TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4789-3p
miRNA Sequence: CACACAUAGCAGGUGUAUAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX86925 5994 5815 5254 4581 1442 1125 117 --1572 21111 575
NM_000176chr5103808 3555 3293 2588 2488 1378 1288 668 331 269 13674 53309 3307 3305 3303 2781 --
NM_000212chr173815 232 140 1213 8202 195 193 191 189 181 161 159 1164
NM_000242chr1011098 22598 809 41766 1764 1762 1760 22199 750
NM_000334chr1752043 1683 1671 1514 1445 11547 51689 1687 1685 1659 1403 11394
NM_000337chr555617 1264 155 145 127 --34246 1830 129 2120 114
NM_000378chr1131026 971 47 1407 151054 1052 1050 1048 1046 1044 1042 1040 1038 1036 1034 1032 1030 1028 412 --
NM_000555chrX47870 7729 1684 387 --112556 1696 1694 1692 1690 1688 1686 1654 1652 1650 1648 27873 7732
NM_000793chr1475026 3853 3612 1098 989 274 228 --15108 24667 4294
NM_000814chr1554011 3578 1102 402 140 2753 228 12658 1192
NM_000831chr194898 4182 2481 2376 2234 2220 2120 2063 1945 24601 2365 52240 2238 2236 1971 1947 12084
NM_000875chr1545759 5521 2557 2534 14276 115761 5749 5525 5523 2563 2561 2559 2548 2540 2538 2536 22647 2543
NM_000899chr1274090 3463 2732 1299 1209 865 855 14293 --34314 4299 3466
NM_000921chr122648 641 --23650 598 596 594 592 590 588 586 584 582 580 578 576 574 572 570 568 566 564 562 254 252 250 2257 146
NM_000926chr1189467 8664 8271 5772 2995 2784 2104 470 1127 67020 2800 2798 2796 1946 1504 --
NM_001001484chr1021676 1605 --52223 2211 2209 2207 2064 12067
NM_001001664chr283800 2946 2924 2915 2870 2794 1528 719 --82993 2956 2948 2932 2930 2928 2926 2796 12935
NM_001002914chr173922 893 839 --11915 913 911 909 907 905 903 901 899 897 895 --
NM_001003407chr1085137 4955 4849 4749 3288 1935 1283 1162 --264957 4751 1979 1977 1975 1973 1971 1969 1967 1965 1963 1961 1959 1957 1955 1953 1951 1949 1947 1945 1943 1941 1939 1937 1285 1164 14988
NM_001003408chr1085137 4955 4849 4749 3288 1935 1283 1162 --264957 4751 1979 1977 1975 1973 1971 1969 1967 1965 1963 1961 1959 1957 1955 1953 1951 1949 1947 1945 1943 1941 1939 1937 1285 1164 14988
NM_001003652chr18108619 8604 8361 8071 7717 7440 2738 2731 620 383 --51705 470 387 385 66 37892 1694 306
NM_001003943chr1533069 1374 246 --43845 3837 3812 3395 23848 3840
NM_001004065chr963999 2823 1323 1260 1250 1168 11302 134001 1331 1329 1327 1325 1288 1272 1270 1268 1266 1264 1262 1252 21334 1275
NM_001004317chr653165 892 496 232 225 1724 24158 260 23735 263
NM_001004329chr121386 --3297 295 281 2300 272
NM_001004419chr1264291 3148 1580 1361 571 405 --1573 13364
NM_001005473chr574487 4477 2352 2177 1982 1235 808 11934 24497 4495 34500 2004 1985
NM_001007023chr1475026 3853 3612 1098 989 274 228 --15108 24667 4294
NM_001008220chr5153830 3355 3125 2907 2825 2802 1565 1554 1522 1485 1464 1430 1414 1237 1103 --112909 1454 1361 1359 1313 1280 1258 1256 1241 1239 1197 33358 1433 1221
NM_001009899chr335561 5485 4544 --101204 1202 1200 1198 1196 1184 103 101 99 97 21207 1187
NM_001010853chr63831 652 226 13269 1833 22519 366
NM_001010867chr122547 2499 --82513 2511 2509 2507 2505 2503 2501 719 16084
NM_001010891chr562093 1544 1118 673 418 64 26156 6088 86106 1564 1562 1554 1552 1550 1548 1546 --
NM_001011666chr734847 1954 1852 --174328 3991 2461 1880 1878 1876 1874 1872 1870 1868 1866 1864 1862 1860 1858 1856 1854 24168 3994
NM_001012977chrX41442 1037 1023 559 --161446 1444 1061 1059 1057 1055 1053 1051 1049 1047 1045 1043 1041 1039 1025 902 --
