TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4790-3p
miRNA Sequence: UGAAUGGUAAAGCGAUGUCACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr11103525 2743 2548 1130 853 675 645 483 222 111 22190 30 ----
NM_000084chrX156946 6670 6263 5870 5835 5581 4738 2718 2252 2129 1793 1671 1628 1462 1416 36172 5975 2521 21532 1405 --
NM_000092chr284535 3291 3159 3119 1816 1257 1085 339 --13359 13751
NM_000109chrX52638 2244 1728 758 338 ----11757
NM_000115chr134608 486 330 115 1834 ----
NM_000125chr6104152 3803 3300 3023 2930 1536 1460 1334 642 582 33368 2922 141 13568 --
NM_000138chr1572606 2465 1862 1827 965 853 620 2404 283 21670 134 --
NM_000151chr175601 354 323 112 64 ----11819
NM_000163chr532301 2202 1462 11946 11812 11494
NM_000167chrX31310 327 290 ----191
NM_000168chr782644 2335 2213 2200 1173 1090 976 205 11262 12772 --
NM_000176chr533395 1159 988 23904 1450 12469 --
NM_000212chr1772076 1915 1884 588 411 373 26 1713 ----
NM_000217chr1284181 3665 3300 1772 1572 1017 653 211 24419 1008 14529 15128
NM_000248chr372371 2024 945 886 541 459 308 ------
NM_000259chr1586167 5733 5724 4081 2302 1989 1599 603 15907 11629 --
NM_000267chr1773452 3424 3397 3232 3003 2521 354 12753 ----
NM_000314chr1043297 3223 2055 1176 --22746 2040 --
NM_000321chr1361764 1601 1545 1538 1490 575 2482 231 ----
NM_000332chr6136692 5505 5450 2874 2834 2752 2549 2357 2240 1988 1967 1669 42 35179 1896 1169 --1591
NM_000337chr565492 4582 4158 1610 1281 1140 14425 --22180 342
NM_000362chr2242572 2441 961 336 12417 1464 22786 217
NM_000391chr1181678 1175 644 577 378 341 324 100 ------
NM_000393chr252082 1929 1904 1651 469 2720 55 --1793
NM_000397chrX52527 1583 679 522 489 11940 11779 --
NM_000408chr263456 3106 2803 2768 2350 778 1196 ----
NM_000428chr1432085 1946 570 12675 12403 --
NM_000430chr1753796 3151 3066 948 795 --21455 870 --
NM_000439chr562268 2015 535 518 501 313 --11771 --
NM_000441chr75862 803 110 91 67 ------
NM_000448chr1173020 2965 2844 2177 2098 1240 588 13258 ----
NM_000449chr161125 1110 1049 937 111 90 1542 --1486
NM_000461chr373445 3295 1425 593 259 181 55 2796 488 11454 --
NM_000489chrX83438 3345 2907 2607 981 711 459 381 --21383 167 22991 2574
NM_000508chr44677 382 354 307 2865 253 ----
NM_000555chrX157219 7141 6749 6717 6163 5830 5824 4888 3043 2922 2451 2000 1987 1376 49 22588 1979 ----
NM_000599chr284560 1618 1312 1091 996 769 672 486 ------
NM_000609chr1062821 2805 2212 2067 2003 243 --31248 645 151 --
NM_000610chr1182885 2848 2268 2258 563 406 50 35 22812 2718 ----
NM_000617chr121120 --21611 242 12285
NM_000618chr1286520 6383 5648 4745 4587 2553 1029 710 76146 4683 2420 2081 1799 1443 376 ----
NM_000618chr1286520 6383 5648 4745 4587 2553 1029 710 76146 4683 2420 2081 1799 1443 376 ----
NM_000633chr1895217 5167 4719 3834 3799 1872 1322 435 224 23423 486 14472 11736
NM_000671chr451338 1226 870 328 297 1137 ----
NM_000719chr12106644 6503 5680 4859 4722 4137 1717 1571 992 965 24579 117 26427 375 12603
NM_000788chr451416 1335 1052 984 314 ------
NM_000793chr1494513 3751 3452 1723 1664 1374 1111 1082 280 11252 ----
NM_000800chr541368 1288 354 85 --11357 11434
NM_000809chr458971 8547 5917 3204 2036 43586 2552 683 120 36166 2101 1781 --
NM_000813chr5155475 5438 5085 4428 4359 4159 3898 3643 2259 2142 2009 1892 1556 1280 143 11008 1153 --
NM_000814chr1583749 3671 3555 3250 2952 2726 2674 1457 --21309 977 --
NM_000824chr44914 863 119 37 --1357 --
NM_000829chr1162012 1960 1765 1671 908 290 11773 ----
NM_000831chr175638 5415 5308 5087 991 672 368 16082 16187 --
NM_000838chr652623 2568 2098 2075 1084 12532 ----
NM_000875chr1586523 6247 5985 5774 5208 4838 1827 678 187 36095 4569 570 --
NM_000899chr1274067 4000 2716 1437 1094 939 883 32892 1116 672 34231 4116 332 23707 3348
NM_000902chr3103247 3167 2761 2056 946 883 785 572 562 213 12956 13098 13053
NM_000926chr11147945 7897 7476 6837 6389 6201 3189 2743 2589 2572 2277 2219 1176 658 37398 2861 1681 21329 604 --
NM_000950chrX63592 2455 1153 544 169 30 ------
NM_000961chr2043144 3126 2672 542 41418 936 461 297 12887 --
NM_001001331chr342396 1857 613 447 1963 --12680
NM_001001389chr1182885 2848 2268 2258 563 406 50 35 22812 2718 ----
NM_001001390chr1182885 2848 2268 2258 563 406 50 35 22812 2718 ----
NM_001001391chr1182885 2848 2268 2258 563 406 50 35 22812 2718 ----
NM_001001392chr1192931 2894 2314 2304 609 452 96 81 59 22858 2764 ----
NM_001001395chr1262459 1954 722 360 287 245 12802 1349 --
NM_001001396chr144159 3813 1432 328 42853 827 655 511 ----
NM_001001481chr893189 3009 2984 2735 2641 2418 934 590 255 1401 --166
NM_001001664chr233861 2723 1296 13319 11574 --
NM_001001668chr1953862 2906 1387 299 245 32964 2631 207 ----
NM_001001711chr1161001 448 400 330 186 86 1988 ----
NM_001001928chr2298364 7824 6958 5707 5320 2990 1216 979 385 46740 5513 2547 368 37570 6273 5861 1325
NM_001002257chr243477 953 857 115 --12649 --
NM_001002258chr231994 1925 672 21557 225 ----
NM_001002296chr841180 563 362 348 31267 288 129 194 --
NM_001002860chr1494610 4079 3791 3429 3198 3003 935 616 47 --13541 --
NM_001003652chr18168713 8673 7232 6157 6112 5816 5380 5350 5253 1677 1629 1444 1045 751 745 644 32825 1742 1313 26358 5405 --
NM_001003674chr1897077 6551 6427 5813 5375 4403 2430 1601 1330 25820 2669 14397 16723
NM_001003675chr1897077 6551 6427 5813 5375 4403 2430 1601 1330 25820 2669 14397 16723
NM_001003681chr2262040 1993 630 621 572 41 --1404 --
NM_001003688chr45897 794 775 470 33 ------
NM_001003712chr1243407 3148 2961 510 13815 11582 12544
NM_001004065chr9103724 3168 2564 1282 1147 987 822 656 482 87 13058 12701 --
NM_001004419chr1264245 3953 3581 3482 3419 132 34466 4287 1399 ----
NM_001005353chr121054 1015 21286 39 21310 976 --
NM_001005353chr121054 1015 21286 39 21310 976 --
NM_001005386chr222223 1576 173 42085 2069 955 273 --
NM_001005463chr1062360 2229 1856 788 209 162 --1362 --
NM_001005473chr586105 4899 4852 4428 2297 2044 201 88 25849 2450 ----
NM_001005474chr31135 11608 177 11292
NM_001006605chr151040 825 287 246 191 11183 124 --
NM_001006605chr151040 825 287 246 191 11183 124 --
NM_001006623chr252179 1935 1762 1740 289 22074 232 12588 --
NM_001007023chr1494513 3751 3452 1723 1664 1374 1111 1082 280 11252 ----
NM_001007097chr975093 5019 4549 3255 3105 1903 1842 34809 1623 1244 24929 4897 --
NM_001007257chr121430 1046 --21282 1040 --
NM_001007466chr684507 4331 3944 3658 1799 1139 439 37 23279 920 13912 --
NM_001008239chr1873837 3628 3538 3493 3175 1419 1366 22978 1455 11441 --
NM_001008408chr7115565 5502 4993 4160 2554 1971 1331 1195 1135 1055 989 1662 15538 --
NM_001008495chr852118 1884 1468 892 160 2597 587 ----
NM_001008564chr1341725 1713 291 273 ----143
NM_001008738chr552420 2362 2307 2204 1789 --1782 11011
NM_001008801chr1962074 1903 1839 828 818 365 1554 ----
NM_001009894chr1221503 26 1151 1113 --
NM_001009899chr365940 5870 5082 4803 4282 878 15496 25390 5013 --
NM_001009959chr242227 2024 357 344 --12102 1587
NM_001009993chr244466 4310 3090 269 --24323 965 --
NM_001010000chr1853395 2776 2560 2255 1102 --1859 --
NM_001010861chr142252 1797 499 316 2414 58 --1604
NM_001010862chrX43142 3084 2549 461 12697 13183 --
NM_001010888chrX94665 4352 4300 3632 3204 1612 1528 1484 122 --11813 13933
NM_001010891chr566555 6292 5050 4818 1420 148 26398 4290 16146 --
NM_001010923chr641314 600 409 202 --21580 429 --
NM_001010986chrX82375 2236 1775 1603 818 396 377 141 ------
NM_001011513chr473932 3794 3635 3382 3123 1050 265 11010 33734 3483 852 --
NM_001011666chr7135822 5399 5179 4806 4209 4200 4098 2270 1829 1732 762 616 300 65699 5384 4593 4544 1085 800 --24486 649
NM_001012393chr1154918 3369 2008 952 621 --43731 3610 1224 306 1228
NM_001012420chr1582675 2513 2356 1171 850 722 494 310 12329 1325 --
NM_001012423chr1582675 2513 2356 1171 850 722 494 310 12329 1325 --
NM_001012751chr1071588 1555 1508 1482 511 322 56 1673 21774 1666 --
NM_001012755chrX85044 4838 4815 4422 4141 976 762 280 2897 887 21985 1035 --
NM_001012761chr582265 2205 2114 2035 1071 922 707 385 ------
NM_001012968chrX72395 2142 1926 1845 1043 803 259 --1637 12759
NM_001013406chr741742 1553 504 427 11270 11388 --
NM_001013415chr431354 566 350 ----11284
NM_001013659chr19104902 4890 4781 4758 4476 1331 1101 1048 375 139 11018 21447 1433 --
NM_001014797chr1096265 6001 5263 3087 2937 2324 1141 773 152 ------
NM_001015877chrX32383 940 243 --157 13105
NM_001015882chr9--1257 --1314
NM_001017368chr1732432 2389 504 ----12073
NM_001017424chr121853 583 ----1397
NM_001017425chr121853 583 ----1397
NM_001017440chr7148243 7983 7003 6368 6288 3286 3105 3021 844 760 635 607 554 394 47994 7964 5548 1685 11323 1128
NM_001017995chr574583 4184 3875 3300 2980 1931 1628 24362 836 24804 82 --
NM_001018065chr9115200 4922 4841 4297 4269 2325 1944 1519 1318 1067 813 14582 --26040 5767
NM_001018066chr9115200 4922 4841 4297 4269 2325 1944 1519 1318 1067 813 14582 --26040 5767
NM_001018067chr164842 4656 3406 1776 949 758 23722 112 11608 21016 121
NM_001018068chr164842 4656 3406 1776 949 758 23722 112 11608 21016 121
NM_001018069chr164842 4656 3406 1776 949 758 23722 112 11608 21016 121
NM_001018074chr533395 1159 988 23904 1450 12469 --
NM_001018075chr533395 1159 988 23904 1450 12469 --
NM_001018076chr533395 1159 988 23904 1450 12469 --
NM_001018077chr533395 1159 988 23904 1450 12469 --
NM_001024094chr533395 1159 988 23904 1450 12469 --
NM_001024455chrX72193 2173 1882 1796 1062 930 83 21852 1657 1923 --
NM_001024649chr572782 2601 2403 2201 1943 1859 1114 12895 --1379
NM_001024660chr33592 208 89 1494 1423 --
NM_001024948chr152381 2132 975 525 506 12157 13369 --
NM_001025076chr1075902 5350 4369 1932 1015 953 562 --25404 3939 --
NM_001025077chr1087260 6708 5727 4609 2373 2311 1920 1017 --36762 5297 4694 --
NM_001025079chr393830 3780 3640 3473 3254 2941 2704 619 604 --23685 2597 --
NM_001025233chr1232729 2719 619 2546 394 --11114
NM_001025252chr8103074 2992 1181 1045 933 902 675 662 230 176 1925 1692 --
NM_001025253chr8103074 2992 1181 1045 933 902 675 662 230 176 1925 1692 --
NM_001025266chr364805 3815 1915 1554 1520 391 21352 1239 --24544 1926
NM_001025580chrX74310 4289 4156 3077 3001 1124 699 23610 2989 198 --
NM_001025603chr161125 1110 1049 937 111 90 1542 --1486
NM_001029858chr683329 3172 1115 1013 797 691 624 371 32605 2172 1155 22540 1295 --
NM_001029863chr663041 3005 2168 967 592 243 --33072 2809 2588 --
NM_001029875chr552802 2182 1181 556 478 12304 ----
NM_001030007chr1683681 3357 3091 2935 2736 890 780 22 13028 ----
NM_001030055chr1474689 4608 4024 4001 3833 3574 1782 14371 43512 3221 1159 277 34651 3985 3826
