TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4787-5p
miRNA Sequence: GCGGGGGUGGCGGCGGCAUCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1291881 1570 931 431 364 263 241 182 138 --21589 274 1966
NM_000029chr13228 108 45 --1455 --
NM_000037chr8152484 2238 2227 2170 2063 1783 1765 1668 1626 1612 1569 867 567 549 219 21969 591 11850 163
NM_000068chr1912967 630 577 528 426 417 228 147 116 91 82 25 ------
NM_000080chr173363 268 96 ------
NM_000084chrX106599 5007 4540 1821 1814 1556 1453 1207 1093 925 ------
NM_000088chr17101246 1210 1184 1123 949 525 497 491 379 87 ------
NM_000092chr293471 2969 2823 1705 1228 986 847 201 102 ------
NM_000125chr673949 3336 3130 1452 625 486 52 13585 ----
NM_000135chr162844 34 3831 715 265 ----
NM_000138chr1522454 922 --1846 --
NM_000163chr531590 720 619 ------
NM_000165chr63532 313 302 ------
NM_000167chrX31858 262 134 ------
NM_000168chr773239 2803 2621 2196 2152 282 243 ------
NM_000176chr543515 3268 411 405 ------
NM_000189chr251850 392 281 93 72 ------
NM_000192chr123989 298 254 ------
NM_000202chrX63935 2691 2495 2479 2425 1539 12770 ----
NM_000208chr1974640 3301 1400 1067 835 748 298 14271 11574 --
NM_000245chr731675 603 597 1621 1656 --
NM_000259chr1545016 4259 2424 404 --13861 --
NM_000260chr112492 209 --174 --
NM_000264chr962067 1211 1097 1083 53 46 12118 ----
NM_000267chr1743483 2859 2666 59 22938 2593 ----
NM_000278chr10112206 2009 1787 1775 785 585 256 232 211 110 59 1172 1147 --
NM_000284chrX51753 1460 793 671 285 ------
NM_000304chr172877 410 ------
NM_000330chrX51991 1510 736 656 64 1236 ----
NM_000332chr655874 5400 2322 913 789 --2325 250 --
NM_000333chr331124 111 60 ------
NM_000361chr205661 465 117 106 55 ------
NM_000389chr6101283 1022 975 598 530 415 359 291 148 123 ------
NM_000391chr1181597 1123 616 473 259 160 93 34 ----11249
NM_000435chr197996 989 715 645 243 215 119 --145 --
NM_000442chr173517 354 223 --11273 --
NM_000445chr871003 882 831 790 297 232 214 --1871 --
NM_000461chr363354 3030 2893 1220 849 378 ------
NM_000500chr67439 414 317 168 77 64 53 ------
NM_000522chr71263 3993 840 141 ----
NM_000530chr161100 772 407 303 282 203 2852 817 2373 253 --
NM_000544chr6_cox_hap173105 2570 2405 2249 1148 696 669 11251 ----
NM_000554chr1953007 838 832 526 158 22219 561 --1976
NM_000555chrX127660 7646 7595 6984 5839 5000 4852 2763 2689 2154 1954 1125 15035 22581 1743 --
NM_000572chr13852 408 152 ------
NM_000597chr22213 30 --1294 --
NM_000599chr2154477 4082 3612 3562 3515 3289 3195 3162 2874 1328 1276 553 217 41 31 ----1600
NM_000609chr10112855 2613 2556 2379 2346 2315 1982 891 618 497 85 ------
NM_000612chr11283701 3663 3633 3555 3315 3198 3186 3174 2905 2893 2631 2529 2453 2415 2328 821 815 699 505 498 341 316 282 272 256 176 136 112 1152 23597 876 --
NM_000616chr12101374 1273 1203 1193 1141 1089 961 484 269 91 11443 11434 --
NM_000618chr1276349 5379 5373 5166 4176 2382 496 ------
NM_000618chr1276349 5379 5373 5166 4176 2382 496 ------
NM_000633chr1853585 3201 3181 833 825 --11461 --
NM_000635chr1951401 1007 599 288 136 ------
NM_000682chr2111822 1786 1409 1360 1248 756 658 227 216 137 87 --11443 1738
NM_000719chr12196456 6448 6438 6415 6355 6193 5883 5764 5656 5332 5238 4825 4698 4301 2111 836 611 285 165 1585 --16571
NM_000723chr17111345 1315 1225 1205 1048 689 682 612 605 286 167 ------
NM_000725chr1281001 942 314 204 189 181 118 109 --1249 --
NM_000757chr15843 328 317 295 75 --1612 --
NM_000767chr1961562 1452 955 301 78 51 --1308 --
NM_000795chr1151052 270 230 171 40 --11128 --
NM_000806chr52553 325 --1152 --
NM_000814chr1553928 3381 3139 1672 394 13257 ----
NM_000831chr1216042 6035 5965 5883 5571 5536 5403 5292 5240 5198 5005 4933 4115 3890 3837 1621 986 582 572 82 76 1798 13898 --
NM_000832chr912875 869 835 801 776 728 721 649 639 554 162 120 ------
NM_000836chr199841 723 623 385 367 346 325 144 27 --3758 642 313 --
NM_000837chr85421 403 210 140 59 ------
NM_000870chr561305 1001 599 509 421 232 140 --11331
NM_000872chr1021372 1083 ------
NM_000875chr15155965 5866 4777 2159 2044 1934 1926 1718 1472 1333 983 974 878 866 722 ------
NM_000899chr1224173 3399 ------
NM_000918chr173324 146 36 173 2735 168 --
NM_000924chr1251152 472 424 365 355 11025 21362 1340 --
NM_000957chr13491 214 174 ------
NM_000964chr17201339 1310 1279 1224 1200 1193 1084 1073 1045 1008 974 464 415 409 304 251 106 93 36 29 --31272 1217 1052 --
NM_000965chr311030 --1309 --
NM_000966chr1210946 926 918 879 768 708 193 169 112 21 ------
NM_001001323chr123249 168 103 ------
NM_001001331chr342517 1872 902 323 ------
NM_001001395chr1232710 825 629 12540 --12624
NM_001001523chr141258 916 70 50 11264 ----
NM_001001664chr242854 1211 1201 501 ------
NM_001001890chr2184082 3913 2899 1434 972 758 225 51 ------
NM_001001924chr841871 1831 1428 189 ------
NM_001001925chr841871 1831 1428 189 ------
NM_001001931chr841871 1831 1428 189 ------
NM_001002006chr22601 162 ------
NM_001002838chrX41788 667 465 349 ------
NM_001003713chr73113 53 22 ------
NM_001003760chr623447 857 ------
NM_001003810chr42692 25 ------
NM_001003940chr15163705 3580 3151 3034 3024 3013 2609 2602 2587 2374 1041 1000 898 659 619 401 12576 ----
NM_001003942chr15163705 3580 3151 3034 3024 3013 2609 2602 2587 2374 1041 1000 898 659 619 401 12576 ----
NM_001003943chr15163709 3584 3155 3038 3028 3017 2613 2606 2591 2378 1045 1004 902 663 623 405 12580 ----
NM_001004106chr55802 785 315 156 142 ------
NM_001004127chr135829 785 760 694 293 ------
NM_001004317chr643497 3240 1644 351 1572 ----
NM_001004342chr1165806 5431 5319 4618 4583 4494 4150 4098 3841 2360 2178 1673 1449 1148 438 260 ------
NM_001004419chr1244035 3697 1783 1017 1619 ----
NM_001004439chr1591293 1158 938 528 507 478 345 249 227 1133 11113 --
NM_001004720chr251041 426 296 79 29 ------
NM_001004722chr241210 465 248 198 ------
NM_001005271chr1791120 1035 987 851 716 184 127 100 52 141 ----
NM_001005273chr1791120 1035 987 851 716 184 127 100 52 141 ----
NM_001005404chr1742899 2847 1332 980 13200 ----
NM_001005415chr19------2441 398
NM_001005416chr19------2441 398
NM_001005417chr17503 437 286 239 226 136 89 ------
NM_001005463chr1022011 1877 ----11893
NM_001005505chr3101612 1590 1138 1124 537 498 77 62 29 23 ----1215
NM_001005609chrX83850 3387 3291 2674 1378 1020 800 59 ----11448
NM_001005611chrX3196 160 149 1540 ----
NM_001005920chr165911 819 356 275 109 --1974 --
NM_001006115chr362687 2605 2349 717 266 27 12276 ----
NM_001006617chr941328 250 161 110 11032 ----
NM_001006619chr941328 250 161 110 11032 ----
NM_001006620chr941328 250 161 110 11032 ----
NM_001006621chr941328 250 161 110 11032 ----
NM_001006932chr6142815 2708 2582 2529 2480 2184 1352 1176 801 759 742 206 124 30 --12590 1376
NM_001007026chr125535 411 125 60 54 1392 1381 --
NM_001007098chr12752 276 ------
NM_001007246chr2121918 746 ------
NM_001007271chr104853 303 184 25 --1337 --
NM_001008220chr5223861 3780 3767 3643 3484 3410 3033 2626 879 863 840 785 736 712 622 600 587 413 402 292 200 165 23874 3573 13531 --
NM_001008222chrX51243 1028 936 926 291 11019 ----
NM_001008407chr74677 661 498 169 ------
NM_001008408chr7106254 6057 5629 4629 4065 1347 993 721 656 83 --22532 1691 --
NM_001008701chr19142944 2749 2698 2647 2603 2028 1191 1086 1078 731 719 684 655 406 12415 ----
NM_001008738chr542926 2056 1921 949 --11885 --
NM_001009184chr85421 403 210 140 59 ------
NM_001009566chr171088 378 318 296 176 167 117 ------
NM_001009571chr741652 1606 1341 674 ------
NM_001009813chr195398 127 98 41 29 ------
NM_001009899chr344563 2274 2263 1415 12097 --15855
NM_001009960chr722497 161 ------
NM_001010891chr565627 5548 5374 5335 2585 1791 --15163 --
NM_001010895chr92637 375 ------
NM_001010898chr1173707 3384 3371 3353 2936 2792 2514 2449 2408 1040 1005 953 818 661 340 246 140 13027 13235 --
NM_001010924chr104807 776 335 211 ------
NM_001011658chrX2669 663 1704 1333 --
NM_001012264chr147932 794 643 389 224 218 207 1817 ----
NM_001012329chr1102211 2128 2096 1930 1715 1661 1550 700 100 86 1832 ----
NM_001012393chr113983 609 484 ----14646
NM_001012426chr6243354 2873 2510 2483 2392 1370 1303 1237 1184 966 935 904 718 683 643 564 548 434 393 377 256 244 189 38 22385 88 32499 690 205 12769
NM_001012427chr6243354 2873 2510 2483 2392 1370 1303 1237 1184 966 935 904 718 683 643 564 548 434 393 377 256 244 189 38 22385 88 32499 690 205 12769
NM_001012643chr197550 377 370 187 178 127 33 ------
NM_001012755chrX84617 4410 3571 1580 1405 1270 1264 357 11305 ----
NM_001012977chrX121150 989 917 510 430 419 220 211 161 84 72 65 ------
NM_001013415chr4261 47 ------
NM_001013615chr151182 887 789 468 301 ------
NM_001013620chr1236381 2911 2905 12946 11566 --
NM_001013690chr12132403 2225 1932 1811 1721 1672 900 652 499 355 54 45 39 --32018 1916 434 --
NM_001013693chr192645 2619 2492 2370 2162 961 889 200 30 22634 442 ----
NM_001013693chr192645 2619 2492 2370 2162 961 889 200 30 22634 442 ----
NM_001013839chr17122198 2021 1593 941 656 644 622 461 385 211 150 128 12235 ----
NM_001014797chr1082514 2335 2230 1806 1461 1057 789 135 11635 ----
NM_001014809chr43891 801 763 ------
NM_001014831chr199674 591 580 573 536 235 229 123 35 --2785 48 --
NM_001014832chr199674 591 580 573 536 235 229 123 35 --2785 48 --
NM_001014834chr199674 591 580 573 536 235 229 123 35 --2785 48 --
NM_001014835chr199674 591 580 573 536 235 229 123 35 --2785 48 --
NM_001014839chr111886 775 433 409 319 271 242 199 162 87 75 --1893 --
NM_001014841chr111886 775 433 409 319 271 242 199 162 87 75 --1893 --
NM_001015877chrX22140 656 ------
NM_001017368chr1772319 2201 1859 1728 1721 356 333 ----1147
NM_001017395chr383085 2446 2248 1320 1095 1047 628 32 ------
NM_001017440chr7207837 6919 5984 5598 3260 3217 3208 3138 3128 3030 3016 2837 2664 2544 2246 593 530 441 389 383 ----12166
NM_001017930chrX2992 125 ------
NM_001017979chr41120 ----1755
NM_001017999chr141435 543 476 187 ------
NM_001017999chr141435 543 476 187 ------
NM_001018000chr141435 543 476 187 ------
NM_001018000chr141435 543 476 187 ------
NM_001018001chr141435 543 476 187 ------
NM_001018037chr91421 --11319 --
NM_001018050chr22123425 3224 2751 2560 2520 2485 2365 2348 2307 2108 1093 509 11026 ----
NM_001018052chr22123425 3224 2751 2560 2520 2485 2365 2348 2307 2108 1093 509 11026 ----
NM_001018054chr12980 479 ------
NM_001018065chr9115716 4608 3886 2321 2120 2008 1691 757 576 521 204 --13930 --
NM_001018066chr9115716 4608 3886 2321 2120 2008 1691 757 576 521 204 --13930 --
NM_001018074chr543515 3268 411 405 ------
NM_001018075chr543515 3268 411 405 ------
NM_001018076chr543515 3268 411 405 ------
NM_001018077chr543515 3268 411 405 ------
NM_001018108chr1572035 1763 1506 912 212 181 25 --1192 --
NM_001018111chr783231 1128 1065 880 689 607 592 129 ------
NM_001020658chr12448 127 ------
NM_001020658chr12448 127 ------
NM_001024094chr543515 3268 411 405 ------
NM_001024401chr16202592 2560 2532 2266 2175 1845 1803 1797 1071 916 861 779 706 532 470 443 408 351 184 152 ------
NM_001024455chrX122443 2407 2355 2069 1842 1763 998 565 343 311 57 49 --1795 --
NM_001024647chr1265729 5715 4908 4847 1967 429 25198 33 ----
NM_001024688chr821590 691 ------
NM_001024807chr193306 71 39 ------
NM_001024808chr1272651 2413 2395 1932 848 833 474 11041 --1874
NM_001024809chr17201339 1310 1279 1224 1200 1193 1084 1073 1045 1008 974 464 415 409 304 251 106 93 36 29 --31272 1217 1052 --
NM_001024858chr14162695 2659 2221 2100 999 978 957 915 714 505 442 347 312 195 183 124 --1905 --
NM_001024937chr173610 580 49 ----1152
NM_001024959chr34569 336 330 229 178 ----
NM_001024960chr34569 336 330 229 178 ----
NM_001025077chr1086482 6386 6092 1294 1166 1129 460 439 14883 ----
NM_001025081chr1891438 1000 625 485 320 262 250 103 77 21281 1081 ----
NM_001025090chr1891438 1000 625 485 320 262 250 103 77 21281 1081 ----
NM_001025092chr1891438 1000 625 485 320 262 250 103 77 21281 1081 ----
NM_001025101chr1891438 1000 625 485 320 262 250 103 77 21281 1081 ----
NM_001025109chr16969 349 321 308 74 47 ------
NM_001025205chr33180 39 27 --2379 303 --
NM_001025242chrX41292 1095 867 23 1335 ----
NM_001025243chrX41292 1095 867 23 1335 ----
NM_001025252chr842843 2367 653 477 ------
NM_001025253chr842843 2367 653 477 ------
NM_001025580chrX64093 3602 3442 3194 3153 1445 ------
NM_001025616chr431943 625 350 ------
NM_001029864chr2062463 1594 1011 375 306 163 1729 ----
NM_001029875chr542275 1859 141 63 ------
NM_001030006chr1782408 2251 1736 1042 944 863 297 212 1784 --32265 2142 1886
NM_001030007chr1643730 1235 1059 263 1304 ----
NM_001031680chr1132165 1938 975 948 637 520 470 456 449 286 225 201 22 22175 423 1429 1531
NM_001031690chr752137 1146 1064 64 32 --1955 --
NM_001031695chr2265087 4939 4606 4475 3470 35 ------
NM_001031740chr141176 629 179 38 ------
NM_001031804chr16123907 3593 3035 1773 1204 571 565 333 141 132 116 110 --1347 14401
NM_001032288chr2051307 623 615 405 390 --2585 518 11287
NM_001032289chrX5790 716 241 74 66 1177 1268 --
NM_001033044chr12408 202 11796 ----
NM_001033047chr431871 473 188 ------
NM_001033056chr12408 202 11796 ----
NM_001033059chr62457 407 ------
NM_001033081chr13620 606 59 ------
NM_001033082chr13620 606 59 ------
NM_001033117chr3154501 4480 4402 4283 4164 3473 1879 1566 1477 1342 843 781 735 664 293 --1788 1879
NM_001033551chr17144067 3822 3811 3743 3480 3391 3356 3250 2937 1278 1024 591 83 39 23780 3674 11330 --
NM_001033561chr174840 816 342 326 ------
NM_001034954chr1041189 1026 437 413 ------
NM_001034955chr1041189 1026 437 413 ------
NM_001034956chr1041189 1026 437 413 ------
NM_001034957chr1041189 1026 437 413 ------
NM_001035254chr992452 1792 1578 728 700 663 648 186 142 --2638 502 --
NM_001037290chr111311 ----1750
NM_001037332chr562115 1030 578 343 143 123 ------
NM_001037333chr562115 1030 578 343 143 123 ------
NM_001038707chr1101629 838 711 514 439 271 171 162 110 38 ------
NM_001038707chr1101629 838 711 514 439 271 171 162 110 38 ------
NM_001039348chr22998 671 ------
NM_001039349chr22998 671 ------
NM_001039350chr761285 1183 241 223 175 83 ------
NM_001039538chr231034 743 118 11377 ----
NM_001039570chr22114388 4238 4129 4037 3753 3533 3347 2943 1322 641 133 13937 24254 3340 --
NM_001039571chr22114388 4238 4129 4037 3753 3533 3347 2943 1322 641 133 13937 24254 3340 --
NM_001039577chr1124417 4345 4155 2839 2813 2772 2755 2738 1289 1212 877 678 13395 23129 3108 --
NM_001039711chr141047 921 745 166 --1103 --
NM_001039712chr141047 921 745 166 --1103 --
NM_001039771chr1491051 1028 936 819 387 316 216 206 95 138 ----
NM_001039877chr194843 659 250 75 1653 1805 1226
NM_001039937chr1321148 739 11104 ----
NM_001040002chr1751343 933 78 55 40 ------
NM_001040056chr167761 753 692 659 563 229 166 ------
NM_001040151chr11104362 3763 3565 3219 3005 1838 358 316 267 184 ------
NM_001040167chr741045 1010 437 36 ------
NM_001040172chr561305 1001 599 509 421 232 140 --11331
NM_001040173chr561305 1001 599 509 421 232 140 --11331
NM_001040214chr622033 204 ------
NM_001040284chr1623957 2165 ------
NM_001040402chr423132 865 ------
NM_001040424chr2172825 2673 2285 2032 933 920 144 ------
NM_001040429chr1333073 2243 377 ------
