1135120 4452 3448 ------
NM_001012642chr1522052 1933 ------
NM_001012979chrX1193 ------
NM_001012989chrX125 ------
NM_001013415chr42290 115 ------
NM_001013690chr1211784 ------
NM_001013699chr121510 ------
NM_001014380chr1331981 1858 281 15870 ----
NM_001015045chr42489 254 ------
NM_001015877chrX1854 12519 ----
NM_001017368chr17--1761 ----
NM_001017371chr211130 ------
NM_001017395chr343169 2917 2533 44 ------
NM_001017406chr1128 ------
NM_001017424chr12726 93 ------
NM_001017425chr12726 93 ------
NM_001017440chr776340 6165 2194 1050 566 48 42 ------
NM_001017523chr1221719 749 ------
NM_001017926chr81546 ------
NM_001017930chrX11026 1139 ----
NM_001018008chr151632 ------
NM_001018009chr31778 129 ----
NM_001018057chr111150 ------
NM_001018072chr1221719 749 ------
NM_001020658chr111057 ------
NM_001020658chr111057 ------
NM_001023567chr1512385 ------
NM_001024024chr141115 ------
NM_001024070chr141111 ------
NM_001024071chr14183 ------
NM_001024226chr13858 406 116 ------
NM_001024227chr13858 406 116 ------
NM_001024228chr13858 406 116 ------
NM_001024465chr6171 ------
NM_001024660chr31683 ------
NM_001024668chr121897 ------
NM_001024688chr81588 ------
NM_001024858chr1431972 597 21 ------
NM_001024948chr111411 --12337 --
NM_001025076chr1015361 ------
NM_001025108chr242988 2777 1549 430 ------
NM_001025356chr1252984 2942 2156 1032 963 --1358 --
NM_001025579chr171967 ------
NM_001029858chr6196 ------
NM_001029860chr81292 ------
NM_001029875chr51250 ------
NM_001030006chr17143 ------
NM_001030007chr161592 12901 ----
NM_001030272chr11144 ------
NM_001030273chr11144 ------
NM_001031679chr1213141 --11002 --
NM_001031690chr722686 522 --12482 --
NM_001031695chr221232 ------
NM_001031696chr19----1228 --
NM_001031804chr16----12678 --
NM_001032280chr6----11416 --
NM_001032296chr1322714 2672 1475 ----
NM_001032380chr101143 ------
NM_001032999chr2044786 3391 1938 82 15291 ----
NM_001033059chr61252 ------
NM_001033087chr201853 --22907 700 --
NM_001033117chr324861 3993 1370 11391 --
NM_001033581chr11289 ------
NM_001033581chr11289 ------
NM_001033582chr11289 ------
NM_001033723chr822587 1706 ------
NM_001033910chr1--12122 ----
NM_001033925chr1011356 ------
NM_001034845chr42568 378 ------
NM_001035chr11506 ------
NM_001037131chr22852 291 ------
NM_001037132chr732068 870 738 1195 ----
NM_001037133chr732068 870 738 1195 ----
NM_001037164chr71644 ------
NM_001037332chr51162 ------
NM_001037333chr51162 ------
NM_001037339chr111737 ------
NM_001037340chr111737 ------
NM_001037341chr111737 ------
NM_001037341chr111737 ------
NM_001037553chr2134423 4333 3452 ------
NM_001037582chr421520 262 ------
NM_001037639chr3----127 --
NM_001037872chr2171 ------
NM_001039141chr2242558 2032 1734 653 ------
NM_001039199chr2034978 4221 1862 ------
NM_001039538chr21643 ------
NM_001039577chr143263 856 425 38 13735 ----
NM_001039585chr121118 155 ------
NM_001039590chrX13876 11573 ----
NM_001039591chrX13876 11573 ----
NM_001039619chr14169 ------
NM_001039709chr2044786 3391 1938 82 15291 ----
NM_001039762chr1011812 ------
NM_001039888chr11116 ------
NM_001039933chr17129 ------
NM_001039937chr1324083 3984 --13431 --
NM_001040101chr461478 1393 1382 483 188 112 ------
NM_001040110chr7168 ------
NM_001040142chr21254 ------
NM_001040143chr21254 ------
NM_001040152chr744304 4273 1901 1679 --13365 --
NM_001040202chr411646 ------
NM_001040284chr1624488 452 11965 ----
NM_001040402chr4186 ------
NM_001040429chr13--11048 ----
NM_001040450chr1522151 1039 ------
NM_001040453chr1522151 1039 ------
NM_001040633chr71401 ------
NM_001040712chr942693 1276 866 334 11296 ----
NM_001042355chr1634322 1156 274 ------
NM_001042371chr1662021 1663 1603 1585 704 551 ------
NM_001042388chr182754 133 ------
NM_001042412chr1634322 1156 274 ------
NM_001042425chr6----11416 --
NM_001042459chr31119 ------
NM_001042479chrX1647 ------
NM_001042480chrX1647 ------
NM_001042510chr8--1491 ----
NM_001042511chr8--1491 ----
NM_001042537chrX2516 84 ------
NM_001042555chr122612 134 11825 ----
NM_001042599chr217093 1434 ----
NM_001042601chr313103 --13069 --
NM_001042646chr311730 ------
NM_001042749chrX1144 ------
NM_001042750chrX1144 ------
NM_001042751chrX1144 ------
NM_001043318chr1433122 1638 982 1327 ----
NM_001068chr31241 ------
NM_001069chr6124 ------
NM_001083620chr421852 108 12271 22236 1882 --
NM_001099678chr3----14885 --
NM_001106chr347756 6972 1759 818 17057 ----
NM_001113490chrX43283 2713 1230 543 13255 ----
NM_001121chr10--21759 1519 ----
NM_001122chr9123 ------
NM_001122679chr51954 ------
NM_001128chr161592 12901 ----
NM_001148chr411431 ------
NM_001178chr11144 ------
NM_001206chr911224 11131 ----
NM_001241chr22933 325 ------
NM_001241chr22933 325 ------
NM_001256chr17------12362
NM_001264chr62760 25 ------
NM_001278chr101371 ------
NM_001282chr17143 ------
NM_001290chr41275 ------
NM_001300chr10----1191 --
NM_001331chr11----11094 --
NM_001332chr54537 328 40 34 ------
NM_001356chrX--12451 ----
NM_001364chr1121648 1350 14679 ----
NM_001379chr191196 ------
NM_001391chr181897 ------
NM_001396chr2122483 757 ------
NM_001397chr122402 2114 ------
NM_001401chr91328 ------
NM_001412chrX----13369 --
NM_001414chr12128 ------
NM_001427chr711978 ------
NM_001429chr221387 ------
NM_001438chr112329 ----11135
NM_001448chrX2267 190 ------
NM_001482chr15186 ------
NM_001483chr7----1857 --
NM_001494chr101647 ------
NM_001500chr6159 ------
NM_001542chr112541 --22651 97 --
NM_001543chr524635 3519 --14192 --
NM_001587chrX1568 ------
NM_001604chr111861 ------
NM_001621chr721981 1217 ------
NM_001621chr721981 1217 ------
NM_001634chr61252 ------
NM_001650chr18--12579 ----
NM_001655chr1122204 495 ------
NM_001656chr5--11506 ----
NM_001658chr13858 406 116 ------
NM_001677chr1------1354
NM_001681chr124681 619 88 51 ------
NM_001682chr1212221 ------
NM_001683chr312084 ------
NM_001684chr1--12542 ----
NM_001693chr821151 1126 ------
NM_001706chr31386 ------
NM_001707chr71141 ------
NM_001744chr51113 ------
NM_001754chr212524 57 13382 ----
NM_001759chr1224674 1296 ------
NM_001795chr16----11560 --
NM_001810chr20182 ------
NM_001830chrX33854 3376 1436 ------
NM_001833chr91252 ------
NM_001839chr11535 ------
NM_001896chr161390 185 ----
NM_001901chr61417 ------
NM_001918chr118584 18861 ----
NM_001946chr12------1293
NM_001949chr612912 12642 ----
NM_001967chr3164 ------
NM_001968chr41653 ------
NM_001969chr1463337 2462 1528 850 807 711 ------
NM_001980chr1221469 319 ------