NM_001031732chr473669 3577 3272 2885 2833 2674 880 --12397 --
NM_001031804chr1684360 4218 3353 2876 2753 1616 875 861 14107 --1424
NM_001032394chr672821 2728 2529 1784 584 561 522 32351 809 73 1886 12542
NM_001032395chr672688 2595 2396 1651 451 428 389 22218 676 1753 12409
NM_001033045chr294092 3413 2733 1735 1585 1532 1154 961 841 ------
NM_001033117chr384057 3324 3184 1948 1827 1470 1069 1058 23935 3721 ----
NM_001034954chr1082892 2226 1287 903 842 770 624 372 13132 --152
NM_001034955chr1082892 2226 1287 903 842 770 624 372 13132 --152
NM_001034956chr1082892 2226 1287 903 842 770 624 372 13132 --152
NM_001034957chr1082892 2226 1287 903 842 770 624 372 13132 --152
NM_001035chr151333 1186 1177 1089 1036 11122 1254 1841
NM_001035003chr411304 3958 473 462 145 --
NM_001035004chr411304 3958 473 462 145 --
NM_001037132chr752243 896 690 606 29 1207 ----
NM_001037133chr752243 896 690 606 29 1207 ----
NM_001037317chr142252 1797 499 316 2414 58 --1604
NM_001037334chr1842071 1649 1626 56 1879 2408 294 --
NM_001037954chr1183364 2348 1359 1221 1110 915 745 251 11190 21085 360 --
NM_001038702chr562686 851 681 567 396 350 --1240 --
NM_001039547chr3138084 7274 7205 7071 6482 6418 4935 2486 2117 1646 1475 1421 1267 16286 16435 --
NM_001039618chr1165583 5465 5387 1193 857 194 14298 14312 --
NM_001039840chrX125583 4790 3923 2248 1628 1520 1100 903 871 852 358 259 15049 ----
NM_001039937chr1374003 3034 2567 2522 743 568 149 24116 1136 --11215
NM_001040001chr641924 1475 631 448 1198 11546 1441
NM_001040142chr271823 1641 861 666 462 449 24 32265 874 578 ----
NM_001040143chr271823 1641 861 666 462 449 24 32265 874 578 ----
NM_001040202chr472491 1899 1851 1808 1788 987 70 ------
NM_001040214chr641949 1695 1594 334 --21924 1484 --
NM_001040284chr1693684 1674 1615 1569 1433 1301 1183 1013 960 15166 25188 490 --
NM_001040429chr134853 695 603 82 12507 --1970
NM_001040441chr1104875 4868 3431 1871 1517 1393 1017 607 164 154 13705 --1587
NM_001040446chr532196 1782 829 ----12502
NM_001040624chr832216 489 261 ----12608
NM_001040625chr832216 489 261 ----12608
NM_001040626chr832216 489 261 ----12608
NM_001040627chr832216 489 261 ----12608
NM_001040628chr832216 489 261 ----12608
NM_001040629chr832216 489 261 ----12608
NM_001040630chr832216 489 261 ----12608
NM_001040665chr754982 4612 3531 1319 48 23132 969 14940 24686 1495
NM_001040712chr993589 3312 2763 2629 2550 2340 804 701 127 11043 1582 12724
NM_001040876chr441555 714 639 341 131 11902 --
NM_001042355chr1685406 5395 5201 4579 1184 760 659 393 1714 34172 1994 1350 --
NM_001042404chr171995 1715 1611 621 477 182 27 --21585 431 --
NM_001042406chr641262 897 68 26 ----11068
NM_001042412chr1685406 5395 5201 4579 1184 760 659 393 1714 34172 1994 1350 --
NM_001042413chr983861 2753 2637 1643 1507 1171 696 179 11491 22723 2679 --
NM_001042453chrX81706 1359 1110 443 359 250 165 145 ------
NM_001042473chr1061961 1757 776 594 357 293 --12002 --
NM_001042492chr1773452 3424 3397 3232 3003 2521 354 12753 ----
NM_001042493chr641244 562 184 175 ----11682
NM_001042494chr1521278 677 ----13753
NM_001042495chr1521278 677 ----13753
NM_001042496chr1521278 677 ----13753
NM_001042497chr1521278 677 ----13753
NM_001042510chr872107 2045 1903 1471 1363 751 585 ----11695
NM_001042511chr872107 2045 1903 1471 1363 751 585 ----11695
NM_001042543chr451348 1155 520 429 114 --11009 11567
NM_001042555chr1294638 3900 3766 3589 3208 1770 1722 1561 827 33334 1668 840 11815 13304
NM_001042599chr2137777 7627 7414 7379 6828 4937 3032 2312 1916 1631 1618 1401 1126 26018 2536 --16057
NM_001042601chr383120 3038 2786 2771 2547 715 370 184 --151 --
NM_001042603chr12105208 4892 4741 4601 3932 1980 1398 1334 1288 1118 1899 ----
NM_001042604chr374573 4196 3106 1019 396 320 93 ------
NM_001042681chr162622 2170 1877 880 634 582 ----12133
NM_001042682chr162622 2170 1877 880 634 582 ----12133
NM_001042682chr162622 2170 1877 880 634 582 ----12133
NM_001042683chr631693 1259 486 --21726 1245 --
NM_001044305chr62192 108 11185 --1493
NM_001044385chr283786 3699 3681 3513 2797 1036 289 47 --12953 --
NM_001046chr552792 2641 1131 806 780 22324 1057 --22415 478
NM_001071775chr131734 --21947 1515 11375
NM_001106chr3109763 8568 7586 7043 3653 3540 3297 2241 1740 1170 29563 8110 11618 12456
NM_001121chr1041789 1660 1559 74 ----1759
NM_001126chr131011 811 215 ----1424
NM_001128chr1683681 3357 3091 2935 2736 890 780 22 13028 ----
NM_001167chrX86422 5137 4620 4258 1395 569 510 201 --26781 6459 --
NM_001173chr1474689 4608 4024 4001 3833 3574 1782 14371 43512 3221 1159 277 34651 3985 3826
NM_001186chr2162591 2581 2092 2005 1175 466 1289 13002 --
NM_001198chr651777 633 617 472 325 1866 --1388
NM_001201chr4103935 3742 3214 2691 2406 1392 1320 1201 919 39 33961 3348 3271 11053 1685
NM_001204chr2156252 6146 6097 6051 5649 5641 5207 3021 2499 2405 1041 895 887 764 43 12412 12236 32689 1898 1220
NM_001259chr796192 6089 5278 5270 5105 4190 1155 798 290 15303 11966 14332
NM_001304chr1752943 2828 2366 1056 675 33667 3314 2950 13426 --
NM_001351chr331460 743 70 11553 21604 1310 --
NM_001364chr1194604 4203 3785 3535 3238 3184 3106 1863 1298 23764 669 --11174
NM_001390chr1843603 3498 2497 720 11424 13429 1578
NM_001396chr2142785 1959 1794 245 1294 1873 --
NM_001401chr921196 494 21149 282 11179 --
NM_001419chr1954906 4219 3381 2950 1186 23918 341 24609 4535 --
NM_001432chr473673 3473 3418 2896 870 166 64 12566 ----
NM_001438chr1103538 3194 2509 2430 2349 822 792 361 304 291 32522 1084 916 --23023 2712
NM_001453chr621744 1353 11266 11468 1708
NM_001490chr953725 3640 3579 1195 372 23740 2353 1397 23424 1273
NM_001497chr932712 2274 2241 12220 1467 1129
NM_001554chr11131 ----1643
NM_001560chrX72178 1757 1656 963 207 61 54 --1851 1109
NM_001616chr273516 3309 3250 2499 2292 736 464 13209 ----
NM_001621chr711059 1123 22521 671 --
NM_001621chr711059 1123 22521 671 --
NM_001655chr1141599 1473 1397 862 --11405 2881 749
NM_001663chr1432602 2512 2253 151 --11838
NM_001683chr342396 1857 613 447 1963 --12680
NM_001684chr153876 3530 1593 1149 45 42570 544 372 228 ----
NM_001689chr231994 1925 672 21557 225 ----
NM_001695chr873834 3590 2617 1416 1092 323 314 --23956 649 --
NM_001742chr741869 1309 104 41 1339 --1228
NM_001746chr572782 2601 2403 2201 1943 1859 1114 12895 --1379
NM_001755chr1652265 2196 1461 519 426 ------
NM_001759chr1254875 4750 4630 4462 2088 1420 31219 957 526 --
NM_001777chr393830 3780 3640 3473 3254 2941 2704 619 604 --23685 2597 --
NM_001819chr20------2117 82
NM_001830chrX73866 3702 1566 1529 790 710 666 13447 ----
NM_001845chr1351292 1095 1020 356 350 ------
NM_001854chr141130 420 333 61 11201 --1128
NM_001858chr6124996 4957 4426 3967 3924 3392 3281 431 340 204 156 144 ------
NM_001859chr933803 751 228 13013 23041 1454 11068
NM_001875chr241113 970 920 830 2876 224 11004 --
NM_001918chr1189035 8957 8946 8234 7011 6825 6743 5913 5875 5734 3104 3072 2260 2223 2186 1254 1137 720 29164 2170 ----
NM_001933chr1421141 537 1265 --11346
NM_001942chr1831579 1494 1316 11951 2485 310 --
NM_001949chr642486 2094 1009 728 1832 1860 12074
NM_001992chr542222 2179 2018 764 11504 --12109
NM_002006chr4104730 4425 4281 3539 2332 1821 1373 395 382 151 ----14839
NM_002015chr1352239 2201 999 521 243 12639 22833 1294 12998
NM_002024chrX22002 1896 12133 2304 37 1326
NM_002025chrX128808 8209 7552 7484 7354 6686 6165 6064 6028 3287 1455 1229 ----38827 5843 1360
NM_002035chr1833475 891 305 1779 1216 12851
NM_002040chr2163220 2491 2409 2235 1113 372 ------
NM_002069chr761839 1237 1217 647 562 404 ------
NM_002092chr494866 4506 3955 3789 3390 3208 1853 1839 1599 ------
NM_002126chr1773586 3547 3186 2989 682 225 129 --21535 861 13226
NM_002128chr1342236 1905 835 535 21937 1016 12000 --
NM_002158chr2103541 3419 3374 3137 2469 2415 1272 1230 1165 847 12386 ----
NM_002182chr382345 1992 1913 1748 724 492 305 70 22728 1068 22172 154 22795 2665
NM_002196chr2021117 972 ----11126
NM_002196chr2021117 972 ----11126
NM_002203chr584158 3753 3719 3631 3155 2746 1509 970 23092 694 --12770
NM_002214chr755246 4656 3912 922 905 24349 4222 15692 --
NM_002232chr131134 1125 136 11223 --195
NM_002253chr4--1236 --11370
NM_002254chr252174 1555 930 877 845 31777 906 562 --11454
NM_002264chr384889 4093 3468 3101 1629 1223 582 349 24693 1780 24460 3699 --
NM_002270chr555519 3565 2027 1999 1856 23890 294 11963 --
NM_002336chr1284540 3658 3255 3122 1082 1017 860 598 23622 3301 14065 --
NM_002356chr652844 2100 1841 876 812 --2220 205 --
NM_002372chr5132 ----2632 463
NM_002451chr943920 2903 1137 1046 13888 1268 --
NM_002500chr2----122 11137
NM_002515chr1482045 1945 1751 1297 666 657 271 49 ------
NM_002519chr1111456 11236 11311 1444
NM_002526chr621079 307 --11205 1352
NM_002543chr1261450 1190 1020 458 245 63 11506 ----
NM_002545chr1154918 3369 2008 952 621 --43731 3610 1224 306 1228
NM_002577chr373351 3117 1375 1314 784 740 36 53987 3719 2854 326 270 1133 --
NM_002628chr351217 1136 971 808 141 --1428 --
NM_002641chrX31599 607 364 11609 11636 31500 645 133
NM_002645chr1162854 2791 2058 1972 964 215 22343 462 21953 858 --
NM_002655chr885184 4985 4334 3715 1122 924 299 269 14499 2177 61 --
NM_002670chr351560 1341 1205 1175 444 --1294 --
NM_002677chr892521 1967 1113 1083 1043 919 912 879 36 1249 ----
NM_002711chr75890 767 193 179 118 ----2784 76
NM_002716chr1173675 1377 1141 973 219 206 139 1620 1413 --
NM_002719chr1482167 1824 1732 1717 1710 907 263 117 --12313 --
NM_002731chr162887 2224 1076 317 271 108 22218 732 21926 573 --
NM_002736chr72696 468 22157 2105 11733 11796
NM_002737chr17126429 6284 6176 5060 4129 2001 1597 1121 755 700 504 299 26535 5264 56706 6552 6224 4449 2326 --
NM_002740chr362667 2406 939 932 387 373 142 187 --
NM_002822chr12----174 1737
NM_002837chr1274403 3954 3847 1542 941 916 251 13632 --13480
NM_002839chr993589 3312 2763 2629 2550 2340 804 701 127 11043 1582 12724
NM_002843chr1163334 2872 2239 1246 729 335 12171 ----
NM_002873chr51121 154 --1348
NM_002886chr3105156 5090 4848 4725 4475 3967 1696 1493 1430 1116 ----14415
NM_002906chr1142329 2167 1680 1635 --22204 744 11959
NM_002938chr4102025 1750 1652 1646 1607 1508 672 631 544 75 ----11868
NM_002940chr441555 714 639 341 131 11902 --
NM_002941chr361339 1013 643 236 212 145 ------
NM_002959chr164238 4203 3698 2749 2710 1255 --11473 --
NM_002994chr43706 542 350 --11869 --
NM_003016chr1761996 1415 1366 449 242 106 ------
NM_003068chr841057 799 706 354 ------
NM_003074chr321899 392 --22311 331 1919
NM_003081chr2021122 819 --1974 1813
NM_003094chr11913 --1208 1175