NM_001040439chr1691353 1328 1223 1211 1072 925 554 377 346 --2357 57 143
NM_001040446chr572586 2084 727 688 655 596 532 ----1933
NM_001040709chr162236 2086 1663 888 741 472 11636 155 --
NM_001042413chr963167 1158 1132 1110 818 511 ------
NM_001042476chr1661789 1781 775 704 662 406 --1669 --
NM_001042479chrX52017 1984 1678 549 410 ------
NM_001042480chrX52017 1984 1678 549 410 ------
NM_001042492chr1743483 2859 2666 59 22938 2593 ----
NM_001042494chr1583652 3342 2738 2436 2346 906 595 84 12628 22887 918 --
NM_001042495chr1583652 3342 2738 2436 2346 906 595 84 12628 22887 918 --
NM_001042496chr1583652 3342 2738 2436 2346 906 595 84 12628 22887 918 --
NM_001042497chr1583652 3342 2738 2436 2346 906 595 84 12628 22887 918 --
NM_001042498chrX6927 853 378 211 203 84 1314 1405 --
NM_001042506chrX131160 1152 989 917 510 430 419 220 211 161 84 72 65 ------
NM_001042510chr832130 1899 576 ------
NM_001042511chr832130 1899 576 ------
NM_001042539chr1651064 1057 1041 421 402 ------
NM_001042555chr1253934 3200 2981 1858 532 ------
NM_001042599chr286369 6309 5252 2984 2461 1955 862 56 25633 5545 ----
NM_001042603chr1245332 5113 4178 1365 --14395 --
NM_001042632chr20132543 2488 2319 2256 2179 1833 996 951 616 605 381 362 124 ------
NM_001042633chr20132543 2488 2319 2256 2179 1833 996 951 616 605 381 362 124 ------
NM_001042646chr361554 338 245 116 89 63 ------
NM_001042663chr171437 1334 1199 1074 339 302 222 1237 1367 --
NM_001042664chr171437 1334 1199 1074 339 302 222 1237 1367 --
NM_001042665chr171437 1334 1199 1074 339 302 222 1237 1367 --
NM_001042669chr431943 625 350 ------
NM_001042683chr621195 1185 11609 ----
NM_001042724chr197752 581 575 531 321 305 155 176 ----
NM_001042728chr1210946 926 918 879 768 708 193 169 112 21 ------
NM_001043318chr14123437 3410 3235 2536 1669 1454 1061 1035 821 730 280 249 --33458 2687 32 --
NM_001044385chr253715 3607 1334 879 412 ------
NM_001077628chr12461 182 --122 --
NM_001079874chr152089 1864 1508 1493 555 ------
NM_001092chr1762278 2223 2123 1567 213 92 ------
NM_001095chr12131855 1706 1661 1513 1351 1321 1275 1219 662 587 484 95 62 --11241 --
NM_001106chr379712 2818 1636 1204 1167 501 308 ------
NM_001116chr16112821 2353 2346 2335 1238 1121 1030 1023 914 593 100 ----22744 775
NM_001127chr226707 700 350 327 172 56 11019 2219 201 --
NM_001128chr1643730 1235 1059 263 1304 ----
NM_001131chr62325 134 --1332 --
NM_001148chr431411 432 104 ------
NM_001191chr20101407 1340 1153 568 493 321 190 60 36 28 ------
NM_001194chr1911652 644 626 614 476 458 426 220 210 176 165 ------
NM_001199chr85200 188 94 87 25 --1257 --
NM_001204chr237392 5283 106 --1117 --
NM_001222chr1041641 1257 167 152 11615 ----
NM_001232chr14950 863 324 137 ------
NM_001259chr756079 5461 4515 1513 1128 ------
NM_001273chr124417 92 74 23 ------
NM_001277chr115864 758 748 684 446 1920 ----
NM_001282chr1782408 2251 1736 1042 944 863 297 212 1784 --32265 2142 1886
NM_001284chr52549 21 ------
NM_001313chr43891 801 763 ------
NM_001319chr196885 724 384 354 314 72 2418 24 1165 --
NM_001329chr102610 390 ------
NM_001331chr1141103 1056 930 161 ------
NM_001347chr461228 1070 505 423 410 44 11422 ----
NM_001356chrX3252 243 237 ------
NM_001364chr1194345 4034 4005 3800 3623 3517 3342 1512 931 ------
NM_001383chr174597 572 295 32 --1247 --
NM_001387chr582928 2578 2569 2561 2541 2335 2227 220 12072 ----
NM_001396chr2142589 700 543 426 ------
NM_001397chr1132554 2503 2363 1720 1034 828 772 724 586 511 495 184 57 22293 732 12083 --
NM_001399chrX83850 3387 3291 2674 1378 1020 800 59 ----11448
NM_001406chr178579 551 474 214 195 128 107 98 11308 ----
NM_001408chr171488 1049 660 653 380 350 195 11105 1231 --
NM_001419chr19113602 3589 3488 3056 3036 1858 1738 1715 1078 836 512 13846 13667 --
NM_001420chr19242937 2832 2808 2751 2743 2719 2707 2586 2559 2551 2532 1216 1184 1170 1161 509 458 394 332 326 228 208 33 27 --1496 2350 340
NM_001421chrX81691 1666 1612 1412 1233 1123 129 87 1612 ----
NM_001427chr742071 714 699 293 --12078 --
NM_001429chr2231000 920 318 ------
NM_001431chr6------147
NM_001447chr541224 536 327 156 --1276 --
NM_001453chr63444 361 219 ----1111
NM_001454chr175936 911 862 383 59 --1372 --
NM_001455chr661703 1673 323 299 282 40 ------
NM_001478chr124967 790 247 176 ------
NM_001493chrX6772 743 306 291 238 22 ------
NM_001543chr5194342 4123 3706 3458 3215 1876 1780 1578 912 903 808 710 698 578 539 525 490 346 212 13035 ----
NM_001569chrX41292 1095 867 23 1335 ----
NM_001610chr113579 54 30 ------
NM_001616chr263523 3512 3449 2983 2519 576 ------
NM_001619chr11101024 1009 1001 980 933 841 414 356 259 135 1271 1867 --
NM_001634chr62457 407 ------
NM_001635chr74927 789 402 270 ------
NM_001642chr113908 902 119 --1877 --
NM_001655chr1151770 298 284 158 104 1474 1435 1149
NM_001659chr12102499 2282 1681 1658 669 412 387 284 148 75 --12572 140
NM_001663chr1422194 22 ------
NM_001665chr118574 553 526 411 389 194 104 30 ------
NM_001668chr12150 127 1627 --1116
NM_001678chr17101741 1643 1477 1347 1322 667 598 443 414 368 21331 322 ----
NM_001683chr342517 1872 902 323 ------
NM_001693chr83938 338 190 ------
NM_001707chr74768 756 627 278 1200 ----
NM_001709chr1132383 1974 773 ------
NM_001716chr1191239 1132 1045 629 565 405 295 267 152 --21550 1275 --
NM_001754chr2184082 3913 2899 1434 972 758 225 51 ------
NM_001759chr12104856 4381 3704 3434 2129 1154 1069 1054 383 115 ------
NM_001773chr171335 967 440 413 315 69 45 2251 52 192 --
NM_001789chr36650 214 152 143 56 46 ------
NM_001821chr143509 1432 970 35 ------
NM_001845chr133525 484 383 ------
NM_001858chr644204 3388 946 74 ------
NM_001859chr963324 3315 3052 1259 396 192 --1144 --
NM_001895chr2021171 51 11006 ----
NM_001918chr189062 7717 7021 6680 6479 5703 5641 3693 --16984 --
NM_001927chr26700 680 489 459 145 126 --141 1560
NM_001936chr761285 1183 241 223 175 83 ------
NM_001940chr125535 411 125 60 54 1392 1381 --
NM_001949chr661248 1154 733 724 608 321 ------
NM_001950chr167651 622 604 314 209 155 82 ------
NM_001954chr64820 583 276 232 1100 ----
NM_001970chr178561 531 486 456 401 171 149 58 2597 65 ----
NM_001975chr122876 822 295 85 ----
NM_001978chr87896 879 853 809 148 59 29 --138 --
NM_002015chr1362360 2235 2194 2120 138 93 ------
NM_002023chr151592 1216 642 119 36 --1657 --
NM_002025chrX108839 7581 7101 6483 3725 3655 3056 1728 1400 410 --16405 17855
NM_002028chr1421311 359 1402 ----
NM_002035chr1853002 1379 1283 337 170 11294 ----
NM_002045chr3365 34 28 ------
NM_002048chr94255 228 221 161 21073 187 150 --
NM_002065chr12408 202 11796 ----
NM_002072chr93814 390 375 ------
NM_002074chr151658 1606 1483 1471 110 ------
NM_002080chr163832 716 225 ------
NM_002082chr55765 748 278 119 105 ----1398
NM_002086chr1772027 1848 1808 1700 1413 543 132 21946 1604 11437 --
NM_002088chr198519 489 462 394 346 186 146 79 ------
NM_002092chr464814 4728 4611 4605 4237 3257 14646 13546 --
NM_002103chr198998 970 824 355 245 147 120 22 --182 --
NM_002126chr1783780 3506 3494 3060 2779 1012 319 125 ------
NM_002128chr1352126 2080 911 845 51 ------
NM_002131chr6131247 1239 1079 924 903 532 434 327 242 219 129 87 81 ------
NM_002135chr124409 210 85 74 ------
NM_002138chr42692 25 ------
NM_002145chr172144 78 --133 --
NM_002204chr1761293 1199 556 209 120 21 --11272 --
NM_002221chr1102883 2844 2791 2338 869 610 372 324 102 25 --22928 2300 --
NM_002222chr31517 1400 ----
NM_002230chr17111005 956 866 859 727 690 431 299 87 59 25 1283 2901 289 --
NM_002232chr15970 961 846 224 51 ------
NM_002247chr1052079 1837 1831 1737 93 ------
NM_002251chr2092170 1768 884 818 532 345 291 54 21 ------
NM_002254chr2101962 1858 1819 1702 937 840 513 399 321 228 2802 433 ----
NM_002264chr343369 1935 892 614 11645 1172 --
NM_002293chr14492 376 351 95 --12498 --
NM_002333chr1981264 1076 1053 963 500 491 434 103 1815 ----
NM_002336chr1235022 4300 4294 ------
NM_002356chr632457 1943 44 ------
NM_002359chr17114248 3832 3755 3680 3156 2835 2820 2788 2727 1414 248 23738 360 14187 1394
NM_002360chr7142422 2366 2179 1784 831 812 764 496 371 310 237 179 121 64 ------
NM_002361chr195296 227 218 55 33 --146 --
NM_002373chr1591358 1284 923 495 357 337 330 266 35 ------
NM_002374chr231034 743 118 11377 ----
NM_002375chr3101831 1586 649 349 339 220 206 167 57 35 --1896 --
NM_002383chr166887 880 864 295 244 225 1354 ----
NM_002385chr1891438 1000 625 485 320 262 250 103 77 21281 1081 ----
NM_002390chr1791638 1509 1489 1444 631 561 325 227 65 ------
NM_002401chr1772348 1977 1888 1882 1719 1677 200 --2801 295 --
NM_002404chr174875 840 698 34 176 1389 --
NM_002429chr1231298 262 243 ----140
NM_002430chr2251990 448 305 82 47 ----12176
NM_002442chr12211713 1342 1274 1180 1103 715 660 598 556 338 324 312 244 228 222 173 160 145 138 107 100 --1417 --
NM_002444chrX111755 1743 1506 1355 1327 1321 803 574 218 166 26 ------
NM_002473chr2291278 1267 517 439 399 329 212 194 126 ------
NM_002485chr821590 691 ------
NM_002501chr19294078 3729 3691 3682 3558 3530 3422 3221 3153 3062 3050 3003 2974 2940 1560 1457 1403 1225 1217 993 967 938 863 796 690 472 451 445 120 31207 632 361 63943 3672 3461 3019 713 204 13253
NM_002508chr191818 573 337 317 239 232 226 219 200 ----1261
NM_002515chr1441372 1362 1259 35 ------
NM_002522chr17133854 3696 2532 2400 1341 1165 987 972 841 674 172 117 34 22617 828 12499 --
NM_002545chr113983 609 484 ----14646
NM_002547chrX4630 619 264 214 23946 1005 ----
NM_002556chr1161980 1576 828 660 336 311 ------
NM_002558chr1741006 971 265 106 ------
NM_002569chr15111424 1415 1400 1303 1277 1266 1220 454 218 209 34 --2584 141 --
NM_002576chr1121096 313 --11141 --
NM_002578chrX3385 324 154 ------
NM_002586chr6111483 1436 1166 1094 998 532 517 507 351 296 127 --1524 --
NM_002588chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_002601chr23366 316 103 ------
NM_002608chr22121487 1460 1451 1339 1236 528 458 342 201 150 97 62 11153 1433 --
NM_002609chr591722 1670 1627 1332 1221 761 653 417 42 --11284 --
NM_002613chr16134672 4275 4054 4044 2138 1533 1517 1454 1368 625 442 261 251 ------
NM_002616chr174525 380 227 137 ------
NM_002634chr175837 728 638 608 219 --124 --
NM_002636chr66416 396 71 61 34 28 --1490 --
NM_002643chr2------1152
NM_002645chr1132941 924 903 ------
NM_002646chr151881 1480 1351 839 67 11513 ----
NM_002655chr834275 1061 565 ------
NM_002657chr20143204 2875 2644 2453 2447 2374 1578 1376 1038 1030 968 804 614 309 --33051 1383 546 --
NM_002698chr19142791 2455 2111 2036 1906 1122 1064 1024 1018 809 756 740 642 100 12967 1254 --
NM_002699chr191055 955 948 430 422 386 302 277 155 1287 1296 --
NM_002705chr163575 278 64 --1121 --
NM_002714chr65924 849 353 294 121 --134 --
NM_002730chr199868 400 388 257 220 212 203 133 122 --11241 --
NM_002739chr197597 471 296 130 85 70 40 ------
NM_002745chr2224402 4226 --21375 75 --
NM_002746chr167592 584 523 490 394 249 60 ------
NM_002776chr1971935 1856 1658 608 588 324 187 1739 ----
NM_002779chr103559 521 99 ----1189
NM_002827chr2091690 1394 1334 1170 1142 360 177 159 25 11443 ----
NM_002833chr1571429 1289 1266 1226 1114 326 310 1288 ----
NM_002837chr1224536 3297 --13128 --
NM_002847chr761320 1200 1005 636 122 32 --11604 --
NM_002850chr19111106 1061 974 967 397 351 195 165 84 68 57 1159 11222 --
NM_002855chr11263667 3549 3431 3277 3250 3079 2870 2703 2682 2281 2273 1496 1434 1280 961 831 721 710 460 440 353 201 78 71 60 51 --23464 1296 --
NM_002859chr12101455 1220 1193 668 578 197 162 122 45 25 1417 1178 --
NM_002868chr1282185 2010 1569 232 205 85 70 58 --1957 --
NM_002885chr181020 776 712 401 301 233 145 130 1900 1831 1325
NM_002886chr374147 3633 1639 1022 271 155 139 --23279 1032 --
NM_002918chr19121062 1039 800 785 721 713 705 459 351 280 39 30 ------
NM_002956chr124959 307 301 168 1283 ----
NM_002959chr184015 3958 3413 3157 3067 2722 1121 59 ----1932
NM_002996chr1681955 1650 1303 789 705 506 401 72 21493 750 ----
NM_003028chr9173774 3681 3347 3124 3015 2892 2871 2530 2477 1253 1019 753 419 231 225 219 61 --11029 --
NM_003029chr151375 940 555 413 397 ----1490
NM_003042chr341869 1611 1437 647 2420 40 1163 --
NM_003045chr13113430 1697 1617 1606 1297 692 367 200 114 75 49 24192 805 31322 1153 164 --
NM_003047chr1111264 1214 1181 1172 1082 1034 958 276 174 164 141 11164 ----
NM_003051chr151806 1292 1263 737 648 ------
NM_003053chr82697 609 1337 ----
NM_003074chr361921 1663 897 258 156 23 ------
NM_003075chr123316 84 33 ------
NM_003076chr12111408 1362 1356 1329 1316 1096 1075 1066 678 237 194 ----11201
NM_003099chr1554184 1469 1243 112 77 ------
NM_003107chr681941 1933 887 682 524 401 362 201 ------
NM_003108chr2127212 6178 5498 2919 2815 2777 2568 2274 2019 1864 1852 863 --12078 --
NM_003110chr177839 695 411 397 345 216 63 --2864 359 --
NM_003118chr521984 41 ------
NM_003131chr6132208 1923 1916 1707 1692 1575 1424 861 815 610 328 263 220 ------
NM_003139chr117813 782 760 684 253 216 150 ------
NM_003153chr1271059 930 851 213 204 116 47 ------
NM_003155chr882437 2316 2100 2001 296 277 243 121 1286 ----
NM_003156chr1191340 1329 1230 1163 869 390 242 212 148 ------
NM_003164chr113192 156 43 1144 --1494
NM_003165chr9101941 1695 1596 1508 1409 1391 1381 604 405 131 --31671 1483 710 --
NM_003168chr176923 805 779 659 101 39 ------
NM_003173chrX71391 1352 1339 1212 227 117 56 ------
NM_003178chr351764 1517 439 432 84 ------
NM_003179chrX121414 1374 1287 1234 1210 1194 278 225 189 95 74 62 1290 11131 --
NM_003200chr19102343 1973 1888 1862 1850 1831 1521 783 764 230 1237 21807 1786 --
NM_003202chr591721 1322 1256 604 589 158 148 106 37 1261 ----
NM_003246chr1531945 673 83 ------
NM_003255chr1792092 1791 1690 746 737 729 550 496 488 --11817 --
NM_003274chr2142812 1904 557 322 ------
NM_003281chr1195357 5117 4982 4476 4339 4096 3852 3825 3697 3676 3376 2073 2055 1316 1060 980 935 904 548 23950 658 11279 1634
NM_003286chr202432 81 ------
NM_003292chr122237 1849 ------
NM_003317chr145699 585 552 544 538 ------
NM_003319chr22977 403 ------
NM_003336chrX4183 158 149 64 ------
NM_003340chr421174 134 ------
NM_003342chr1722079 558 ----23032 779
NM_003349chr2051307 623 615 405 390 --2585 518 11287
NM_003363chr36632 602 557 461 451 46 ------
NM_003370chr197779 690 569 552 243 204 123 ------
NM_003371chr9132065 1981 1712 1588 1509 628 620 434 421 413 325 184 105 11425 ----
NM_003373chr1041752 1295 1256 240 1708 ----
NM_003378chr712437 408 295 184 164 158 131 125 82 58 33 23 ------
NM_003392chr363561 1738 1723 1050 790 510 ------
NM_003404chr2031623 697 45 --11968 --
NM_003407chr193436 276 120 1151 ----
NM_003445chr194796 325 208 181 ------
NM_003458chr3134006 3463 3205 2973 2539 1485 1479 1379 1030 965 776 608 329 1451 11501 --
NM_003466chr2122235 2174 1934 983 782 711 583 514 502 385 285 133 1935 12476 --
NM_003468chr251066 955 885 237 107 ------
NM_003482chr12202667 2657 2508 2499 2411 2399 2172 2044 2038 1727 1025 751 735 724 502 496 490 484 234 132 ------
NM_003485chr1441047 870 107 84 ------
NM_003498chr1682260 1988 834 823 636 627 348 180 11116 12130 --
NM_003557chr171365 1194 1139 512 363 310 232 ------
NM_003559chr17163881 3410 3273 3093 3037 2843 2730 2577 2492 2474 1488 1163 1005 906 824 414 1978 ----
NM_003566chr122766 223 --1808 --