NM_001981chr12491 474 ------
NM_001999chr5----1978 --
NM_002009chr151152 ------
NM_002010chr131476 ------
NM_002025chrX49125 8891 6479 6080 ------
NM_002031chr61160 ------
NM_002040chr21--13182 ----
NM_002074chr11224 11073 ----
NM_002077chr912125 ------
NM_002080chr161890 ------
NM_002084chr52736 234 --1182 --
NM_002126chr1733937 495 139 ------
NM_002141chr71618 ------
NM_002148chr21666 --1620 --
NM_002154chr51192 ------
NM_002189chr10180 ------
NM_002198chr5167 ------
NM_002247chr1021506 145 ------
NM_002267chr1341684 1600 789 420 ------
NM_002268chr3------11287
NM_002270chr545300 4510 4196 1534 --11491 --
NM_002285chr242988 2777 1549 430 ------
NM_002298chr13131 ------
NM_002336chr1224032 1967 ------
NM_002353chr1190 ------
NM_002356chr6------1451
NM_002359chr1722674 542 --13205 --
NM_002372chr51684 ------
NM_002374chr21643 ------
NM_002387chr524000 322 --1933 --
NM_002395chr621174 419 ------
NM_002397chr5--11367 1533 --
NM_002401chr1712501 ------
NM_002406chr51670 --1105 --
NM_002442chr12--1367 ----
NM_002444chrX11791 ------
NM_002465chr12157 ------
NM_002485chr81588 ------
NM_002515chr1411385 1324 ----
NM_002519chr1111021 ------
NM_002524chr1----11070 --
NM_002545chr1135120 4452 3448 ------
NM_002547chrX24258 3020 ------
NM_002552chr211247 ------
NM_002558chr172791 30 ----1149
NM_002569chr1521465 625 ------
NM_002581chr9--15335 ----
NM_002588chr5--11382 ----
NM_002594chr2011809 ------
NM_002595chr121296 11966 ----
NM_002600chr111737 ------
NM_002605chr151430 ------
NM_002628chr32419 398 ------
NM_002645chr11149 12992 ----
NM_002653chr57891 646 356 297 61 55 49 ------
NM_002674chr121168 ------
NM_002693chr152164 53 ------
NM_002698chr19137 ------
NM_002699chr1346 40 28 --11456 --
NM_002705chr16195 ------
NM_002716chr1143136 2453 2386 1457 ------
NM_002729chr101143 ------
NM_002740chr31597 12676 ----
NM_002744chr11289 ------
NM_002745chr2223946 3386 ----1928
NM_002748chr1511009 ------
NM_002755chr15197 ------
NM_002794chr1179 ------
NM_002822chr1211830 ------
NM_002828chr181104 ------
NM_002834chr1223071 1301 ------
NM_002837chr1214377 ------
NM_002839chr942693 1276 866 334 11296 ----
NM_002840chr1------11427
NM_002843chr111954 ------
NM_002844chr621242 25 ------
NM_002852chr3--187 ----
NM_002867chr12655 226 ------
NM_002868chr1222027 701 ------
NM_002869chr11----1658 --
NM_002874chr931718 171 39 ------
NM_002896chr11151 ------
NM_002897chr2------1181
NM_002912chr62902 65 ------
NM_002942chr31296 ------
NM_002948chr31878 --1323 --
NM_002950chr32375 84 ------
NM_002979chr11218 ------
NM_002998chr81469 ------
NM_003010chr171167 ------
NM_003011chr9--1360 ----
NM_003016chr1711603 ------
NM_003017chr6----1103 --
NM_003028chr943713 3676 3656 3171 ------
NM_003068chr8----1687 --
NM_003069chrX--141 ----
NM_003077chr171714 ------
NM_003106chr3167 ------
NM_003107chr612046 ------
NM_003108chr272896 2890 2636 2611 2335 2328 38 16164 1971 --
NM_003111chr211130 ------
NM_003112chr712567 ------
NM_003128chr22903 205 --12232 --
NM_003155chr8--12697 ----
NM_003156chr111259 ------
NM_003161chr171174 ------
NM_003173chrX1884 ------
NM_003178chr31617 ------
NM_003185chr2021144 336 ------
NM_003189chr133186 919 881 ------
NM_003204chr17--11398 ----
NM_003216chr2233099 2626 117 --2430 108 --
NM_003220chr6----11416 --
NM_003221chr621128 177 ------
NM_003222chr201914 ------
NM_003247chr6137 1379 ----
NM_003250chr171438 ------
NM_003255chr1732618 373 254 ------
NM_003257chr15--1963 1332 --
NM_003269chr62880 209 ------
NM_003298chr326154 1738 ------
NM_003304chr311286 ------
NM_003317chr141242 ------
NM_003340chr411167 ------
NM_003347chr22153 --11613 --
NM_003348chr12125 ------
NM_003352chr2------11024
NM_003375chr101301 ------
NM_003385chr21168 ------
NM_003389chr91471 ------
NM_003390chr111710 ------
NM_003392chr343404 3379 1267 465 ------
NM_003400chr2--1550 ----
NM_003406chr811468 ------
NM_003412chr312042 --12806 --
NM_003432chr51457 ------
NM_003463chr61733 ------
NM_003470chr163516 451 71 ------
NM_003471chr311849 ------
NM_003478chr11--12816 ----
NM_003489chr2143011 3003 2987 2902 ------
NM_003507chr211890 ------
NM_003566chr12--13061 ----
NM_003574chr1833768 3543 1412 ------
NM_003576chr1322714 2672 1475 ----
NM_003583chr1233263 3203 2760 ------
NM_003586chr161601 ------
NM_003590chr233834 990 399 ------
NM_003615chr332430 902 56 ------
NM_003621chr11194 ------
NM_003632chr171742 ------
NM_003633chr521604 209 ------
NM_003663chr31289 ------
NM_003668chr121133 ------
NM_003671chr91180 23411 2192 1305 --
NM_003705chr2--1747 ----
NM_003714chr522036 400 ------
NM_003716chr3149 ------
NM_003728chr41523 ------
NM_003735chr5--11382 ----
NM_003736chr5--11382 ----
NM_003749chr1312386 11716 ----
NM_003783chr11936 ------
NM_003787chr1811306 ------
NM_003795chr61239 ------
NM_003873chr101371 1492 ----
NM_003877chr122734 670 ------
NM_003884chr311301 ------
NM_003885chr1732190 1641 932 --11813 --
NM_003921chr11344 ------
NM_003927chr182899 279 ------
NM_003947chr32217 124 ------
NM_003966chr525684 114 26798 422 17597 --
NM_003968chr31547 ------
NM_003972chr1011072 11136 ----
NM_003980chr611178 ------
NM_004006chrX1511 12271 ----
NM_004007chrX1511 12271 ----
NM_004009chrX1511 12271 ----
NM_004010chrX1511 12271 ----
NM_004011chrX1511 12271 ----
NM_004012chrX1511 12271 ----
NM_004013chrX1511 12271 ----
NM_004014chrX1511 12271 ----
NM_004015chrX1511 12271 ----
NM_004016chrX1425 12185 ----
NM_004017chrX1511 12271 ----
NM_004018chrX1425 12185 ----
NM_004020chrX1511 12271 ----
NM_004021chrX1425 12185 ----
NM_004022chrX1425 12185 ----
NM_004023chrX1425 12185 ----
NM_004028chr18--12579 ----
NM_004037chr11875 ------
NM_004056chr8--1950 ----
NM_004063chr82950 86 ------
NM_004067chr71484 ------
NM_004081chrY150 ------
NM_004093chr1332616 2387 896 1427 1410 --
NM_004100chr632474 2306 917 ------
NM_004114chrX11124 1201 ----
NM_004171chr1128906 44 28558 101 ----
NM_004215chr8--1379 ----
NM_004227chr731244 282 107 ------
NM_004229chrX1146 ------
NM_004232chr1812933 ------
NM_004242chr6--2297 274 ----
NM_004249chr41104 ------
NM_004263chr22576 458 ------
NM_004267chr31167 ------
NM_004296chr1413960 ------
NM_004302chr122670 557 --1296 --
NM_004330chr15--1448 ----
NM_004338chr1836408 1694 805 15265 ----
NM_004339chr212479 42 ------
NM_004342chr7--1703 ----
NM_004370chr611921 ----1304
NM_004379chr221517 439 ------
NM_004389chr21273 ------
NM_004397chr111388 ------
NM_004411chr7--1561 ----