NM_001013620chr1246642 5956 2406 453 12643 68321 6121 6119 5890 5888 5886 26124 5893
NM_001014380chr1365808 4449 4155 4049 3886 1335 14955 23888 774 13891
NM_001017969chr9----18140 138 136 134 132 130 128 126 124 122 120 118 116 114 112 110 108 106 --
NM_001018067chr175031 4853 3792 3780 3540 1826 507 2911 334 163820 3818 3816 3814 3812 3810 3808 3806 3804 3802 3800 3798 3796 3794 3782 968 --
NM_001018068chr175031 4853 3792 3780 3540 1826 507 2911 334 163820 3818 3816 3814 3812 3810 3808 3806 3804 3802 3800 3798 3796 3794 3782 968 --
NM_001018069chr175031 4853 3792 3780 3540 1826 507 2911 334 163820 3818 3816 3814 3812 3810 3808 3806 3804 3802 3800 3798 3796 3794 3782 968 --
NM_001018074chr5103808 3555 3293 2588 2488 1378 1288 668 331 269 13674 53309 3307 3305 3303 2781 --
NM_001018075chr5103808 3555 3293 2588 2488 1378 1288 668 331 269 13674 53309 3307 3305 3303 2781 --
NM_001018076chr5103808 3555 3293 2588 2488 1378 1288 668 331 269 13674 53309 3307 3305 3303 2781 --
NM_001018077chr5103808 3555 3293 2588 2488 1378 1288 668 331 269 13674 53309 3307 3305 3303 2781 --
NM_001020818chr1921708 707 21681 700 13733 731 729 727 725 723 721 719 717 715 713 711 709 --
NM_001020819chr1921708 707 21681 700 13733 731 729 727 725 723 721 719 717 715 713 711 709 --
NM_001020820chr1921708 707 21681 700 13733 731 729 727 725 723 721 719 717 715 713 711 709 --
NM_001020821chr1921708 707 21681 700 13733 731 729 727 725 723 721 719 717 715 713 711 709 --
NM_001024094chr5103808 3555 3293 2588 2488 1378 1288 668 331 269 13674 53309 3307 3305 3303 2781 --
NM_001024401chr1642869 2820 1139 665 12467 42490 2488 2480 2472 22483 2475
NM_001024649chr562713 2376 2321 2191 1850 671 --62327 2325 2323 867 675 673 --
NM_001024956chr1164704 1903 1892 1783 1032 772 --44583 3558 3556 1034 --
NM_001025076chr1066049 3900 2420 2285 1126 1024 --32287 1171 422 16119
NM_001025077chr1057407 5258 2484 2382 1276 --22529 1780 17477
NM_001025108chr233634 1544 153 13657 51235 807 195 165 155 23637 198
NM_001025580chrX54238 3662 3513 2738 964 --73419 3417 1515 1507 1505 1503 1501 --
NM_001031804chr1644331 4310 3526 3066 13497 5490 488 486 484 482 11713
NM_001033117chr364490 3873 1539 409 365 128 --2351 349 43305 905 412 354
NM_001037165chr7118904 8406 8157 7608 6207 3581 2869 2145 2078 1355 332 --158436 8434 8432 8430 8428 8426 8424 8422 8420 8418 8416 8414 8412 8410 8408 18439
NM_001039590chrX53901 3705 3002 1488 1328 1226 --11331
NM_001039591chrX53901 3705 3002 1488 1328 1226 --11331
NM_001039618chr1165551 5420 4776 4511 3827 505 14540 3370 368 366 --
NM_001039840chrX55274 5127 3799 1637 231 35382 2226 1736 55286 5278 5276 4842 1756 --
NM_001040020chr72573 110 21476 293 1461 2464 76
NM_001040110chr731502 1481 270 --51483 296 288 286 272 3321 291 275
NM_001042486chr2041514 1073 1061 1021 ----31097 1076 1064
NM_001042555chr1243348 3251 1821 432 13245 23253 948 13256
NM_001042603chr1235290 3645 3266 14951 43857 3647 1511 1438 34965 4356 3860
NM_001042604chr354654 1800 1098 1091 198 11615 64009 4007 4005 3353 518 516 1110
NM_001044385chr223272 2847 187 --23885 2723
NM_001106chr3129716 9195 8947 8190 8055 7011 6833 6254 3112 2684 1383 560 --58951 8949 8192 7604 2882 --
NM_001390chr1843082 2632 255 197 --123614 3557 3555 3553 3551 3549 3547 3545 3543 3541 3539 257 --
NM_001668chr131943 1592 537 --9561 559 557 555 553 551 549 547 539 1542
NM_001695chr853240 2755 1463 549 439 1221 2861 44 1552