NM_003575chr741472 1436 267 151 --1634 --
NM_003581chr251041 426 296 79 29 ------
NM_003586chr167582 574 542 515 228 190 97 ----1668
NM_003598chr195453 162 144 40 28 ------
NM_003607chr183922 3781 3273 3120 2843 279 273 172 ------
NM_003624chr1981290 1283 1164 1005 956 434 356 67 11329 1469 --
NM_003629chr142887 2863 804 287 --12652 --
NM_003631chr103958 178 33 ------
NM_003634chr2251028 954 797 217 22 ------
NM_003637chr141512 408 297 225 1630 ----
NM_003644chr17266483 6385 6325 6189 5976 5486 5376 5168 5094 4896 4158 3990 2635 2533 2517 2155 2141 2133 1762 1250 1037 958 949 764 90 83 26498 236 26504 5990 15337
NM_003671chr963233 3094 2711 2418 2307 1073 ------
NM_003714chr562637 2277 1973 1966 1032 348 --1174 --
NM_003735chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_003736chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_003737chr114395 389 152 144 --1383 --
NM_003741chr33253 135 129 2349 326 ----
NM_003743chr241631 1448 575 376 ------
NM_003745chr165274 167 142 136 85 ------
NM_003749chr1341846 522 508 370 ------
NM_003758chr153573 372 136 ------
NM_003758chr153573 372 136 ------
NM_003762chr121359 1224 ------
NM_003768chr16727 641 464 323 122 49 ------
NM_003769chr12------1234
NM_003780chr17503 437 286 239 226 136 89 ------
NM_003829chr93450 44 33 ------
NM_003872chr252752 2741 2232 949 194 ------
NM_003924chr43617 208 195 ------
NM_003936chr281098 762 752 483 315 262 59 27 142 ----
NM_003939chr1083805 3460 3353 3048 2743 2552 665 273 13993 ----
NM_003947chr33488 167 62 --1190 --
NM_003949chr17162058 1978 1888 1873 1620 1441 1354 1343 1306 1257 515 420 300 273 229 112 126 1286 --
NM_003955chr1751474 1206 608 497 58 ------
NM_003966chr587701 5800 5625 2497 2213 1252 1139 34 ------
NM_003987chr10112206 2009 1787 1775 785 585 256 232 211 110 59 1172 1147 --
NM_003988chr10132283 2086 1864 1852 862 662 333 309 288 187 136 45 29 1249 1224 --
NM_003994chr1224173 3399 ------
NM_004036chr23465 245 120 1273 ----
NM_004050chr1472560 2071 2036 866 755 615 604 ------
NM_004055chr1161890 1714 1616 733 375 354 11970 ----
NM_004068chr33180 39 27 --2379 303 --
NM_004077chr1291224 1058 939 869 858 850 493 281 199 --11310 --
NM_004090chr1752942 2719 2199 662 363 ----22554 379
NM_004093chr1342130 1293 546 418 ------
NM_004094chr1432941 2077 308 ------
NM_004097chr24575 347 89 58 ------
NM_004098chr101903 --1244 --
NM_004100chr642635 2618 2321 1000 ------
NM_004105chr22998 671 ------
NM_004113chr311633 --11984 --
NM_004133chr842210 2194 706 250 ------
NM_004170chr921746 125 ------
NM_004171chr1189347 9026 6895 6568 6204 6033 475 36 27774 2063 --17953
NM_004186chr34661 627 309 117 ------
NM_004187chrX51065 1037 445 203 39 31357 984 467 1405 21403 135
NM_004200chr11173210 3018 2569 2149 1223 1214 1110 1102 1081 980 803 771 461 383 309 182 88 1397 12943 --
NM_004227chr763035 2027 1982 821 149 69 ------
NM_004230chr19102363 2183 2082 1954 1663 1657 751 745 228 102 ------
NM_004272chr531731 343 232 ------
NM_004274chr1452980 2781 406 296 82 ------
NM_004283chr194802 642 633 29 1124 ----
NM_004287chr1742243 1981 1891 503 ------
NM_004295chr1741343 421 183 147 --186 --
NM_004302chr12102527 2508 2394 2115 2027 2018 1785 577 201 162 22779 2684 12385 --
NM_004305chr23128 43 23 149 ----
NM_004308chr11111661 1517 1421 747 735 669 653 562 534 294 83 1757 ----
NM_004309chr1771060 912 827 372 305 288 107 31151 841 161 21071 978 --
NM_004311chr1072892 2837 2743 2723 2315 2157 150 22490 2276 1685 --
NM_004313chr175374 352 178 156 64 ------
NM_004321chr2123397 3388 3286 3121 2550 2541 2355 1284 453 443 120 43 --13295 --
NM_004349chr82460 285 ------
NM_004350chr1132165 1938 975 948 637 520 470 456 449 286 225 201 22 22175 423 1429 1531
NM_004364chr1961280 1210 1118 830 400 37 ------
NM_004370chr621956 811 1771 ----
NM_004380chr1652199 2154 2112 1820 1804 ----12103
NM_004391chr3112083 1582 1554 1535 1339 1291 226 156 122 99 68 11941 11411 --
NM_004395chr56591 582 536 519 513 267 ------
NM_004397chr1123734 2881 ------
NM_004405chr25912 870 419 295 82 --1155 --
NM_004409chr194729 648 541 150 1623 1743 1737
NM_004420chr11132408 2384 2368 2321 1868 1816 975 909 855 761 439 418 296 --11824 --
NM_004423chr3152718 2339 2261 932 849 749 716 624 523 361 313 300 293 257 188 1873 1677 --
NM_004427chr141169 1012 792 150 2816 44 ----
NM_004429chrX121264 1221 1060 927 921 319 302 191 154 138 74 66 127 ----
NM_004430chr86935 791 211 149 45 21 1406 1353 --
NM_004433chr14654 471 427 194 ------
NM_004437chr153602 2786 567 449 293 --22775 1382 --
NM_004438chr242442 1013 898 648 ------
NM_004440chr621783 279 ------
NM_004442chr151679 1597 538 366 44 ------
NM_004454chr382242 2117 2035 2029 1876 1509 654 533 ------
NM_004458chrX42035 1901 1894 1883 ------
NM_004468chr16602 247 216 162 148 90 --1446 --
NM_004485chr1104110 3917 3801 2791 2740 1376 1212 640 634 49 11720 ----
NM_004494chr181179 1106 984 937 508 329 94 26 ------
NM_004500chr1421481 445 --11268 --
NM_004501chr143547 1505 1116 347 ------
NM_004503chr125792 258 165 41 23 ------
NM_004527chr1751343 933 78 55 40 ------
NM_004535chr2031719 594 48 11697 ----
NM_004583chr177606 538 527 521 317 36 26 --1615 --
NM_004588chr11103383 3230 3224 3214 1192 1097 661 628 463 26 14078 1854 1138
NM_004598chr582988 2412 1330 1175 959 588 489 336 --1918 --
NM_004602chr205528 368 341 284 91 --1318 --
NM_004603chr7101124 1047 970 956 913 160 154 125 119 112 --191 --
NM_004608chr1610340 334 291 162 156 129 90 75 67 38 ------
NM_004612chr923772 2963 11699 ----
NM_004630chr1151049 864 398 311 271 ------
NM_004631chr12980 479 ------
NM_004637chr341254 1005 466 435 --11026 --
NM_004642chr12167 ----1588
NM_004656chr331228 1218 1018 ------
NM_004697chr941055 193 150 121 ------
NM_004711chr22183575 3525 3512 3376 3330 3225 3205 2703 2256 1392 1168 960 850 811 683 673 63 22 11418 2865 829 --
NM_004719chr1242275 2028 665 202 ------
NM_004729chrX52002 1889 1610 1446 606 --133 --
NM_004730chr541669 1389 589 38 ------
NM_004734chr133789 434 63 276 34 --11313
NM_004745chr8186783 6010 5725 5425 4509 4377 2400 2196 1636 624 537 511 490 419 124 115 94 26 16249 ----
NM_004747chr1051482 526 409 391 143 ------
NM_004750chr194273 105 80 24 1129 1237 --
NM_004758chr17111161 1096 1089 881 866 825 309 257 107 89 70 --1979 --
NM_004759chr191974 1967 1848 1741 1505 1496 1489 568 481 --1372 --
NM_004762chr1761575 1568 761 340 63 56 ------
NM_004772chr52986 295 1348 ----
NM_004774chr1732863 2371 2233 12212 ----
NM_004804chr252775 560 550 167 33 168 ----
NM_004807chr2112398 2229 1773 1674 1071 1053 894 689 600 525 499 --11647 --
NM_004818chr124566 144 130 67 ------
NM_004822chr17163746 3259 3186 2875 1445 1286 1034 911 783 777 771 749 552 531 518 178 13114 1157 22826 836
NM_004836chr22617 365 ------
NM_004845chrX84120 3445 3206 3050 1658 1558 504 332 23682 3297 11001 --
NM_004857chr1443592 1721 1566 1016 ------
NM_004860chr176509 386 206 183 144 136 ------
NM_004884chr15101629 1467 1447 1124 624 563 507 400 241 170 11173 ----
NM_004889chr73113 53 22 ------
NM_004922chr103983 218 200 ------
NM_004924chr1941058 936 902 113 1193 --130
NM_004926chr149597 589 532 488 442 228 125 65 22 --2695 607 --
NM_004930chr15531 506 265 173 83 199 ----
NM_004936chr952286 2233 895 547 58 1201 1620 --
NM_004938chr95483 259 171 164 135 ----1917
NM_004943chr19141230 1219 1194 1074 1017 395 385 315 307 260 151 58 37 21 11027 11172 --
NM_004947chr342339 1679 789 129 ------
NM_004952chr111839 757 739 718 388 354 293 284 158 149 99 1684 ----
NM_004959chr9101488 1427 1405 1397 1376 1369 1268 1197 1126 278 21413 147 11355 --
NM_004976chr11285061 4860 4805 4720 4675 4641 4626 4511 4455 4390 4205 4177 4049 3913 3782 3751 3311 3292 3217 1891 1816 1739 1441 1315 1251 848 589 182 21992 1751 1496 --
NM_004977chr198587 551 534 466 409 396 68 21 ----1418
NM_004978chr171616 1530 1217 1164 1119 657 522 ------
NM_004992chrX268498 8087 8061 7929 7883 7789 6933 5911 5777 5282 5181 5173 3191 3090 2871 2816 2645 2544 2490 1819 1756 1502 455 446 328 321 17470 27314 393 --
NM_004992chrX268498 8087 8061 7929 7883 7789 6933 5911 5777 5282 5181 5173 3191 3090 2871 2816 2645 2544 2490 1819 1756 1502 455 446 328 321 17470 27314 393 --
NM_004995chr1451279 330 137 109 103 2384 211 ----
NM_005027chr19121104 979 958 912 389 336 311 272 247 217 145 35 ------
NM_005029chr105287 234 201 88 55 ----127
NM_005056chr1255576 5357 4422 1609 189 --14639 --
NM_005060chr141258 916 70 50 11264 ----
NM_005079chr842843 2367 653 477 ------
NM_005109chr372279 2135 1956 614 241 204 107 ------
NM_005121chr1743606 3327 1503 1461 ------
NM_005135chr1583652 3342 2738 2436 2346 906 595 84 12628 22887 918 --
NM_005155chr64626 595 169 117 1452 ----
NM_005156chr943525 1925 1687 170 ------
NM_005161chr11102189 2181 2013 1906 1654 1521 486 443 42 32 1119 ----
NM_005166chr193306 71 39 ------
NM_005169chr116416 228 192 131 116 33 ------
NM_005180chr10------139
NM_005184chr19111421 1339 1332 1319 1186 1178 1161 1088 288 224 78 ------
NM_005187chr1651641 1551 1430 1350 243 21335 86 ----
NM_005197chr1454941 4724 1704 508 163 ------
NM_005202chr1121602 1594 1421 779 735 725 621 549 441 433 318 77 ------
NM_005219chr571783 1624 1614 1401 1117 697 107 ------
NM_005220chr1791438 957 947 489 473 223 193 108 60 1187 --11139
NM_005229chrX51003 809 343 145 26 ------
NM_005235chr286369 6309 5252 2984 2461 1955 862 56 25633 5545 ----
NM_005242chr521120 148 ------
NM_005263chr141124 892 163 94 ----1861
NM_005276chr1261723 1408 1262 575 492 93 ------
NM_005276chr1261723 1408 1262 575 492 93 ------
NM_005312chr9102600 2334 2325 1694 1676 1049 954 898 714 321 ------
NM_005329chr164921 473 462 197 --12189 --
NM_005334chrX101423 1230 1162 673 577 499 250 73 40 21 --21718 107 --
NM_005336chr291921 1759 874 732 671 657 416 91 23 ------
NM_005339chr423681 613 14355 1623 --
NM_005342chrX32680 908 756 ------
NM_005354chr198256 238 229 207 199 149 106 33 2168 115 ----
NM_005374chr17112236 2127 1976 1837 1730 368 358 291 99 79 60 11584 1441 --
NM_005386chr205878 706 205 109 99 --1155 1270
NM_005397chr783231 1128 1065 880 689 607 592 129 ------
NM_005407chr1471298 1244 633 525 262 184 66 ------
NM_005410chr52748 24 ------
NM_005413chr23166 107 57 ------
NM_005430chr12131054 929 782 651 644 311 272 257 234 198 114 102 22 ------
NM_005436chr1041649 1506 741 413 ----13826
NM_005440chr17133229 3038 2944 2927 2664 2538 540 505 478 330 317 83 58 --21288 884 --
NM_005453chr64459 418 187 75 ----1469
NM_005458chr952425 1622 502 447 32 ------
NM_005465chr151545 1266 798 153 136 ------
NM_005479chr1011279 --1591 1993
NM_005497chr1755233 4782 2448 1862 1590 14951 ----
NM_005504chr1244711 4116 990 695 ------
NM_005523chr751477 375 349 324 314 --1247 1386
NM_005542chr741559 1204 1192 641 ------
NM_005569chr2251511 1181 1105 308 143 --1259 --
NM_005607chr84971 783 748 31 ------
NM_005634chrX5554 540 64 45 39 --152 --
NM_005652chr1651201 1004 988 431 174 2207 58 1167 --
NM_005668chr534120 994 777 ------
NM_005678chr157947 883 856 842 810 745 718 ------
NM_005704chr181009 905 840 825 740 418 237 103 ------
NM_005716chr199540 529 468 452 211 205 174 147 54 --1492 --
NM_005718chr34569 336 330 229 178 ----
NM_005725chr131506 841 168 12359 ----
NM_005736chr1091560 1533 1450 1369 1196 400 394 388 340 ------
NM_005737chr272742 2655 2080 997 578 237 230 ------
NM_005759chr234719 4137 3391 --1876 --
NM_005768chr123619 255 249 ------
NM_005779chr533360 3258 948 ------
NM_005789chr1751744 1482 1382 1344 702 --1719 --
NM_005814chr16584 567 522 286 218 51 ------
NM_005819chr132629 2323 392 1495 ----
NM_005822chr632220 707 57 ------
NM_005828chr1764569 1924 1312 1269 613 62 ------
NM_005840chrX117660 7532 6467 6021 2152 2029 1919 1749 1485 1243 458 --11323 --
NM_005845chr1341266 563 556 349 1465 ----
NM_005852chr1791120 1035 987 851 716 184 127 100 52 141 ----
NM_005880chr1621512 242 ------
NM_005884chr199674 591 580 573 536 235 229 123 35 --2785 48 --
NM_005895chr1273421 3382 3218 3148 2706 1301 834 --11289 --
NM_005898chr1113119 1380 ----
NM_005902chr1574557 4284 1862 1302 1278 363 297 ------
NM_005909chr544252 2700 1596 1589 ------
NM_005910chr17153934 3777 3184 2948 2769 1429 1383 1246 1202 1115 820 736 627 95 82 11512 11147 --
NM_005920chr1213670 3515 3416 3192 3084 2804 2423 2369 1247 1231 1195 1128 878 648 599 588 398 238 223 95 85 ----13266
NM_005933chr1183046 2802 2414 810 737 719 645 90 --1564 --
NM_005934chr19212365 2238 2127 2097 2046 1776 1769 1728 1695 1649 1622 783 507 480 428 324 302 224 172 77 24 21053 408 ----
NM_005935chr494607 3263 3256 2117 2105 1551 1278 1156 642 --3822 806 628 --
NM_005937chr17204069 4058 3922 3912 3579 3519 3131 2921 2870 1331 1230 1086 1075 918 898 493 272 196 182 26 23789 1052 23906 3405 --
NM_005938chrX41274 1042 250 26 11059 21325 354 --
NM_005943chr661566 1509 1405 1246 273 156 ------
NM_005955chr1105370 5191 4357 3893 2173 2085 2065 1927 1050 1035 11965 ----
NM_005957chr1143594 3563 3220 3169 1801 1274 1161 1034 864 561 469 360 283 119 33120 1809 325 23144 1490 --
NM_005967chr125603 534 458 294 58 --2221 74 --
NM_006007chr954138 3747 3716 2823 451 1214 ----
NM_006015chr16926 897 245 223 172 26 ------
NM_006030chr3101612 1590 1138 1124 537 498 77 62 29 23 ----1215
NM_006034chr11142436 1909 1849 1569 901 848 685 493 428 407 290 259 245 96 --11588 1573
NM_006038chr206552 545 533 512 364 257 --21391 350 --
NM_006039chr1711897 771 758 693 394 386 356 321 262 170 70 ------
NM_006040chr1641395 1213 1089 184 ----1560
NM_006054chr1121319 161 ----1515
NM_006077chr109849 642 203 164 158 112 49 33 25 ------
NM_006079chr65625 616 608 227 36 ------
NM_006091chr1591640 1288 625 575 487 369 279 207 165 --2403 126 --
NM_006094chr842386 2061 1932 535 ----1592
NM_006113chr152089 1864 1508 1493 555 ------
NM_006133chr11232333 2239 2228 2198 2103 2019 2012 1699 1648 1605 998 907 894 867 771 574 493 480 452 313 175 99 71 21592 402 21749 958 --
NM_006148chr17112874 2435 2303 2124 969 898 793 613 607 550 124 1683 ----
NM_006158chr81518 140 ----
NM_006160chr17101467 1240 1052 1041 527 520 293 81 62 47 --21599 1305 --
NM_006161chr53492 267 82 --1161 --
NM_006162chr1841514 1424 515 152 --1382 --
NM_006186chr241050 138 129 113 ------
NM_006190chr21973 21063 356 ----
NM_006194chr145832 452 298 87 54 ------
NM_006201chrX81090 1019 749 324 308 135 66 51 ------
NM_006202chr19151870 1688 1447 1381 1347 1303 1297 1278 792 776 577 387 167 67 47 159 ----
NM_006203chr535342 1936 181 12204 ----
NM_006206chr422901 2738 ------
NM_006224chr1792407 2153 2133 2082 1973 1548 814 267 68 1227 ----
NM_006226chr211202 --1222 --
NM_006237chr134739 709 589 83 ------
NM_006251chr54797 601 580 574 ------
NM_006268chr114854 845 471 294 124 ----
NM_006306chrX175946 4932 4696 4573 4532 4478 4471 4463 4056 1032 1017 726 640 582 260 91 73 ----21048 462
NM_006312chr122346 87 2365 110 1187 --
NM_006313chr1211637 --1525 --
NM_006320chr431030 998 52 ------
NM_006321chr362045 1438 794 415 238 52 ------
NM_006336chr961485 1353 1243 553 484 459 ------
NM_006361chr1771952 1937 1841 1747 1740 1298 425 ------
NM_006371chr395035 4796 4777 4621 3674 3458 3452 734 129 23478 333 1293 --