NM_004420chr1122312 729 ------
NM_004430chr8189 ------
NM_004432chr9----22067 1976 --
NM_004438chr232812 1242 150 ------
NM_004474chr11941 ------
NM_004482chr21121 ------
NM_004491chr1974209 3655 3634 3614 2765 1480 1127 ------
NM_004499chr51115 ------
NM_004504chr2--1319 ----
NM_004506chr6----1225 --
NM_004550chr11145 ------
NM_004571chr2142614 2380 145 132 ------
NM_004575chr4----11140 --
NM_004598chr51876 --13320 --
NM_004600chr121320 1190 1116 ----
NM_004603chr721008 177 ------
NM_004615chrX1665 ------
NM_004619chr1--12122 ----
NM_004660chrY11420 ------
NM_004685chr1311059 --1615 --
NM_004687chr171318 ------
NM_004698chr1--1194 ----
NM_004725chr102593 183 ------
NM_004726chrX21888 1345 11607 ----
NM_004730chr5----11415 --
NM_004734chr13--1444 12359 13256
NM_004745chr8----1407 --
NM_004768chr11904 ------
NM_004772chr511393 ------
NM_004774chr171384 13055 ----
NM_004796chr1412294 ------
NM_004800chr131261 ------
NM_004801chr21502 11294 ----
NM_004808chr10--12226 ----
NM_004831chr19125 ------
NM_004834chr21799 ------
NM_004844chr31778 129 ----
NM_004845chrX1197 ------
NM_004860chr17----1549 --
NM_004866chr541665 732 506 128 ------
NM_004871chr1744374 3996 3292 1606 ------
NM_004904chr746556 5108 2497 1315 14242 ----
NM_004906chr61554 1593 ----
NM_004923chr11----1190 --
NM_004932chr51206 ------
NM_004938chr9--1395 --1954
NM_004949chr1812007 ------
NM_004962chr102148 79 ------
NM_004967chr4179 197 ----
NM_004985chr12----1275 --
NM_005010chr732068 870 738 1195 ----
NM_005011chr7168 ------
NM_005028chr103417 266 260 1919 ----
NM_005032chrX1443 --141 --
NM_005052chr171259 ------
NM_005093chr2044786 3391 1938 82 15291 ----
NM_005095chr1------1258
NM_005109chr32667 48 ------
NM_005116chr2023710 880 --11674 --
NM_005118chr92992 849 ------
NM_005126chr31927 ------
NM_005134chr182754 133 ------
NM_005156chr925259 1242 ------
NM_005157chr921901 589 11835 ----
NM_005188chr1127344 212 1571 ----
NM_005197chr1426030 681 --12434 --
NM_005201chr31166 ------
NM_005225chr204371 353 274 214 ------
NM_005235chr217093 1434 ----
NM_005241chr311358 ------
NM_005249chr141176 ------
NM_005252chr14----159 --
NM_005259chr21503 ------
NM_005261chr81127 ------
NM_005262chr1621337 76 ------
NM_005277chr41568 ------
NM_005281chr11972 ------
NM_005316chr11----1384 --
NM_005328chr81258 ------
NM_005374chr17--11756 ----
NM_005375chr61143 ------
NM_005378chr2------1789
NM_005382chr8----1368 --
NM_005386chr204925 914 800 51 ------
NM_005388chr921500 395 ------
NM_005401chr1194 ------
NM_005412chr121536 ------
NM_005417chr2011518 ------
NM_005433chr181204 ------
NM_005436chr1023638 923 ------
NM_005455chr11147 --1216 --
NM_005465chr1--1491 ----
NM_005494chr71510 --1657 --
NM_005499chr19--1226 ----
NM_005503chr151912 11152 ----
NM_005504chr1234447 598 579 1106 ----
NM_005520chr5151 ------
NM_005566chr11166 1425 ----
NM_005570chr18--11134 ----
NM_005596chr911385 ------
NM_005602chr3----11292 --
NM_005604chr61839 --12013 --
NM_005605chr81197 --1110 --
NM_005638chrX11689 ------
NM_005656chr21170 ------
NM_005665chr1--1979 ----
NM_005688chr311115 1396 ----
NM_005707chr1521039 1030 ------
NM_005715chr61817 --1100 --
NM_005717chr111227 ------
NM_005722chr211815 --12035 --
NM_005724chr15------1542
NM_005725chr112078 11859 ----
NM_005730chr1221230 995 ------
NM_005734chr111118 ------
NM_005736chr1011335 ------
NM_005737chr222476 481 ------
NM_005738chr71644 ------
NM_005768chr122645 35 ------
NM_005776chr14136 ------
NM_005786chr181173 ------
NM_005796chr162153 123 ------
NM_005822chr61924 ------
NM_005840chrX72881 2857 2508 1959 1444 864 161 ------
NM_005862chr32808 782 ------
NM_005871chr101862 ------
NM_005885chr521067 262 11404 ----
NM_005901chr1848607 8337 5587 2608 ------
NM_005909chr513276 ------
NM_005911chr221124 36 ------
NM_005917chr21183 ------
NM_005924chr721010 249 ------
NM_005937chr1742566 1151 862 774 14088 12987 12949
NM_005955chr143728 1905 1456 948 1307 ----
NM_005969chr113967 810 197 ------
NM_006011chr15------14297
NM_006022chr1311022 ------
NM_006047chr2012629 ------
NM_006048chr11990 ------
NM_006055chr211166 ------
NM_006109chr14169 ------
NM_006141chr1622734 532 ------
NM_006166chr1212184 ----12507
NM_006176chr111777 ------
NM_006191chr121822 ------
NM_006195chr9146 ------
NM_006203chr521168 61 ------
NM_006206chr41496 ------
NM_006246chr14----11282 --
NM_006251chr5--11120 ----
NM_006256chr111086 ------
NM_006257chr10--1811 ----
NM_006265chr8----1284 --
NM_006268chr111264 ------
NM_006281chr81185 ------
NM_006281chr81185 ------
NM_006293chr151384 ------
NM_006298chr632859 1198 538 --22260 2116 --
NM_006310chr17--1493 ----
NM_006311chr17129 ------
NM_006313chr1221703 423 ------
NM_006317chr52904 701 ------
NM_006320chr4----11054 --
NM_006325chr12169 ------
NM_006336chr921372 434 ------
NM_006359chrX2516 84 ------
NM_006367chr11209 ------
NM_006375chrX11855 ------
NM_006379chr7------1209
NM_006380chr1713898 --12799 --
NM_006383chr151521 ------
NM_006411chr61212 ------
NM_006420chr2043309 2116 1200 1007 ------
NM_006431chr121222 ------
NM_006458chr111121 ------
NM_006464chr223272 651 14620 ----
NM_006482chr1233263 3203 2760 ------
NM_006489chr1411385 1324 ----
NM_006495chr17--1146 ----
NM_006534chr2033025 2523 2496 ------
NM_006538chr214053 ------
NM_006544chr1415833 ----1864
NM_006546chr1735446 1604 818 ------
NM_006547chr71549 ------
NM_006561chr1015361 ------
NM_006599chr1626634 286 1708 ----
NM_006603chrX1144 ------
NM_006614chr313088 11257 ----
NM_006621chr1----1469 --
NM_006622chr51480 ------
NM_006654chr122612 134 11825 ----
NM_006699chr11766 ----12687
NM_006706chr5179 ------
NM_006713chr51150 ------
NM_006717chr912951 --11221 --
NM_006734chr611477 ------
NM_006742chr1611962 ------
NM_006775chr62955 902 ------
NM_006788chr182480 50 --1778 --
NM_006806chr211342 ------
NM_006822chr171187 ------
NM_006826chr211151 ------
NM_006854chr731759 1742 1694 --11783 --
NM_006885chr1611307 ------
NM_006914chr91465 ------
NM_006915chrX21769 1562 ------
NM_006920chr22755 293 ------
NM_006922chr222152 382 --1942 --
NM_006924chr1724089 1300 ------
NM_006931chr1231347 707 346 ------
NM_006940chr1221201 597 ------
NM_006943chr2042703 538 474 21 ------
NM_006981chr91482 12382 ----
NM_006988chr21290 56 11236 ----
NM_006996chr11102 ------
NM_006997chr10--1359 ----
NM_007006chr1642529 2158 1363 489 ------
NM_007010chr1711424 ------
NM_007032chr2242558 2032 1734 653 ------
NM_007038chr2115107 ------