NM_001746chr562713 2376 2321 2191 1850 671 --62327 2325 2323 867 675 673 --
NM_001858chr644984 4804 4794 4437 11031 11844 24797 1911
NM_002025chrX139119 9099 8291 8253 7896 7080 6460 5668 3671 3301 2396 1643 782 --128295 8293 8269 8267 8265 8263 8261 8259 8257 8255 8174 7898 19077
NM_002040chr211462 1292 32662 2031 2029 32034 1079 195
NM_002069chr731680 1660 1388 --151565 1563 1561 1559 1557 1555 1553 1551 1549 1547 1545 1543 1541 1312 597 11568
NM_002126chr1793941 3917 2668 1271 969 701 196 179 164 --173959 3957 3949 3947 3945 3943 3929 3927 3925 3923 3921 3919 3668 181 151 149 147 13952
NM_002233chr111305 --6325 323 321 319 317 307 1310
NM_002270chr535432 4762 2049 11675 62131 2129 2127 2125 2123 2121 11154
NM_002285chr233634 1544 153 13657 51235 807 195 165 155 23637 198
NM_002313chr1085137 4955 4849 4749 3288 1935 1283 1162 --264957 4751 1979 1977 1975 1973 1971 1969 1967 1965 1963 1961 1959 1957 1955 1953 1951 1949 1947 1945 1943 1941 1939 1937 1285 1164 14988
NM_002336chr1284036 3792 3734 3461 3450 3437 1414 1316 11681 3661 659 657 --
NM_002522chr1741401 786 334 320 13529 141437 1435 1433 1431 1424 1422 1420 1418 1416 1414 1412 324 322 304 --
NM_002591chr203419 412 403 ----1438
NM_002594chr2031927 1864 1813 --21805 227 51936 1930 1877 1867 1816
NM_002655chr865293 4050 3842 3311 2086 949 --25098 3844 25101 39
NM_002737chr1725268 1766 36684 6581 781 96403 6401 4433 1772 1770 1768 1758 1541 1539 21852 1544
NM_002833chr1531357 580 208 21501 560 6525 523 521 519 517 515 1538
NM_002843chr1133296 3099 961 22632 1387 53244 1045 1043 1041 1025 11048
NM_002886chr32908 887 1876 84438 914 912 910 901 899 891 889 1894
NM_002959chr134390 3559 1212 --63870 3868 1515 824 822 349 13873
NM_003034chr1267620 2989 2421 1580 1251 56 --217038 3071 3027 3025 3023 3021 3019 3017 3015 3013 3011 3009 3007 3005 3003 3001 2999 2997 2995 2993 2991 13030
NM_003043chr343645 1519 179 158 14146 9185 183 181 168 166 164 162 160 146 1171
NM_003144chr632274 2261 243 1235 3226 224 116 1804
NM_003199chr1855198 4861 4456 4384 4165 1965 65672 4863 2165 2163 2161 1977 14866
NM_003298chr386038 4094 4057 3954 2045 1319 591 85 21245 442 34885 998 351 34103 4097 354
NM_003326chr11395 --172166 2164 2162 2160 2006 2004 1811 1809 1807 1805 1803 1801 1799 1791 1789 1787 397 11814
NM_003458chr343953 3678 3652 2766 --93692 3690 3688 3686 3684 3682 3680 1517 1515 23655 3635
NM_003459chr24630 590 491 269 --19575 552 550 548 546 544 542 540 538 536 534 532 530 528 526 524 522 520 518 --
NM_003463chr653162 1352 1175 938 433 11131 23327 1354 13154
NM_003574chr1885473 5233 3833 3533 2134 1580 1344 861 1882 45479 5477 5475 5235 1115
NM_003762chr111200 ----21038 82
NM_003895chr2122110 81 1138 --2469 157
NM_003994chr1274090 3463 2732 1299 1209 865 855 14293 --34314 4299 3466
NM_004171chr1188903 8381 7600 7474 2847 2624 2560 2498 13452 58383 8331 8329 3722 883 --
NM_004430chr852380 572 546 522 506 --9574 552 550 548 538 536 534 532 524 2888 527
NM_004443chr33675 637 629 --11679 677 655 653 651 649 647 645 643 641 639 --
NM_004464chr494340 4239 4113 4074 4066 4048 2955 722 528 --14332 2700 694
NM_004504chr241961 352 155 38 12081 11963 1911
NM_004571chr2173216 3185 2970 391 207 199 165 --14209 191 189 187 185 183 181 179 177 175 173 171 169 167 --
NM_004748chr1554126 3916 3076 649 520 12735 --1523
NM_004904chr734847 1954 1852 --174328 3991 2461 1880 1878 1876 1874 1872 1870 1868 1866 1864 1862 1860 1858 1856 1854 24168 3994