NM_006373chr1781260 379 360 317 272 260 159 149 1118 ----
NM_006380chr1754186 3529 1194 965 320 --23522 3008 --
NM_006389chr1161283 1271 1006 229 98 36 21094 907 1122 --
NM_006411chr610922 791 715 404 355 319 237 231 177 89 ------
NM_006420chr2033244 2306 983 ------
NM_006434chr1041189 1026 437 413 ------
NM_006449chr222124 1573 ------
NM_006454chr4123038 2882 2845 2753 2624 2411 2241 2152 1988 802 784 207 --32916 2665 2643 12041
NM_006458chr115388 289 260 153 147 --1269 --
NM_006460chr1741574 1174 296 123 ------
NM_006489chr1441372 1362 1259 35 ------
NM_006500chr114980 528 125 112 1259 ----
NM_006516chr131421 1332 1323 ----11486
NM_006517chrX51957 1917 1788 1754 311 --21618 251 --
NM_006521chrX91298 1280 1153 1074 915 294 265 84 21 --2288 147 --
NM_006526chr203745 619 51 ------
NM_006532chr195710 664 570 257 133 --21476 1446 --
NM_006534chr2052623 2428 1183 609 258 ------
NM_006538chr233441 2930 526 --1432 --
NM_006544chr1435255 4387 70 ------
NM_006546chr17236003 5910 5890 5536 5524 5349 5138 5064 4345 4238 4119 2668 2491 2343 2225 1921 1081 957 790 598 452 217 67 36282 4393 1137 25989 4741 --
NM_006557chr951313 1203 1146 496 266 ------
NM_006562chr104234 216 92 61 --1106 --
NM_006572chr1743521 3323 459 258 11262 ----
NM_006599chr1697477 7161 6813 6301 5732 5563 3159 1773 1767 ------
NM_006618chr131590 1052 22 ------
NM_006628chr1544646 4019 3224 1836 ------
NM_006640chr17141596 1586 1559 1305 1219 715 598 568 489 435 418 262 120 34 41857 285 194 162 3732 531 21 --
NM_006650chr5223861 3780 3767 3643 3484 3410 3033 2626 879 863 840 785 736 712 622 600 587 413 402 292 200 165 23874 3573 13531 --
NM_006651chr4131494 1301 1202 1058 952 527 516 503 182 173 93 57 33 170 1320 --
NM_006654chr1253934 3200 2981 1858 532 ------
NM_006675chr12163280 3257 3018 2907 2844 2818 2811 2333 2250 1231 993 852 465 312 215 110 12577 2289 99 --
NM_006698chr2041264 1127 370 267 ------
NM_006763chr141594 1545 1430 623 ----11975
NM_006772chr6231706 1679 1663 1563 1553 1434 1324 1237 1199 1076 586 510 459 431 372 350 344 299 278 234 194 184 145 2324 109 11427 --
NM_006775chr642066 1972 1965 811 ------
NM_006827chr1422571 792 --13294 --
NM_006833chr71346 1113 1122 --
NM_006841chr35717 638 587 526 63 --1599 --
NM_006843chr12--1347 148 1431
NM_006856chr1231068 223 74 --1289 --
NM_006861chr1281880 1291 575 520 373 223 214 156 ------
NM_006873chr233315 2255 1216 ------
NM_006885chr1663414 2866 1354 1111 727 327 ------
NM_006888chr1433009 2380 2260 13208 ----
NM_006889chr351521 1452 442 291 132 --1557 --
NM_006896chr771063 732 466 425 336 261 162 1241 ----
NM_006898chr25588 576 125 101 94 ------
NM_006913chr67433 422 379 346 94 85 26 ------
NM_006927chr16102073 1630 870 845 637 576 537 479 297 291 31462 829 731 ----
NM_006941chr2281058 989 849 830 323 289 38 25 ------
NM_006943chr20263222 3039 3030 2837 2658 2114 1337 1074 1001 984 527 512 479 380 351 304 277 234 199 193 164 136 116 102 74 30 2268 206 1489 --
NM_006946chr115498 402 225 36 28 --1238 --
NM_006950chrX8902 863 629 609 289 264 204 104 1869 1283 1144
NM_006987chr17101253 1169 1012 903 520 479 261 246 204 169 2411 229 ----
NM_006990chr182337 2148 1953 1859 1719 611 507 445 ------
NM_007005chr941003 382 133 73 --21064 80 --
NM_007030chr5134526 4313 4300 1797 1524 1042 1008 936 891 359 223 185 176 23411 1476 ----
NM_007033chr1142208 2129 1910 1902 1893 1869 1472 1459 1413 862 770 708 359 301 11631 ----
NM_007038chr2155795 1467 1010 424 232 ------
NM_007040chr19101103 398 347 303 297 257 241 78 33 23 ------
NM_007050chr20197666 7424 7159 7136 6092 5505 5151 5080 3126 2792 2769 1378 780 614 561 479 469 373 54 15942 1821 --
NM_007052chrX3509 396 122 ------
NM_007067chr1731077 386 124 --11039 --
NM_007084chr136616 443 436 428 88 76 ------
NM_007111chr132357 96 1291 ----
NM_007137chrX94936 4909 4903 4199 4106 4052 2177 1939 892 --14572 --
NM_007144chr17101270 1084 1061 1055 967 839 825 810 525 474 11213 ----
NM_007162chr66488 242 189 138 128 66 1582 ----
NM_007174chr1281851 1841 1766 1592 792 570 221 108 --1151 --
NM_007192chr141245 ----149
NM_007213chrX6541 482 188 147 107 47 --1520 --
NM_007245chr1610827 771 723 612 605 598 386 378 164 134 1339 ----
NM_007249chr1399406 9159 8856 8149 7033 2314 417 172 74 16864 ----
NM_007275chr37935 929 911 823 462 50 30 --2970 256 --
NM_007327chr9191190 1184 1150 1116 1091 1043 1036 964 954 869 752 477 435 322 297 200 119 35 28 ------
NM_007347chr151161 ----12453
NM_007353chr783023 2378 2248 2017 1864 1182 558 40 --1590 --
NM_007359chr1721483 1379 11133 1157 --
NM_007365chr192051 1593 1423 779 709 594 509 188 51 --22025 2008 --
NM_007375chr142518 1089 1080 377 ------
NM_012074chr1461113 969 775 169 138 38 ------
NM_012081chr543731 2273 620 207 ------
NM_012099chr1961143 940 484 327 221 73 1809 1769 --
NM_012104chr1192641 2458 2447 1519 1450 1227 937 113 34 --21146 47 --
NM_012104chr1192641 2458 2447 1519 1450 1227 937 113 34 --21146 47 --
NM_012137chr142260 620 167 161 1178 2995 632 --
NM_012141chr1321148 739 11104 ----
NM_012164chr965937 5476 2561 1329 788 687 15811 12288 --
NM_012166chr951313 1102 1081 477 137 1100 ----
NM_012193chr11105418 5153 4795 3330 2133 2070 2000 1504 567 335 14619 1128 --
NM_012199chr1104489 4256 2865 1786 1530 1092 1047 894 617 221 14057 ----
NM_012232chr1782075 478 465 302 179 139 124 110 --1196 --
NM_012234chr332464 1282 55 ------
NM_012244chr14141602 1565 1506 1190 1174 714 695 631 591 304 287 240 96 53 ------
NM_012261chr20122 ----1482
NM_012266chr95996 885 446 160 43 ----11095
NM_012282chrX4835 221 84 77 --1208 --
NM_012287chr344157 4149 554 41 11356 --11129
NM_012288chr6144903 4891 4688 4625 4366 3704 3586 3571 2166 1821 968 813 241 68 --14263 23526 1665
NM_012294chr722554 23 --11342 --
NM_012296chr11173404 3239 3190 2989 2844 2830 2824 2715 2688 2650 2444 868 400 190 161 97 76 ------
NM_012308chr1152085 1822 472 393 107 2998 44 12480 --
NM_012309chr1174211 4171 4160 3977 1401 377 317 --2388 178 --
NM_012316chr185489 5234 2253 2198 1870 1864 170 149 25354 907 ----
NM_012325chr202553 70 11352 ----
NM_012326chr28791 782 704 694 655 625 62 38 --1214 --
NM_012334chr583971 3955 3938 3867 3516 3060 425 48 1442 ----
NM_012384chr20112228 2177 2041 1992 1899 1823 1709 819 618 411 23 1812 ----
NM_012399chr2221437 554 --11465 --
NM_012402chr113514 376 277 ------
NM_012405chr153513 3343 2733 1360 406 2309 34 ----
NM_012461chr143554 270 135 1116 ----
NM_012478chr178852 817 323 269 229 159 48 29 2782 302 ----
NM_013231chr1473240 3197 3127 1688 1124 788 473 ------
NM_013233chr25103 95 66 56 50 ------
NM_013269chr1243962 3624 1710 944 1546 ----
NM_013372chr1541340 599 226 110 ------
NM_013388chr23419 253 71 ------
NM_013390chr9----1264 11294
NM_013399chr1671361 1244 732 355 117 44 23 ------
NM_013400chr751057 913 699 367 335 ------
NM_013403chr194843 659 250 75 1653 1805 1226
NM_013411chr142750 2592 2098 914 1609 12032 12083
NM_013433chr19101960 1950 1941 1717 1447 1317 713 383 258 143 1479 --1513
NM_013446chr72154 56 ----11099
NM_013449chr12122814 2358 2277 2008 1994 852 839 726 570 563 472 347 ------
NM_013951chr2122235 2174 1934 983 782 711 583 514 502 385 285 133 1935 12476 --
NM_013952chr2112312 2251 2011 859 788 660 591 579 462 362 210 11012 12553 --
NM_013953chr2112312 2251 2011 859 788 660 591 579 462 362 210 11012 12553 --
NM_013992chr2112312 2251 2011 859 788 660 591 579 462 362 210 11012 12553 --
NM_013993chr64820 583 276 232 1100 ----
NM_013994chr64820 583 276 232 1100 ----
NM_013999chr1751380 970 115 92 77 ------
NM_014000chr1041752 1295 1256 240 1708 ----
NM_014001chr1761366 1173 1109 485 460 288 1257 ----
NM_014023chr101248 1657 1882 --
NM_014030chr17111050 991 945 415 371 309 292 283 224 127 78 1955 1158 --
NM_014048chr1664309 3813 3520 3423 1456 1436 ----15129
NM_014056chr331730 1723 334 ------
NM_014112chr834741 903 665 ------
NM_014155chr1176873 6114 5194 4642 2675 1077 237 ------
NM_014157chr1663932 1441 983 552 182 113 ------
NM_014182chr123623 471 137 --1715 --
NM_014190chr471720 671 464 409 283 220 141 31294 78 66 ----
NM_014211chr541500 666 583 353 ------
NM_014212chr126930 867 787 170 161 127 ------
NM_014216chr14111279 1201 1113 666 585 551 524 464 457 243 94 11409 --11187
NM_014220chr33803 240 105 ------
NM_014225chr195334 311 99 50 42 ------
NM_014232chr17131649 1621 1599 1480 1209 1150 425 259 237 136 95 89 50 11269 11185 --
NM_014232chr17131649 1621 1599 1480 1209 1150 425 259 237 136 95 89 50 11269 11185 --
NM_014233chr1782033 2027 2021 1717 1710 1373 530 97 --1443 --
NM_014240chr363576 2980 2672 666 368 73 23380 453 ----
NM_014246chr2261659 933 751 742 427 40 21737 122 12041 --
NM_014275chr57893 830 658 617 215 181 76 2865 742 ----
NM_014284chr111886 775 433 409 319 271 242 199 162 87 75 --1893 --
NM_014286chr9183573 3506 3354 3093 2752 2513 2239 1217 976 958 935 460 453 311 302 177 161 40 13116 11167 --
NM_014289chrX51277 1241 357 191 149 1939 1568 --
NM_014292chr2281618 1205 670 620 583 381 214 81 11786 11640 --
NM_014299chr1982074 2064 1402 831 761 730 321 144 11699 ----
NM_014309chr2265077 4929 4596 4465 3460 25 ------
NM_014316chr1661789 1781 775 704 662 406 --1669 --
NM_014333chr1122252 1984 ------
NM_014345chr62944 160 ------
NM_014368chr94782 671 437 230 --2113 101 --
NM_014374chr751057 913 699 367 335 ------
NM_014376chr562115 1030 578 343 143 123 ------
NM_014415chr321161 556 ------
NM_014418chr1461916 1885 1787 1324 463 43 ------
NM_014423chr534972 3992 1380 ------
NM_014460chr22111758 1728 1552 1508 1502 1171 1157 1080 456 370 361 1377 21713 1393 --
NM_014494chr1652066 1855 331 324 213 ------
NM_014507chr226913 844 833 485 441 395 2407 83 11187 1375
NM_014550chr224663 531 198 140 --1590 --
NM_014553chr221195 432 12269 151 --
NM_014563chrX2669 663 1704 1333 --
NM_014570chr222693 222 ------
NM_014591chr10121277 1266 1234 1200 1069 942 842 385 301 294 230 214 ------
NM_014612chr921175 1017 --21388 245 --
NM_014620chr125700 183 43 37 24 ------
NM_014630chr15103908 2887 2660 1248 1150 985 704 193 158 91 ------
NM_014634chr22103396 3196 2838 2551 1230 1117 1097 574 398 149 --22648 2561 12451
NM_014636chr993826 3015 3009 2869 1744 1492 1003 982 668 13139 14153 --
NM_014646chr1852802 2625 782 631 563 32339 1083 811 22389 557 --
NM_014647chr1622150 1475 1105 ----
NM_014661chr10143855 3839 3536 3476 3318 3003 2693 2650 1028 1009 695 357 329 50 21238 217 13360 --
NM_014666chr521256 1198 ------
NM_014670chr22258 91 ------
NM_014676chr12448 127 ------
NM_014683chr1731761 417 85 ------
NM_014690chr752137 1146 1064 64 32 --1955 --
NM_014701chr1541374 1364 700 372 ------
NM_014712chr167520 434 416 104 67 43 29 1205 1190 --
NM_014715chr112881 175 ----1104
NM_014721chr687139 6235 5766 5125 4676 2613 2545 523 15231 ----
NM_014726chr17121380 1247 1237 1037 975 906 532 391 272 119 109 50 ------
NM_014727chr195294 110 104 35 26 ------
NM_014730chr1265241 5220 3320 1927 1314 922 ------
NM_014730chr1265241 5220 3320 1927 1314 922 ------
NM_014731chr2081607 1520 1479 1362 405 288 202 180 11431 ----
NM_014737chr2093933 3816 3038 2580 1699 1611 1549 107 58 11621 1187 --
NM_014739chr644247 2743 2651 1541 ------
NM_014747chr1145540 4106 3692 3566 1833 1608 1215 1025 929 774 717 486 97 67 25030 4456 15231 --
NM_014757chr552306 1847 1707 1563 734 --11841 --
NM_014766chr742837 574 492 480 ------
NM_014767chr10193565 3558 3197 3165 3063 3031 2840 2744 2738 2500 2346 2327 1340 1163 1066 681 614 424 392 --1476 --
NM_014770chr12121288 1090 961 947 495 335 220 177 147 130 30 24 --11030 --
NM_014774chr142877 2866 2755 1032 ----12177
NM_014787chr122049 1099 ------
NM_014798chr17111706 1511 1392 1231 671 480 303 203 186 174 125 11695 ----
NM_014820chr361798 1658 1577 1367 45 26 ------
NM_014826chr183922 3781 3273 3120 2843 279 273 172 ------
NM_014830chr12123778 3692 3671 3262 2671 2576 1416 1206 1167 928 298 206 22477 1316 22595 659 --
NM_014838chr224852 798 789 162 ------
NM_014840chr1242888 2288 830 245 ------
NM_014847chr15340 169 115 108 21 ------
NM_014848chr1531837 1817 131 ----12547
NM_014849chr161143 284 224 110 103 88 ------
NM_014850chr3154501 4480 4402 4283 4164 3473 1879 1566 1477 1342 843 781 735 664 293 --1788 1879
NM_014873chr174204 1728 1290 1129 1075 592 138 11323 ----
NM_014876chr2241608 658 652 531 ----1794
NM_014877chr1795992 5581 5287 2173 2078 2070 1605 1275 1165 --25985 5598 --
NM_014901chr5111617 1581 1571 1474 1431 608 577 491 275 197 172 ------
NM_014903chr1231519 705 429 ------
NM_014904chr1043535 3167 1615 1233 12975 13199 --
NM_014905chr241769 1598 669 496 ----12033
NM_014906chr1772511 1466 1367 810 481 290 252 ------
NM_014909chr14113820 3731 3624 3219 2975 2767 2658 632 366 177 143 13945 ----
NM_014921chr19142944 2749 2698 2647 2603 2028 1191 1086 1078 731 719 684 655 406 12415 ----
NM_014923chr132947 472 ------
NM_014931chr197591 174 135 113 87 53 42 ------
NM_014934chr1343816 3526 3171 629 ------
NM_014944chr171088 378 318 296 176 167 117 ------
NM_014945chr541910 1472 614 493 ------
NM_014948chr20122389 2348 2309 1976 1664 1622 1597 671 325 304 235 121 1461 1292 178
NM_014952chr1542033 680 247 148 --11330 --
NM_014961chr441368 729 525 495 ------
NM_014964chr1772215 1956 1530 573 373 213 159 --1168 --
NM_014989chr622024 1681 ------
NM_014991chr452359 2084 574 246 42 ------
NM_015002chr1231656 344 88 ------
NM_015008chr383085 2446 2248 1320 1095 1047 628 32 ------
NM_015015chr19101864 1830 1750 1589 801 757 413 132 115 26 196 --1103
NM_015020chr1653530 3385 2878 1159 351 1227 ----
NM_015023chr1171721 1702 1689 1545 1460 1251 1229 1191 504 461 306 252 240 206 118 45 28 1198 1606 --
NM_015024chr821343 297 1984 ----
NM_015033chr9112699 2425 2411 2387 2158 1043 1037 220 170 101 48 1397 ----
NM_015035chr20126571 6037 4842 4147 4050 2228 2206 1532 1288 667 540 530 --25920 169 --
NM_015039chr193387 2905 2898 1387 1295 670 511 125 52 13111 ----
NM_015042chr15194268 4047 3238 3128 3108 3097 2836 2746 1741 1512 1161 1025 892 867 451 407 401 378 161 14060 33894 2672 173 --
NM_015044chr1642752 2233 2134 683 --12607 --
NM_015045chr1032002 1525 285 ------
NM_015049chr243185 717 635 499 ------
NM_015051chr932852 1062 959 1147 ----
NM_015059chr15123791 3599 3402 3139 2601 1353 961 661 583 561 108 102 11463 --13244
NM_015063chr19101253 875 443 400 373 312 221 209 142 135 1942 --2998 459
NM_015064chr1283119 2988 2232 1332 1268 706 142 113 21324 135 13282 --
NM_015071chr574106 3998 2324 2109 1843 1351 1138 14499 14714 --
NM_015074chr164751 3717 3206 3125 1971 151 ------
NM_015075chrX211748 902 885 853 840 816 804 791 749 740 734 620 610 595 585 566 539 416 378 366 335 --246 34 --
NM_015076chr654317 2817 1812 1388 210 22993 2858 ----
NM_015077chr17194378 3541 3471 3311 3016 2883 1682 1577 1539 1489 1453 1197 875 582 499 226 158 145 133 ------
NM_015079chr1583003 2730 2472 2317 782 654 422 397 12762 ----
NM_015090chr1196015 5868 5849 5837 5751 5207 5175 4337 2504 2089 1694 1387 1302 873 762 605 599 186 172 25654 1729 --25811 1061
NM_015094chr22294253 4238 4148 4093 3914 3842 3752 3672 3591 3448 3264 3148 3046 2977 2863 1881 1869 1863 1856 1607 1565 1470 742 674 246 237 218 131 42 ------
NM_015099chr173277 166 86 1568 1259 --