NM_007064chr31683 ------
NM_007078chr103893 549 168 ------
NM_007096chr91252 ------
NM_007124chr611274 ------
NM_007144chr17--11139 ----
NM_007158chr1----1268 --
NM_007159chr311751 ------
NM_007170chr1168 ------
NM_007174chr12----12142 --
NM_007182chr32275 99 ------
NM_007222chr81546 ------
NM_007271chr61586 ------
NM_007285chr162107 23 ------
NM_007287chr332722 2699 1173 ------
NM_007288chr332722 2699 1173 ------
NM_007289chr332722 2699 1173 ------
NM_007313chr921901 589 11835 ----
NM_007331chr411890 --12654 --
NM_007349chr7122 ------
NM_007358chr1--1588 ----
NM_007361chr141512 ------
NM_007363chrX1979 --1222 --
NM_007372chr171878 ------
NM_007375chr121723 851 ----1872
NM_012081chr523293 795 ------
NM_012090chr11317 ------
NM_012104chr111519 ------
NM_012104chr111519 ------
NM_012111chr141146 ------
NM_012137chr112785 ------
NM_012141chr1324083 3984 --13431 --
NM_012156chr2022385 902 ------
NM_012164chr936402 2090 59 27231 7138 ----
NM_012188chr51864 ------
NM_012193chr1133977 3820 3308 ------
NM_012210chr921432 450 ------
NM_012218chr191140 ------
NM_012249chr233561 752 693 ------
NM_012252chr714392 ------
NM_012268chr19----1228 --
NM_012281chr732462 2288 949 ------
NM_012290chr211065 ------
NM_012294chr753336 2726 1419 609 371 ------
NM_012304chr5171 21871 855 ----
NM_012325chr2011443 ------
NM_012328chr7194 ------
NM_012330chr1021108 482 11527 ----
NM_012333chr11341 ------
NM_012334chr524225 601 14574 ----
NM_012417chr171128 ------
NM_012421chr11302 ------
NM_012448chr171149 --11766 --
NM_012455chr221609 1478 ------
NM_013231chr1421556 118 ------
NM_013253chr111150 ------
NM_013262chr611200 ------
NM_013269chr122877 667 1839 ----
NM_013281chr2011287 ------
NM_013316chr7--1317 ----
NM_013333chr19176 ------
NM_013372chr151155 ------
NM_013374chr31592 ------
NM_013381chr121351 ------
NM_013390chr911799 --11177 --
NM_013438chr9--11201 ----
NM_013449chr1232893 894 209 ------
NM_013995chrX12217 ------
NM_014016chr3--11085 ----
NM_014057chr911511 ------
NM_014089chr1321899 1787 1490 ----
NM_014112chr825410 1702 ------
NM_014153chr161574 ----1111
NM_014155chr111795 15247 ----
NM_014159chr31231 ------
NM_014160chr311424 ------
NM_014212chr12----1638 --
NM_014216chr1431419 310 38 --1426 --
NM_014217chr12726 93 ------
NM_014223chr11131 ------
NM_014225chr191106 ------
NM_014232chr171602 --11664 --
NM_014232chr171602 --11664 --
NM_014240chr343822 3317 2847 757 ------
NM_014243chr411634 31976 1423 305 --168
NM_014253chrX32367 2177 403 ------
NM_014263chr1011141 --1960 --
NM_014268chr1811407 ------
NM_014309chr221222 ------
NM_014315chr141124 ------
NM_014319chr1211657 ------
NM_014325chr1211511 ------
NM_014344chr11--1855 ----
NM_014368chr911588 ------
NM_014376chr51162 ------
NM_014392chr461478 1393 1382 483 188 112 ------
NM_014393chr8----1291 --
NM_014415chr321439 219 ------
NM_014417chr191179 ------
NM_014423chr525356 3676 ----11351
NM_014454chr61788 --1856 --
NM_014470chr12151 ------
NM_014472chr102215 102 ------
NM_014480chr191808 ----1580
NM_014481chrX--1312 ----
NM_014488chr111470 ------
NM_014498chr3--1146 ----
NM_014500chrX--192 ----
NM_014504chr721431 482 ------
NM_014515chr121812 ------
NM_014517chr31247 ------
NM_014554chr121771 ------
NM_014574chr14--1254 ----
NM_014586chr2134444 1427 1314 ------
NM_014588chr201236 140 ----
NM_014600chr211645 ------
NM_014606chr41445 11537 ----
NM_014607chr2--12120 ----
NM_014614chr221433 1198 ------
NM_014634chr2253465 3410 3170 2856 331 ------
NM_014636chr91416 13487 12777 --
NM_014660chr71306 ------
NM_014663chr11720 --11110 --
NM_014665chr883442 3174 3142 3108 2973 2643 2519 1350 ------
NM_014676chr111057 ------
NM_014677chr811310 ------
NM_014686chr1922436 2426 ------
NM_014690chr722686 522 --12482 --
NM_014705chr71688 ------
NM_014706chr1221147 802 ------
NM_014707chr711918 ------
NM_014717chr191163 ------
NM_014743chr442247 2001 1162 261 --11140 1719
NM_014746chr21566 ----1533
NM_014747chr145706 5047 4988 1103 ----11994
NM_014751chr8--11762 ----
NM_014755chr244030 3868 725 78 1340 14077 --
NM_014764chr1211244 ------
NM_014772chr182648 50 --12756 --
NM_014779chr31272 ------
NM_014781chr81294 ------
NM_014803chr10--11126 ----
NM_014813chr11611 ------
NM_014819chr51208 ------
NM_014820chr311711 ------
NM_014836chr101143 ------
NM_014839chr111957 ------
NM_014841chr611364 ------
NM_014850chr324861 3993 1370 11391 --
NM_014868chr12----1877 --
NM_014872chr911919 ------
NM_014873chr1162 11915 ----
NM_014883chr42489 254 ------
NM_014890chr31119 ------
NM_014897chr172950 855 ------
NM_014903chr1211693 ------
NM_014905chr21224 ------
NM_014912chr10199 ------
NM_014914chr22852 291 ------
NM_014918chr1521518 638 ------
NM_014921chr1933011 1074 297 ------
NM_014932chr31620 ------
NM_014942chr612587 ------
NM_014947chr132585 1939 1055 ------
NM_014961chr411774 --1376 --
NM_014962chr2022755 2126 ------
NM_014964chr1742251 2071 2016 1591 1463 ----
NM_014978chr101501 ------
NM_014982chr1411089 ------
NM_014989chr611929 --11342 --
NM_014997chr711148 ------
NM_015000chr122288 67 ------
NM_015008chr343169 2917 2533 44 ------
NM_015025chr2--1514 ----
NM_015026chr121537 ------
NM_015027chr1611250 ------
NM_015032chr1312333 ------
NM_015040chr213119 12114 ----
NM_015045chr1021983 394 ------
NM_015052chr71154 1515 ----
NM_015053chr112261 ------
NM_015068chr743156 3125 753 531 ------
NM_015069chr161453 ------
NM_015071chr514194 16309 ----
NM_015076chr61310 ------
NM_015090chr146086 5482 4326 379 ------
NM_015092chr163962 897 144 14639 ----
NM_015094chr2253328 1062 770 736 473 --1434 --
NM_015097chr3--11597 ----
NM_015101chr132129 2121 822 ------
NM_015103chr32422 335 ------
NM_015107chrX----1109 --
NM_015115chr4186 ------
NM_015132chr7--11621 --1216
NM_015155chr1022441 579 1408 13093 --
NM_015156chr1423284 1048 1405 12503 --
NM_015161chr161196 31483 185 165 ----
NM_015163chr14188 ------
NM_015180chr14--1610 ----
NM_015199chr31736 ------
NM_015200chr411967 ------
NM_015208chr1823809 2603 12902 ----
NM_015215chr123062 1206 ------
NM_015247chr1634322 1156 274 ------
NM_015251chr16--1168 ----
NM_015263chr151170 ------
NM_015265chr212656 ------
NM_015271chr424179 2613 ------
NM_015277chr1821773 1153 ------
NM_015282chr232530 434 299 ------
NM_015285chr182307 148 ------
NM_015296chr131301 ------
NM_015310chr856633 3268 2528 2470 1162 --1114 --
NM_015326chr112772 ------
NM_015336chr1212508 ------
NM_015347chr1252948 2343 2287 2093 911 ----12044