NM_003099chr15116344 6326 6072 5257 4108 2134 1904 1866 738 674 158 22528 2108 16538 21584 506
NM_003108chr296556 6539 5648 5472 4641 1838 1513 600 361 25067 4929 ----
NM_003112chr783073 2770 2756 2415 2291 1070 654 110 --12620 --
NM_003128chr232002 924 769 1409 2544 397 --
NM_003149chr321336 1037 21680 1425 --11415
NM_003161chr1753454 2934 869 787 668 --12261 --
NM_003199chr18115499 5142 4575 4504 4140 4107 3822 1917 1042 583 102 1898 14554 1244
NM_003246chr15102013 1958 1950 1769 1734 1357 782 750 559 293 ------
NM_003262chr3123601 3399 1732 1588 1125 1072 702 520 404 215 197 175 23317 245 21924 1229 11981
NM_003298chr3106245 5953 5905 4247 3831 2316 1977 1925 553 110 34511 4451 2328 1580 151
NM_003319chr2133 1715 --1250
NM_003338chr103394 200 125 1735 1110 --
NM_003339chr5177 1400 --11468
NM_003340chr421396 429 21362 143 1328 --
NM_003342chr1732991 2353 995 33248 477 401 ----
NM_003385chr231017 997 253 263 48 ----
NM_003387chr242080 2011 1038 377 22256 717 12217 11870
NM_003392chr354365 2924 1742 641 623 3964 922 419 24276 126 --
NM_003406chr861847 1754 1617 562 380 30 11284 21515 54 --
NM_003423chr1982078 1772 1681 1012 384 341 271 216 11958 ----
NM_003463chr6102673 2627 2607 2599 2094 1284 643 552 452 300 ------
NM_003468chr244258 3715 3048 1609 32862 1590 1496 11487 --
NM_003471chr341723 608 230 197 --22378 2108 --
NM_003489chr2153343 3072 2531 1229 709 1314 1892 13276
NM_003557chr161576 1452 621 580 314 291 ------
NM_003566chr1232925 2340 83 2782 216 ----
NM_003574chr1885602 5078 4832 4688 3633 1655 1235 917 23916 414 2104 74 --
NM_003583chr1232609 1210 916 ----13153
NM_003590chr253784 3553 995 127 72 23412 3231 13206 --
NM_003597chr232002 1948 430 21538 831 1649 --
NM_003603chr42768 360 11915 --12008
NM_003607chr174122 3836 3617 3558 1685 1487 235 --13437 24056 2916
NM_003615chr363990 3541 3308 3232 1482 878 12460 --2694 213
NM_003622chr1252341 2240 2053 906 679 1298 --12109
NM_003659chr25981 471 346 214 138 ----1935
NM_003663chr363341 3084 3029 2668 2415 593 1911 ----
NM_003671chr9103385 3016 1452 1347 1241 972 841 502 475 330 13136 ----
NM_003722chr331675 924 613 --1440 32183 1876 1091
NM_003783chr111037 1946 --1824
NM_003799chr18134524 4237 3876 3864 3687 3677 3226 2840 1499 1440 925 574 252 --24121 1009 --
NM_003800chr682231 1710 1633 709 614 567 465 64 12103 ----
NM_003825chr152980 26 ----1996
NM_003848chr33719 65 37 --1632 1393
NM_003850chr133568 476 49 ----1166
NM_003861chr1462704 2626 2306 2071 1021 188 ----11897
NM_003872chr2103051 2674 2461 2354 1011 793 663 595 418 35 --11215 12930
NM_003899chr1352470 2303 994 356 257 1587 --21816 1711
NM_003901chr1052705 1836 980 894 887 12026 2912 264 --
NM_003913chr673768 3601 3530 2990 1625 1303 942 14218 24287 4028 --
NM_003930chr7102532 2337 2259 2215 1727 1563 375 337 293 266 ------
NM_003934chr951202 872 526 188 39 ------
NM_003941chr762449 2028 1727 817 346 259 ------
NM_003966chr5187725 6867 6091 6084 6010 5980 5047 4893 4763 2991 2836 2674 2640 2288 1855 1022 649 207 47823 7626 2951 1247 --37859 2455 1391
NM_003980chr641298 1053 213 120 --11138 --
NM_003994chr1274067 4000 2716 1437 1094 939 883 32892 1116 672 34231 4116 332 23707 3348
NM_004006chrX52638 2244 1728 758 338 ----11757
NM_004007chrX52638 2244 1728 758 338 ----11757
NM_004009chrX52638 2244 1728 758 338 ----11757
NM_004010chrX52638 2244 1728 758 338 ----11757
NM_004011chrX52638 2244 1728 758 338 ----11757
NM_004012chrX52638 2244 1728 758 338 ----11757
NM_004013chrX52638 2244 1728 758 338 ----11757
NM_004014chrX52638 2244 1728 758 338 ----11757
NM_004015chrX52638 2244 1728 758 338 ----11757
NM_004016chrX52552 2158 1642 672 252 ----11671
NM_004017chrX52638 2244 1728 758 338 ----11757
NM_004018chrX52552 2158 1642 672 252 ----11671
NM_004020chrX52638 2244 1728 758 338 ----11757
NM_004021chrX52552 2158 1642 672 252 ----11671
NM_004022chrX52552 2158 1642 672 252 ----11671
NM_004023chrX52552 2158 1642 672 252 ----11671
NM_004087chr341647 206 192 41 32030 1653 1383 ----
NM_004096chr1031866 1636 699 --21601 181 1429
NM_004098chr1021139 1029 ----11014
NM_004109chr1172114 1935 1753 870 482 156 119 12056 ----
NM_004113chr341738 1687 486 66 159 --1586
NM_004114chrX3826 806 146 21272 1049 1135 --
NM_004117chr652196 1900 1403 834 699 --11457 --
NM_004124chr1493353 3238 3094 2182 1243 685 418 308 295 33406 2259 1373 12252 --
NM_004136chr1593150 2660 2619 2545 2539 1017 889 839 441 --2591 281 --
NM_004171chr1198236 7246 3738 3184 3136 3094 2990 2821 1518 28158 3112 27008 6333 --
NM_004172chr53214 80 48 --11927 21787 1397
NM_004232chr1873072 2839 2742 2587 2408 422 105 11252 23752 2483 --
NM_004274chr1483085 2195 2153 2133 1268 668 577 565 ----1768
NM_004323chr972014 1702 1048 917 885 613 111 --11787 11798
NM_004331chr822697 82 --12510 1350
NM_004338chr1897077 6551 6427 5813 5375 4403 2430 1601 1330 25820 2669 14397 16723
NM_004346chr421543 1018 ----1505
NM_004392chr1352323 2024 1684 1075 735 --1342 --
NM_004397chr1173592 3323 2917 2786 1666 1554 818 13530 24013 665 1479
NM_004423chr352668 2554 367 317 26 12277 --1401
NM_004438chr252215 1322 1163 375 360 12279 --12340
NM_004440chr641962 1868 603 424 --1409 --
NM_004457chr23483 111 95 --1133 --
NM_004458chrX21719 1685 11823 1105 1479
NM_004459chr1761942 1906 1656 233 203 57 ------
NM_004464chr494267 4203 3604 3389 3334 1526 1366 917 500 1575 130 --
NM_004496chr1451342 1061 1052 887 121 ----1936
NM_004501chr153581 3533 768 724 354 23632 931 ----
NM_004504chr2102764 2666 2207 2187 2111 1865 971 485 439 430 ------
NM_004505chr1761980 1802 1633 1451 576 222 ------
NM_004514chr172681 481 12196 33009 2254 924 --
NM_004540chr213861 643 163 1720 174 --
NM_004586chrX65352 4907 4066 1936 1723 557 22182 1830 13375 --
NM_004612chr951932 1822 1082 812 583 21756 1474 ----
NM_004650chrX31729 506 228 --11445 11198
NM_004663chr1521466 42 11209 1376 11311
NM_004666chr651281 1109 1016 978 970 ------
NM_004709chrX21521 51 41233 467 455 443 21294 1274 --
NM_004717chr761416 1334 1295 1162 556 530 ----11276
NM_004719chr1232456 1010 65 ----12191
NM_004726chrX105375 4195 3629 1683 1663 1654 1599 1364 577 240 15579 ----
NM_004745chr8116755 6720 6629 6488 6477 5257 5168 1704 1676 1324 484 36574 6461 4564 12782 1876
NM_004755chr141783 2831 158 1242 --
NM_004760chr742252 1894 1838 1562 --11915 --
NM_004815chr1104618 4424 3897 3815 3526 2999 1341 1132 917 300 33906 3434 1973 41908 1884 883 494 --
NM_004842chr621681 240 1344 --11191
NM_004857chr1454357 4092 1785 1468 1055 13191 23388 1582 23475 944
NM_004859chr1732921 2611 189 1715 1709 12388
NM_004904chr7135822 5399 5179 4806 4209 4200 4098 2270 1829 1732 762 616 300 65699 5384 4593 4544 1085 800 --24486 649
NM_004912chr741742 1553 504 427 11270 11388 --
NM_004921chr152553 2471 2178 2141 522 12319 ----
NM_004932chr541719 1528 657 104 ----1550
NM_004936chr972918 2805 2452 2351 2290 2201 1978 ------
NM_004947chr382478 2217 2091 2073 726 701 232 141 --22382 712 --
NM_004949chr1872149 2106 2098 1505 1399 744 545 --12040 --
NM_004956chr764475 4028 3719 1806 786 423 11555 13515 21224 1163
NM_004966chr104395 201 96 34 ----1890
NM_004985chr12114365 4273 4232 3771 3583 3476 1781 1581 660 649 359 11654 1757 --
NM_004992chrX138013 7923 7891 7780 5185 3085 2955 2797 2452 2403 1231 985 745 12895 18451 --
NM_004992chrX138013 7923 7891 7780 5185 3085 2955 2797 2452 2403 1231 985 745 12895 18451 --
NM_004999chr664069 3183 3141 2869 1590 241 12824 179 --
NM_005010chr752243 896 690 606 29 1207 ----
NM_005023chr521222 397 ----21068 985
NM_005036chr2298364 7824 6958 5707 5320 2990 1216 979 385 46740 5513 2547 368 37570 6273 5861 1325
NM_005056chr12105452 5136 4985 4845 4176 2224 1642 1578 1532 1362 11143 ----
NM_005065chr1435319 1027 997 --23755 1190 11115
NM_005068chr62483 362 --11399 11276
NM_005079chr8103074 2992 1181 1045 933 902 675 662 230 176 1925 1692 --
NM_005105chr162131 1750 1648 226 149 42 --21992 625 --
NM_005121chr1773730 2749 2434 1305 1164 943 700 23183 2404 21325 982 --
NM_005135chr1521278 677 ----13753
NM_005151chr1842071 1649 1626 56 1879 2408 294 --
NM_005154chr15--197 --1210
NM_005156chr975328 5299 4529 3944 3851 3331 656 ----14191
NM_005160chr22176757 6595 6278 6133 5960 5443 5277 4736 4342 4189 1783 1722 1270 871 688 664 87 14333 16090 --
NM_005188chr11148210 8068 7416 5689 3208 3107 3073 2710 2628 2614 2446 1949 1543 781 25563 1855 38121 7515 3124 11447
NM_005197chr14116135 6127 5815 5309 5239 4246 1845 1054 1003 742 298 15630 138 --
NM_005235chr2137777 7627 7414 7379 6828 4937 3032 2312 1916 1631 1618 1401 1126 26018 2536 --16057
NM_005238chr1173508 3287 2874 1196 556 496 305 13593 22593 2450 --
NM_005313chr15159 --1906 11000
NM_005333chrX71086 991 490 351 198 60 33 ------
NM_005339chr4144179 4125 4080 4040 3894 3817 3646 3422 3398 1554 1208 1185 1016 131 2556 373 21267 495 --
NM_005358chr1311446 ----1552
NM_005359chr1875920 5085 5051 4792 4727 2607 1978 1835 2350 276 25950 4325
NM_005399chr153538 2807 1451 1371 1307 --22949 1280 --
NM_005400chr232574 994 269 13002 --1891
NM_005402chr741279 449 368 65 11848 1635 --
NM_005433chr1842713 1976 440 303 12702 12046 --
NM_005436chr1093393 3357 2551 1510 1146 946 933 320 241 11126 ----
NM_005455chr141650 647 397 74 2320 87 2355 336 --
NM_005475chr1253187 2946 2920 2887 2005 13031 ----
NM_005487chr2262040 1993 630 621 572 41 --1404 --
NM_005502chr9103180 3075 3064 2785 2772 2733 2297 1250 1145 903 1421 --22752 136
NM_005509chr541765 1624 1315 692 1174 174 --
NM_005530chr1531240 277 269 --1287 --
NM_005578chr384106 3926 3659 1598 1403 1021 453 419 1262 23869 1732 24522 983
NM_005596chr956027 4082 2533 1585 570 14846 21602 497 --
NM_005611chr1621113 532 ----21050 213
NM_005665chr154952 3232 1496 1083 202 13666 23463 317 13209
NM_005668chr5104608 4548 4385 3369 3253 3042 3003 1059 760 285 --11164 --
NM_005717chr1----1234 1912
NM_005722chr222223 1576 173 42085 2069 955 273 --
NM_005730chr12123594 3474 3444 3363 3199 3082 2369 1212 1050 951 766 391 ------
NM_005739chr15102314 1893 1877 1646 1548 1512 943 934 884 280 1231 11795 --
NM_005746chr742720 2260 1999 1051 22674 243 1628 --
NM_005759chr284708 3320 3276 3226 2929 962 934 196 --44545 2982 503 239 --
NM_005795chr262629 1198 850 822 712 326 12318 ----
NM_005807chr11138 ----1195
NM_005822chr632351 2291 612 11799 12014 --
NM_005828chr1795022 4727 4690 4438 3937 3912 1443 963 335 ------
NM_005840chrX117341 6946 6874 5444 5144 5111 1580 1383 1173 751 538 11391 --27716 6206
NM_005862chr35935 719 412 237 223 ----2979 746
NM_005868chr752047 1730 1534 732 577 21658 938 12417 12533