NM_015100chr121606 130 1136 ----
NM_015107chrX142021 1975 1824 1655 1629 527 489 438 318 257 149 36 28 21 11868 1283 12160
NM_015113chr1782053 1917 1880 627 570 515 429 161 ------
NM_015115chr423132 865 ------
NM_015125chr198517 506 457 226 171 150 84 38 1159 ----
NM_015133chr1691353 1328 1223 1211 1072 925 554 377 346 --2357 57 143
NM_015134chr171408 ----1579
NM_015138chr1562781 2348 2324 841 357 165 1857 ----
NM_015144chr1633223 978 250 1287 1417 --
NM_015155chr1052773 2763 2481 1019 425 --1801 --
NM_015163chr143498 272 184 --141 --
NM_015178chr8142526 2300 2094 2048 1010 978 832 733 721 610 491 410 374 56 12331 ----
NM_015193chr86523 451 255 226 220 198 1121 21442 1095 --
NM_015194chr1761465 659 641 631 504 130 --1239 --
NM_015205chr13164462 4120 3940 3894 1938 1265 1252 1191 1154 1144 1099 980 611 249 113 39 24418 286 11305 --
NM_015209chr141435 543 476 187 ------
NM_015215chr122931 2509 ------
NM_015219chr17122198 2021 1593 941 656 644 622 461 385 211 150 128 12235 ----
NM_015229chr1761122 935 921 347 317 284 --2466 133 --
NM_015254chr8152894 2742 2494 2267 2221 1254 1193 1176 1100 918 624 520 468 428 149 ----12306
NM_015270chr1252224 2028 1682 1667 489 --12194 --
NM_015271chr463381 2945 2937 2862 893 663 ------
NM_015275chr1221731 654 ------
NM_015282chr292870 2506 2478 2353 2296 2056 1961 882 71 --12444 --
NM_015285chr1862458 2009 905 897 743 348 ------
NM_015288chr5163378 2830 2753 2601 2529 2482 1132 1119 1112 1097 1078 737 659 635 461 410 ----1104
NM_015291chr161120 576 371 310 270 51 ------
NM_015299chr1473209 3190 3142 1521 1451 834 309 13096 ----
NM_015310chr8107837 7557 7226 7158 6752 3346 3296 2727 1759 832 --12761 --
NM_015315chr5133164 3123 3098 2878 2310 2163 832 671 648 445 393 386 195 --22850 174 --
NM_015326chr172687 2535 2201 2090 1128 791 135 --1807 --
NM_015327chr191354 1308 1190 956 862 515 417 273 246 ------
NM_015331chr14555 205 184 94 1445 ----
NM_015332chr7113549 3349 3219 3050 2818 1382 1096 996 554 330 107 13097 22965 25 --
NM_015365chrX64093 3602 3442 3194 3153 1445 ------
NM_015385chr1041189 1026 437 413 ------
NM_015396chr331401 1387 38 --11131 --
NM_015404chr97574 539 501 478 464 125 41 ------
NM_015457chr114999 796 204 91 1977 ----
NM_015481chr12101058 894 803 281 267 215 92 84 39 32 1847 1753 2940 261
NM_015488chr2131567 1555 1509 1369 1333 1320 1294 1165 1152 682 123 96 32 --11589 --
NM_015493chr195632 490 206 102 54 ----12069
NM_015503chr167629 517 264 185 167 41 24 ------
NM_015509chr123668 613 165 ------
NM_015526chr1910965 942 534 426 370 309 252 245 177 165 1133 1118 --
NM_015537chr991137 1040 917 756 464 451 150 81 40 ----1337
NM_015541chr33563 487 113 ------
NM_015553chr675019 3417 3382 3347 3281 1986 1254 14156 ----
NM_015557chr1153551 3427 2802 2790 2740 2661 2217 1287 1181 1071 1044 742 567 267 244 --23324 1021 --
NM_015565chr2121566 295 ------
NM_015568chr20143992 3983 3852 3789 3578 1726 1654 1533 1390 1198 1188 1181 1128 665 --12906 --
NM_015576chr32885 617 12718 12726 --
NM_015609chr182921 2099 2020 880 732 412 179 133 1740 12880 --
NM_015635chr961828 1611 1591 1585 372 321 1883 ----
NM_015649chr196364 356 306 283 141 116 178 ----
NM_015686chrX92243 2196 2076 1796 936 242 149 135 25 --42116 1831 1810 310 --
NM_015695chr67781 721 701 463 358 207 73 ------
NM_015711chr192226 24 4661 613 102 38 ----
NM_015716chr173610 580 49 ----1152
NM_015719chr199789 715 594 582 574 332 289 280 272 ------
NM_015831chr711920 884 875 854 785 770 760 598 349 295 178 ------
NM_015850chr881932 1609 392 268 243 182 62 48 ------
NM_015872chr1151789 1755 1502 1470 1353 1327 1237 1208 1155 715 663 601 590 444 202 ------
NM_015898chr19292508 2440 2317 2306 2285 2265 2142 1862 1818 1811 1746 1726 1718 1705 1576 1523 894 845 816 804 791 632 603 542 522 446 335 219 74 42466 2127 888 531 1825 --
NM_015906chr153498 3377 1321 428 120 ------
NM_015964chr16139 ----1282
NM_015981chr5183011 2772 2653 2582 2375 2348 2116 1267 1258 1193 656 587 459 437 275 228 221 215 12366 1683 --
NM_015995chr15175211 5022 4900 4515 3888 3660 3558 2102 2038 1245 1226 1146 580 507 289 243 35 ----1774
NM_016021chr642217 1898 1848 658 ------
NM_016022chr17853 710 313 269 249 232 126 --1414 --
NM_016032chrX51243 1028 936 926 291 11019 ----
NM_016096chr832130 1899 576 ------
NM_016140chr16139 ----1282
NM_016147chr1171096 1071 930 846 375 225 118 --11104 --
NM_016152chr311030 --1309 --
NM_016169chr10103256 3093 2597 1219 946 778 596 353 258 182 12504 ----
NM_016201chr342180 870 232 199 12069 11510 --
NM_016206chr368624 7494 7473 7467 3346 2356 ------
NM_016231chr1721154 1123 ------
NM_016257chr153078 2882 225 103 49 ----12559
NM_016260chr2106254 5852 5553 5356 2182 2164 2024 1398 1080 26 --27285 6536 --
NM_016272chr2292033 1940 1766 1019 624 618 570 437 193 ------
NM_016277chr621561 1411 ------
NM_016284chr163720 714 708 ------
NM_016287chr13802 796 283 1837 ----
NM_016320chr116852 841 800 342 286 115 ------
NM_016322chr962796 2404 1968 854 792 320 ------
NM_016352chr751439 1080 1056 358 288 ------
NM_016376chr1784403 4231 3117 3016 1717 856 557 42 24285 4225 ----
NM_016418chr22122979 2918 1423 1417 1283 1249 897 793 622 463 392 341 12951 23623 2911 13053
NM_016433chr122152 94 128 ----
NM_016436chr2031986 785 407 ------
NM_016496chr19------2441 398
NM_016507chr1753115 2415 2409 2123 198 ------
NM_016530chr1532499 185 91 ----1614
NM_016532chr1781173 1144 1015 966 876 865 482 295 197 ----
NM_016548chr921425 1273 --11340 11359
NM_016574chr1151052 270 230 171 40 --11128 --
NM_016577chr374246 1680 1473 1264 675 445 393 --14230 --
NM_016603chr52820 621 ------
NM_016605chr582584 2519 2415 2346 1867 941 718 513 ------
NM_016621chr11154341 4318 4310 4273 4231 4075 4036 3806 3319 3264 3141 3116 3004 2944 660 --14057 11748
NM_016631chr213744 279 261 ------
NM_016733chr2251511 1181 1105 308 143 --1259 --
NM_016827chr34256 198 176 59 --1496 149
NM_016829chr34311 253 231 114 --1551 1104
NM_016834chr17153934 3777 3184 2948 2769 1429 1383 1246 1202 1115 820 736 627 95 82 11512 11147 --
NM_016835chr17153934 3777 3184 2948 2769 1429 1383 1246 1202 1115 820 736 627 95 82 11512 11147 --
NM_016841chr17153934 3777 3184 2948 2769 1429 1383 1246 1202 1115 820 736 627 95 82 11512 11147 --
NM_016929chr641568 1513 380 49 --125 --
NM_016932chr27892 851 828 668 580 300 84 1869 ----
NM_016936chr1641861 1437 455 358 ------
NM_016946chr143410 3193 3187 122 22938 68 ----
NM_016952chr11154088 3750 3636 3622 3596 3522 2930 2916 2853 2638 2604 1234 676 545 216 33615 3506 2811 23604 519 --
NM_016953chr255303 3994 1667 1318 221 11804 ----
NM_017409chr127699 615 607 595 530 513 44 ------
NM_017413chrX122168 2050 1790 1668 1628 763 701 688 674 439 298 21 --136 --
NM_017415chr5114070 3466 3451 2881 1705 1696 1583 1262 1250 1060 237 1192 1183 --
NM_017420chr1432869 2829 891 ------
NM_017449chr151679 1597 538 366 44 ------
NM_017450chr1791196 1138 947 560 500 201 192 161 54 --1286 --
NM_017452chr205528 368 341 284 91 --1318 --
NM_017453chr205528 368 341 284 91 --1318 --
NM_017454chr205528 368 341 284 91 --1318 --
NM_017456chr1761575 1568 761 340 63 56 ------
NM_017482chr251051 261 185 116 23 ------
NM_017488chr241374 1312 1068 290 11297 ----
NM_017514chrX9878 376 280 243 237 214 158 141 86 ------
NM_017515chr1121214 26 1984 ----
NM_017522chr12980 479 ------
NM_017550chr19101078 949 773 751 734 418 177 116 94 83 ------
NM_017553chr1531157 814 300 --11029 --
NM_017575chr1771515 1148 587 310 210 27 21 --11043 --
NM_017586chr9111793 1691 1624 1498 767 703 695 641 465 402 329 --11423 --
NM_017590chr22182440 2284 2178 2117 2080 1846 1656 1001 957 635 544 522 425 417 280 238 197 120 1130 ----
NM_017594chr942780 2550 50 37 ------
NM_017596chr1204326 4316 4230 4002 3759 3460 3082 2966 1592 1493 1434 1099 978 756 692 598 495 376 313 279 23971 1424 21737 1457 24455 608
NM_017607chr196476 470 352 119 65 58 --1131 --
NM_017626chr1041663 1460 1265 234 21101 704 ----
NM_017637chr988268 6718 6568 6142 6013 2869 2268 269 ------
NM_017650chr755503 4806 4126 1689 1584 ------
NM_017670chr1110813 784 721 697 678 235 213 122 100 35 ------
NM_017719chr322219 696 ------
NM_017762chr153970 405 296 --12125 --
NM_017772chr691664 1600 1512 1383 1324 1213 1203 1109 1101 --11412 --
NM_017797chr1991003 913 870 769 716 688 352 77 31 ------
NM_017811chr992897 2167 2077 2069 2055 1976 196 138 21 --1280 --
NM_017813chr845687 5532 5390 4869 ----12167
NM_017848chrX84460 4016 3976 3863 3126 3073 3060 763 --1521 --
NM_017849chr2122950 2642 2087 2011 1115 967 674 605 488 464 455 235 1903 12719 --
NM_017856chrX52017 1984 1678 549 410 ------
NM_017857chr117570 534 458 185 158 131 67 128 2166 139 --
NM_017893chr10131453 1385 1328 1244 925 584 529 523 401 282 168 98 84 --11146 --
NM_017907chr115361 331 320 67 58 ----1509
NM_017921chr1762119 2053 1560 434 400 274 1749 ----
NM_017938chrX52217 1392 619 419 345 ------
NM_017954chr741652 1606 1341 674 ------
NM_017955chr1471172 1043 845 313 257 186 180 ------
NM_017957chr1791589 1406 1345 1151 963 364 358 352 60 --21237 205 --
NM_018026chr1171324 1203 1105 912 570 282 95 --1189 --
NM_018028chr195359 287 178 137 60 --1309 --
NM_018036chr1464084 3724 3366 3335 3155 3057 ------
NM_018046chr521730 1546 ------
NM_018048chr1242053 1839 1796 506 ------
NM_018115chr44616 607 543 299 ------
NM_018157chr1243004 2976 2481 819 ------
NM_018182chr17122132 2087 2017 1998 1962 1780 1649 1635 776 692 414 45 ------
NM_018205chr1062314 1895 840 472 406 358 21959 1866 12179 --
NM_018207chr191620 1499 1102 534 400 285 279 127 27 --1269 1431
NM_018208chr171110 1098 1008 738 477 433 289 --1365 --
NM_018218chr241415 1290 1208 396 1632 --128
NM_018239chr1062314 1895 840 472 406 358 21959 1866 12179 --
NM_018244chr207427 355 278 270 214 204 48 ------
NM_018263chr262114 1790 1753 1720 782 729 --1837 --
NM_018275chr74370 85 69 49 2412 213 ----
NM_018293chr32690 203 ------
NM_018315chr4261 47 ------
NM_018320chr115405 285 268 126 80 --11244 --
NM_018364chr123293 1245 ------
NM_018373chr1456137 4394 1171 52 26 --160 --
NM_018383chr241806 222 207 138 ------
NM_018388chrX31506 1482 44 ------
NM_018400chr11104362 3763 3565 3219 3005 1838 358 316 267 184 ------
NM_018416chr1242272 1659 169 89 ------
NM_018426chr65387 179 112 53 47 ------
NM_018440chr8117634 6555 6495 6008 5476 5270 1781 1317 355 254 205 --15595 --
NM_018445chr15------153
NM_018489chr162109 1556 747 649 617 600 --1874 --
NM_018638chr1223491 1689 ------
NM_018640chr1232710 825 629 12540 --12624
NM_018644chr11102093 864 731 711 671 552 531 303 290 110 ------
NM_018667chr16142293 2269 2259 2251 2105 2065 2001 1937 1885 1073 789 675 532 445 --32332 1064 396 --
NM_018674chr27580 564 195 188 140 54 42 ------
NM_018702chr101954 --2639 374 --
NM_018717chr451881 1170 852 744 644 ------
NM_018718chr7------154
NM_018837chr204701 280 206 22 ------
NM_018847chr931517 1315 395 ------
NM_018912chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018913chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018914chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018915chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018916chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018917chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018918chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018919chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018920chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018921chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018922chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018923chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018924chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018925chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018926chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018927chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018928chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018929chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_018992chr1651672 1347 1222 665 290 ------
NM_018993chr2041411 265 108 96 ------
NM_018999chr1054227 1106 569 530 415 1258 ----
NM_019027chr432301 759 753 12040 ----
NM_019063chr241901 1547 475 329 ------
NM_019064chr175761 599 561 115 56 --1776 --
NM_019072chr541581 1412 1406 76 ------
NM_019106chr2293196 3112 3024 3017 2915 2193 2139 2122 487 --11226 --
NM_019114chr972430 2289 2268 2224 2118 2108 860 ------
NM_019594chr961442 1311 1226 1102 373 331 --21075 88 --
NM_019610chr121551 608 ------
NM_019624chr128917 762 716 687 225 158 74 22 187 2730 194 --
NM_019625chr128917 762 716 687 225 158 74 22 187 2730 194 --
NM_019850chr25617 316 306 257 95 1270 ----
NM_019854chr125659 295 191 152 141 ------
NM_019859chr1021403 1114 ------
NM_019860chr1021451 1162 ------
NM_019884chr195490 477 459 367 141 --2580 169 --
NM_019885chr2151992 1190 1107 935 908 762 698 684 548 433 394 341 242 218 107 ------
NM_020039chr12131855 1706 1661 1513 1351 1321 1275 1219 662 587 484 95 62 --11241 --
NM_020062chr206957 382 285 167 160 50 ------
NM_020116chr421452 599 ------
NM_020131chr171344 1296 448 440 274 155 74 138 ----
NM_020142chr127582 574 546 529 509 159 70 ------
NM_020145chr98528 452 432 250 224 218 178 22 ----1237
NM_020159chr441518 1360 577 337 ------
NM_020160chr195398 127 98 41 29 ------
NM_020168chr155525 233 215 175 137 1195 11055 --
NM_020182chr20103519 3362 3028 2392 2245 1431 1234 1035 736 128 1880 ----
NM_020184chr261902 907 766 480 131 22 --21633 864 --
NM_020205chr163420 3358 2424 1323 720 280 ------
NM_020211chr15121478 1157 1067 455 402 350 304 297 281 256 245 156 ------
NM_020239chr1101629 838 711 514 439 271 171 162 110 38 ------
NM_020245chr664896 3771 2003 1739 1666 508 ------
NM_020248chr1102211 2128 2096 1930 1715 1661 1550 700 100 86 1832 ----
NM_020309chr1961095 944 816 792 340 39 --1702 --
NM_020310chr17152529 2522 2472 2034 1990 1724 837 797 790 413 401 339 118 106 24 1925 21836 294 --
NM_020336chr2022697 101 ------
NM_020337chr442733 2727 1113 185 ------
NM_020338chr10103460 2928 2825 2353 1206 766 459 332 225 138 22953 278 --1610
NM_020342chr221982 838 ------
NM_020348chr10122689 2673 2356 2222 1892 1719 1707 1021 173 165 137 64 1348 --1319
NM_020360chr176474 399 228 204 156 140 ------
NM_020384chrX111879 1741 1725 1682 1521 519 391 374 340 264 245 ------
NM_020416chr45988 853 784 155 23 ----152
NM_020429chr752470 2159 2036 211 71 ----12683
NM_020431chr14192648 2604 2593 2480 2398 2363 2332 2281 2086 2077 2064 1852 1701 1083 968 871 453 97 86 ----1904
NM_020440chr152946 2875 2302 533 461 --12499 --
NM_020443chr1136941 6747 6727 6544 6298 5516 4812 2722 2569 1683 1667 779 220 22592 2341 46528 5816 4311 26 --
NM_020452chr151320 802 369 312 113 ------
NM_020475chr8152421 2175 2164 2107 2000 1720 1702 1605 1563 1549 1506 804 504 486 156 21906 528 11787 --
NM_020476chr8152421 2175 2164 2107 2000 1720 1702 1605 1563 1549 1506 804 504 486 156 21906 528 11787 --
NM_020477chr8152421 2175 2164 2107 2000 1720 1702 1605 1563 1549 1506 804 504 486 156 21906 528 11787 --
NM_020478chr8152484 2238 2227 2170 2063 1783 1765 1668 1626 1612 1569 867 567 549 219 21969 591 11850 163