NM_015355chr171726 ------
NM_015358chr2111055 ------
NM_015393chr443522 2503 2326 86 ------
NM_015416chr121897 ------
NM_015423chr1111490 ------
NM_015435chr821051 204 ------
NM_015455chr53997 978 318 ------
NM_015457chr11196 ------
NM_015472chr3191 ------
NM_015472chr3191 ------
NM_015477chr151150 ------
NM_015497chr151747 ------
NM_015509chr1221651 599 ------
NM_015534chr111017 ------
NM_015542chr1011053 ------
NM_015549chr141620 ------
NM_015550chr7----1386 --
NM_015557chr153486 3479 1446 825 753 --13164 --
NM_015565chr2112123 ------
NM_015571chr6----1151 --
NM_015575chr223688 427 12686 ----
NM_015609chr132824 528 420 ------
NM_015678chr13----1569 --
NM_015686chrX2927 561 ------
NM_015878chr821834 1792 --1696 --
NM_015881chr111150 ------
NM_015906chr11329 ------
NM_015912chr822182 1982 ------
NM_015915chr14----127 --
NM_015949chr72919 163 1993 1130 --
NM_016021chr612967 ------
NM_016022chr12811 376 ------
NM_016061chr211657 ------
NM_016073chr1511005 ------
NM_016076chr11174 ------
NM_016094chr31166 ------
NM_016096chr8--1491 ----
NM_016107chr51309 ------
NM_016132chr1511377 12656 ----
NM_016169chr1013282 ------
NM_016185chr171751 ------
NM_016199chr19125 ------
NM_016203chr71401 ------
NM_016205chr41138 ------
NM_016206chr337445 6953 392 ------
NM_016226chr121309 ------
NM_016231chr1711519 11087 ----
NM_016260chr237369 2698 2524 ------
NM_016263chr1963355 2687 2627 1326 829 698 ------
NM_016277chr61537 ------
NM_016287chr12774 65 ------
NM_016300chr3------1178
NM_016316chr2171 ------
NM_016322chr911192 ------
NM_016339chr1731806 1196 527 ------
NM_016376chr1713875 ------
NM_016396chr1512153 ----1813
NM_016427chr181111 ------
NM_016441chr222334 1702 ------
NM_016472chr141995 ------
NM_016489chr7139 ------
NM_016516chr21193 ------
NM_016522chr1111275 ------
NM_016530chr1512797 ------
NM_016544chr233709 3383 2542 ------
NM_016605chr51426 ------
NM_016620chr111170 ------
NM_016651chr1411012 ------
NM_016824chr10--21759 1519 ----
NM_016836chr2------1181
NM_016839chr2------1181
NM_016929chr623853 98 14069 ----
NM_017410chr122430 84 --11123 --
NM_017420chr14----13006 --
NM_017423chr411880 ------
NM_017426chr4--1243 ----
NM_017519chr61263 ------
NM_017520chr131210 ------
NM_017586chr931584 537 484 --11820 --
NM_017593chr42133 73 ------
NM_017594chr921215 354 ------
NM_017602chrX1634 ------
NM_017629chr11600 ------
NM_017633chr61596 33348 2828 658 ----
NM_017634chr8------1154
NM_017637chr959173 7117 3603 1804 118 12718 18453 --
NM_017643chr171272 ------
NM_017650chr724758 4311 11188 ----
NM_017657chr21896 ------
NM_017658chr14--1848 ----
NM_017664chr133998 230 169 1192 ----
NM_017667chr71112 ------
NM_017709chr133934 1241 347 ------
NM_017719chr332106 885 168 ------
NM_017737chr11120 ------
NM_017738chr91274 ------
NM_017741chr41312 ------
NM_017744chr121723 895 ------
NM_017745chrX--152 ----
NM_017753chr91251 ------
NM_017769chr14--12318 ----
NM_017780chr81191 ------
NM_017786chr8--1592 ----
NM_017790chr9----2465 151 --
NM_017811chr91527 --11053 --
NM_017831chr1821804 146 ------
NM_017848chrX33833 1213 722 ----13679
NM_017849chr223144 2627 ------
NM_017856chrX1647 ------
NM_017902chr1064971 1732 897 881 840 342 1727 ----
NM_017925chr921365 564 ------
NM_017946chr711339 ------
NM_017966chr112302 294 ------
NM_017994chr7--12998 ----
NM_018017chr1021003 216 --11151 --
NM_018027chr1022083 1133 ------
NM_018032chr16--1367 ----
NM_018084chr222074 853 12656 ----
NM_018086chr22271 170 ------
NM_018110chr1611225 ------
NM_018120chr81403 ------
NM_018133chr3--1317 ----
NM_018155chr323408 2191 ------
NM_018157chr122750 737 ------
NM_018171chr121727 ------
NM_018179chr12169 ------
NM_018180chr10123 ------
NM_018184chr332079 2063 1898 ------
NM_018211chr12464 392 ------
NM_018240chr11181 ------
NM_018247chr6136 ------
NM_018254chr1--11851 ----
NM_018299chr81150 --1161 --
NM_018312chr111218 ------
NM_018314chr111114 ------
NM_018315chr42290 115 ------
NM_018327chr2021769 1462 --11528 --
NM_018330chr10--1529 ----
NM_018332chr1651281 1121 411 164 61 ------
NM_018364chr113692 ------
NM_018374chr71745 ------
NM_018375chr141104 ------
NM_018398chr3185 ------
NM_018413chr121272 ------
NM_018425chr1021652 66 11804 ----
NM_018434chr5165 ------
NM_018452chr6_random11541 ------
NM_018464chr101169 ------
NM_018465chr91220 ------
NM_018469chr1731022 553 387 ------
NM_018471chr21459 ------
NM_018557chr211500 ------
NM_018566chr1--11740 ----
NM_018571chr21112 ------
NM_018622chr3----127 --
NM_018638chr1212279 12069 ----
NM_018644chr111331 ------
NM_018650chr111709 1441 ----
NM_018657chr3--1595 --164
NM_018682chr7--1557 ----
NM_018685chr7--11131 ----
NM_018695chr5--1491 ----
NM_018717chr41486 ------
NM_018847chr911818 ------
NM_018912chr5--11382 ----
NM_018913chr5--11382 ----
NM_018914chr5--11382 ----
NM_018915chr5--11382 ----
NM_018916chr5--11382 ----
NM_018917chr5--11382 ----
NM_018918chr5--11382 ----
NM_018919chr5--11382 ----
NM_018920chr5--11382 ----
NM_018921chr5--11382 ----
NM_018922chr5--11382 ----
NM_018923chr5--11382 ----
NM_018924chr5--11382 ----
NM_018925chr5--11382 ----
NM_018926chr5--11382 ----
NM_018927chr5--11382 ----
NM_018928chr5--11382 ----
NM_018929chr5--11382 ----
NM_018951chr71432 ------
NM_018979chr121540 ------
NM_019004chr72953 933 ------
NM_019041chr6----12133 --
NM_019057chr5------165
NM_019063chr211453 ------
NM_019091chr21225 ------
NM_019095chr201152 ------
NM_019096chr6--11048 ----
NM_019102chr71382 ------
NM_019102chr71382 ------
NM_019114chr911958 ------
NM_019593chr2032857 2263 754 ------
NM_019845chr22708 250 ------
NM_019885chr252922 1975 673 403 297 ------
NM_019903chr10--21759 1519 ----
NM_020122chr235126 3758 393 11229 ----
NM_020132chr2134423 4333 3452 ------
NM_020133chr644383 4083 1792 751 ------
NM_020134chr21728 ------
NM_020148chr1832436 2055 815 ------
NM_020150chr1021697 212 12184 ----
NM_020153chr111123 ------
NM_020156chr71599 ------
NM_020159chr4149 ------
NM_020178chr1711156 ------
NM_020182chr2063505 2771 2434 2300 1389 94 --12700 --
NM_020184chr221893 1466 ------
NM_020226chr41585 ------
NM_020248chr122029 2021 ------
NM_020310chr171143 ------
NM_020317chr11106 ------
NM_020319chr71677 ------
NM_020337chr41335 13010 ----
NM_020341chr20195 ------
NM_020348chr1022388 1110 --1566 --
NM_020381chr61590 ------
NM_020382chr121282 ------
NM_020420chrY150 ------
NM_020423chr11235 ------
NM_020432chr741637 1432 746 702 ------