NM_005871chr103836 781 108 2692 172 ----
NM_005877chr2282472 2065 1612 904 895 366 158 33 --12376 --
NM_005900chr45897 794 775 470 33 ------
NM_005901chr18168713 8673 7232 6157 6112 5816 5380 5350 5253 1677 1629 1444 1045 751 745 644 32825 1742 1313 26358 5405 --
NM_005902chr1544585 4056 3632 3404 --14442 14042
NM_005909chr553816 3702 3493 3225 569 1764 13347 --
NM_005920chr163890 3600 2776 2738 2730 1135 --23221 246 --
NM_005935chr4124770 4020 3755 3381 1543 1319 871 811 795 405 166 37 ------
NM_005941chr8144189 4162 3276 3220 3082 2900 2697 1525 1403 878 846 708 645 372 22996 239 1587 --
NM_005955chr1135224 4548 4364 4329 4229 4121 3996 3832 2207 1819 1638 1588 164 --1177 --
NM_005986chr1331962 801 614 22854 2619 ----
NM_006007chr943729 3513 3420 83 24390 1441 13312 --
NM_006016chr662099 1831 1554 584 177 99 ------
NM_006033chr1852269 2030 681 577 536 ----1926
NM_006037chr224774 3551 --24324 3435 24672 1606
NM_006054chr1111038 ----144
NM_006080chr772916 2835 2765 2081 2026 841 361 22862 2432 ----
NM_006094chr831870 723 317 1631 22028 1630 --
NM_006095chr484535 3059 1699 1457 1384 845 367 308 43390 3087 2965 1184 14283 --
NM_006108chr1142093 1640 1592 442 ----11506
NM_006136chr73163 53 26 31133 483 107 ----
NM_006139chr252679 2321 2144 498 163 --1402 --
NM_006154chr1592957 2921 2832 2616 2102 1813 1095 770 474 ------
NM_006158chr821395 511 21506 1439 --1278
NM_006203chr575347 5315 2193 2000 1355 963 341 13909 ----
NM_006241chr382386 2265 2153 1966 1608 872 782 541 ------
NM_006251chr532836 189 71 33389 2169 2125 --23060 1245
NM_006252chr187105 6085 5429 5285 5208 4838 2857 1003 17177 ----
NM_006267chr23655 438 291 --21358 370 --
NM_006282chr2011902 13818 11814 23647 1394
NM_006283chr874914 4478 4151 1785 1323 904 718 ------
NM_006287chr272610 2117 2088 975 860 664 309 42272 2169 1997 851 11783 11845
NM_006306chrX64490 4134 2028 1971 1461 1432 65209 4500 1501 1372 547 527 15863 --
NM_006315chr444051 1720 1172 561 21709 1369 --23481 1438
NM_006379chr752323 2150 1847 1582 1531 ------
NM_006380chr17114325 4312 4076 3941 3929 3256 3137 2990 1680 1127 333 12863 24287 3760 --
NM_006393chr1074376 4269 3525 1267 1240 1041 93 1640 ----
NM_006420chr2033442 1333 53 22909 2322 23339 243 22439 2248
NM_006434chr1082892 2226 1287 903 842 770 624 372 13132 --152
NM_006457chr473932 3794 3635 3382 3123 1050 265 11010 33734 3483 852 --
NM_006469chr13466 272 137 21605 1175 11348 11363
NM_006482chr1232609 1210 916 ----13153
NM_006489chr1482045 1945 1751 1297 666 657 271 49 ------
NM_006504chr1072986 2455 2163 1183 831 818 271 --42916 2528 1086 752 --
NM_006544chr14155314 4523 4457 4437 4274 4107 4071 1635 1629 1444 1178 694 627 379 235 21719 365 11185 15604
NM_006546chr1785920 5858 5553 4553 2638 2435 2318 1245 35463 4430 457 16207 --
NM_006547chr742145 1586 652 449 --12072 1846
NM_006561chr1075902 5350 4369 1932 1015 953 562 --25404 3939 --
NM_006566chr183878 355 156 --1855 11221
NM_006572chr1763381 3311 3135 1098 1004 936 22922 240 --11067
NM_006595chr1161735 1675 1461 692 362 297 11371 ----
NM_006599chr16117991 6030 5888 5641 5146 5069 5047 2221 1991 1263 901 37909 5127 2370 47984 6831 5827 2064 --
NM_006601chr124759 450 180 128 ----1937
NM_006614chr363343 3011 2582 2266 2244 1022 1288 1320 --
NM_006620chr623387 840 21465 809 --24160 3920
NM_006625chr13457 402 394 1849 1781 --
NM_006625chr13457 402 394 1849 1781 --
NM_006625chr13457 402 394 1849 1781 --
NM_006626chr962076 2058 1850 994 718 412 22617 2039 1135 --
NM_006628chr1574404 3987 2857 1801 839 715 572 186 11409 13004
NM_006629chr1872843 2508 2211 1872 416 174 129 ------
NM_006644chr13283 22 --2459 253 --
NM_006654chr1294638 3900 3766 3589 3208 1770 1722 1561 827 33334 1668 840 11815 13304
NM_006699chr132348 459 177 --3604 125 23 --
NM_006717chr973161 2652 2292 2282 2221 1259 1094 11265 1301 --
NM_006722chr372371 2024 945 886 541 459 308 ------
NM_006729chrX115250 4447 4360 3687 2227 2073 619 511 246 224 157 11450 14847 25117 3852
NM_006750chr16137267 6681 5975 5460 5235 5110 2425 1286 1201 919 894 832 564 37049 6860 3050 17455 16284
NM_006756chr841505 1327 602 32 --11127 --
NM_006766chr852721 2382 2336 2136 477 --11857 --
NM_006775chr692762 2675 2225 2096 1917 831 679 488 130 11180 12537 --
NM_006826chr24932 915 159 58 199 --11023
NM_006827chr1463307 3280 3204 2824 2194 376 1912 --11120
NM_006851chr122563 531 32918 2249 42 ----
NM_006873chr253077 3005 2172 811 560 --23214 2724 --
NM_006885chr1653275 1426 993 537 270 12632 1846 --
NM_006888chr145885 834 516 273 106 33074 1154 394 ----
NM_006915chrX42029 388 224 152 22249 932 ----
NM_006922chr261904 1644 790 578 430 330 --11602 --
NM_006924chr17104414 4353 3932 2918 2758 1604 1455 705 671 429 --11334 11260
NM_006996chr131460 1246 576 21445 461 --1167
NM_007011chr15116860 6800 6380 6119 6045 6011 5991 5842 5206 2450 1878 35981 2690 2221 1575 --
NM_007034chr1--1363 --1198
NM_007038chr2195915 5742 4961 4164 2061 2010 1726 1162 348 15215 34511 2307 622 --
NM_007064chr33592 208 89 1494 1423 --
NM_007073chr6104239 4135 4044 3712 3304 3273 2743 1257 866 392 24156 1044 23690 2630 --
NM_007106chr1342642 2040 883 594 --1300 22707 89
NM_007114chr343210 2666 2310 1001 --22813 209 --
NM_007137chrX75048 4031 3904 3434 2134 2061 682 --25535 1640 --
NM_007153chr1974293 4039 3877 2843 1588 282 190 --23198 2928 14138
NM_007159chr341727 1528 546 491 --21104 79 --
NM_007173chr1152315 1762 936 209 174 2772 498 ----
NM_007175chr853390 3300 3280 3055 2441 33192 1183 1037 13426 13008
NM_007195chr1873040 2473 1449 871 765 220 42 22609 578 ----
NM_007197chr1211015 1354 --1833
NM_007203chr9103724 3168 2564 1282 1147 987 822 656 482 87 13058 12701 --
NM_007212chr121869 618 1142 32164 1498 288 --
NM_007249chr13129200 6830 6421 5816 5790 5748 3266 3079 2906 2890 2667 605 33481 1126 275 19449 12223
NM_007287chr3103247 3167 2761 2056 946 883 785 572 562 213 12956 13098 13053
NM_007288chr3103247 3167 2761 2056 946 883 785 572 562 213 12956 13098 13053
NM_007289chr3103247 3167 2761 2056 946 883 785 572 562 213 12956 13098 13053
NM_007294chr1721050 311 1321 --1261
NM_007295chr1721050 311 1321 --1261
NM_007296chr1721050 311 1321 --1261
NM_007297chr1721050 311 1321 --1261
NM_007298chr1721050 311 1321 --1261
NM_007299chr1721050 311 1321 --1261
NM_007300chr1721050 311 1321 --1261
NM_007302chr1721050 311 1321 --1261
NM_007303chr1721050 311 1321 --1261
NM_007304chr1721050 311 1321 --1261
NM_007305chr1721050 311 1321 --1261
NM_007347chr1552550 1003 960 714 690 13083 --11154
NM_007350chr1244431 3254 2906 2884 13335 1372 --
NM_007373chr1061728 1458 1317 1275 1198 46 21507 153 11538 --
NM_007375chr152790 2737 2468 690 352 1636 ----
NM_012081chr573603 3084 2637 2350 943 678 147 ------
NM_012089chr141383 1271 1089 512 1964 ----
NM_012095chr1093432 2860 2497 2463 1120 731 590 519 63 12222 12246 --
NM_012102chr162622 2170 1877 880 634 582 ----12133
NM_012104chr1153362 3159 2961 2676 562 21247 1122 23437 307 --
NM_012104chr1153362 3159 2961 2676 562 21247 1122 23437 307 --
NM_012141chr1374003 3034 2567 2522 743 568 149 24116 1136 --11215
NM_012164chr9177507 6968 6902 6451 5839 5821 5663 5255 3031 2620 2540 1988 1824 1207 592 220 130 11706 37064 5552 4645 --
NM_012210chr961282 1196 1121 1008 984 356 1553 ----
NM_012214chr2115499 5021 4125 2535 2355 1777 1164 698 591 372 252 56080 5576 4267 2033 612 12397 16383
NM_012234chr363705 2890 1426 951 889 236 12431 13117 1825
NM_012249chr293377 3253 3027 3013 2662 2311 1274 428 35 22614 2279 ----
NM_012252chr794609 4386 4237 3417 3386 3253 1978 1940 1067 24048 3281 --1795
NM_012259chr63972 923 45 ----1252
NM_012262chr1105233 4617 4019 3965 3622 1742 1566 895 656 379 14320 14364 11445
NM_012281chr752268 1875 1766 1602 888 --11733 --
NM_012287chr384340 4162 3751 3685 3253 2783 1578 888 24396 137 44310 3278 1432 1388 24218 1163
NM_012288chr675670 5081 4457 4173 2014 1895 884 24749 901 25181 194 --
NM_012296chr1173413 3302 2693 2655 2524 499 79 --23325 1307 13740
NM_012297chr482448 2386 1922 1882 1683 719 662 107 12242 1916 --
NM_012301chr742140 2029 1803 662 11700 11545 1545
NM_012316chr194503 4068 3536 2267 2082 2032 1937 1533 397 14009 ----
NM_012330chr1081754 1547 1243 692 631 625 523 41 ----1128
NM_012334chr543882 3694 3491 3416 24614 4533 11020 --
NM_012397chr1851710 1673 1578 567 82 --21255 425 --
NM_012425chr1042704 2463 207 56 --1201 1345
NM_013238chr1351572 1248 1157 716 130 1706 21550 1172 --
NM_013250chr1151265 1156 430 261 160 1510 ----
NM_013254chr121696 ----1599
NM_013255chr7148661 8625 8142 7892 7743 6656 5519 3493 3458 2211 800 505 366 192 26945 6140 16126 11965
NM_013261chr443335 3132 2652 75 1484 1417 --
NM_013262chr63425 59 49 --1456 --
NM_013269chr1264172 3880 3508 3409 3346 59 34393 4214 1326 ----
NM_013283chr52322 208 ----1754
NM_013309chr1552595 2458 2316 1726 361 ----1847
NM_013372chr1553416 3228 1224 1077 1070 ------
NM_013374chr342632 2274 1123 877 11007 --22252 1928
NM_013381chr1221536 897 31827 1740 182 22070 946 --
NM_013386chr171172 722 625 610 457 443 330 ------
NM_013400chr72852 396 ----11052
NM_013410chr121054 1015 21286 39 21310 976 --
NM_013437chr82931 185 151 --11136
NM_013450chr241055 978 922 168 --1153 --
NM_013943chr152996 2612 2493 1143 306 42917 1119 805 317 ----
NM_013989chr1494513 3751 3452 1723 1664 1374 1111 1082 280 11252 ----
NM_013995chrX42384 2162 762 318 11759 1739 --
NM_014011chr211015 ----11881
NM_014016chr341176 419 220 188 ------
NM_014021chr163107 2459 2399 2317 796 619 23235 1311 ----
NM_014028chr653278 3096 2852 269 130 --1300 12870
NM_014034chr68975 559 453 427 355 302 177 54 --11336 --
NM_014048chr1644226 3818 2107 1143 65059 4744 4109 3758 2034 563 13438 --
NM_014057chr931359 1295 449 11451 --1258
NM_014089chr1341725 1713 291 273 ----143
NM_014112chr895163 5074 3358 2049 2018 1824 1661 754 398 --1407 --
NM_014155chr11107202 6338 6230 4708 2536 2258 1864 1349 581 266 26949 6590 --12329
NM_014181chr242641 2596 2521 179 --22042 762 --
NM_014217chr121853 583 ----1397
NM_014250chr2262040 1993 630 621 572 41 --1404 --
NM_014251chr74961 825 806 177 ----1147
NM_014268chr181163 1918 --11347
NM_014319chr1221832 659 1201 11466 --
NM_014331chr486431 5862 5177 4749 2521 2510 1870 296 47707 6971 3067 697 37793 7782 7118 11237
NM_014333chr1182739 2217 2127 2089 2069 1908 1790 399 --12769 --
NM_014372chr1--11330 139 11411
NM_014374chr72852 396 ----11052
NM_014382chr371608 1588 1461 529 418 371 53 ----1106
NM_014393chr852347 1488 472 224 76 --12172 --
NM_014423chr584818 4786 4661 4563 3604 1708 1663 877 34308 4095 1681 ----