NM_020480chr8152421 2175 2164 2107 2000 1720 1702 1605 1563 1549 1506 804 504 486 156 21906 528 11787 --
NM_020530chr228845 796 670 384 322 165 157 81 1338 ----
NM_020631chr171437 1334 1199 1074 339 302 222 1237 1367 --
NM_020663chr144305 182 134 105 ------
NM_020698chr1263151 2930 2787 1991 994 474 ------
NM_020699chr1185305 4823 4303 4124 3906 3897 3876 3842 3802 3786 3410 3403 1822 1337 1326 1166 984 182 1316 13417 12040
NM_020702chr9111558 1208 1139 573 439 362 230 94 84 59 33 ------
NM_020708chr20121865 1844 1624 1574 782 608 420 400 333 222 68 58 1723 32505 731 373 --
NM_020713chr20223091 3078 2870 2801 2612 2530 2468 2372 2313 2242 1063 1035 803 680 626 506 496 469 329 171 99 25 --3633 521 107 --
NM_020717chrX53561 3297 670 562 142 ------
NM_020718chr1635362 5231 1549 --157 --
NM_020728chr773144 3089 3077 1259 1121 1026 63 ------
NM_020749chr841871 1831 1428 189 ------
NM_020764chr1681042 917 414 396 232 132 44 24 ------
NM_020766chrX34181 1465 489 --1551 --
NM_020768chr553110 778 598 357 54 ----12350
NM_020769chrX4787 762 250 119 ------
NM_020770chr141162 1005 531 246 ------
NM_020772chr1758365 6718 3446 1568 1526 ------
NM_020778chr15133286 1790 1739 1726 1500 1257 989 811 777 684 417 253 230 1317 11117 --
NM_020795chr17121793 1754 1528 1351 1334 599 552 543 448 429 365 28 1592 ----
NM_020796chr552929 2683 2526 327 320 ----12558
NM_020809chr1131793 829 74 ------
NM_020814chr241237 1128 1112 76 --11230 11002
NM_020825chr1673609 3557 3544 2875 1385 1348 423 ------
NM_020832chr15481 270 212 172 72 --2489 437 --
NM_020834chr1441252 458 414 222 ------
NM_020836chr147667 267 138 131 97 85 37 1682 ----
NM_020845chr12182474 2391 2328 2321 2264 2253 2217 2033 1990 1937 1884 1687 1642 503 374 368 349 248 ------
NM_020850chr1642838 2832 2390 862 1738 ----
NM_020854chr1821074 129 ------
NM_020888chr171641 1395 1281 1254 685 294 129 --1485 --
NM_020899chr1771623 1614 761 320 128 51 40 1352 ----
NM_020922chrX41788 667 465 349 ------
NM_020925chr131441 283 96 ------
NM_020939chr671384 1358 1237 1199 513 380 151 177 1322 --
NM_020951chr1941867 1741 1720 1714 ----11550
NM_020956chr19234640 4412 4402 4002 3646 3105 1875 1797 1719 1641 1602 979 967 755 699 665 650 608 539 497 366 104 71 23174 1297 --13498
NM_020962chr1571717 870 654 518 379 373 168 1566 ----
NM_020964chr1884289 3671 3358 3326 3102 825 787 319 --23883 3452 --
NM_020972chr45883 800 302 127 45 ------
NM_020977chr431411 432 104 ------
NM_020983chr1252224 2028 1682 1667 489 --12194 --
NM_020988chr164857 363 338 124 --2886 538 --
NM_020993chr1272651 2413 2395 1932 848 833 474 11041 --1874
NM_021020chr8133361 2979 2632 2370 2200 1228 860 691 677 107 89 66 57 --13285 1132
NM_021032chr311633 --11984 --
NM_021035chr2041121 966 530 31 --21044 472 --
NM_021079chr17113016 2833 2594 2544 2538 2364 1055 1038 904 845 753 --1193 --
NM_021097chr252392 865 819 471 166 ------
NM_021116chr7238557 8526 8500 8095 8081 8024 7930 7804 7516 7327 7176 2818 2622 2599 2148 1961 1839 1620 1133 1020 785 728 271 ----15809
NM_021131chr971443 1415 1217 1026 973 950 82 --1309 --
NM_021135chr6142815 2708 2582 2529 2480 2184 1352 1176 801 759 742 206 124 30 --12590 1376
NM_021145chr73995 160 82 ------
NM_021155chr19132942 2903 2719 1206 1172 1029 658 496 487 369 360 303 148 ----1795
NM_021159chr441304 1208 1135 146 ------
NM_021198chr2121515 1212 1200 1175 954 493 483 424 415 372 222 51 131 ----
NM_021238chr125515 384 302 166 79 ------
NM_021239chr144954 420 318 166 ----11451
NM_021267chr19171011 942 933 910 483 449 428 367 359 338 309 187 168 136 119 84 61 1348 1179 1991
NM_021569chr9191190 1184 1150 1116 1091 1043 1036 964 954 869 752 477 435 322 297 200 119 35 28 ------
NM_021638chr4174222 3962 3716 3600 3471 3257 3072 1798 1351 1273 1237 825 802 543 522 364 42 13159 1406 11342
NM_021648chr64991 849 745 46 12114 ----
NM_021649chr531542 1196 681 ------
NM_021783chrX32203 637 26 ------
NM_021804chrX3769 689 680 ------
NM_021813chr685467 5083 1828 1683 1645 1082 736 205 11361 ----
NM_021814chr62149 21 --1216 --
NM_021828chr103331 305 103 ------
NM_021905chr682041 1973 1847 916 907 886 312 53 22279 1505 ----
NM_021912chr1553928 3381 3139 1672 394 13257 ----
NM_021945chr6112891 2867 2859 2791 1250 1239 1171 1060 827 414 306 ------
NM_021946chrX101309 1237 1060 1037 1004 986 546 416 400 58 172 ----
NM_021961chr1176625 5159 2800 2398 2079 1747 738 12793 ----
NM_021962chr1762278 2223 2123 1567 213 92 ------
NM_021964chr336454 5299 4951 ------
NM_021973chr42187 167 --1260 --
NM_021988chr2051307 623 615 405 390 --2585 518 11287
NM_022003chr116850 804 447 389 226 150 1455 11056 --
NM_022048chr15116249 5610 5180 4392 4351 3878 2558 2210 373 366 139 --24997 2358 --
NM_022059chr174858 807 706 365 ------
NM_022060chr1481316 1153 1073 1046 905 432 216 51 ----11200
NM_022062chr11101925 1682 1493 1443 1329 1322 1307 1286 451 319 ------
NM_022066chr174422 216 78 62 ------
NM_022085chr641487 1296 251 38 ------
NM_022114chr1143693 3619 3597 3507 3448 3305 3206 3167 3144 3101 3095 1283 1065 823 --11601 --
NM_022166chr16125448 5008 4867 4823 2407 2338 1966 1912 1758 1712 1282 1013 11358 11394 1298
NM_022169chr11111451 1298 1226 1218 1066 983 614 547 381 314 45 ------
NM_022442chr2051307 623 615 405 390 --2585 518 11287
NM_022456chr1265729 5715 4908 4847 1967 429 25198 33 ----
NM_022459chr1355886 5846 4257 4163 2187 ------
NM_022465chr12122891 2883 2283 2251 2245 1152 901 791 492 324 316 140 ------
NM_022473chr1584120 3955 1786 1683 1172 978 131 58 ------
NM_022475chr42478 206 ------
NM_022497chr342916 1302 459 86 ------
NM_022572chr2131567 1555 1509 1369 1333 1320 1294 1165 1152 682 123 96 32 --11589 --
NM_022574chr7162180 2123 2052 2041 2018 1980 1941 1935 1787 1726 1616 495 477 285 84 23 11974 11796 --
NM_022648chr2104403 3767 3642 3505 3398 1312 1090 345 295 233 --13681 --
NM_022658chr126990 367 361 330 282 37 1407 ----
NM_022737chr19121259 1246 1138 1121 972 909 403 212 150 137 122 95 --1107 --
NM_022748chr782575 2506 1876 1112 921 368 267 77 11037 ----
NM_022749chr891415 1371 1217 965 560 482 279 108 82 2899 885 ----
NM_022755chr952293 2236 1784 895 114 11834 ----
NM_022758chr642986 2537 1213 118 --22162 106 --
NM_022780chr22318 169 ------
NM_022802chr102610 390 ------
NM_022822chr115836 814 636 108 47 1359 1346 --
NM_022823chr23193 113 94 ------
NM_022825chrX5271 112 96 39 28 ------
NM_022841chr1531913 984 76 ------
NM_022893chr25561 86 57 42 29 ------
NM_022898chr1464259 3532 3209 1070 111 78 ------
NM_022912chr222900 382 ------
NM_022977chrX42035 1901 1894 1883 ------
NM_023009chr12521 273 --1292 --
NM_023067chr381134 1034 995 530 421 241 216 105 ------
NM_023076chr1652638 2228 864 296 23 ------
NM_023105chr881932 1609 392 268 243 182 62 48 ------
NM_023106chr881932 1609 392 268 243 182 62 48 ------
NM_023110chr881932 1609 392 268 243 182 62 48 ------
NM_023111chr881932 1609 392 268 243 182 62 48 ------
NM_024007chr542323 1179 606 216 ------
NM_024016chr178608 555 322 303 264 156 141 77 ------
NM_024017chr1741454 1060 542 151 11214 ----
NM_024046chr371117 1025 888 863 222 115 100 ------
NM_024085chr27948 768 720 400 271 237 228 --2408 310 --
NM_024086chr17123788 3735 3376 3187 1456 1274 1070 967 696 690 652 150 --11449 1257
NM_024095chr122155 144 ------
NM_024103chr19191851 1835 1825 1696 1639 1382 1357 1348 1303 721 700 596 582 411 350 344 248 219 36 ------
NM_024117chr941328 250 161 110 11032 ----
NM_024294chr642986 2537 1213 118 --22162 106 --
NM_024306chr165881 838 819 332 57 --1180 --
NM_024345chr935712 5213 4566 ------
NM_024422chr1821734 1711 ------
NM_024511chr442938 561 554 404 12214 ----
NM_024541chr1051863 1219 1162 637 479 2677 90 ----
NM_024602chr15885 736 717 705 677 --1852 --
NM_024626chr141546 418 316 299 ------
NM_024676chr171140 1134 1110 979 964 217 167 ------
NM_024698chr11141312 1276 1106 1066 1031 1003 980 350 317 283 253 169 107 93 11082 ----
NM_024740chr1173404 3332 3015 1157 909 538 65 12941 ----
NM_024742chr1671705 1361 1345 1256 561 394 52 11629 ----
NM_024761chr9124077 3703 3644 3603 3588 3399 1125 1017 585 576 566 101 ------
NM_024770chr296408 6397 5625 4919 4160 2222 1502 1312 1222 11908 ----
NM_024779chr1261545 1335 1173 1066 1027 169 11611 ----
NM_024785chr251477 1159 1070 521 101 ------
NM_024786chr54183 155 58 24 ------
NM_024811chr11141914 1645 1639 1621 1559 757 632 488 276 195 144 120 113 92 ------
NM_024830chr572076 2045 1857 733 366 226 34 ------
NM_024859chrX61055 817 769 730 145 83 --11020 --
NM_024874chr14853 467 223 169 2276 65 1134 --
NM_024881chr19123301 3021 3015 2935 2681 2341 1047 582 546 147 48 42 13056 ----
NM_024887chr1122103 1585 1566 1411 808 740 723 612 566 131 84 56 ------
NM_024889chr10191222 1207 1170 1156 1141 1126 1109 725 710 696 681 666 652 625 611 596 324 277 240 ------
NM_024896chr931563 761 714 --11839 --
NM_024909chr651484 597 558 525 461 ------
NM_024923chr351201 1173 1086 456 52 ------
NM_024939chr1641069 671 505 79 ------
NM_024949chr454310 4011 3954 3130 1437 ----14105
NM_024953chr1252247 2174 645 461 202 ------
NM_024991chr1041189 1026 437 413 ------
NM_025073chr144503 3948 3942 1799 ------
NM_025083chr1571972 783 777 415 250 243 36 11704 ----
NM_025106chr161786 1615 1328 1262 247 140 11815 11892 11832
NM_025140chr122473 414 1445 1465 --
NM_025160chr133789 3306 1520 ------
NM_025164chr1172005 1925 1694 613 478 471 442 ------
NM_025179chr184598 4258 3911 3296 3214 3201 3186 1892 1113 13777 --
NM_025182chr94884 710 417 386 ------
NM_025222chr32974 373 --12042 --
NM_025248chr17153191 3007 2896 2797 2760 2753 2126 2113 2066 1196 554 450 444 365 154 12036 12875 --
NM_025250chr7192806 2784 2615 2503 2450 2336 2302 1177 1005 968 861 748 670 592 569 389 367 154 47 --191 --
NM_025251chr812900 813 806 482 464 256 215 132 121 112 71 40 ------
NM_025263chr65635 584 443 143 105 ------
NM_030576chr17162312 2242 2212 2206 2186 2116 977 675 667 490 388 340 284 272 176 23 --11879 --
NM_030594chr1551210 853 487 238 226 ------
NM_030621chr1443342 1512 1397 378 ------
NM_030627chr543310 3164 1665 66 ------
NM_030629chr16121862 1726 1554 1447 1439 1236 1196 759 638 617 437 183 --21304 1228 --
NM_030634chr142308 2076 1582 160 ------
NM_030640chr123867 324 231 ------
NM_030647chr764764 4414 3914 3839 721 80 ------
NM_030648chr434878 1342 561 24781 2107 11255 --
NM_030651chr613783 774 767 757 719 698 519 293 277 269 252 209 192 137 ----
NM_030661chr731397 586 158 1368 ----
NM_030665chr1771169 982 927 320 302 221 84 ------
NM_030761chr192499 2189 2097 1929 1757 1707 707 683 425 1928 ----
NM_030810chr641487 1296 251 38 ------
NM_030884chr3101831 1586 649 349 339 220 206 167 57 35 --1896 --
NM_030913chr19667 528 494 298 260 254 177 103 88 1131 ----
NM_030914chr95862 669 606 223 59 ------
NM_030915chr262294 2126 1873 1820 1693 1547 1909 ----
NM_030918chr1115205 4220 3401 1941 1690 1327 967 850 831 189 158 ------
NM_030920chr131719 808 213 ------
NM_030935chr78312 295 164 143 136 97 89 62 ------
NM_030957chr196561 480 469 407 236 184 1486 1142 --
NM_030962chr112409 207 ------
NM_030964chr5143391 3087 2848 2678 2417 2411 2277 1377 1108 1002 649 373 131 124 11383 ----
NM_030981chr11131228 1120 1107 1039 972 883 842 806 789 392 324 270 75 ------
NM_031216chr1821734 1625 --11750 --
NM_031268chr16134672 4275 4054 4044 2138 1533 1517 1454 1368 625 442 261 251 ------
NM_031283chr23876 674 345 1367 1613 --
NM_031305chr431943 625 350 ------
NM_031309chr8252375 2254 2135 2000 1978 1855 1744 1554 1545 1477 892 789 782 776 743 590 583 506 455 395 359 345 236 212 49 11483 2633 531 --
NM_031314chr1421481 445 --11268 --
NM_031369chr42692 25 ------
NM_031370chr42692 25 ------
NM_031417chr1981822 882 867 796 733 712 517 140 --1240 11120
NM_031439chr851552 504 203 182 31 21361 255 11517 --
NM_031444chr2271729 649 491 452 435 42 30 --1575 11590
NM_031445chr252389 512 411 146 29 --1377 --
NM_031453chr1022250 82 --1522 --
NM_031459chr1111481 1203 1197 1096 454 430 392 368 264 146 94 ------
NM_031468chr7207837 6919 5984 5598 3260 3217 3208 3138 3128 3030 3016 2837 2664 2544 2246 593 530 441 389 383 ----12166
NM_031469chr643264 2769 2709 588 --34052 3958 46 --
NM_031477chr163354 103 93 ------
NM_031844chr143547 1505 1116 347 ------
NM_031845chr231034 743 118 11377 ----
NM_031847chr231034 743 118 11377 ----
NM_031866chr104754 413 247 95 1393 1677 1421
NM_031886chr1942268 1727 186 34 12196 ----
NM_031890chr22182904 2656 2636 2545 2524 2351 2148 1912 1892 1153 654 634 580 556 286 247 210 49 12342 1786 --
NM_031938chr111311 ----1750
NM_032017chr191810 1434 849 784 679 622 615 458 98 11603 ----
NM_032088chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_032092chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_032109chr5111198 1189 464 458 427 405 266 229 222 194 30 ------
NM_032153chr342546 1856 1701 405 21121 907 ----
NM_032160chr1853343 1496 791 319 202 --23692 2653 --
NM_032268chr16152730 2679 2621 2439 2433 2172 1096 1084 1077 739 474 356 231 120 48 --22277 806 --
NM_032271chr16111297 1279 1077 1054 586 335 260 253 247 240 145 132 ----
NM_032281chr19242937 2832 2808 2751 2743 2719 2707 2586 2559 2551 2532 1216 1184 1170 1161 509 458 394 332 326 228 208 33 27 --1496 2350 340
NM_032283chr181586 1443 1369 1265 1245 707 65 42 ------
NM_032294chr1791656 1541 1243 521 391 242 148 83 65 --1119 --
NM_032325chr115762 576 557 519 44 11381 2157 95 --
NM_032353chr173529 360 32 ------
NM_032389chr1181150 1020 992 946 760 732 264 229 ------
NM_032403chr5141714 1654 1647 1481 1421 1413 1402 1335 1251 590 537 220 171 98 ------
NM_032420chr57774 752 725 614 204 85 25 1308 1814 --
NM_032431chr116972 388 307 137 111 47 ------
NM_032449chr162316 2098 713 530 517 38 --3631 603 290 --
NM_032452chr1481394 1346 1313 1249 584 240 222 50 ------
NM_032457chr43366 259 220 ------
NM_032458chrX22470 986 ------
NM_032510chr1842194 2104 1810 39 --1995 --
NM_032511chr63374 43 21 ------
NM_032514chr206376 369 361 280 158 121 ----1347
NM_032538chr6202735 2687 2438 2342 2334 2178 2111 2019 1141 1099 1087 896 889 749 519 471 418 259 46 34 32370 905 441 ----
NM_032552chr9111766 1682 1576 1458 690 684 443 434 343 326 177 ------
NM_032558chr921218 258 --165 --
NM_032569chr166475 383 243 47 35 26 21251 171 ----
NM_032575chr16151709 1527 1438 1332 583 556 505 482 436 324 293 283 172 43 30 31638 765 56 21717 693 --
NM_032595chr17191592 1360 1348 1338 1294 1222 1168 1002 996 545 509 427 178 138 125 116 80 61 37 11369 11480 --
NM_032638chr351300 476 400 191 119 --134 --
NM_032646chr1771555 1372 1253 706 431 288 227 --1516 --
NM_032664chr841491 1416 1302 691 ------
NM_032682chr333303 2960 2373 11270 ----
NM_032711chr17114248 3832 3755 3680 3156 2835 2820 2788 2727 1414 248 23738 360 14187 1394
NM_032737chr1961972 1092 1062 889 860 551 ------
NM_032741chr610922 791 715 404 355 319 237 231 177 89 ------
NM_032772chr103447 207 186 ------
NM_032800chr172585 2520 2401 811 573 485 387 ------
NM_032808chr156926 149 141 134 128 90 --127 --
NM_032833chr111885 11716 22346 1676 --
NM_032836chr1971052 1020 1000 728 688 653 382 ------
NM_032840chr1291151 1027 1021 776 395 143 126 102 41 --21015 485 --
NM_032866chr1553164 2347 325 314 277 ------