NM_020443chr116670 --24555 4547 --
NM_020475chr841989 1781 756 64 ------
NM_020476chr841989 1781 756 64 ------
NM_020477chr841989 1781 756 64 ------
NM_020478chr842052 1844 819 127 ------
NM_020480chr841989 1781 756 64 ------
NM_020546chr532939 2082 231 --1334 --
NM_020713chr2032947 2700 2095 ------
NM_020718chr1646436 4832 1706 1529 ------
NM_020732chr61263 ------
NM_020734chr121730 ------
NM_020738chr2----1255 --
NM_020755chr61169 ------
NM_020769chrX1339 ------
NM_020772chr17--15316 ----
NM_020791chr17--1115 ----
NM_020794chr12232 225 ------
NM_020801chr51537 ------
NM_020813chr1952411 879 378 291 255 12131 ----
NM_020814chr22160 65 ------
NM_020815chr4124 ------
NM_020824chr101152 1760 ----
NM_020825chr1623126 2551 13840 13269 --
NM_020834chr142715 410 ------
NM_020841chr1233918 2499 1030 ------
NM_020850chr1622865 82 ------
NM_020854chr181539 ------
NM_020856chr19------1171
NM_020860chr4----11186 --
NM_020865chr31148 ------
NM_020868chr22273 190 1671 ----
NM_020873chr31161 ------
NM_020960chr914451 --13524 --
NM_020962chr152477 252 ------
NM_020977chr411431 ------
NM_021004chr141372 ------
NM_021005chr151321 ------
NM_021007chr21254 ------
NM_021020chr8162 ------
NM_021035chr201111 ------
NM_021061chr814152 ------
NM_021076chr221522 ------
NM_021090chr2244782 3284 1760 1558 ------
NM_021111chr911249 ------
NM_021120chrX3858 460 274 ------
NM_021136chr141258 ------
NM_021159chr42264 99 ------
NM_021161chr142609 509 ------
NM_021183chrX--1159 ----
NM_021190chr12841 337 --1945 --
NM_021202chr2022912 2761 ------
NM_021260chr14----1316 --
NM_021269chr1911539 --11979 --
NM_021602chr17129 ------
NM_021638chr431557 1117 517 ------
NM_021643chr221930 497 ------
NM_021785chrX----149 --
NM_021813chr634703 4615 112 ------
NM_021911chr511342 11801 ----
NM_021923chr421539 943 ------
NM_021947chr171954 ------
NM_021956chr621371 264 ------
NM_021964chr311997 ----16055
NM_021979chr141141 ------
NM_022006chr191370 ------
NM_022041chr16----1328 --
NM_022048chr1545413 5123 2409 1938 13928 ----
NM_022049chr121825 411 ------
NM_022062chr1111432 ------
NM_022072chr31213 ------
NM_022114chr154534 4392 4043 1823 720 ------
NM_022130chr51355 ------
NM_022133chr8--1276 ----
NM_022170chr71141 ------
NM_022444chr721324 527 ------
NM_022459chr1335729 1626 1437 ----25875 5181
NM_022479chr721028 991 ------
NM_022497chr31676 ------
NM_022574chr712078 ------
NM_022652chr12------1293
NM_022658chr121997 ------
NM_022726chr621565 1181 ------
NM_022735chr12555 428 ------
NM_022739chr1711180 ------
NM_022763chr31151 ------
NM_022776chr311032 ------
NM_022778chr121484 1383 ------
NM_022781chr92873 417 --1645 --
NM_022841chr1522245 2137 ------
NM_022912chr223001 904 ------
NM_023010chrX--1745 ----
NM_023037chr1311027 ------
NM_023067chr3122 ------
NM_023071chr121107 ------
NM_023076chr1632662 2620 1053 ------
NM_023079chr1711901 ------
NM_023927chr521160 102 ------
NM_023929chr811080 ------
NM_024007chr532317 1988 576 ------
NM_024019chr41369 ------
NM_024060chr11----1219 --
NM_024090chr4189 ------
NM_024295chr8159 ------
NM_024416chr911511 ------
NM_024429chr71401 ------
NM_024490chr151511 ------
NM_024545chr21210 ------
NM_024551chr1252079 2037 1870 657 204 12031 ----
NM_024551chr1252079 2037 1870 657 204 12031 ----
NM_024561chr13----171 --
NM_024582chr4----1350 --
NM_024590chr411306 ------
NM_024595chr12979 436 ------
NM_024624chr21466 ------
NM_024665chr323504 3257 --1651 --
NM_024674chr122437 697 --22580 83 --
NM_024704chr201740 ------
NM_024721chr821990 1642 ----11037
NM_024749chr131575 1433 572 ------
NM_024761chr923773 1924 33355 2064 1989 ----
NM_024770chr265941 4934 2191 1920 649 146 12435 ----
NM_024779chr121530 ------
NM_024834chr1021804 477 --1445 --
NM_024893chr201382 ------
NM_024900chr42667 567 --11569 --
NM_024900chr42667 567 --11569 --
NM_024930chr5178 ------
NM_024943chr42841 591 ------
NM_024953chr121825 ------
NM_024989chr256010 5461 5174 2272 2236 27820 272 ----
NM_025069chr81190 ------
NM_025076chr22621 247 ------
NM_025134chr16185 ------
NM_025160chr12417 73 ------
NM_025182chr91679 ------
NM_025191chr11138 ------
NM_025222chr352259 1924 1141 765 202 22952 1114 ----
NM_025244chr2179 ------
NM_025251chr81174 ------
NM_025263chr63631 513 325 ------
NM_030625chr1021672 194 1691 ----
NM_030627chr512793 ------
NM_030647chr7152 ----1672
NM_030648chr424435 975 --15498 --
NM_030661chr731222 1167 672 ------
NM_030664chr1032398 2227 2054 ------
NM_030674chr1254822 4057 3921 3831 1548 ------
NM_030759chr101182 --1660 --
NM_030791chr141146 11303 ----
NM_030796chr742146 1812 810 329 ------
NM_030799chr512058 ------
NM_030808chr171881 ------
NM_030912chr102958 891 ------
NM_030949chr6--11445 ----
NM_030963chr6191 ------
NM_031266chr51115 ------
NM_031365chr222544 46 ----1963
NM_031366chr222544 46 ----1963
NM_031418chr1112581 ------
NM_031426chr912762 ------
NM_031461chr81379 ------
NM_031468chr776340 6165 2194 1050 566 48 42 ------
NM_031469chr623352 763 ------
NM_031483chr20----1528 --
NM_031845chr21643 ------
NM_031847chr21643 ------
NM_031908chr51985 ------
NM_031935chr11968 ------
NM_031992chr71141 ------
NM_032052chr22----1205 --
NM_032088chr5--11382 ----
NM_032092chr5--11382 ----
NM_032116chr1331981 1858 281 15870 ----
NM_032124chr1821067 133 --1415 --
NM_032139chr19----1268 --
NM_032153chr331745 846 802 --3576 441 116 --
NM_032186chr111170 ------
NM_032189chr1313107 --14839 --
NM_032199chr10----13204 --
NM_032228chr112961 505 ------
NM_032233chr14----1758 --
NM_032236chr1----1704 --
NM_032288chr322255 1973 ------
NM_032299chr11----190 --
NM_032352chr141969 ------
NM_032373chr1021991 877 11059 ----
NM_032403chr5--11382 ----
NM_032440chr101153 ------
NM_032445chr1522409 1684 ------
NM_032446chr5--11018 ----
NM_032451chr162177 75 ------
NM_032457chr411306 ------
NM_032458chrX11184 12849 ----
NM_032482chr1932681 737 717 ------
NM_032505chr3123 --12341 --
NM_032521chr2042540 1294 1163 931 ------
NM_032523chr21155 ------
NM_032560chr14--1888 ----
NM_032594chr141350 ------
NM_032632chr1411461 1692 ----
NM_032682chr323421 231 ------
NM_032711chr1722674 542 --13205 --
NM_032727chr1021312 276 11192 ----
NM_032731chr171275 --11507 --
NM_032741chr61212 ------
NM_032804chr1022397 439 12423 ----
NM_032812chr101312 ------
NM_032829chr1241087 379 363 40 ------
NM_032837chr1712165 ------
NM_032859chr1313584 23739 769 ----
NM_032867chr11----1592 --
NM_032869chr811776 ------
NM_032870chr6--1473 ----