NM_014445chr361795 801 164 141 56 28 --11677 --
NM_014458chr161438 1384 1328 1078 1068 341 ------
NM_014494chr1661495 912 804 715 311 106 1267 21918 361 --
NM_014572chr1331781 1763 287 1701 1480 --
NM_014615chr1662517 861 841 442 326 193 1201 ----
NM_014616chr363234 820 789 585 575 304 1711 12133 --
NM_014636chr993892 3882 3234 3050 3001 1141 848 573 213 43335 3319 2760 737 --13930
NM_014667chr31487 --22381 590 11915
NM_014702chr643425 3030 2491 637 13304 13390 --
NM_014705chr721991 1487 11868 --11389
NM_014711chr1641518 1334 745 117 --31730 1351 552 --
NM_014721chr6127426 7128 6912 6704 5662 4891 4756 4720 4691 1656 598 574 37458 5411 1620 34685 2892 2113 --
NM_014729chr831556 492 89 --1128 1238
NM_014730chr1294986 4919 4891 4599 2110 2068 1508 1497 722 1173 ----
NM_014730chr1294986 4919 4891 4599 2110 2068 1508 1497 722 1173 ----
NM_014739chr673486 3134 1157 1103 972 818 728 12935 148 --
NM_014758chr1172426 1761 1729 1598 749 488 151 1480 ----
NM_014764chr1241291 1194 971 510 1225 1939 --
NM_014765chr142543 726 209 151 1484 --12104
NM_014774chr193263 2816 2115 1146 960 930 835 789 724 --1179 --
NM_014781chr831094 500 461 164 --1817
NM_014812chr171995 1715 1611 621 477 182 27 --21585 431 --
NM_014820chr381995 1976 1962 1645 1402 804 782 523 ------
NM_014826chr174122 3836 3617 3558 1685 1487 235 --13437 24056 2916
NM_014827chr151192 428 211 202 88 11360 21666 193 --
NM_014829chr562209 2063 1889 1771 1644 381 1346 ----
NM_014830chr1253866 2995 2916 2883 245 ----1469
NM_014850chr384057 3324 3184 1948 1827 1470 1069 1058 23935 3721 ----
NM_014872chr931939 949 612 ----11472
NM_014873chr174549 4190 3943 3691 1671 1109 928 ------
NM_014897chr1732363 1069 749 12899 12836 --
NM_014904chr1063703 3578 3539 2966 2741 193 23444 2902 ----
NM_014906chr1733870 3763 3613 34087 3016 1311 13526 1883
NM_014912chr1073260 3074 2939 2563 854 503 307 21001 733 11339 --
NM_014918chr1561489 1188 1107 524 492 441 --11594 --
NM_014920chr673496 3375 3255 2652 765 744 603 13270 12607 --
NM_014924chr1473023 2872 2235 906 836 714 478 ------
NM_014926chr361119 737 383 328 265 217 ------
NM_014932chr341743 550 91 23 1234 ----
NM_014946chr232428 2368 1166 ----12980
NM_014947chr153050 2607 2411 2401 906 12878 ----
NM_014959chr1983363 2327 1072 967 833 258 240 76 --22920 1298 11129
NM_014982chr1474639 3965 2015 1531 1461 796 632 34328 3667 1815 --11943
NM_014988chr452161 1140 941 773 622 22087 1985 134 --
NM_014991chr422841 144 12642 --11133
NM_015000chr1272215 2127 2029 1067 908 366 300 --12003 --
NM_015002chr1252166 800 705 568 339 --1321 --
NM_015020chr1693787 2524 2379 784 657 620 596 255 207 13453 ----
NM_015025chr262533 2504 2380 1710 862 460 ------
NM_015026chr1264749 4616 4573 3361 2922 715 13895 24435 4096 --
NM_015039chr154228 3510 3264 2882 168 --24299 898 --
NM_015049chr253233 2949 2837 2467 430 --13007 12584
NM_015064chr1283666 3299 3010 2957 514 315 293 26 --23344 2846 --
NM_015071chr566554 6297 5982 2510 1304 74 25242 1085 15686 --
NM_015074chr174561 4552 4397 4081 3404 1937 154 24347 603 ----
NM_015076chr684103 3606 1819 1654 1110 1081 969 543 1101 11563 1697
NM_015092chr1633410 674 355 33671 1338 981 13705 --
NM_015097chr352302 2226 1905 268 103 ------
NM_015107chrX41549 597 460 446 12216 --12364
NM_015138chr1572864 2562 2233 2199 2037 797 631 --1150 --
NM_015156chr1474043 3932 3246 3226 2853 1456 660 33055 2800 1399 ----
NM_015192chr2062759 2396 2370 755 465 414 12288 11993 --
NM_015199chr392522 2353 1193 893 831 708 683 476 322 32940 2135 1158 ----
NM_015206chr15112989 2968 2650 2584 2502 1548 990 829 540 458 324 ------
NM_015225chr952115 812 656 256 117 ----12261
NM_015230chr461826 1807 1648 1580 1456 585 ------
NM_015247chr1685406 5395 5201 4579 1184 760 659 393 1714 34172 1994 1350 --
NM_015268chr32499 458 ----1696
NM_015271chr484329 3026 2772 1739 1328 1086 794 109 23389 2851 ----
NM_015272chr1662027 862 672 538 332 183 ------
NM_015289chr1561921 1832 1571 1561 220 109 --1760 1562
NM_015291chr173542 3097 2654 2629 2416 1124 249 11380 ----
NM_015310chr8117800 7595 6637 5921 5806 5789 5228 3096 2337 1738 665 16195 46675 6046 5989 2817 --
NM_015313chr1154306 1086 885 356 214 34573 4218 3046 24796 3549 14669
NM_015317chr272580 2490 2484 2098 1879 140 118 --12122 --
NM_015328chr792214 1946 1226 1144 1133 1034 626 363 269 --23048 279 --
NM_015336chr1242521 1842 829 190 22464 2136 11695 --
NM_015347chr1262670 2512 944 250 240 156 ----12413
NM_015349chr673084 2621 2598 2573 1899 1229 903 --11913 --
NM_015365chrX74310 4289 4156 3077 3001 1124 699 23610 2989 198 --
NM_015385chr1082892 2226 1287 903 842 770 624 372 13132 --152
NM_015393chr433314 3125 959 11120 33653 1256 191 --
NM_015394chr1292210 2195 1690 1643 1550 948 800 750 580 ------
NM_015429chr341044 269 49 33 1249 1858 --
NM_015431chr1103238 2948 2715 2475 2280 985 672 638 578 455 43038 1241 758 95 1399 13601
NM_015436chr452874 2676 2665 2188 1162 22469 760 13383 12503
NM_015455chr563274 3178 2712 1525 1377 505 21459 1315 33357 1285 383 13511
NM_015458chr8114911 4580 3446 564 558 516 486 379 294 278 53 24218 3664 21347 1322 25161 1169
NM_015460chr351904 1730 619 440 131 ------
NM_015475chr2--1147 --1423
NM_015535chr273756 3083 2811 2781 1370 979 132 12820 14172 --
NM_015550chr732944 2340 239 12586 33406 2417 1165 --
NM_015564chr592927 2891 2714 2580 2347 2249 2243 1163 312 22498 2229 ----
NM_015569chr1113964 3169 1585 1551 1395 1004 894 625 442 269 67 11624 ----
NM_015575chr273509 3223 2727 2355 2341 335 173 --42819 2388 839 769 185
NM_015576chr362498 2264 2154 486 384 296 1965 --1798
NM_015602chr121443 186 --11128 2441 151
NM_015608chr104658 640 224 64 1104 ----
NM_015640chr164842 4656 3406 1776 949 758 23722 112 11608 21016 121
NM_015713chr893556 3376 2848 2782 2482 1163 926 775 134 23358 614 13112 21101 456
NM_015866chr121430 1046 --21282 1040 --
NM_015878chr82745 122 11607 --11747
NM_015879chr18158237 7998 7677 7611 6763 5329 3109 2707 1538 1341 1276 1148 1063 880 726 45308 2121 719 112 68637 8532 7447 7271 1386 1178 --
NM_015886chr8115506 4920 4811 4710 4397 4092 3999 2274 2108 2083 297 44860 1767 1462 696 25568 468 --
NM_015901chr101703 ----1863
NM_015906chr184539 2995 2959 1843 1594 912 651 530 13382 ----
NM_015912chr852487 2114 2025 639 386 1239 185 --
NM_015994chr142557 498 1259 --1179
NM_016021chr652760 2298 504 223 111 1477 12155 --
NM_016023chr821917 1514 --1369 1229
NM_016045chr2041801 1390 1259 503 ------
NM_016072chr1222123 631 ----1742
NM_016076chr132953 2862 718 23128 2245 12340 1919
NM_016083chr643201 2627 392 184 1720 12687 11256
NM_016096chr872107 2045 1903 1471 1363 751 585 ----11695
NM_016099chr841180 563 362 348 31267 288 129 194 --
NM_016124chr1----11056 21382 186
NM_016131chr272323 1840 1539 598 322 310 78 --2736 724 --
NM_016132chr1552095 1169 685 549 254 3786 528 211 42854 2142 1099 657 12238
NM_016206chr3189006 8741 8630 8492 7937 7836 7804 7766 7669 3599 3593 2969 2947 2275 1887 1599 1422 358 57899 6274 2212 1000 81 15822 12221
NM_016260chr2107075 6946 6902 6304 4710 2980 2204 1886 1761 266 11105 36225 2077 1707 --
NM_016271chr1832013 546 74 1338 31920 1872 1824 --
NM_016275chr362636 2513 2368 2201 901 45 ------
NM_016277chr621644 1258 --11065 1625
NM_016289chr242160 2133 1920 854 155 ----
NM_016297chr273792 3468 3419 1033 311 108 102 13387 ----
NM_016308chr141935 1466 1409 1293 12026 1527 --
NM_016315chr241328 726 472 158 11674 --1456
NM_016322chr952931 2891 2619 1089 800 22999 572 1621 --
NM_016356chr632054 842 408 12601 --12535
NM_016376chr1793474 3048 2941 2782 1521 707 284 238 155 --34250 3487 320 --
NM_016377chr621681 240 1344 --11191
NM_016422chr1163065 1005 177 137 129 103 ------
NM_016436chr2072547 2099 2046 1896 788 448 161 11948 --12126
NM_016442chr552324 2144 2133 650 374 11796 ----
NM_016507chr1793062 2770 2608 2465 2419 2337 1091 272 80 12639 ----
NM_016513chr673496 3375 3255 2652 765 744 603 13270 12607 --
NM_016531chr484057 3072 2756 1440 1378 1231 902 526 1726 13102 --
NM_016542chrX81706 1359 1110 443 359 250 165 145 ------
NM_016544chr253115 1543 1211 260 152 1112 13039 --
NM_016577chr364172 3904 3578 1296 1285 207 ----1420
NM_016605chr542760 2371 2108 1859 ----12302
NM_016607chrX11201 11136 1677 147
NM_016651chr1431090 802 742 --11129 --
NM_016824chr1041789 1660 1559 74 ----1759
NM_016954chrX1100 ----1593
NM_017420chr1443308 2634 376 273 22525 84 11247 --
NM_017423chr452006 1810 1492 666 85 --11690 --
NM_017447chr2194406 4127 3518 3092 2874 1016 449 188 160 ------
NM_017563chr365932 5642 3893 1815 1688 1059 --24796 664 1339
NM_017594chr9113274 3001 2868 2621 2279 2093 977 866 626 542 485 12397 ----
NM_017628chr475231 5147 4950 4736 4488 4117 2118 34150 922 456 34918 4725 3384 15279
NM_017634chr871988 1650 1380 1235 767 682 665 11698 ----
NM_017637chr9129191 8703 8183 5857 3644 3421 2294 2172 2018 1793 881 549 27861 659 28507 1651 --
NM_017641chr121363 1373 --1794
NM_017643chr1762946 2871 2419 845 596 566 --21148 965 --
NM_017644chr375190 4233 2072 1208 826 580 408 13169 24269 1823 --
NM_017650chr7105831 5689 5271 3716 3696 2354 2055 1956 1829 602 11770 33914 1129 917 15423
NM_017658chr1464630 3472 3183 1807 1664 1650 24260 3174 1838 --
NM_017666chrX62038 1913 1877 1740 1403 393 --2788 382 --
NM_017672chr1541345 1000 329 21 1384 ----
NM_017703chr194614 598 150 42 ----1455
NM_017719chr342160 129 86 74 1986 --11994
NM_017752chrX21760 1682 1557 2493 146 --
NM_017754chr633255 663 314 44924 3947 3778 1183 --11305
NM_017761chr111053 --1599 1295
NM_017769chr1463129 2886 1120 982 974 930 13036 12190 12574
NM_017770chr642959 2804 2470 121 12264 1457 22336 729
NM_017778chr841105 373 317 119 11268 11161 1253
NM_017813chr885292 4838 4795 4488 4252 3961 1062 222 11648 1309 --
NM_017824chr1042594 2252 236 70 11823 ----
NM_017831chr1844793 4681 4095 3234 2844 529 --146
NM_017848chrX144683 4262 4252 4192 3995 3858 3654 3562 3366 3264 3257 3013 1764 1587 21881 758 11441 --
NM_017902chr1045465 3518 1781 509 21493 1250 --11483
NM_017915chr1231187 779 215 ----146
NM_017922chr141224 ----1195
NM_017958chr262766 2738 2668 2114 1225 223 --1111 --
NM_018046chr541762 1653 1618 716 --1159 --
NM_018084chr273073 2908 2386 970 367 188 116 1434 12237 --
NM_018085chr1118154 7681 6872 6001 2693 1832 1528 1411 956 519 452 12655 151 1378
NM_018126chr431223 539 147 ----1429
NM_018155chr352924 2750 977 828 253 --1117 13357
NM_018176chr441574 1516 379 200 ----1209
NM_018181chr182722 700 --2364 269 --
NM_018184chr351714 1694 736 322 59 11559 12122 --
NM_018200chr1562139 1890 1047 570 485 275 12399 22044 269 1975