NM_005011chr731502 1481 270 --51483 296 288 286 272 3321 291 275
NM_005056chr1245534 3889 3510 94 15195 44101 3891 1755 1682 35209 4600 4104
NM_005099chr141246 476 458 446 --6480 478 466 464 462 460 1449
NM_005126chr33825 497 83 12083 1746 172
NM_005160chr2276730 6381 5418 4468 993 861 443 --206017 4506 4504 4502 4500 4498 4496 4494 4492 4490 4488 4486 4484 4482 4480 4478 4476 4474 4472 4470 --
NM_005188chr1188080 7350 6706 6434 5749 3302 2326 368 21633 526 146774 3276 2380 2378 2376 977 723 430 428 396 376 374 372 370 --
NM_005197chr1495687 5228 5181 5062 4846 4038 3759 1729 1685 24823 1799 25689 5064 --
NM_005238chr1163567 2236 2228 2216 2186 296 --252289 2287 2285 2283 2281 2279 2277 2275 2273 2271 2269 2267 2265 2263 2261 2259 2257 2255 2253 2251 2238 2220 2218 826 824 --
NM_005359chr1885739 5712 5207 4331 2436 1668 1624 128 11491 15714 1653
NM_005509chr531526 671 592 1208 8608 606 604 602 600 598 596 594 1611
NM_005613chr132047 434 134 11906 1530 3623 456 444
NM_005725chr122299 212 --42301 2133 2131 2129 12304
NM_005828chr1764484 4197 1403 459 275 194 --11431 23980 278
NM_005840chrX117135 7019 6182 6153 5891 5636 4872 2694 2066 1967 824 24854 813 41969 830 828 826 --
NM_005901chr18108619 8604 8361 8071 7717 7440 2738 2731 620 383 --51705 470 387 385 66 37892 1694 306
NM_005935chr475129 4679 1996 1876 1744 1695 998 --54659 4651 4649 2012 1998 34662 4654 2001
NM_005937chr1773778 3237 2860 1492 778 762 754 11573 203185 3183 3181 1510 1508 804 802 800 798 796 794 792 790 788 786 784 782 780 766 764 --
NM_005955chr143878 3518 716 403 14730 51287 1285 1283 1281 427 23737 3633
NM_006203chr565332 5035 3679 2111 1300 1002 --45535 4458 988 986 --
NM_006206chr422845 230 1693 62399 2397 2395 2393 2391 2389 --
NM_006212chr185406 5399 5390 4554 4411 4354 4290 451 --3453 163 41 15409
NM_006226chr23247 226 211 --12271 269 267 265 263 261 259 257 255 253 251 249 --
NM_006300chr1932096 891 796 12252 42230 893 352 350 145
NM_006544chr1435837 5639 2231 --45829 5827 5825 5823 15840
NM_006561chr1066049 3900 2420 2285 1126 1024 --32287 1171 422 16119
NM_006595chr11--21517 708 6754 752 750 748 746 744 1757
NM_006599chr1677830 6168 5344 2884 1939 1481 562 --42279 1941 1496 1483 15347
NM_006650chr5153830 3355 3125 2907 2825 2802 1565 1554 1522 1485 1464 1430 1414 1237 1103 --112909 1454 1361 1359 1313 1280 1258 1256 1241 1239 1197 33358 1433 1221
NM_006654chr1243348 3251 1821 432 13245 23253 948 13256
NM_006717chr943414 2933 2579 2389 23287 3184 32567 981 415 1418
NM_006720chr1085137 4955 4849 4749 3288 1935 1283 1162 --264957 4751 1979 1977 1975 1973 1971 1969 1967 1965 1963 1961 1959 1957 1955 1953 1951 1949 1947 1945 1943 1941 1939 1937 1285 1164 14988
NM_006729chrX1217 2350 241 1259 31826 1117 1107
NM_006750chr1697799 7714 7297 6149 5048 3007 2783 2566 1626 18050 17299 --
NM_006813chr63710 688 303 --2663 21 2192 24
NM_006827chr1463191 2455 2129 1202 403 315 1691 --1660
NM_006918chr1164704 1903 1892 1783 1032 772 --44583 3558 3556 1034 --
NM_007007chr1254102 3367 1504 1267 226 3846 785 441 103387 3385 3383 3381 3379 3377 3375 3373 3371 3369 13390
NM_007011chr1566841 5912 4681 2422 1391 317 --51158 1156 1154 1152 403 --
NM_007036chr52804 237 --3762 239 197 2765 242
NM_007068chr22--11021 6238 230 228 226 224 222 1241
NM_007125chrY--1432 3910 908 476 2919 913
NM_007173chr1142168 582 403 94 --11405 395 112 110 108 106 104 102 100 98 96 1115