NM_032926chrX1193 ------
NM_032961chr41357 ------
NM_032978chr181897 ------
NM_032979chr181897 ------
NM_032981chr181897 ------
NM_032995chr221294 598 ------
NM_033014chr911511 ------
NM_033020chr11329 ------
NM_033044chr11317 ------
NM_033138chr7--1703 ----
NM_033139chr7--1703 ----
NM_033140chr7--1703 ----
NM_033143chr424667 131 ----13404
NM_033157chr7--1703 ----
NM_033211chr511410 ------
NM_033224chr712456 --15224 --
NM_033228chr5--176 ----
NM_033278chr111121 ------
NM_033331chr91180 23411 2192 1305 --
NM_033360chr1212840 --1396 --
NM_033389chr1723681 2962 --1127 --
NM_033426chr14--12827 12090 --
NM_033631chr133870 3742 729 --13827 --
NM_033632chr42290 115 ------
NM_033642chrX11124 1201 ----
NM_052820chr91471 ------
NM_052834chr182307 148 ------
NM_052851chr1332206 274 71 1313 ----
NM_052874chr161704 ------
NM_052875chr111747 12031 ----
NM_052879chr12--21341 782 ----
NM_052885chr1214690 ------
NM_052898chr821470 274 ------
NM_052905chr211351 ------
NM_052918chr1033139 3004 355 ------
NM_053002chr311082 ------
NM_053006chr222111 55 ------
NM_053016chr935799 575 180 --26485 3140 12644
NM_053025chr341796 1650 1579 1312 ----11662
NM_053026chr341796 1650 1579 1312 ----11662
NM_053027chr341796 1650 1579 1312 ----11662
NM_053028chr341796 1650 1579 1312 ----11662
NM_053031chr341796 1650 1579 1312 ----11662
NM_053032chr341796 1650 1579 1312 ----11662
NM_053043chr7175 ----14571
NM_054025chr111331 ------
NM_057159chr91328 ------
NM_057178chr17--1761 ----
NM_057180chr121309 ------
NM_058172chr421117 86 ------
NM_058241chr22833 225 ------
NM_058241chr22833 225 ------
NM_078487chr942304 873 200 96 1613 1141 --
NM_080390chrX1150 ------
NM_080599chr1011053 ------
NM_080607chr20150 ------
NM_080616chr201604 ------
NM_080626chr12--1295 ----
NM_080632chrX--1745 ----
NM_080645chr611921 ----1304
NM_080671chr222138 1578 1244 ----
NM_080676chr201853 --22907 700 --
NM_080678chr21548 ------
NM_080797chr2043384 2267 2257 133 --11106 --
NM_080872chr823046 342 ------
NM_080874chr411603 ------
NM_130391chr942693 1276 866 334 11296 ----
NM_130392chr942693 1276 866 334 11296 ----
NM_130393chr942693 1276 866 334 11296 ----
NM_130436chr2122483 757 ------
NM_130438chr2123060 1334 ------
NM_130440chr1------11427
NM_130469chr141608 --2912 99 --
NM_130847chr1135164 3657 1165 25107 4602 ----
NM_133334chr414150 11543 140 --
NM_133369chr52905 660 ------
NM_133446chr10135 ------
NM_133462chr31356 ------
NM_133493chr623894 3651 --13636 --
NM_134442chr221517 439 ------
NM_138317chr142609 509 ------
NM_138318chr142609 509 ------
NM_138335chr41605 ----1345
NM_138340chr18----121 --
NM_138357chr10--11672 ----
NM_138375chr181924 ------
NM_138395chr21205 11041 ----
NM_138426chr721744 676 --11814 --
NM_138459chr6--23243 2565 ----
NM_138473chr1211563 ------
NM_138492chr5----11390 --
NM_138621chr214053 ------
NM_138713chr1626634 286 1708 ----
NM_138714chr1626634 286 1708 ----
NM_138727chr121723 895 ------
NM_138728chr121723 895 ------
NM_138730chr6--2322 299 ----
NM_138735chr21502 11276 ----
NM_138806chr31778 1704 ----
NM_138927chr211818 ------
NM_138931chr31386 ------
NM_138970chr1412294 ------
NM_138971chr111519 ------
NM_138971chr111519 ------
NM_138972chr111519 ------
NM_138972chr111519 ------
NM_138973chr111519 ------
NM_138973chr111519 ------
NM_139014chr64915 829 494 238 1846 ----
NM_139035chrX--141 ----
NM_139068chr51456 ------
NM_139069chr51456 ------
NM_139076chr41154 ------
NM_139078chr121133 ------
NM_139136chr121306 --11052 --
NM_139156chr11875 ------
NM_139168chr52452 231 ----11884
NM_139239chr19164 ------
NM_139278chr82177 147 ------
NM_139312chr1011141 --1960 --
NM_139321chr2014180 ------
NM_144570chr1632284 2103 394 --12916 --
NM_144571chr4--1156 ----
NM_144579chr232674 2314 224 ------
NM_144632chr221746 642 ------
NM_144636chr32707 103 ------
NM_144642chr31531 ------
NM_144664chr111271 ------
NM_144723chr51546 ------
NM_144963chr812018 ------
NM_144982chr121652 ------
NM_145011chr1032115 806 762 ------
NM_145055chr1823783 488 ------
NM_145206chr1013257 ------
NM_145233chr191294 ------
NM_145285chr101792 ------
NM_145320chr7----1386 --
NM_145321chr7----1386 --
NM_145322chr7----1386 --
NM_145686chr21799 ------
NM_145687chr21799 ------
NM_145690chr811468 ------
NM_145739chr21155 ------
NM_145759chr1--12122 ----
NM_145805chr151461 ------
NM_145808chr733007 2691 2039 ------
NM_145891chr1621700 621 ------
NM_145892chr1621700 621 ------
NM_145893chr1621822 743 ------
NM_147156chr101356 ------
NM_147175chrX22029 2007 ------
NM_147189chr811437 ------
NM_148174chr821834 1792 --1696 --
NM_148894chr41126 ------
NM_148921chr1742251 2071 2016 1591 1463 ----
NM_152253chr2222821 720 ------
NM_152265chr121473 221 ------
NM_152271chr81982 ------
NM_152300chr1711424 ------
NM_152371chr111431 --11595 --
NM_152380chr121416 1047 ------
NM_152390chr21478 ------
NM_152409chr51774 12918 ----
NM_152414chr811206 ------
NM_152418chr8181 ----11727
NM_152450chr151112 ------
NM_152519chr21808 ------
NM_152520chr21896 ------
NM_152553chr61200 ------
NM_152556chr712065 ------
NM_152588chr1211891 ------
NM_152589chr121252 ------
NM_152594chr1522276 184 ------
NM_152622chr522399 234 ------
NM_152624chr535941 2581 581 11903 ----
NM_152653chr32555 55 --1503 --
NM_152666chr11229 ------
NM_152699chr323264 318 ------
NM_152721chr18----1710 --
NM_152744chr733077 853 260 ------
NM_152758chr852776 2697 2140 715 164 ------
NM_152780chrX1906 ------
NM_152835chr11446 12013 ----
NM_152836chr8--1276 ----
NM_152837chr8--1276 ----
NM_152838chr2012629 ------
NM_152857chr6--1655 ----
NM_152858chr6--1655 ----
NM_152989chr1221201 597 ------
NM_153013chr512508 1408 ----
NM_153020chr621224 668 ------
NM_153038chr21741 ------
NM_153050chr2244782 3284 1760 1558 ------
NM_153051chr2244782 3284 1760 1558 ------
NM_153188chr545300 4510 4196 1534 --11491 --
NM_153261chr1611599 ------
NM_153331chr31656 ------
NM_153367chr102362 96 ------
NM_153449chr121347 ------
NM_153619chr1522525 2421 ------
NM_153631chr731222 1167 672 ------
NM_153632chr731222 1167 672 ------
NM_153685chr12121 ------
NM_153715chr71432 ------
NM_153748chr121306 --11052 --
NM_153756chr11165 ------
NM_153812chr1----11903 --
NM_153836chr21452 1622 ----
NM_170665chr1264516 4454 3923 3886 1495 1229 ------
NM_170712chr32275 99 ------
NM_170713chr32275 99 ------
NM_170714chr32275 99 ------
NM_170780chr31778 1704 ----
NM_172006chr20126 ------
NM_172070chr22832 309 11864 ----