NM_032873chr1164485 3510 1692 1543 657 546 --13617 --
NM_032966chr1191239 1132 1045 629 565 405 295 267 152 --21550 1275 --
NM_032982chr762567 1967 1794 1761 432 100 ------
NM_032983chr7103381 2781 2608 2575 1246 914 824 806 477 151 --12093 --
NM_032998chr141047 921 745 166 --1103 --
NM_033016chr22121487 1460 1451 1339 1236 528 458 342 201 150 97 62 11153 1433 --
NM_033018chrX81090 1019 749 324 308 135 66 51 ------
NM_033020chr153498 3377 1321 428 120 ------
NM_033023chr741092 988 516 109 ------
NM_033025chr196978 896 701 669 658 644 2724 677 ----
NM_033036chr117670 449 316 228 155 119 81 1163 ----
NM_033102chr171223 1172 1077 1060 1002 962 55 ------
NM_033102chr171223 1172 1077 1060 1002 962 55 ------
NM_033121chr1231352 1230 1137 --1315 --
NM_033129chr20242021 2004 1996 1976 1625 1603 1555 1504 1481 1462 1334 1262 774 728 677 664 415 300 247 234 160 114 78 55 1205 21753 129 --
NM_033132chr1332292 1932 1478 ------
NM_033136chr53690 282 163 --1359 --
NM_033137chr53690 282 163 --1359 --
NM_033201chr165468 421 63 46 36 ------
NM_033221chr981021 996 584 411 349 153 94 41 --134 --
NM_033224chr766682 5465 4921 462 77 44 1914 --15719
NM_033240chr1541625 1255 1155 663 21349 474 11337 --
NM_033246chr153135 104 81 144 ----
NM_033253chr22601 162 ------
NM_033259chr39938 802 730 342 332 314 303 296 84 1664 1789 --
NM_033274chr5103409 3142 2823 2351 2206 1323 855 468 127 113 13119 1606 --
NM_033278chr115388 289 260 153 147 --1269 --
NM_033300chr12980 479 ------
NM_033305chr91421 --11319 --
NM_033315chr17172208 2079 2029 1993 1390 1382 831 774 680 664 490 442 341 198 170 136 121 12020 11877 --
NM_033331chr963233 3094 2711 2418 2307 1073 ------
NM_033375chr1761429 1400 1144 586 135 22 11333 ----
NM_033387chr9102335 2314 1966 960 938 771 461 155 140 106 32354 1949 394 --12262
NM_033419chr17101226 1217 1123 600 435 428 332 238 153 41 11533 11408 --
NM_033421chr2081887 1832 1663 1600 1523 775 340 295 1636 ----
NM_033430chr423675 1412 ----14083
NM_033437chr423675 1412 ----14083
NM_033449chr591879 1824 1811 1478 786 685 127 121 23 ----11470
NM_033503chr15163705 3580 3151 3034 3024 3013 2609 2602 2587 2374 1041 1000 898 659 619 401 12576 ----
NM_033512chr852963 2062 859 829 27 ------
NM_033542chr2031437 379 66 11857 ----
NM_033551chr5133164 3123 3098 2878 2310 2163 832 671 648 445 393 386 195 --22850 174 --
NM_033624chr1231656 344 88 ------
NM_033626chrX111759 1267 1234 1151 690 682 551 457 424 408 396 11497 ----
NM_033632chr4261 47 ------
NM_033637chr1083805 3460 3353 3048 2743 2552 665 273 13993 ----
NM_052834chr1862458 2009 905 897 743 348 ------
NM_052854chr115561 548 428 255 89 1151 136 --
NM_052869chr1771555 1372 1253 706 431 288 227 --1516 --
NM_052874chr168186 180 174 128 101 83 69 60 ------
NM_052875chr1172168 590 555 466 423 268 44 ------
NM_052880chr223481 109 55 --1300 --
NM_052896chr1112532 2166 2138 2058 2052 2045 1851 1601 1584 481 156 185 11821 12149
NM_052897chr125289 202 189 112 68 2592 214 ----
NM_052899chr510944 893 872 627 386 310 304 193 176 136 2320 101 1265 --
NM_052906chr22194932 4490 4298 4272 3854 3762 3558 3448 1859 1720 1708 1301 1262 1204 1175 964 801 755 618 1988 2996 641 --
NM_052910chr13111727 1437 1373 1361 1350 602 563 401 308 302 168 --197 --
NM_052934chr1111906 1888 1760 1464 1422 774 699 607 593 164 108 11860 ----
NM_052953chr3------1204
NM_052971chr5------140
NM_052996chr16101674 1660 1634 1622 1363 1122 1107 1086 623 373 1635 --11526
NM_053023chr11112949 2442 659 617 581 561 440 320 170 162 155 ------
NM_053043chr7106254 6057 5629 4629 4065 1347 993 721 656 83 --22532 1691 --
NM_053064chr147930 605 512 500 280 272 29 ------
NM_053279chr852610 2003 712 359 96 --12530 --
NM_054013chr57893 830 658 617 215 181 76 2865 742 ----
NM_054025chr11102093 864 731 711 671 552 531 303 290 110 ------
NM_054027chr55856 752 642 581 309 --1249 --
NM_054033chr22177 96 ----141
NM_057161chr66452 443 373 105 55 21 --189 --
NM_057175chr4------12291
NM_057178chr1772319 2201 1859 1728 1721 356 333 ----1147
NM_078467chr6101283 1022 975 598 530 415 359 291 148 123 ------
NM_078471chr1771210 1162 1078 1028 1020 767 320 ------
NM_078487chr952589 2536 1198 850 361 1504 1923 --
NM_078625chr621225 364 21118 222 ----
NM_079834chr19211664 1647 1641 1631 1571 1546 1428 1361 1343 1212 1204 639 581 545 500 363 256 209 143 99 36 2689 556 163 --
NM_080491chr11173404 3239 3190 2989 2844 2830 2824 2715 2688 2650 2444 868 400 190 161 97 76 ------
NM_080645chr621956 811 1771 ----
NM_080670chr56791 670 235 228 181 61 ------
NM_080717chr123989 298 254 ------
NM_080738chr131869 1809 471 11264 --11905
NM_080797chr20123301 3141 2903 2892 2762 2598 2446 2305 1408 891 301 23 ----1160
NM_080836chr20174712 4334 4011 3803 3539 3496 3456 3267 2981 2972 2966 1796 1460 1426 1402 1273 172 23917 129 11171 --
NM_080872chr853227 2823 1334 701 130 ------
NM_080881chr56591 582 536 519 513 267 ------
NM_130385chr1153032 2654 2222 1157 1122 ------
NM_130436chr2142589 700 543 426 ------
NM_130438chr2143166 1277 1120 1003 --1411 --
NM_130446chr363575 1118 957 951 122 64 31364 379 32 23407 3324 --
NM_130459chr951536 1417 675 629 418 21212 1164 11384 --
NM_130766chr1781173 1144 1015 966 876 865 482 295 197 ----
NM_130797chr761285 1183 241 223 175 83 ------
NM_130807chr19152315 2288 2089 2074 2020 1947 1782 1695 1677 1609 540 518 460 381 204 1499 11802 --
NM_130830chr3103660 3285 2696 1378 1334 1119 1054 901 335 161 --33113 256 77 --
NM_133170chr20197666 7424 7159 7136 6092 5505 5151 5080 3126 2792 2769 1378 780 614 561 479 469 373 54 15942 1821 --
NM_133177chr181009 905 840 825 740 418 237 103 ------
NM_133178chr181009 905 840 825 740 418 237 103 ------
NM_133264chr17103430 3389 3116 2959 2541 1000 752 742 586 154 176 ----
NM_133328chr197621 305 240 230 218 77 30 ------
NM_133372chr542926 2056 1921 949 --11885 --
NM_133378chr22977 403 ------
NM_133432chr22977 403 ------
NM_133437chr22977 403 ------
NM_133445chr982794 1405 1195 1171 1088 1005 504 143 1450 ----
NM_133452chr1981100 915 875 843 826 468 368 283 11174 1976 --
NM_133457chr76481 428 385 224 185 85 --1231 --
NM_133496chr154506 3857 3282 2988 2982 ----1112
NM_133499chrX8972 933 699 679 359 334 274 174 1939 1353 1214
NM_133507chr122947 599 ------
NM_133634chr21101520 1471 1462 1196 1172 1151 752 671 470 379 --2142 84 --
NM_133647chr1583652 3342 2738 2436 2346 906 595 84 12628 22887 918 --
NM_134325chr181441 1423 1295 673 309 234 142 128 11395 ----
NM_138281chr173548 165 73 ------
NM_138288chr1421807 1456 1792 1293 --
NM_138300chr181619 1593 1515 1508 1371 1309 379 107 ------
NM_138333chr91108 11986 ----
NM_138338chr22123425 3224 2751 2560 2520 2485 2365 2348 2307 2108 1093 509 11026 ----
NM_138360chr145280 97 85 69 59 131 ----
NM_138430chr137462 455 445 426 391 376 73 ------
NM_138444chr1373804 298 281 252 241 213 90 ------
NM_138457chr6243354 2873 2510 2483 2392 1370 1303 1237 1184 966 935 904 718 683 643 564 548 434 393 377 256 244 189 38 22385 88 32499 690 205 12769
NM_138468chr254932 4917 4767 1138 644 ------
NM_138473chr1274995 4207 4128 4087 3564 1235 41 ------
NM_138479chr1102004 1630 1565 1501 1404 733 646 222 202 196 ------
NM_138494chr722497 161 ------
NM_138576chr1464259 3532 3209 1070 111 78 ------
NM_138578chr20101407 1340 1153 568 493 321 190 60 36 28 ------
NM_138619chr1761366 1173 1109 485 460 288 1257 ----
NM_138621chr233441 2930 526 --1432 --
NM_138713chr1697477 7161 6813 6301 5732 5563 3159 1773 1767 ------
NM_138714chr1697477 7161 6813 6301 5732 5563 3159 1773 1767 ------
NM_138717chr64626 595 169 117 1452 ----
NM_138795chr1111513 1507 1256 319 301 290 283 223 190 96 64 --21143 74 --
NM_138799chr241395 809 392 237 --11936 --
NM_138967chr15132109 1574 999 954 924 843 731 388 338 332 326 261 175 ----1789
NM_138971chr1192641 2458 2447 1519 1450 1227 937 113 34 --21146 47 --
NM_138971chr1192641 2458 2447 1519 1450 1227 937 113 34 --21146 47 --
NM_138972chr1192641 2458 2447 1519 1450 1227 937 113 34 --21146 47 --
NM_138972chr1192641 2458 2447 1519 1450 1227 937 113 34 --21146 47 --
NM_138973chr1192641 2458 2447 1519 1450 1227 937 113 34 --21146 47 --
NM_138973chr1192641 2458 2447 1519 1450 1227 937 113 34 --21146 47 --
NM_139057chr1592679 2256 2227 2081 2041 1885 1818 380 87 12579 ----
NM_139067chr123316 84 33 ------
NM_139071chr12111408 1362 1356 1329 1316 1096 1075 1066 678 237 194 ----11201
NM_139132chr116852 841 800 342 286 115 ------
NM_139135chr16926 897 245 223 172 26 ------
NM_139167chr8------1469
NM_139246chr941540 646 489 31 1881 ----
NM_139283chr1232401 800 49 1865 ----
NM_139316chr74927 789 402 270 ------
NM_139323chr2031623 697 45 --11968 --
NM_139343chr23128 43 23 149 ----
NM_139344chr23128 43 23 149 ----
NM_139345chr23128 43 23 149 ----
NM_139346chr23128 43 23 149 ----
NM_139347chr23128 43 23 149 ----
NM_139348chr23128 43 23 149 ----
NM_139349chr23128 43 23 149 ----
NM_139350chr23128 43 23 149 ----
NM_139351chr23128 43 23 149 ----
NM_144568chr143602 446 86 1588 ----
NM_144571chr447014 5356 2261 1816 ------
NM_144577chr198423 412 330 323 312 179 72 21 ------
NM_144578chr14105364 5234 5225 5099 5090 2162 1848 1622 1251 927 --14491 --
NM_144579chr282885 2862 2725 2246 2178 2162 1128 119 1761 12580 --
NM_144582chr292248 2083 1826 1681 1628 265 146 140 51 12481 ----
NM_144586chr26430 241 66 59 47 22 1898 ----
NM_144599chr1565182 4236 3728 1184 553 547 ------
NM_144629chr221096 155 ------
NM_144635chr36492 463 391 384 203 33 --1210 --
NM_144723chr53828 299 270 ------
NM_144732chr19101103 398 347 303 297 257 241 78 33 23 ------
NM_144967chrX3753 414 237 ----1268
NM_144973chr1284822 4790 3967 3959 3790 1714 1535 964 ------
NM_145008chr114767 129 123 30 --196 --
NM_145056chr198800 731 697 691 326 118 54 46 ------
NM_145065chr116452 340 307 159 92 55 1797 ----
NM_145071chr38800 712 375 356 291 197 77 26 ------
NM_145117chr1191302 1204 1194 495 461 263 133 95 58 ------
NM_145173chr19172565 2559 2544 2529 2373 655 549 345 258 231 212 196 156 147 140 71 34 1106 3875 677 45 --
NM_145185chr19222034 1999 1949 1856 1849 1785 1779 1637 1538 1235 804 559 516 502 455 447 415 378 303 178 153 54 1221 ----
NM_145206chr1052293 2176 1030 719 108 ------
NM_145239chr1612447 396 378 315 303 284 259 241 219 104 98 68 ------
NM_145253chr1610681 569 539 525 518 106 97 80 71 22 ------
NM_145279chr141518 1218 466 71 ------
NM_145349chr1761839 1556 1544 892 763 641 41872 835 604 248 ----
NM_145714chr164292 77 70 63 ------
NM_145730chr226707 700 350 327 172 56 11019 2219 201 --
NM_145733chr224985 901 813 806 ------
NM_145804chr1181228 884 519 446 354 270 154 134 21069 1043 1325 --
NM_145861chr131869 1809 471 11264 --11905
NM_145888chr1971935 1856 1658 608 588 324 187 1739 ----
NM_145894chr19346 30 24 ------
NM_145899chr6131247 1239 1079 924 903 532 434 327 242 219 129 87 81 ------
NM_145901chr6131247 1239 1079 924 903 532 434 327 242 219 129 87 81 ------
NM_145902chr6131247 1239 1079 924 903 532 434 327 242 219 129 87 81 ------
NM_145903chr6131247 1239 1079 924 903 532 434 327 242 219 129 87 81 ------
NM_145904chr6131247 1239 1079 924 903 532 434 327 242 219 129 87 81 ------
NM_145905chr6131247 1239 1079 924 903 532 434 327 242 219 129 87 81 ------
NM_145912chr22223801 3766 3729 3690 3590 3584 3574 3143 1875 1710 1645 1439 1189 1076 1023 858 810 581 163 121 96 57 13661 13833 --
NM_146388chr1991171 1111 995 987 876 865 853 490 64 11024 ----
NM_147161chr181157 1145 468 410 281 121 108 32 1796 1150 --
NM_147192chr1121428 625 616 561 466 452 429 417 334 306 256 180 ------
NM_147202chr9152591 2268 2179 2162 2125 2023 1997 1794 769 763 498 485 396 94 71 --12172 --
NM_147223chr251814 1631 758 559 138 ------
NM_147233chr241631 1448 575 376 ------
NM_148414chr167375 319 160 153 146 90 49 ------
NM_148415chr165315 100 93 86 30 ------
NM_148416chr164292 77 70 63 ------
NM_148571chr173598 268 203 11991 ----
NM_148921chr1772215 1956 1530 573 373 213 159 --1168 --
NM_148955chr1554184 1469 1243 112 77 ------
NM_152237chr22141615 1575 1420 1408 1392 1382 1312 1271 584 548 533 495 480 453 41256 1103 1085 354 1489 11333
NM_152253chr22113705 3184 2754 1637 1577 1486 1266 813 548 380 80 ------
NM_152263chr155319 3753 1534 159 36 12257 ----
NM_152264chr117935 740 419 409 287 118 24 ------
NM_152265chr131247 1181 421 ------
NM_152272chr841066 874 385 22 ------
NM_152280chr142412 2406 769 578 --127 --
NM_152296chr199297 286 266 252 236 132 126 59 34 ------
NM_152345chr1791116 943 884 835 829 727 455 261 225 1406 2932 21 --
NM_152346chr17141197 1095 1073 986 881 463 457 451 383 363 313 237 130 87 --155 --
NM_152384chr281611 1562 1435 1387 1262 736 730 469 2760 636 ----
NM_152388chr253715 3607 1334 879 412 ------
NM_152424chrX144756 4580 4209 4159 3836 3345 1753 1422 1280 1192 801 605 539 477 --21897 1646 --
NM_152470chr18123669 3635 3609 3600 3497 3421 3169 3095 2860 2729 1219 933 ------
NM_152493chr1111624 1401 1379 1343 1271 1100 1091 1016 1009 506 76 1552 11278 --
NM_152519chr252034 510 474 79 72 ------
NM_152557chr781436 1396 1194 605 555 497 453 24 --1412 --
NM_152629chr963167 1158 1132 1110 818 511 ------
NM_152636chr1122670 674 ------
NM_152641chr1212574 ----1477
NM_152699chr333241 2838 371 --12764 --
NM_152744chr7103347 2974 2800 2723 1432 1348 1136 421 405 302 21034 771 1277 --
NM_152765chr83861 306 43 21612 173 1737 --
NM_152769chr195799 670 590 313 193 136 1119 --
NM_152787chrX53922 3607 1584 1571 443 ------
NM_152792chr23446 164 24 ------
NM_152826chr1554184 1469 1243 112 77 ------
NM_152857chr6----1922 1261
NM_152858chr6----1922 1261
NM_152860chr12101440 1377 1342 1310 1165 1067 1036 613 489 348 ------
NM_153013chr532526 1736 1625 ------
NM_153029chr16203965 3789 3702 3579 3567 3550 3539 3525 3091 3083 2911 2752 2707 2693 2685 2623 2613 1254 1050 670 --22796 490 --
NM_153035chr152113 2013 588 514 454 1421 ----
NM_153234chr532559 122 24 ------
NM_153262chr142912 2667 2357 673 ------
NM_153273chr362687 2605 2349 717 266 27 12276 ----
NM_153321chr172877 410 ------
NM_153322chr172877 410 ------
NM_153335chr173954 254 27 1399 ----
NM_153350chr16171633 1513 1296 1235 1108 1097 1089 687 622 402 332 287 262 173 111 103 73 2548 158 ----
NM_153367chr10213775 3719 3252 1464 1419 1329 1294 1230 1203 1177 1167 1087 750 715 609 573 416 390 192 108 32 11260 11211 --
NM_153487chr6244792 4784 4724 4663 4509 4390 4358 4319 4271 3839 3803 3761 3676 3440 3395 3323 3296 1783 1598 1246 930 820 36 22 13580 23012 78 --
NM_153499chr1262802 2557 2520 1922 51 35 ------
NM_153500chr1262802 2557 2520 1922 51 35 ------
NM_153619chr1593531 2304 1028 810 653 594 491 434 313 ------
NM_153620chr771824 1789 1171 1152 385 352 26 ------
NM_153631chr731397 586 158 1368 ----
NM_153632chr731397 586 158 1368 ----
NM_153633chr125700 183 43 37 24 ------
NM_153685chr1271000 778 307 301 264 143 56 1870 ----
NM_153686chr432285 1690 1656 ------
NM_153693chr125792 258 165 41 23 ------
NM_153756chr131294 192 139 ------
NM_153810chr1053675 3391 3263 767 486 ------
NM_153827chr173610 580 49 ----1152
NM_153831chr84971 783 748 31 ------
NM_170663chr173610 580 49 ----1152
NM_170706chr193387 2905 2898 1387 1295 670 511 125 52 13111 ----