NM_007203chr963999 2823 1323 1260 1250 1168 11302 134001 1331 1329 1327 1325 1288 1272 1270 1268 1266 1264 1262 1252 21334 1275
NM_007249chr1388881 8487 8187 7712 6439 6354 3047 2033 --13280 18309
NM_007276chr72930 730 --12403 401 399 397 395 393 391 389 387 385 383 381 1406
NM_012081chr543355 2527 1298 749 11045 32502 766 366 23449 545
NM_012448chr1732274 2205 356 --13212 210 208 206 204 202 200 198 196 194 192 190 182 --
NM_013261chr473534 2723 2573 1313 1037 336 299 --113419 2706 1317 1315 362 338 329 327 315 313 311 1318
NM_013269chr1264218 3075 1507 1288 498 332 --1500 13291
NM_013390chr931681 1627 1345 --141795 1653 1651 1649 1647 1645 1643 1641 1639 1637 1635 1633 1631 1629 --
NM_013449chr1242820 480 432 404 --311054 1052 1050 1048 1046 1044 1042 1017 1015 1013 1011 1009 1007 1005 1003 980 978 976 974 972 970 968 966 964 962 960 958 956 954 952 950 --
NM_013989chr1475026 3853 3612 1098 989 274 228 --15108 24667 4294
NM_013995chrX41748 1639 944 614 12139 181641 460 458 456 454 452 450 448 446 444 442 440 438 436 434 432 430 428 --
NM_014023chr1072505 2470 2377 2345 860 319 172 --122379 2367 2365 2363 2361 2359 2357 2355 2353 2351 2349 2347 --
NM_014112chr834947 4585 3869 --61698 1696 1694 1692 1690 821 --
NM_014293chr2284061 4051 4043 3274 2520 1130 1006 178 --94081 4079 4077 4069 4067 4065 4063 4053 3751 24072 594
NM_014319chr1241654 1501 1326 678 11903 4706 704 696 680 4709 699 683 541
NM_014325chr122845 254 11580 51824 1812 1810 479 477 11815
NM_014331chr457630 7498 5586 5231 289 15687 166863 6861 6416 5235 5233 1682 1680 1678 1676 1674 1672 1670 1668 1666 1658 1656 37291 1685 1661
NM_014423chr565353 2000 1077 702 663 131 25496 3683 53577 3575 3573 953 704 --
NM_014452chr621144 96 --19140 138 136 134 132 130 128 126 124 122 120 118 116 114 112 104 102 100 98 --
NM_014702chr64367 318 302 289 11171 102699 2697 2695 2693 2691 2689 2687 2685 2683 2681 --
NM_014705chr742047 1822 1595 336 --12049 22052 1494
NM_014725chrX1365 --101215 1185 1175 1173 1171 1169 1167 1165 1163 1161 21218 1178
NM_014739chr633860 1530 1496 --51322 1320 1318 1316 715 13098
NM_014747chr175662 4478 1569 313 181 169 161 --5410 189 187 185 183 1192
NM_014767chr1083499 3358 2800 1153 242 203 191 147 --82406 221 219 217 215 213 211 149 1206
NM_014850chr364490 3873 1539 409 365 128 --2351 349 43305 905 412 354
NM_014877chr1741963 752 588 196 1879 56569 6417 6285 1733 754 --
NM_014888chr72573 110 21476 293 1461 2464 76
NM_014902chr2041514 1073 1061 1021 ----31097 1076 1064
NM_014904chr1052566 997 983 606 536 --1608 23418 3412
NM_014936chr63810 799 782 32877 2848 2363 22249 790 --
NM_014947chr162915 2777 2384 1943 887 241 12892 102779 1953 1951 1949 1947 1945 1921 1912 1910 1908 1358
NM_014982chr1465294 5282 3923 3768 3491 108 21186 724 75300 5298 5296 3931 3929 3927 3925 13934
NM_014992chr142237 125 1136 1151 1154
NM_015026chr1231766 1367 645 --21114 316 21117 502
NM_015071chr556497 6209 5551 5016 2220 --85810 5808 5800 5798 5796 4458 4272 1940 25813 5803
NM_015094chr2231085 1044 939 --113625 1078 1070 1068 1066 1050 1048 1046 1032 404 402 11053
NM_015265chr222653 399 --1401 21859 404
NM_015310chr878050 5727 5602 2129 942 932 442 16307 4934 920 918 916 13218
NM_015365chrX54238 3662 3513 2738 964 --73419 3417 1515 1507 1505 1503 1501 --
NM_015455chr574096 3480 2968 2669 563 307 219 --142996 2994 2992 2990 2988 2986 2984 2982 2980 2978 2976 2974 2972 2970 --
NM_015458chr841941 1699 783 692 25243 4835 51392 1052 939 927 925 1920