NM_172071chr117266 ----16515
NM_172103chr632474 2306 917 ------
NM_172105chr632474 2306 917 ------
NM_172127chr421495 143 ------
NM_172128chr421451 99 ------
NM_172159chr311849 ------
NM_172160chr311849 ------
NM_172200chr10180 ------
NM_173079chr1731719 725 227 ------
NM_173083chr11321 ------
NM_173156chr11299 ------
NM_173172chr21229 ------
NM_173198chr91482 12382 ----
NM_173199chr9180 ------
NM_173200chr91482 12382 ----
NM_173214chr1626634 286 1708 ----
NM_173454chr151430 ------
NM_173463chr443691 3572 1708 33 --12852 --
NM_173468chr425379 409 15758 1481 --
NM_173476chr1622160 415 ------
NM_173491chr5141 ------
NM_173508chr1----11138 --
NM_173511chr221460 1030 ------
NM_173519chr81387 ------
NM_173531chr1923369 1428 12700 ----
NM_173552chr322395 1795 11803 ----
NM_173560chr61532 ------
NM_173576chr102591 347 ------
NM_173595chr1215272 --15123 --
NM_173618chr161139 ------
NM_173653chr311327 ------
NM_173683chr8----11337 --
NM_173797chr511300 ------
NM_173834chrX1390 ------
NM_174909chr51702 ------
NM_174921chr4----11069 --
NM_175061chr711907 ----11748
NM_175610chr15--1963 1332 --
NM_175624chr1222605 2174 --25379 2970 --
NM_175625chr1222605 2174 --25379 2970 --
NM_175630chr22861 795 1116 ----
NM_175748chr1412093 ------
NM_175863chr61263 ------
NM_176812chr20192 1743 ----
NM_176814chr71272 --11485 --
NM_176871chr842996 2596 690 558 ------
NM_177968chr2----21905 311 --
NM_177990chr20195 ------
NM_177996chr2022385 902 ------
NM_177999chr923689 739 ------
NM_178006chr1332206 274 71 1313 ----
NM_178007chr1332206 274 71 1313 ----
NM_178010chr1221201 597 ------
NM_178011chr1023052 916 1987 ----
NM_178140chr5----11895 --
NM_178441chr14----1316 --
NM_178468chr20125 ------
NM_178539chr12--21321 52 ----
NM_178554chr333564 2365 976 ------
NM_178812chr811201 ------
NM_178830chr19121 --1690 --
NM_181358chr123754 1162 ------
NM_181443chr2022755 2126 ------
NM_181481chr1836408 1694 805 15265 ----
NM_181482chr1836408 1694 805 15265 ----
NM_181483chr1836408 1694 805 15265 ----
NM_181492chr2211207 ------
NM_181504chr523042 2912 ------
NM_181523chr523042 2912 ------
NM_181524chr523042 2912 ------
NM_181552chr7------1349
NM_181598chr14----127 --
NM_181659chr2033025 2523 2496 ------
NM_181659chr2033025 2523 2496 ------
NM_181672chrX------1242
NM_181673chrX------1242
NM_181689chr204925 914 800 51 ------
NM_181698chr101532 ------
NM_181701chr92307 221 ------
NM_181702chr81127 ------
NM_181712chr11233 11942 ----
NM_181741chr211247 ------
NM_181742chr211247 ------
NM_181807chr111311 ------
NM_181825chr22175 ------
NM_181886chr411167 ------
NM_181887chr411167 ------
NM_181888chr411167 ------
NM_181889chr411167 ------
NM_181890chr411167 ------
NM_181891chr411167 ------
NM_181892chr411214 ------
NM_181893chr411167 ------
NM_182314chrX11855 ------
NM_182485chr4194 --145 --
NM_182488chr131338 ------
NM_182569chr171260 ------
NM_182646chr4194 --145 --
NM_182700chr731523 1350 343 ------
NM_182797chr2041303 1248 418 395 ------
NM_182898chr746556 5108 2497 1315 14242 ----
NM_182899chr746556 5108 2497 1315 14242 ----
NM_182910chr14--1610 ----
NM_182911chr2179 ------
NM_182913chr14--1610 ----
NM_182914chr14--1610 ----
NM_182920chr3----179 --
NM_182931chr7--1557 ----
NM_182970chr2033092 3029 1319 --13760 --
NM_182975chr1--11120 ----
NM_183004chr1463337 2462 1528 850 807 711 ------
NM_183227chr61537 ------
NM_183376chr1522440 2429 21723 436 ----
NM_183393chr3149 ------
NM_183394chr3149 ------
NM_183419chr821051 204 ------
NM_183422chr1311022 ------
NM_194247chr221660 757 ------
NM_194278chr1433122 1638 982 1327 ----
NM_194282chr432762 2050 51 --11086 --
NM_194317chr222386 2271 ------
NM_194328chr92873 417 --1645 --
NM_194329chr92873 417 --1645 --
NM_194330chr92873 417 --1645 --
NM_194332chr92873 417 --1645 --
NM_194356chr1231592 442 25 ------
NM_194434chr1833768 3543 1412 ------
NM_194449chr181636 ------
NM_198056chr31890 --11559 --
NM_198120chr8--1379 ----
NM_198181chr1512065 ------
NM_198195chr31547 ------
NM_198225chr101143 ------
NM_198268chr123754 1162 ------
NM_198269chr123754 1162 ------
NM_198270chrX13130 ------
NM_198273chr532902 714 40 22978 799 ----
NM_198291chr2011518 ------
NM_198391chr2011287 ------
NM_198503chr1----1350 --
NM_198513chr81615 ------
NM_198595chr431557 1117 517 ------
NM_198715chr145652 5241 4362 3865 15541 11194 --
NM_198718chr11312 ------
NM_198896chr11----1658 --
NM_198902chr15------1542
NM_198903chr51580 ------
NM_198904chr51580 12017 ----
NM_198956chr731523 1350 343 ------
NM_198965chr121409 ------
NM_198966chr121409 ------
NM_199051chr11291 ------
NM_199169chr2063505 2771 2434 2300 1389 94 --12700 --
NM_199170chr2063505 2771 2434 2300 1389 94 --12700 --
NM_199171chr2063505 2771 2434 2300 1389 94 --12700 --
NM_199188chr12--21341 782 ----
NM_199190chr12--21341 782 ----
NM_199262chr1741609 1588 133 105 ------
NM_199320chr412500 1945 12762 --
NM_199320chr412500 1945 12762 --
NM_199324chr412954 23760 1304 13363 --
NM_199334chr171469 ------
NM_199454chr154534 4392 4043 1823 720 ------
NM_199461chr101329 ------
NM_201269chr111170 ------
NM_201274chr17156 ------
NM_201413chr211279 ------
NM_201414chr211279 ------
NM_201568chr11299 ------
NM_201569chr11299 ------
NM_201591chr41568 ------
NM_201592chr41568 ------
NM_203301chr1411306 ------
NM_203327chr2023710 880 --11674 --
NM_203349chr152837 114 ------
NM_203350chr1142 --1111 --
NM_203351chr1712501 ------
NM_203394chr121177 ------
NM_203404chr11875 ------
NM_203434chr92388 377 11211 ----
NM_203437chr21896 ------
NM_203447chr91240 ------
NM_203459chr112163 ------
NM_203499chr171878 ------
NM_205846chr5----11390 --
NM_206594chr112329 ----11135
NM_206595chr112329 ----11135
NM_206819chr12167 ------
NM_206820chr12167 ------
NM_206821chr12167 ------
NM_206852chr141258 ------
NM_206853chr623964 1331 ------
NM_206854chr635225 553 325 ------
NM_206855chr636190 1518 1290 ------
NM_206857chr141258 ------
NM_206860chr10--1359 ----
NM_206861chr10--1359 ----
NM_206862chr10--1359 ----
NM_206907chr5--11120 ----
NM_206909chr856633 3268 2528 2470 1162 --1114 --
NM_207043chr111689 ------
NM_207044chr111689 ------
NM_207047chr111689 ------
NM_207299chr91251 ------
NM_207303chr1034092 2991 1094 ------
NM_207361chr1323882 385 ------
NM_207396chr12452 149 ------
NM_207481chr21336 ------
NM_207517chr1531763 1483 302 ------
NM_207645chr1121292 281 ------
NM_212460chr71644 ------
NM_212535chr16189 ------
NM_213589chr23699 418 151 1679 11047 --