NM_018211chr121845 1558 2873 76 11421 21789 621
NM_018222chr1141655 1190 442 405 --21200 556 1341
NM_018225chr9105285 5134 5099 4813 4597 4082 2151 1925 1875 1160 14051 ----
NM_018227chr452467 1269 1076 994 988 --21962 749 1362
NM_018229chr143909 778 444 11136 1976 11097
NM_018243chr493957 3581 3560 3488 2907 1540 1168 992 132 ------
NM_018247chr662904 2227 1011 867 738 481 154 12682 23107 2364
NM_018293chr362919 2624 2259 2034 1986 1817 --11067 21021 404
NM_018299chr893189 3009 2984 2735 2641 2418 934 590 255 1401 --166
NM_018315chr431354 566 350 ----11284
NM_018339chr941720 1358 684 160 127 11822 --
NM_018340chr1694906 4703 4604 3749 3621 3412 1086 671 40 122 --1555
NM_018348chr161153 1293 --1121
NM_018351chr1234150 3898 786 23690 1444 44372 3729 311 260 --
NM_018362chr1193697 3490 2453 1529 1199 882 675 512 155 --12962 1833
NM_018364chr183910 3817 3659 3436 3333 2522 1010 839 1681 1913 --
NM_018371chr811340 21384 978 11331 --
NM_018374chr784340 4025 3697 1720 1656 1255 929 714 12090 23240 1802 24752 2108
NM_018401chr461899 1629 1479 1317 375 330 1735 ----
NM_018403chr373996 3292 1398 1300 898 563 250 --1657 13764
NM_018409chr452573 2273 2132 900 382 11030 21085 269 --
NM_018429chr552937 2343 2299 634 187 ------
NM_018440chr8128254 7060 6863 6724 6487 6128 5647 5530 3360 2940 1352 856 26632 376 13394 18482
NM_018469chr1731265 166 148 --21296 1092 --
NM_018489chr151514 1474 836 439 424 ------
NM_018557chr221551 169 11206 1181 --
NM_018566chr195069 4382 4336 4002 3911 3691 2032 1308 810 14662 ----
NM_018638chr12165623 5052 4564 4557 4537 4312 3788 2216 2090 2051 2026 1601 999 972 774 474 25496 3674 13552 --
NM_018640chr1262459 1954 722 360 287 245 12802 1349 --
NM_018657chr35767 277 229 104 35 2116 87 ----
NM_018712chr1151570 1371 1001 447 364 ------
NM_018717chr452873 2844 2411 2320 350 --22722 2686 --
NM_018841chr173903 3810 3731 3426 3355 2873 2677 --13979 --
NM_018945chr663683 2383 945 734 722 182 32640 580 224 12858 --
NM_018947chr744789 4669 3935 3707 34722 4449 728 ----
NM_018970chr7103185 2991 2859 2650 2555 2296 2107 1275 932 443 13011 --11953
NM_018976chr1282863 1883 1769 1760 711 432 417 258 2802 699 1366 --
NM_018979chr1232237 1963 932 11061 --12635
NM_018999chr1073193 1758 1608 1141 957 911 197 --14406 23560 1453
NM_019001chr374573 4196 3106 1019 396 320 93 ------
NM_019022chr1852929 2677 2322 1116 700 --12395 22970 2238
NM_019027chr481055 723 708 606 431 240 176 60 12575 32390 1913 1851 --
NM_019035chr421981 471 12103 1692 1320
NM_019036chr641262 897 68 26 ----11068
NM_019050chr442101 1611 773 567 22048 136 ----
NM_019053chr103697 187 156 --2419 213 --
NM_019072chr584154 4140 4030 3555 3542 3459 3416 273 13548 ----
NM_019080chr1371482 1287 1229 1018 360 177 166 1229 --11465
NM_019094chr1251537 1042 831 561 305 33441 453 379 ----
NM_019116chr1643196 1452 551 169 --21493 228 --
NM_019556chrX51410 1001 493 448 101 ------
NM_019596chr2132335 709 43 22781 2021 11102 11189
NM_019885chr262661 2649 2448 2256 344 170 1224 ----
NM_019903chr1041789 1660 1559 74 ----1759
NM_020122chr275801 5714 4290 3733 2352 1879 161 35736 5189 2085 ----
NM_020133chr665652 5570 4148 2152 1404 1078 34009 2161 1895 --36156 4772 4173
NM_020144chr751749 835 712 690 455 --12024 --
NM_020148chr1842524 2162 698 628 22636 1913 ----
NM_020150chr1052165 1602 1390 677 421 153 12067 --
NM_020152chr215951 808 319 203 189 1958 ----
NM_020177chr583198 2957 2741 2398 2085 798 263 109 --43154 500 434 307 --
NM_020199chr541296 1261 379 359 1370 ----
NM_020226chr41783 1185 --1559
NM_020240chr562686 851 681 567 396 350 --1240 --
NM_020245chr674413 4237 3850 3564 1705 1045 345 23185 826 13818 --
NM_020297chr1263623 3406 2794 2702 1267 1048 13320 22896 1241 13024
NM_020336chr2043597 2825 1245 153 23182 3163 13169 --
NM_020337chr432568 779 545 22843 768 1806 --
NM_020340chr662276 1621 885 596 371 360 11409 ----
NM_020341chr2062029 1878 1469 1429 1394 500 ------
NM_020346chr1151509 528 301 211 191 2674 199 11607 --
NM_020390chr344696 4418 3980 561 --34256 1230 301 --
NM_020425chr641244 562 184 175 ----11682
NM_020432chr742142 1898 336 323 1913 11514 --
NM_020443chr1137005 6572 6368 5364 4825 4743 2579 2186 1867 1561 1341 914 861 35164 5100 1672 11294 --
NM_020455chr672821 2728 2529 1784 584 561 522 32351 809 73 1886 12542
NM_020463chr231284 936 485 --21465 517 --
NM_020466chr675032 4864 4137 3170 806 264 93 1916 ----
NM_020473chrX31599 607 364 11609 11636 31500 645 133
NM_020648chr1892775 2651 2548 2156 1935 665 655 611 458 --22266 432 --
NM_020673chr2097384 7085 6350 5731 5723 4820 2766 908 435 16830 26387 6269 --
NM_020699chr155221 1455 1156 893 59 13528 23353 359 --
NM_020711chr242227 2024 357 344 --12102 1587
NM_020718chr16125858 5735 5571 5235 5137 4573 4506 4444 4374 940 368 197 --14190 --
NM_020734chr1232457 2195 474 13136 22869 2591 12249
NM_020752chr1062844 2395 1985 1090 985 242 1625 --12067
NM_020766chrX74419 4268 4057 3387 2911 852 335 22917 1472 1148 1460
NM_020772chr1788181 7978 7443 6613 6555 3240 2315 1275 1653 ----
NM_020774chr18115971 5274 5209 4832 4791 4643 2279 1754 1660 1274 797 23803 2463 ----
NM_020783chr1852132 2049 1767 1661 1651 1400 ----
NM_020792chr372782 2618 1846 700 658 130 98 --22161 2146 --
NM_020800chr351271 1152 978 462 359 ------
NM_020805chr182227 65 11375 --1736
NM_020808chr11117 --11089 1133
NM_020809chr1152310 1621 752 527 116 1683 21977 569 11924
NM_020810chr1483390 3356 2408 2394 2358 1245 1089 95 11268 2747 727 --
NM_020826chr1183524 3422 3166 2931 2514 2490 1466 80 --13251 --
NM_020830chr283023 2687 2475 2423 2381 2190 979 798 ------
NM_020841chr1243407 3148 2961 510 13815 11582 12544
NM_020844chr896327 6103 5686 5088 5039 2913 2879 1082 128 25080 105 37521 6237 1864 15067
NM_020858chr1562435 2234 1825 702 354 222 1841 ----
NM_020859chr483529 3257 2948 2591 781 402 285 50 13769 23699 2622 --
NM_020871chrX21920 1787 --12415 11807
NM_020917chr1923089 2996 --11414 1147
NM_020918chr1063504 3372 2897 2266 773 227 1464 ----
NM_020935chr293719 3324 3083 1802 1612 1433 1391 854 811 33989 3517 425 11789 23944 1120
NM_020940chr104753 559 516 134 12737 ----
NM_020948chr1102896 2731 2718 2520 2495 2365 2244 1392 1335 1136 23018 275 ----
NM_020962chr1572516 2406 2293 2158 1861 1578 453 ------
NM_020980chr1531296 324 185 ----1666
NM_021007chr271823 1641 861 666 462 449 24 32265 874 578 ----
NM_021032chr341738 1687 486 66 159 --1586
NM_021033chr1353331 2885 2583 1316 312 11349 1198 13400
NM_021038chr373251 2771 2743 2227 2076 991 481 --1773 --
NM_021061chr874046 3809 3574 1284 438 320 26 --23779 1767 13554
NM_021069chr42768 360 11915 --12008
NM_021072chr552214 747 494 462 250 ----12039
NM_021090chr2264855 4001 3154 966 886 717 24983 4505 1433 24675 4398
NM_021097chr282558 2434 2209 1162 1054 919 452 171 1894 ----
NM_021132chr103988 270 116 --11381 11083
NM_021145chr7--1274 1933 1780
NM_021159chr461584 1091 645 583 425 78 --1220 --
NM_021163chr743790 1191 1107 801 --13041 12695
NM_021191chr1242470 1761 316 265 1130 2806 381 --
NM_021222chr141461 1207 1006 578 1417 --1538
NM_021239chr1441112 504 411 26 ----11087
NM_021252chr1051989 1844 744 355 330 ----12100
NM_021255chr1494119 4091 4067 3717 3490 3447 3094 1649 1378 1650 22986 1216 --
NM_021627chr31440 1356 --1930
NM_021629chr385054 4181 4080 4065 687 586 572 317 ------
NM_021633chr151326 1032 967 951 506 ----11229
NM_021638chr484326 4104 3772 3505 1972 1951 651 307 13077 ----
NM_021813chr695864 5772 5577 4858 4852 4735 4173 1978 1611 35236 4129 1295 15837 14925
NM_021911chr5155475 5438 5085 4428 4359 4159 3898 3643 2259 2142 2009 1892 1556 1280 143 11008 1153 --
NM_021912chr1583749 3671 3555 3250 2952 2726 2674 1457 --21309 977 --
NM_021914chr1472291 2275 2005 600 175 145 43 11797 ----
NM_021940chr62192 108 11185 --1493
NM_021942chr43777 608 237 ----1138
NM_021949chrX52389 2330 1139 1000 688 2467 48 12177 --
NM_021954chr1382836 2816 2628 2263 1480 1286 703 382 12288 21402 1183 --
NM_021961chr1186557 6241 4786 2691 1931 1918 1350 192 15412 15455 15610
NM_021964chr385824 5801 5311 5056 1961 1624 625 250 22024 1689 35844 5045 1251 12425
NM_021967chr531329 865 111 11016 --1128
NM_021977chr623866 3640 43889 3235 2700 927 --1447
NM_022048chr15196341 6074 5988 5547 5309 5129 5000 4357 4226 4202 4057 2254 2100 1990 1787 1269 953 323 68 41694 1001 868 300 ----
NM_022049chr11567 --21903 1834 1504
NM_022051chr12477 50 ----1693
NM_022133chr841824 1647 1324 64 127 11662 136
NM_022166chr1675862 5621 4245 2226 2077 1863 1032 25518 5489 24265 713 14289
NM_022351chr833649 3179 2860 43048 2852 2797 1353 13015 1648
NM_022458chr762912 2626 1210 963 489 129 188 --11065
NM_022459chr1375209 4938 4195 1173 884 102 83 --22323 1490 --
NM_022465chr1231158 684 152 12595 32124 595 74 --
NM_022469chr152940 2438 2175 1044 488 22969 863 1906 --
NM_022474chr1442393 1982 396 265 --12205 12450
NM_022482chr2042219 1719 589 572 12353 22384 2373 --
NM_022491chr1273203 3155 2401 965 948 582 471 12735 12511 --
NM_022716chr172593 2567 2331 2244 1220 1186 819 22324 258 ----
NM_022725chr1151593 1470 1443 291 262 ----11835
NM_022726chr641526 1174 330 247 11742 ----
NM_022745chr142765 2038 1840 626 12301 22518 2052 12202
NM_022784chr1521042 34 1855 153 --
NM_022841chr1521817 92 2654 241 --1545
NM_022845chr1652219 2150 1415 473 380 ------
NM_022893chr283172 2957 2896 902 707 444 286 254 12065 ----
NM_022898chr1494782 4587 3768 3739 1228 1119 923 524 43 11585 12954 --
NM_022977chrX21719 1685 11823 1105 1479
NM_022978chr531329 865 111 11016 --1128
NM_023016chr232449 891 709 12007 2841 326 --
NM_023037chr132977 428 166 --1824
NM_023929chr832173 665 283 21940 536 1871 --
NM_024007chr552293 1049 952 779 310 --11084 --
NM_024345chr9105629 5453 5433 4933 4391 3944 2376 1960 1858 1360 25581 4571 11035 12314
NM_024408chr133181 2985 2759 11194 31489 712 547 --
NM_024416chr931359 1295 449 11451 --1258
NM_024612chr172914 358 1862 --1453
NM_024636chr772807 2031 2001 1969 1908 1104 595 --1189 --
NM_024641chr652990 1200 910 873 103 --12670 --
NM_024646chr163504 3345 1462 879 216 57 ------
NM_024665chr3104403 4330 3473 3417 3088 3071 3062 1673 1182 964 --11078 --
NM_024674chr173180 3170 3065 2070 883 587 23 12601 22387 2077 --
NM_024740chr1173675 3559 3357 1161 1045 867 44 --33650 1555 618 --
NM_024749chr161854 1842 1794 824 155 85 1283 21949 655 --
NM_024770chr285462 4348 2636 2565 1722 1517 1394 619 24502 46 35477 4251 245 15229
NM_024817chr1585842 4850 1823 1645 1037 998 655 503 15376 12353 --
NM_024930chr54634 561 500 348 22683 699 12141 --