NM_015569chr184241 4138 3234 3104 3056 1334 633 95 --84249 4217 4215 4213 4211 4209 4207 3309 34244 3245 3155
NM_015578chr19--11676 19451 449 447 439 437 435 433 431 429 427 425 423 421 419 417 415 413 411 409 22106 442
NM_015603chr19----1754 52 50 48 46 44 42 40 38 36 34 32 30 28 26 24 22 --
NM_015640chr175031 4853 3792 3780 3540 1826 507 2911 334 163820 3818 3816 3814 3812 3810 3808 3806 3804 3802 3800 3798 3796 3794 3782 968 --
NM_016083chr662980 2446 1089 899 550 465 21507 451 31099 1097 1069 11092
NM_016133chr251647 1320 1296 676 125 --21298 1284 21490 128
NM_016206chr369001 8065 7881 3321 2118 389 18324 38867 7990 6304 --
NM_016248chr1352939 2675 1372 684 232 21389 226 201374 1364 720 718 716 714 712 710 708 706 704 702 700 698 696 694 692 690 688 686 21377 723
NM_016260chr2117425 7417 7376 7247 6492 6172 4771 2695 2316 1547 447 --47437 7427 6892 5116 27440 7395
NM_016271chr18--192 42028 1674 1672 930 2933 913
NM_016272chr2282712 2522 2065 977 925 824 392 180 1756 52067 979 830 828 826 1833
NM_016275chr321842 265 --5592 273 271 269 267 1595
NM_016339chr1721409 450 11793 27555 502 500 498 496 494 492 490 488 486 484 482 480 478 476 474 472 470 468 466 464 462 460 458 456 454 452 --
NM_016376chr17113640 3611 3499 2992 2979 2775 2763 1661 1538 1203 184 --62996 2994 1585 1377 188 186 21588 1478
NM_016507chr1721976 770 --52962 2960 2958 2374 407 22965 2387
NM_016587chr72930 730 --12403 401 399 397 395 393 391 389 387 385 383 381 1406
NM_016946chr152990 1084 1008 161 139 --143122 3120 3118 3116 3114 3112 3110 3108 3106 3104 1128 1046 1044 1042 11011
NM_017415chr564596 4338 1109 640 370 300 14328 103629 318 316 314 312 310 308 306 304 302 24286 321
NM_017447chr2154022 1708 956 505 421 1466 144160 4158 4156 4154 4152 4150 4148 4146 4144 4142 4140 4138 4136 4134 14025
NM_017551chr1012310 --132352 2350 2348 2346 2344 2342 2340 2332 2330 2328 2326 643 641 1144
NM_017586chr932066 228 47 --132025 1577 1575 1561 1559 1557 1555 1553 1551 1549 1547 1545 1543 11564
NM_017633chr633473 303 106 22917 1014 51144 1040 1038 1036 1019 43259 2811 1043 1022
NM_017637chr968918 7845 3298 3038 1188 94 38634 2963 848 10114 112 110 108 106 104 102 100 98 96 --
NM_017709chr154269 3827 1238 1196 1105 --193949 3947 3831 3829 3819 3817 3815 3813 3811 3809 3807 2674 2672 2670 2668 2660 2658 2656 1456 12663
NM_017714chr205926 324 289 217 206 --4249 247 236 198 1231
NM_017719chr352528 2437 2031 1752 1678 --32439 2306 1921 12309
NM_017789chr23723 312 288 --8625 336 334 332 324 322 320 290 1327
NM_017813chr855576 5463 2277 2269 685 --75578 3730 2271 657 655 653 651 1646
NM_017824chr101700 1590 16742 730 728 726 724 722 720 718 716 714 712 710 708 706 704 702 1733
NM_017848chrX84421 3160 3027 1732 1013 935 912 880 --221035 1023 1015 890 872 870 868 866 864 862 860 858 856 854 852 850 848 846 844 842 840 838 41038 1026 1018 938
NM_017902chr10135145 3880 3715 3510 2202 2032 1726 952 934 912 336 328 263 13914 244708 1728 966 964 962 960 958 956 954 944 942 940 938 936 922 920 918 916 914 875 867 865 853 338 1301
NM_018121chr1033182 2828 2355 --173192 3190 3188 3186 3184 956 954 952 950 948 946 944 942 940 938 936 934 12477
NM_018201chr922538 535 --21577 575 573 571 569 567 565 563 561 559 557 555 553 551 549 547 545 543 541 539 537 --
NM_018257chr2072524 2211 2005 1954 1648 600 68 12306 --1807
NM_018437chr91189 --12213 211 209 207 205 203 201 199 197 195 193 191 1216
NM_018440chr888178 7717 7670 7376 5895 5583 3183 2968 1957 17639 17720