NM_170731chr1132383 1974 773 ------
NM_170732chr1132383 1974 773 ------
NM_170733chr1132383 1974 773 ------
NM_170734chr1132383 1974 773 ------
NM_170735chr1132383 1974 773 ------
NM_170743chr1102299 2293 1826 918 904 893 446 269 93 86 --2822 311 --
NM_170774chr2083933 3816 3038 2580 1611 1549 107 58 11621 1187 --
NM_171825chr5183011 2772 2653 2582 2375 2348 2116 1267 1258 1193 656 587 459 437 275 228 221 215 12366 1683 --
NM_172071chr196795 6363 6133 2978 2806 2559 2281 2275 427 26422 4848 ----
NM_172103chr642635 2618 2321 1000 ------
NM_172105chr642635 2618 2321 1000 ------
NM_172169chr1041641 1257 167 152 11615 ----
NM_172170chr1041641 1257 167 152 11615 ----
NM_172171chr1041641 1257 167 152 11615 ----
NM_172173chr1041641 1257 167 152 11615 ----
NM_172206chr1791656 1541 1243 521 391 242 148 83 65 --1119 --
NM_172211chr15843 328 317 295 75 --1612 --
NM_172225chr1121428 625 616 561 466 452 429 417 334 306 256 180 ------
NM_172226chr1262802 2557 2520 1922 51 35 ------
NM_172230chr116972 388 307 137 111 47 ------
NM_172375chr144855 247 61 39 ------
NM_172387chr1841467 1377 468 105 --1335 --
NM_172388chr1841514 1424 515 152 --1382 --
NM_172389chr1841514 1424 515 152 --1382 --
NM_173064chr1102299 2293 1826 918 904 893 446 269 93 86 --2822 311 --
NM_173074chr2------1296
NM_173156chr161982 1772 1682 221 211 81 ------
NM_173157chr124409 210 85 74 ------
NM_173171chr241050 138 129 113 ------
NM_173172chr251358 446 437 421 315 ------
NM_173173chr241050 138 129 113 ------
NM_173191chr10121277 1266 1234 1200 1069 942 842 385 301 294 230 214 ------
NM_173192chr10121277 1266 1234 1200 1069 942 842 385 301 294 230 214 ------
NM_173193chr10121277 1266 1234 1200 1069 942 842 385 301 294 230 214 ------
NM_173194chr10121277 1266 1234 1200 1069 942 842 385 301 294 230 214 ------
NM_173195chr10121277 1266 1234 1200 1069 942 842 385 301 294 230 214 ------
NM_173214chr1697477 7161 6813 6301 5732 5563 3159 1773 1767 ------
NM_173470chrX32742 1909 83 ----11902
NM_173475chr1641299 1280 1201 639 ------
NM_173582chr1145752 5032 4083 3894 ------
NM_173595chr12405193 5170 5136 5080 4873 4765 4637 4604 4480 4324 4315 4275 4235 4179 3944 3723 3643 3636 3443 3434 3359 3250 3208 2070 2064 2001 1878 1846 1746 1508 713 700 663 594 392 369 232 220 151 23 31607 1564 327 1445 --
NM_173681chr771860 1836 1438 1356 818 656 366 --21933 266 --
NM_173683chr83689 174 77 ------
NM_173797chr52177 77 ------
NM_173822chr231761 663 593 ------
NM_173832chr8263495 3385 3324 3262 3237 3213 3188 3164 3147 3098 2974 2925 2738 2721 2673 1358 1333 1258 1233 1065 922 847 815 804 652 70 1492 73255 3116 2992 2943 2813 646 133 --
NM_173854chr1102136 2063 1821 1779 1706 665 536 462 90 67 12257 ----
NM_174911chr892504 1291 1142 1117 833 729 678 662 240 ------
NM_174934chr11173355 3347 2492 2359 1270 1136 1017 966 958 924 872 611 604 578 543 166 36 2730 277 --12875
NM_174955chr1771317 1298 945 508 296 288 23 1544 1111 --
NM_174975chr223280 65 28 ------
NM_175575chr1761216 1207 1155 806 322 24 --1304 --
NM_175623chr1265729 5715 4908 4847 1967 429 25198 33 ----
NM_175624chr1265824 5810 5003 4942 2062 524 25293 128 ----
NM_175625chr1265824 5810 5003 4942 2062 524 25293 128 ----
NM_175634chr82460 285 ------
NM_175635chr82460 285 ------
NM_175636chr82460 285 ------
NM_175709chr2282677 2607 2513 2095 1216 1031 346 233 --22684 2520 --
NM_175736chr12257650 6664 6415 6368 6352 6236 5477 5398 5379 5264 5253 4801 3143 2651 2538 2472 2335 1979 1802 1682 1341 820 776 207 32 ------
NM_175747chr63913 826 820 --1168 --
NM_175834chr124388 365 340 25 ------
NM_175861chr1243655 2243 1959 679 ------
NM_175862chr351521 1452 442 291 132 --1557 --
NM_175898chr1571260 587 579 430 343 289 43 11293 11253 --
NM_175900chr1651557 704 568 326 140 ----128
NM_175913chr203849 833 827 --1948 --
NM_175931chr1651641 1551 1430 1350 243 21335 86 ----
NM_176801chr471720 671 464 409 283 220 141 31294 78 66 ----
NM_176863chr1751744 1482 1382 1344 702 --1719 --
NM_177438chr1443342 1512 1397 378 ------
NM_177559chr2021171 51 11006 ----
NM_177560chr2021171 51 11006 ----
NM_177925chr1222175 2047 22595 740 1240 1304
NM_177937chr921425 1273 --11340 11359
NM_177977chr17162058 1978 1888 1873 1620 1441 1354 1343 1306 1257 515 420 300 273 229 112 126 1286 --
NM_177999chr972710 1116 842 768 525 414 264 --23434 999 --
NM_178000chr971443 1415 1217 1026 973 950 82 --1309 --
NM_178001chr971443 1415 1217 1026 973 950 82 --1309 --
NM_178003chr971443 1415 1217 1026 973 950 82 --1309 --
NM_178011chr1032777 1320 111 ------
NM_178013chr1472377 794 656 585 402 291 166 2941 132 21901 1172 --
NM_178037chr1283119 2988 2232 1332 1268 706 142 113 21324 135 13282 --
NM_178038chr1283119 2988 2232 1332 1268 706 142 113 21324 135 13282 --
NM_178126chr1751823 1636 843 398 167 1100 11835 --
NM_178135chr431225 983 310 ------
NM_178151chrX127660 7646 7595 6984 5839 5000 4852 2763 2689 2154 1954 1125 15035 22581 1743 --
NM_178152chrX127660 7646 7595 6984 5839 5000 4852 2763 2689 2154 1954 1125 15035 22581 1743 --
NM_178153chrX127660 7646 7595 6984 5839 5000 4852 2763 2689 2154 1954 1125 15035 22581 1743 --
NM_178426chr12250 227 1727 --1216
NM_178427chr12150 127 1627 --1116
NM_178500chr177784 775 583 570 347 318 85 1557 2750 563 --
NM_178502chr128577 444 246 223 202 164 79 27 --1565 --
NM_178553chr24214 50 34 22 183 ----
NM_178554chr3142949 2559 2502 2341 1444 1427 1171 1045 903 893 798 495 48 24 --11403 11454
NM_178565chr831624 257 158 ------
NM_178585chr452359 2084 574 246 42 ------
NM_178830chr196644 592 564 524 213 118 --1575 --
NM_178832chr1051538 1150 1066 633 50 --11388 --
NM_178842chr1531603 273 21 ------
NM_181349chr752470 2159 2036 211 71 ----12683
NM_181486chr123989 298 254 ------
NM_181505chr173730 638 96 --1216 --
NM_181509chr206376 369 361 280 158 121 ----1347
NM_181521chr16117019 6319 6269 4964 2729 2310 1949 1404 916 489 28 17102 ----
NM_181659chr2052623 2428 1183 609 258 ------
NM_181659chr2052623 2428 1183 609 258 ------
NM_181670chr124455 446 269 75 1249 1521 1210
NM_181672chrX4683 675 474 28 ------
NM_181673chrX4683 675 474 28 ------
NM_181689chr205878 706 205 109 99 --1155 1270
NM_181762chrX4183 158 149 64 ------
NM_181777chrX4183 158 149 64 ------
NM_181784chr262119 840 661 338 183 77 22399 1933 11055 --
NM_181828chr22122979 2918 1423 1417 1283 1249 897 793 622 463 392 341 12951 23623 2911 13053
NM_181829chr22122979 2918 1423 1417 1283 1249 897 793 622 463 392 341 12951 23623 2911 13053
NM_181830chr22122979 2918 1423 1417 1283 1249 897 793 622 463 392 341 12951 23623 2911 13053
NM_181844chr175693 612 397 312 128 ------
NM_181876chr45988 853 784 155 23 ----152
NM_181886chr421174 134 ------
NM_181887chr421174 134 ------
NM_181888chr421174 134 ------
NM_181889chr421174 134 ------
NM_181890chr421174 134 ------
NM_181891chr421174 134 ------
NM_181892chr421221 181 ------
NM_181893chr421174 134 ------
NM_182470chr155567 532 498 40 30 ------
NM_182471chr155567 532 498 40 30 ------
NM_182485chr423069 2521 ------
NM_182507chr1271582 872 824 760 708 523 302 --2944 932 --
NM_182509chr1481635 1535 1496 1202 1040 575 444 160 11256 ----
NM_182511chr1821150 148 --1106 --
NM_182527chr2261849 1693 746 590 535 318 --1568 --
NM_182553chr118571 565 445 384 156 132 116 55 ------
NM_182557chr11102093 1953 1825 1610 890 712 532 521 439 317 11807 11940 --
NM_182643chr842386 2061 1932 535 ----1592
NM_182646chr423069 2521 ------
NM_182663chr131938 1680 188 21657 478 ----
NM_182664chr132068 1810 318 21787 608 ----
NM_182665chr131938 1680 188 21657 478 ----
NM_182705chr1752193 526 357 128 37 152 ----
NM_182728chr14141602 1565 1506 1190 1174 714 695 631 591 304 287 240 96 53 ------
NM_182830chr1431997 1985 597 ------
NM_182847chr27580 564 195 188 140 54 42 ------
NM_182925chr5111434 1425 1363 1349 1279 1240 1188 588 320 176 21 21159 236 1497 --
NM_182964chr1191302 1204 1194 495 461 263 133 95 58 ------
NM_182970chr20183794 3557 3525 3016 2929 2895 2815 2702 1535 1512 1261 997 915 690 512 189 162 140 --12786 1182
NM_183050chr61282 22237 47 --1295
NM_183227chr621561 1411 ------
NM_183373chr67843 397 380 261 107 72 23 --1863 --
NM_194071chr7164865 4225 3578 1830 1565 1406 1276 1126 665 524 512 498 448 341 178 51 ----1485
NM_194248chr25956 861 278 214 55 --4893 640 628 403 --
NM_194278chr14123437 3410 3235 2536 1669 1454 1061 1035 821 730 280 249 --33458 2687 32 --
NM_194286chr12114747 4511 4088 1394 1265 1077 991 969 449 400 71 --11894 --
NM_194291chr822728 442 ------
NM_194292chr131633 1293 1285 ------
NM_194322chr25956 861 278 214 55 --4893 640 628 403 --
NM_194452chr115405 285 268 126 80 --11244 --
NM_194453chr115405 285 268 126 80 --11244 --
NM_197941chr552528 2372 2272 612 314 ------
NM_198040chr141169 1012 792 150 2816 44 ----
NM_198081chr642755 2298 632 392 ------
NM_198089chr194796 325 208 181 ------
NM_198240chr124959 307 301 168 1283 ----
NM_198324chr1291224 1058 939 869 858 850 493 281 199 --11310 --
NM_198390chr16121862 1726 1554 1447 1439 1236 1196 759 638 617 437 183 --21304 1228 --
NM_198465chrX31982 831 692 ------
NM_198560chr3113777 3561 3137 1497 1418 1389 961 546 538 351 312 13653 11082 --
NM_198581chr286305 5218 5092 4959 4624 2764 2735 1087 27257 6530 ----
NM_198595chr4174222 3962 3716 3600 3471 3257 3072 1798 1351 1273 1237 825 802 543 522 364 42 13159 1406 11342
NM_198597chr103983 218 200 ------
NM_198679chr9102600 2334 2325 1694 1676 1049 954 898 714 321 ------
NM_198681chr171437 1334 1199 1074 339 302 222 1237 1367 --
NM_198686chr14132254 1018 1005 762 702 595 556 548 396 325 277 175 46 1889 ----
NM_198712chr13491 214 174 ------
NM_198713chr13491 214 174 ------
NM_198715chr126251 5819 ------
NM_198834chr1782021 1945 1887 1650 1548 397 250 180 ------
NM_198836chr1782021 1945 1887 1650 1548 397 250 180 ------
NM_198837chr1782021 1945 1887 1650 1548 397 250 180 ------
NM_198838chr1782021 1945 1887 1650 1548 397 250 180 ------
NM_198839chr1782021 1945 1887 1650 1548 397 250 180 ------
NM_198859chr364447 3863 3296 1973 1514 731 ------
NM_198900chr12257650 6664 6415 6368 6352 6236 5477 5398 5379 5264 5253 4801 3143 2651 2538 2472 2335 1979 1802 1682 1341 820 776 207 32 ------
NM_198968chr1343816 3526 3171 629 ------
NM_198993chr17131730 1639 1573 1528 1505 1446 1410 1202 608 549 393 360 78 --21557 1115 --
NM_199000chr722204 1561 ------
NM_199004chr175374 352 178 156 64 ------
NM_199054chr1971602 602 436 322 291 283 192 1710 41819 1696 1574 508 --
NM_199072chr722341 254 ------
NM_199144chr2051307 623 615 405 390 --2585 518 11287
NM_199160chr94723 612 378 171 --3826 54 42 --
NM_199169chr20103519 3362 3028 2392 2245 1431 1234 1035 736 128 1880 ----
NM_199170chr20103519 3362 3028 2392 2245 1431 1234 1035 736 128 1880 ----
NM_199171chr20103519 3362 3028 2392 2245 1431 1234 1035 736 128 1880 ----
NM_199203chr2051307 623 615 405 390 --2585 518 11287
NM_199245chr1272353 2330 2073 1894 421 331 182 12090 ----
NM_199262chr17132121 2068 1928 1905 1485 1471 798 438 345 263 257 240 56 ------
NM_199324chr452638 967 240 133 118 13322 ----
NM_199334chr175399 374 174 95 85 ------
NM_199415chr20122389 2348 2309 1976 1664 1622 1597 671 325 304 235 121 1461 1292 178
NM_199454chr1143693 3619 3597 3507 3448 3305 3206 3167 3144 3101 3095 1283 1065 823 --11601 --
NM_199487chr207427 355 278 270 214 204 48 ------
NM_201266chr252752 2741 2232 949 194 ------
NM_201279chr252752 2741 2232 949 194 ------
NM_201378chr871003 882 831 790 297 232 214 --1871 --
NM_201379chr871003 882 831 790 297 232 214 --1871 --
NM_201380chr871003 882 831 790 297 232 214 --1871 --
NM_201381chr871003 882 831 790 297 232 214 --1871 --
NM_201382chr871003 882 831 790 297 232 214 --1871 --
NM_201383chr871003 882 831 790 297 232 214 --1871 --
NM_201384chr871003 882 831 790 297 232 214 --1871 --
NM_201403chr141518 1218 466 71 ------
NM_201428chr1121319 161 ----1515
NM_201429chr1121319 161 ----1515
NM_201430chr1141245 616 601 87 ----1441
NM_201432chr17266483 6385 6325 6189 5976 5486 5376 5168 5094 4896 4158 3990 2635 2533 2517 2155 2141 2133 1762 1250 1037 958 949 764 90 83 26498 236 26504 5990 15337
NM_201433chr17266483 6385 6325 6189 5976 5486 5376 5168 5094 4896 4158 3990 2635 2533 2517 2155 2141 2133 1762 1250 1037 958 949 764 90 83 26498 236 26504 5990 15337
NM_201434chr177606 538 527 521 317 36 26 --1615 --
NM_201520chr17151837 1798 1777 1516 1412 1300 1249 1141 1119 731 513 440 408 328 160 ------
NM_201559chr661703 1673 323 299 282 40 ------
NM_201567chr36650 214 152 143 56 46 ------
NM_201568chr161982 1772 1682 221 211 81 ------
NM_201569chr161982 1772 1682 221 211 81 ------
NM_201632chr591721 1322 1256 604 589 158 148 106 37 1261 ----
NM_201634chr591820 1421 1355 703 688 257 247 205 136 1360 ----
NM_202467chr199540 529 468 452 211 205 174 147 54 --1492 --
NM_202468chr199540 529 468 452 211 205 174 147 54 --1492 --
NM_202469chr199540 529 468 452 211 205 174 147 54 --1492 --
NM_202470chr199540 529 468 452 211 205 174 147 54 --1492 --
NM_202494chr199540 529 468 452 211 205 174 147 54 --1492 --
NM_203305chr992452 1792 1578 728 700 663 648 186 142 --2638 502 --
NM_203318chr1771210 1162 1078 1028 1020 767 320 ------
NM_203342chr153602 2786 567 449 293 --22775 1382 --
NM_203343chr153602 2786 567 449 293 --22775 1382 --
NM_203346chr291921 1759 874 732 671 657 416 91 23 ------
NM_203351chr1772348 1977 1888 1882 1719 1677 200 --2801 295 --
NM_203391chrX31858 262 134 ------
NM_203413chr172756 256 --11114 --
NM_203444chr128917 762 716 687 225 158 74 22 187 2730 194 --
NM_203446chr213729 713 704 11847 ----
NM_203458chr173532 2872 2729 1398 221 200 186 ------
NM_203473chrX5271 112 96 39 28 ------
NM_203474chrX5271 112 96 39 28 ------
NM_203475chrX5271 112 96 39 28 ------
NM_203476chrX5271 112 96 39 28 ------
NM_203506chr1772027 1848 1808 1700 1413 543 132 21946 1604 11437 --
NM_205848chr142423 2414 657 113 ------
NM_205861chr1122103 1585 1566 1411 808 740 723 612 566 131 84 56 ------
NM_206853chr6273 30 ------
NM_206854chr643574 1334 1291 82 ------
NM_206855chr654539 2299 2256 1047 301 ------
NM_206907chr54797 601 580 574 ------
NM_206909chr8107837 7557 7226 7158 6752 3346 3296 2727 1759 832 --12761 --
NM_206914chr1231554 275 187 11434 12142 12046
NM_207015chr332401 2384 705 ------
NM_207111chr782566 1048 973 845 251 244 138 66 12294 2905 350 --
NM_207116chr782566 1048 973 845 251 244 138 66 12294 2905 350 --
NM_207119chr1062314 1895 840 472 406 358 21959 1866 12179 --
NM_207171chr121606 130 1136 ----
NM_207317chr53440 105 23 ------
NM_207372chr1052251 2182 1762 1573 550 ------
NM_207380chr15142939 2882 2361 1448 1288 1186 707 699 666 380 372 230 69 30 1942 22854 930 --
NM_207406chr485278 4173 3998 2312 2241 1118 1082 1052 --12153 --
NM_207518chr199868 400 388 257 220 212 203 133 122 --11241 --
NM_207577chr1182295 2241 2201 1128 363 318 256 216 ------
NM_207645chr114534 485 152 24 ------
NM_212464chr1581917 1718 1668 1622 831 253 207 185 1616 ----
NM_212469chr115864 758 748 684 446 1920 ----
NM_212551chr141072 892 876 326 ------
NM_213589chr244891 4851 4421 1136 ------
NM_213609chr32396 37 ------
NM_213648chr591721 1322 1256 604 589 158 148 106 37 1261 ----
NM_213662chr1782301 2290 1740 1647 406 158 85 21 ------