NM_024941chr541337 1240 941 246 --1285 --
NM_024947chr3189644 9562 9423 9284 8037 7916 7886 7643 7186 6923 6813 6646 3700 2357 1985 1112 588 313 26785 3495 ----
NM_024948chr101562 ----1570
NM_024949chr464490 4365 4229 1976 1733 460 11323 --13629
NM_024989chr2167768 7545 7168 6934 5855 5216 5092 2656 1989 1446 1374 987 807 716 255 213 37904 7251 5930 1911 --
NM_024991chr1082892 2226 1287 903 842 770 624 372 13132 --152
NM_024993chr241549 1503 1201 318 2533 213 ----
NM_025054chr863814 2941 2735 1675 1135 703 --13686 23500 3449
NM_025057chr1451287 1097 554 414 350 1275 ----
NM_025073chr164221 1551 1118 910 865 433 31604 496 63 31628 1173 209 --
NM_025074chr452236 2162 1232 909 37 1162 22825 1090 --
NM_025154chr721043 1027 --1984 11256
NM_025160chr144302 3611 3095 1263 13560 2331 128 --
NM_025221chr411304 3958 473 462 145 --
NM_030579chr1673537 3196 3137 1204 1196 1092 402 12397 ----
NM_030621chr1463907 3884 3821 3755 3569 918 14147 ----
NM_030625chr1092533 2412 2335 2089 713 567 482 460 105 ------
NM_030627chr564101 2677 1516 1037 988 58 ------
NM_030647chr785246 5047 4881 4500 1747 728 603 22 --1181 --
NM_030648chr4104694 4013 3679 3526 3449 2135 1206 1109 668 572 12218 11920 --
NM_030650chr2134247 3959 3892 3116 2915 2906 2826 1395 1086 329 266 234 114 13654 ----
NM_030670chr1241545 274 106 62 1640 --21668 1448
NM_030671chr1241545 274 106 62 1640 --21668 1448
NM_030674chr1285515 5341 4613 3640 2191 1322 641 266 25779 4558 ----
NM_030786chr131801 1224 453 1637 21519 606 --
NM_030791chr1481813 1739 1521 1179 695 564 482 155 21198 224 11317 --
NM_030806chr189341 8329 7307 6051 2444 2055 1611 710 58218 6542 5885 790 88 11982 --
NM_030809chr1241662 430 315 32 --166 --
NM_030816chr142287 594 381 189 12351 13397 --
NM_030817chr1283808 3394 3232 2841 2724 2714 747 440 13662 12778 --
NM_030885chr362260 1851 750 337 327 107 ------
NM_030918chr175379 4428 4421 3393 1167 895 878 24825 4562 ----
NM_030920chr12341 136 2598 561 1151 --
NM_031296chr442208 2051 1933 740 ----1300
NM_031419chr31135 11608 177 11292
NM_031427chr14165829 5294 5068 4815 4090 2363 2282 1972 1763 1718 1434 1244 848 720 679 130 13912 35796 5586 3897 24653 2311
NM_031435chr1243087 1331 615 38 12126 11323 --
NM_031442chrX83021 2245 1144 827 757 290 176 78 ------
NM_031445chr233416 1282 58 12256 22489 110 --
NM_031453chr1082339 2012 1787 1725 1033 639 345 187 1715 11982 --
NM_031461chr882219 2174 2158 1848 1810 838 448 101 --136 12203
NM_031468chr7148243 7983 7003 6368 6288 3286 3105 3021 844 760 635 607 554 394 47994 7964 5548 1685 11323 1128
NM_031483chr2063147 2370 1347 1253 1219 508 --1545 --
NM_031844chr153581 3533 768 724 354 23632 931 ----
NM_032021chr1121057 122 --2316 198 1352
NM_032041chr832216 489 261 ----12608
NM_032042chr5122892 2886 2517 2227 2173 2111 1817 1811 967 804 458 438 --12322 --
NM_032102chr1162947 2255 977 417 369 173 --12542 --
NM_032121chrX62746 2395 2092 2036 441 135 12188 1545 --
NM_032160chr1854043 1724 1637 1346 1196 ----14150
NM_032189chr1334429 254 218 --11476 14708
NM_032199chr1063442 2803 2674 1331 601 493 --12468 23309 251
NM_032208chr242637 1334 953 319 32290 1363 1241 --12360
NM_032217chr44996 534 224 179 11263 189 --
NM_032229chr131377 ----1237
NM_032239chr441150 932 431 48 ----11467
NM_032256chr121402 ----1858
NM_032291chr131196 577 255 --1298 11699
NM_032373chr1093798 2119 1235 848 837 530 190 127 42 24990 4780 14311 25617 713
NM_032383chr341244 1066 1016 351 ----1190
NM_032410chr841200 966 931 810 ----11251
NM_032439chr102177 70 1152 2650 161 --
NM_032440chr1082907 2455 1868 1837 941 614 69 55 ------
NM_032446chr553356 2878 2742 1137 936 12854 ----
NM_032457chr4113845 3725 3718 3625 3227 2967 2736 2386 1205 906 807 ------
NM_032458chrX52713 2162 2087 1270 573 --1387 13435
NM_032505chr362226 954 594 463 243 39 1992 11847 --
NM_032582chr1751814 1656 1474 234 175 ------
NM_032590chr1251025 474 354 118 81 --1229 --
NM_032682chr383651 2652 1062 970 777 659 173 92 --1633 --
NM_032859chr1373804 3273 3260 2806 1008 913 611 13600 ----
NM_032968chrX84171 3675 3665 1405 950 820 747 268 ----11341
NM_032969chrX84171 3675 3665 1405 950 820 747 268 ----11341
NM_032975chr1843603 3498 2497 720 11424 13429 1578
NM_032980chr1843603 3498 2497 720 11424 13429 1578
NM_032991chr421543 1018 ----1505
NM_033014chr931359 1295 449 11451 --1258
NM_033020chr184539 2995 2959 1843 1594 912 651 530 13382 ----
NM_033030chr24470 418 281 21 11060 ----
NM_033067chr13670 631 607 2263 75 --1302
NM_033087chr931376 356 243 --21185 203 --
NM_033136chr551549 1469 535 266 38 --11538 11615
NM_033137chr551549 1469 535 266 38 --11538 11615
NM_033143chr4104598 4534 3935 3720 3665 1857 1697 1248 831 168 1906 1361 --
NM_033181chr643201 2627 392 184 1720 12687 11256
NM_033211chr521762 1402 --1195 11965
NM_033224chr7137203 7156 6471 5419 5314 5069 3040 2540 2281 1979 1221 644 372 57766 6273 6170 5800 4926 --27793 7260
NM_033290chrX53797 3756 1472 1130 55 ----12811
NM_033331chr9103385 3016 1452 1347 1241 972 841 502 475 330 13136 ----
NM_033360chr12104486 4394 4353 3892 3704 3597 1702 781 770 480 11775 1878 --
NM_033425chr1183364 2348 1359 1221 1110 915 745 251 11190 21085 360 --
NM_033429chr1553079 2708 2487 2239 323 2623 571 11104 --
NM_033430chr453920 3444 3437 2740 174 11235 33729 1639 367 --
NM_033437chr453920 3444 3437 2740 174 11235 33729 1639 367 --
NM_033505chr2146280 5834 5489 4366 2326 2287 2257 1832 1722 1498 1391 1375 1021 67 11506 14572 26006 4544
NM_033624chr1252166 800 705 568 339 --1321 --
NM_033632chr431354 566 350 ----11284
NM_033642chrX3826 806 146 21272 1049 1135 --
NM_033656chr21125866 5608 5546 5377 5056 4556 4247 2349 1973 1618 1269 1037 24770 1184 45531 2142 2089 1746 --
NM_052832chr863049 2636 853 593 439 379 --12534 --
NM_052885chr1274030 3149 3083 3010 1728 1663 926 --24798 972 1322
NM_052898chr84322 296 135 129 --1542 --
NM_052937chr872711 2143 2069 2028 1737 837 447 ------
NM_052958chr83692 556 94 ----1658
NM_052978chr1451504 1251 1205 595 296 11512 11539 --
NM_053016chr9167620 7596 7250 6836 6298 6234 6141 5971 5482 2814 2666 2560 2487 2080 830 195 22247 1492 27557 736 --
NM_053024chr361539 1458 1293 1130 1053 463 ------
NM_053042chr482710 2269 2061 1020 783 595 518 420 1337 ----
NM_053043chr7115565 5502 4993 4160 2554 1971 1331 1195 1135 1055 989 1662 15538 --
NM_053056chr1152559 2191 1972 1951 119 --21004 466 --
NM_053064chr1412133 21239 800 31220 669 115 12161
NM_054016chr111275 ----21417 39
NM_054016chr111275 ----21417 39
NM_054016chr111275 ----21417 39
NM_057159chr921196 494 21149 282 11179 --
NM_057175chr432191 511 256 12357 1900 --
NM_057178chr1732432 2389 504 ----12073
NM_058170chr15595 583 492 98 85 1438 ----
NM_078487chr983221 3108 2755 2654 2593 2504 2281 2062 ------
NM_080491chr1173413 3302 2693 2655 2524 499 79 --23325 1307 13740
NM_080629chr141130 420 333 61 11201 --1128
NM_080630chr141130 420 333 61 11201 --1128
NM_080743chr641926 1768 800 323 22575 173 32071 229 217 --
NM_080759chr1352323 2024 1684 1075 735 --1342 --
NM_080760chr1352323 2024 1684 1075 735 --1342 --
NM_080867chr14134983 4521 3507 3457 3436 3430 3401 1654 829 727 719 428 145 13113 34231 679 369 1520
NM_080872chr874000 3623 3451 1608 791 491 447 11458 --21208 1182
NM_130391chr993589 3312 2763 2629 2550 2340 804 701 127 11043 1582 12724
NM_130392chr993589 3312 2763 2629 2550 2340 804 701 127 11043 1582 12724
NM_130393chr993589 3312 2763 2629 2550 2340 804 701 127 11043 1582 12724
NM_130435chr1072986 2455 2163 1183 831 818 271 --42916 2528 1086 752 --
NM_130436chr2142785 1959 1794 245 1294 1873 --
NM_130798chr152980 26 ----1996
NM_130811chr2021122 819 --1974 1813
NM_133264chr1783812 3581 3373 3245 2750 733 412 70 23947 2384 1690 1853
NM_133334chr476208 5341 2325 2085 1916 932 78 36296 832 190 34257 2074 1044 2613 591
NM_133338chr51121 154 --1348
NM_133339chr51121 154 --1348
NM_133340chr51121 154 --1348
NM_133341chr51121 154 --1348
NM_133342chr51121 154 --1348
NM_133343chr51121 154 --1348
NM_133344chr51121 154 --1348
NM_133370chr473669 3577 3272 2885 2833 2674 880 --12397 --
NM_133372chr552420 2362 2307 2204 1789 --1782 11011
NM_133378chr2133 1715 --1250
NM_133432chr2133 1715 --1250
NM_133437chr2133 1715 --1250
NM_133468chr741580 970 248 163 12518 --1731
NM_133477chr452629 2478 2076 1217 262 13136 ----
NM_133493chr674329 4075 4016 3929 3315 3201 606 24480 3689 14244 --
NM_133496chr151414 1330 1043 778 440 1145 14159 --
NM_133631chr361339 1013 643 236 212 145 ------
NM_133645chr63614 493 123 ----1481
NM_133646chr285592 5456 4975 4485 3616 1839 1533 358 12228 14274 --
NM_133647chr1521278 677 ----13753
NM_138270chrX83438 3345 2907 2607 981 711 459 381 --21383 167 22991 2574
NM_138286chr1974081 3492 1592 1531 1094 837 191 24233 2948 14312 --
NM_138292chr11103525 2743 2548 1130 853 675 645 483 222 111 22190 30 ----
NM_138328chr171692 11324 23084 3006 23209 3000
NM_138357chr1051809 1783 1404 573 458 11657 ----
NM_138400chr753405 3089 2714 177 108 --12145 11128
NM_138423chr1512318 --152 11460
NM_138426chr732413 2041 1662 31590 215 166 ----
NM_138444chr1374935 4673 4459 4408 4016 3413 108 --24682 3238 24513 3140
NM_138459chr633020 2385 582 --21311 971 13194
NM_138468chr245433 1994 1709 490 26105 623 12521 14499
NM_138576chr1494782 4587 3768 3739 1228 1119 923 524 43 11585 12954 --
NM_138633chr621681 240 1344 --11191
NM_138638chr1472291 2275 2005 600 175 145 43 11797 ----
NM_138694chr643610 2949 1037 579 12606 13096 --
NM_138713chr16117991 6030 5888 5641 5146 5069 5047 2221 1991 1263 901 37909 5127 2370 47984 6831 5827 2064 --
NM_138714chr16117991 6030 5888 5641 5146 5069 5047 2221 1991 1263 901 37909 5127 2370 47984 6831 5827 2064 --
NM_138715chr8141938 1900 1882 1864 1818 1812 1806 1776 1750 1589 803 500 187 165 179 ----
NM_138731chr1484069 1714 1322 1246 954 858 307 260 23516 60 23329 1293 --
NM_138971chr1153362 3159 2961 2676 562 21247 1122 23437 307 --
NM_138971chr1153362 3159 2961 2676 562 21247 1122 23437 307 --
NM_138972chr1153362 3159 2961 2676 562 21247 1122 23437 307 --
NM_138972chr1153362 3159 2961 2676 562 21247 1122 23437 307 --
NM_138973chr1153362 3159 2961 2676 562 21247 1122 23437 307 --
NM_138973chr1153362 3159 2961 2676 562 21247 1122 23437 307 --
NM_139057chr1582917 2884 2784 2692 2240 1832 307 148 1974 ----
NM_139168chr53721 542 288 --11324 11826
NM_139182chr461826 1807 1648 1580 1456 585 ------
NM_139207chr1292190 2164 2033 1996 1823 1582 1563 1451 753 1226 ----
NM_139283chr1221943 619 11701 11719 1179
NM_139321chr2084059 3721 3444 3064 2955 1218 891 690 43466 3269 1533 1114 12989 --