NM_018566chr175058 3741 3475 1867 1736 633 187 11302 1189 --
NM_018638chr1264095 3992 3799 284 218 201 11887 15534 --
NM_018836chr141240 932 408 49 --51242 1069 1035 985 983 31072 1038 988
NM_019001chr354654 1800 1098 1091 198 11615 64009 4007 4005 3353 518 516 1110
NM_019044chr224083 1385 24546 1431 44559 4557 4457 4455 14460
NM_019106chr2212653 --203433 198 196 166 164 162 160 158 156 154 152 150 148 146 144 142 140 138 136 134 --
NM_019114chr941752 806 98 70 --12345 21989 287
NM_019556chrX31464 1448 1399 1501 31468 1466 1438 11471
NM_020465chr1642039 1642 800 793 --131619 1617 1615 1613 1611 1609 1607 1605 1603 1601 1599 1597 802 11622
NM_020718chr1656445 1470 1231 1091 147 12029 81570 151 149 131 129 127 125 123 --
NM_020727chr2173184 3045 2895 2691 1350 270 64 ----13187
NM_020734chr1222428 727 32285 1120 273 31125 1103 1101 22718 1096
NM_020739chr1554126 3916 3076 649 520 12735 --1523
NM_020772chr1756878 6760 6333 3111 1119 27818 3192 157214 3149 3147 3145 3125 3123 3121 3119 3117 3115 3113 2239 1340 1338 1336 17805
NM_020858chr1542098 790 578 530 32372 2075 255 17606 604 602 600 598 596 594 592 590 588 586 584 582 580 570 568 360 --
NM_020917chr1933607 2920 68 --33374 1376 1374 11379
NM_021629chr334822 1551 1276 11481 2438 436 2441 259
NM_021813chr634544 4428 4398 11044 265113 4445 3644 2293 2291 2289 2287 2285 2283 2281 2279 2277 2275 2273 2271 2269 2267 2265 2263 2261 2259 2257 2255 2253 2251 2249 --
NM_021912chr1554011 3578 1102 402 140 2753 228 12658 1192
NM_021914chr1452439 1698 981 899 289 ----11957
NM_021961chr1177233 6823 6711 5267 1311 179 51 --47304 5868 5249 894 21208 1198
NM_021964chr376149 6089 5262 4882 2593 481 347 --46242 4884 1985 1983 --
NM_022048chr15106055 5805 5797 5458 5410 5399 5377 5346 4680 1718 --65379 5370 5368 5366 5364 655 --
NM_022459chr1355255 4867 4822 1078 272 --31957 1955 1533 11946
NM_022648chr284321 4301 3926 3888 3465 1859 671 583 --54303 3918 3916 2910 585 21774 929
NM_022733chr131153 820 802 --7822 808 806 804 790 788 407 21195 811
NM_022763chr372946 2680 2588 2465 2173 2020 419 1575 1943 1422
NM_022781chr9102474 2025 567 527 467 452 445 272 136 81 22503 491 31133 529 245 1532
NM_022910chr1642039 1642 800 793 --131619 1617 1615 1613 1611 1609 1607 1605 1603 1601 1599 1597 802 11622
NM_024052chr1752776 2756 2474 1214 95 --131240 1238 1236 1234 1232 1230 1228 1226 1224 1222 1220 1218 1216 11243
NM_024423chr1844129 791 734 611 --2795 793 23017 798
NM_024424chr1131026 971 47 1407 151054 1052 1050 1048 1046 1044 1042 1040 1038 1036 1034 1032 1030 1028 412 --
NM_024425chr1131026 971 47 1407 151054 1052 1050 1048 1046 1044 1042 1040 1038 1036 1034 1032 1030 1028 412 --
NM_024426chr1131026 971 47 1407 151054 1052 1050 1048 1046 1044 1042 1040 1038 1036 1034 1032 1030 1028 412 --
NM_024595chr11345 --1355 3364 358 348
NM_024900chr45789 705 561 252 152 --131836 1834 1826 1468 698 661 659 657 655 653 651 649 563 11829
NM_024900chr45789 705 561 252 152 --131836 1834 1826 1468 698 661 659 657 655 653 651 649 563 11829
NM_024949chr453351 3210 1209 1114 259 1319 11116 11889
NM_024989chr278061 8014 5720 5707 5474 5142 1977 28151 1290 27741 37 37976 7964 2665
NM_025090chr1715606 392 357 348 321 279 270 241 212 185 159 145 122 108 64 3298 257 228 9359 281 243 214 187 161 147 79 66 4378 273 111 82
NM_025160chr144129 3845 3023 2898 --104135 4133 4131 3866 3864 3862 3853 3851 3849 3847 --
NM_025248chr1782834 2707 2700 2683 2645 2545 2435 2147 12539 92661 2649 2647 2579 2547 2526 2388 2361 2359 --
NM_030647chr775962 5933 5922 2436 2318 625 472 1788 45935 5924 476 474 21217 100
NM_030664chr1021676 1605 --52223 2211 2209 2207 2064 12067
NM_030916chr13341 229 220 1299 5253 251 249 212 210 --
NM_032116chr1365808 4449 4155 4049 3886 1335 14955 23888 774 13891
NM_032121chrX52261 1995 918 463 61 32624 471 154 3514 512 63 --
NM_032160chr1823945 92 --6118 102 100 98 96 94 14342
NM_032373chr1084997 2231 1484 1474 1055 678 515 80 1760 11442 --
NM_032682chr343429 3032 3025 143 12664 113431 3413 3411 3409 3407 3405 3403 3401 3399 3397 543 1546
NM_032810chr1041353 1325 1148 44 11551 2375 373 1392
NM_032826chr785244 4405 4228 4179 3586 1954 1513 1292 24238 1300 121703 1701 1699 1697 1695 1683 1681 1679 1677 1675 1533 1405 11686
NM_032968chrX54007 3936 3767 1417 343 23501 195 --11636
NM_032969chrX54007 3936 3767 1417 343 23501 195 --11636
NM_032975chr1843082 2632 255 197 --123614 3557 3555 3553 3551 3549 3547 3545 3543 3541 3539 257 --
NM_032980chr1843082 2632 255 197 --123614 3557 3555 3553 3551 3549 3547 3545 3543 3541 3539 257 --
NM_033083chr353133 3127 3059 2975 1247 --113079 3077 3075 3073 3071 3069 3067 3065 3063 3061 2977 33082 2980 2324
NM_033143chr4104671 4570 4444 4405 4397 4379 3286 1053 859 94 --14663 21031 1025
NM_033181chr662980 2446 1089 899 550 465 21507 451 31099 1097 1069 11092
NM_033213chr13549 220 44 --13575 573 571 569 567 565 563 561 559 557 555 553 551 1578
NM_033285chr854178 4046 3969 3755 58 11775 24411 3971 2561 61
NM_052874chr163708 585 292 --13730 728 726 724 722 720 718 716 714 712 710 587 294 --
NM_053025chr321654 1628 --71669 1667 1646 1644 1263 1261 1259 11266
NM_053026chr321654 1628 --71669 1667 1646 1644 1263 1261 1259 11266
NM_053027chr321654 1628 --71669 1667 1646 1644 1263 1261 1259 11266
NM_053028chr321654 1628 --71669 1667 1646 1644 1263 1261 1259 11266
NM_053031chr321654 1628 --71669 1667 1646 1644 1263 1261 1259 11266
NM_053032chr321654 1628 --71669 1667 1646 1644 1263 1261 1259 11266
NM_080546chr932296 779 82 --3104 74 72 2107 85
NM_133468chr742246 743 429 86 --1709 2712 127
NM_138373chr1921708 707 21681 700 13733 731 729 727 725 723 721 719 717 715 713 711 709 --
NM_138426chr732468 2282 207 1810 141731 1729 1727 1725 1723 1721 1719 1717 1715 1713 1711 1709 917 209 11734
NM_138459chr632819 2620 161 12695 42246 167 165 163 23104 1116
NM_138473chr1254946 4486 3477 1843 1183 --171845 1831 1725 1723 1721 1719 1717 1715 1713 1711 1709 1707 1705 1703 1701 1699 1697 11728
NM_138638chr1452439 1698 981 899 289 ----11957
NM_138713chr1677830 6168 5344 2884 1939 1481 562 --42279 1941 1496 1483 15347
NM_138714chr1677830 6168 5344 2884 1939 1481 562 --42279 1941 1496 1483 15347
NM_144973chr1263842 3430 1992 696 218 209 --24988 1010 24263 221
NM_144975chr173678 313 259 --15289 287 285 283 281 279 277 275 273 271 269 267 265 263 261 1316
NM_198511chrX21678 399 11543 191818 1816 1714 1712 1710 1708 1531 1529 1527 1525 1523 1521 1519 1517 1515 1513 1511 1509 557 31687 1681 1534
NM_198560chr363726 3669 2778 1256 1236 1226 --91270 1268 1266 1264 1262 1260 1258 1238 1228 11210
NM_198715chr155306 4194 259 247 159 --35308 1325 1323 --
NM_206909chr878050 5727 5602 2129 942 932 442 16307 4934 920 918 916 13218
NM_207497chr641345 1075 595 564 --14588 586 584 582 580 578 576 574 572 570 568 566 316 314 --
NM_213589chr255332 969 669 312 174 1404 4314 139 137 135 5209 203 177 142 130