NM_144571chr477033 6913 6503 6235 2779 901 167 25215 2341 26367 366 26581 2508
NM_144578chr1455273 4547 3652 873 91 24293 3357 35558 5326 211 13459
NM_144632chr252063 1779 1628 130 64 21893 119 --1851
NM_144718chr362477 2222 2072 2020 1760 1719 1350 --12452
NM_144721chr462277 2255 889 758 241 90 --1635 --
NM_144778chr1332374 2201 2112 22670 2249 ----
NM_144949chr211015 ----11881
NM_144963chr812140 12544 --2678 626
NM_145055chr1873837 3628 3538 3493 3175 1419 1366 22978 1455 11441 --
NM_145115chr752357 2291 951 781 112 12252 --132
NM_145206chr1063319 3111 2888 2725 2717 165 --178 --
NM_145244chr441203 653 279 227 ----151
NM_145259chr2126547 6486 6038 5515 5323 5291 2418 1400 1262 940 78 50 14490 ----
NM_145263chr442373 618 388 263 ----1930
NM_145307chr1073702 3551 3273 3100 1682 1097 985 33039 1425 610 14548 13466
NM_145315chr63242 93 82 --1122 --
NM_145320chr732944 2340 239 12586 33406 2417 1165 --
NM_145321chr732944 2340 239 12586 33406 2417 1165 --
NM_145322chr732944 2340 239 12586 33406 2417 1165 --
NM_145690chr861847 1754 1617 562 380 30 11284 21515 54 --
NM_145698chr1061961 1757 776 594 357 293 --12002 --
NM_145735chr1362691 2367 2274 2094 974 189 11009 22712 2162 --
NM_147147chr6104239 4135 4044 3712 3304 3273 2743 1257 866 392 24156 1044 23690 2630 --
NM_147150chr9103724 3168 2564 1282 1147 987 822 656 482 87 13058 12701 --
NM_147175chrX42096 1824 848 798 1818 --22159 337
NM_147181chr411304 3958 473 462 145 --
NM_147182chr411304 3958 473 462 145 --
NM_147183chr411304 3958 473 462 145 --
NM_148174chr82745 122 11607 --11747
NM_148955chr15116344 6326 6072 5257 4108 2134 1904 1866 738 674 158 22528 2108 16538 21584 506
NM_148957chr1362655 2618 2612 2574 2536 2078 ------
NM_152263chr195460 5431 5372 5349 5203 1798 542 495 85 --21924 755 --
NM_152277chr541665 871 813 527 ----1259
NM_152291chr41126 ----1309
NM_152349chr171551 ----1516
NM_152387chr241058 818 184 55 131 --1923
NM_152388chr283786 3699 3681 3513 2797 1036 289 47 --12953 --
NM_152389chr271638 1168 1037 627 446 388 280 ------
NM_152407chr592870 2111 2027 1230 741 593 561 444 191 13147 --12848
NM_152409chr582706 2483 2395 2355 731 607 335 236 23600 3577 --11224
NM_152424chrX73679 1707 1245 829 637 609 301 21116 662 24198 1827 --
NM_152450chr152711 340 ----1577
NM_152529chr294092 3413 2733 1735 1585 1532 1154 961 841 ------
NM_152556chr752439 2149 1834 676 346 ------
NM_152588chr1251272 1211 635 621 32 1384 ----
NM_152594chr1562336 2330 2180 1532 458 107 --21581 232 --
NM_152608chr131991 1698 581 22442 234 11984 146
NM_152622chr573257 3059 2982 1235 1216 828 302 --12391 --
NM_152624chr5117419 7048 6184 6118 6018 5214 4685 4644 2685 2434 1155 14888 --11845
NM_152629chr983861 2753 2637 1643 1507 1171 696 179 11491 22723 2679 --
NM_152630chrX41301 1250 1008 150 ----149
NM_152647chr15--126 --1128
NM_152665chr11997 --1874 11171
NM_152671chr21322 ----1438
NM_152686chr561523 786 526 495 107 68 ------
NM_152724chr1042704 2463 207 56 --1201 1345
NM_152756chr563667 3181 1267 1139 740 253 33212 3142 771 ----
NM_152758chr832976 2766 350 12078 13035 --
NM_152765chr851916 936 567 540 216 12029 --12254
NM_152787chrX83867 3373 2811 1401 1278 912 900 791 179 ----
NM_152793chr754194 2078 592 267 248 24544 1754 25186 282 --
NM_152826chr15116344 6326 6072 5257 4108 2134 1904 1866 738 674 158 22528 2108 16538 21584 506
NM_152836chr841824 1647 1324 64 127 11662 136
NM_152837chr841824 1647 1324 64 127 11662 136
NM_152924chr15116860 6800 6380 6119 6045 6011 5991 5842 5206 2450 1878 35981 2690 2221 1575 --
NM_152999chr754982 4612 3531 1319 48 23132 969 14940 24686 1495
NM_153013chr542113 627 562 395 12394 ----
NM_153035chr142883 2213 1278 127 162 22025 1263 --
NM_153050chr2264855 4001 3154 966 886 717 24983 4505 1433 24675 4398
NM_153051chr2264855 4001 3154 966 886 717 24983 4505 1433 24675 4398
NM_153184chr361470 693 388 350 294 229 11619 1169 --
NM_153188chr555519 3565 2027 1999 1856 23890 294 11963 --
NM_153207chr1264012 3279 3271 1624 851 542 12577 ----
NM_153261chr1631281 611 473 21445 304 ----
NM_153371chr1372280 1804 909 770 764 568 475 ----12392
NM_153607chr553049 2694 1948 433 69 11166 ----
NM_153616chr1562435 2234 1825 702 354 222 1841 ----
NM_153617chr1562435 2234 1825 702 354 222 1841 ----
NM_153618chr1562435 2234 1825 702 354 222 1841 ----
NM_153686chr442044 184 134 121 1525 ----
NM_170672chr21196 21310 1118 --1289
NM_170706chr154228 3510 3264 2882 168 --24299 898 --
NM_170710chr462546 2392 2192 2173 2108 739 --12343 --
NM_171998chrX42268 2247 978 100 --21798 1627 --
NM_172037chr851397 1290 1145 371 281 ------
NM_172069chr252349 2081 560 371 246 22269 1996 ----
NM_172070chr252153 739 597 427 33 32056 319 283 11689 --
NM_172071chr1197289 7066 6773 5977 5876 5772 5353 5177 5107 4972 4954 4915 2905 2628 1651 1562 1307 1090 744 16062 26721 4593 15941
NM_172159chr341723 608 230 197 --22378 2108 --
NM_172160chr341723 608 230 197 --22378 2108 --
NM_172373chr1341259 1073 384 377 ------
NM_173082chr641430 996 584 223 --21463 982 --
NM_173214chr16117991 6030 5888 5641 5146 5069 5047 2221 1991 1263 901 37909 5127 2370 47984 6831 5827 2064 --
NM_173468chr485665 4819 4213 3937 3831 1874 1671 1639 21161 350 25317 192 --
NM_173469chr1521270 1014 1387 21581 479 --
NM_173495chrX52281 1916 1750 940 687 ----12417
NM_173511chr253597 3578 974 424 242 12818 ----
NM_173552chr322335 667 2533 33 12144 --
NM_173576chr1052287 2263 1819 244 136 --2371 352 12011
NM_173582chr1185494 5420 4131 3899 2426 2045 2031 1181 24175 2394 12140 --
NM_173602chr1283182 2827 2417 1508 914 399 310 30 12467 --13523
NM_173642chr1118404 8167 7551 6892 6803 2266 1709 1483 1224 995 463 17751 46620 2789 1539 898 18276
NM_173645chr22181 42 ----1223
NM_173683chr851622 1300 1266 1117 390 ----11322
NM_173694chrX82441 2302 1841 1669 884 462 443 207 11583 ----
NM_173808chr184427 4420 3793 3505 3047 1567 1296 1068 --1912 --
NM_173829chr544216 2405 253 140 14743 13945 14248
NM_173851chr853957 3774 3370 2632 1611 32921 846 149 13090 --
NM_174909chr51800 ----1191
NM_175056chr351895 1811 1770 666 506 --11649 --
NM_175061chr731473 1356 207 3805 720 707 ----
NM_175624chr12127780 7567 7449 7391 6902 6862 6701 6603 5469 4946 2689 628 12303 --25930 2807
NM_175625chr12127780 7567 7449 7391 6902 6862 6701 6603 5469 4946 2689 628 12303 --25930 2807
NM_175736chr1267282 6526 6064 4900 2205 558 1934 47017 6660 1955 272 16975
NM_175748chr1451722 1430 212 133 52 21629 26 11909 --
NM_175861chr1295745 5391 5139 1486 942 708 442 390 112 --34214 1886 1821 --
NM_175907chr1852791 1052 1039 802 297 12385 12759 --
NM_176815chr332790 1178 238 12865 12809 1163
NM_176823chr1103876 3865 3016 2839 2692 2645 1441 1435 1399 1369 21283 367 1263 --
NM_177424chr151888 1738 487 287 115 12109 ----
NM_177438chr1463907 3884 3821 3755 3569 918 14147 ----
NM_177947chrX11201 11136 1677 147
NM_177948chrX11201 11136 1677 147
NM_177968chr251733 1405 876 149 133 ------
NM_177974chr1512318 --152 11460
NM_177990chr2062029 1878 1469 1429 1394 500 ------
NM_177999chr922605 2256 ----13717
NM_178011chr1072805 2781 2761 2029 1172 824 809 11213 ----
NM_178037chr1283666 3299 3010 2957 514 315 293 26 --23344 2846 --
NM_178038chr1283666 3299 3010 2957 514 315 293 26 --23344 2846 --
NM_178151chrX157219 7141 6749 6717 6163 5830 5824 4888 3043 2922 2451 2000 1987 1376 49 22588 1979 ----
NM_178152chrX157219 7141 6749 6717 6163 5830 5824 4888 3043 2922 2451 2000 1987 1376 49 22588 1979 ----
NM_178153chrX157219 7141 6749 6717 6163 5830 5824 4888 3043 2922 2451 2000 1987 1376 49 22588 1979 ----
NM_178423chr731042 394 43 ----1975
NM_178425chr731042 394 43 ----1975
NM_178498chr1173684 3626 3249 2858 583 540 105 1950 23653 2901 1284
NM_178539chr1241861 1744 1327 736 ----12100
NM_178585chr422841 144 12642 --11133
NM_178586chr1482167 1824 1732 1717 1710 907 263 117 --12313 --
NM_178815chr101963 11855 --1471
NM_181054chr1441242 399 380 166 1798 ----
NM_181265chr462546 2392 2192 2173 2108 739 --12343 --
NM_181354chr841532 1245 1142 674 ----1130
NM_181358chr174093 3519 3501 2960 2696 864 652 --1715 --
NM_181481chr1897077 6551 6427 5813 5375 4403 2430 1601 1330 25820 2669 14397 16723
NM_181482chr1897077 6551 6427 5813 5375 4403 2430 1601 1330 25820 2669 14397 16723
NM_181483chr1897077 6551 6427 5813 5375 4403 2430 1601 1330 25820 2669 14397 16723
NM_181521chr16147259 6689 6047 5983 5910 5764 5744 5687 5568 5211 4656 2241 1526 828 --11099 24404 1996
NM_181571chr102327 270 1951 --1101
NM_181644chr14665 385 292 179 1109 1334 --
NM_181670chr1261308 1251 1122 556 483 147 --1476 --
NM_181714chr621407 554 --11593 11570
NM_181782chr631775 901 814 22249 834 --12094
NM_181784chr252608 2456 2315 651 275 11778 1147 --
NM_181787chr863386 1101 868 740 296 240 23766 826 ----
NM_181836chr562583 2158 1947 880 451 27 1215 --1314
NM_181838chr5177 1400 --11468
NM_181886chr421396 429 21362 143 1328 --
NM_181887chr421396 429 21362 143 1328 --
NM_181888chr421396 429 21362 143 1328 --
NM_181889chr421396 429 21362 143 1328 --
NM_181890chr421396 429 21362 143 1328 --
NM_181891chr421396 429 21362 143 1328 --
NM_181892chr421443 476 21409 190 1375 --
NM_181893chr421396 429 21362 143 1328 --
NM_182485chr473759 3704 3087 2637 2356 964 514 ------
NM_182493chr16105206 4594 4552 4317 4160 4139 2138 2132 584 451 ------
NM_182503chr6145589 5206 4581 4477 4422 4267 3665 3517 2065 1585 1080 844 221 134 12190 ----
NM_182515chr19166425 6300 6102 5898 5723 5129 4784 4417 4239 2520 2404 2313 1639 692 82 37 11610 16460 --
NM_182551chr243477 953 857 115 --12649 --
NM_182641chr1761942 1906 1656 233 203 57 ------
NM_182643chr831870 723 317 1631 22028 1630 --
NM_182646chr473759 3704 3087 2637 2356 964 514 ------
NM_182717chr10--11356 --1506
NM_182718chr102327 270 1951 --1101
NM_182719chr102327 270 1951 --1101
NM_182720chr10--11356 --1506
NM_182721chr10--11356 --1506
NM_182722chr10--11356 --1506
NM_182723chr10--11356 --1506
NM_182724chr102327 270 1951 --1101
NM_182725chr102327 270 1951 --1101
NM_182734chr2063006 2643 2617 1002 712 661 12535 12240 --
NM_182757chr653190 3090 1271 1042 263 169 13447 --
NM_182758chr1563240 3039 2952 2882 249 60 23381 566 1242 --
NM_182762chr776082 5258 3920 1868 1767 1446 571 25354 1315 ----
NM_182765chr1051995 1560 852 801 467 1598 21526 267 --
NM_182769chr102327 270 1951 --1101
NM_182770chr102327 270 1951 --1101
NM_182771chr102327 270 1951 --1101
NM_182772chr102327 270 1951 --1101
NM_182796chr52322 208 ----1754
NM_182848chr132179 101 2600 364 --1319
NM_182850chr102327 270 1951 --1101
NM_182853chr10--11356 --1506
NM_182898chr7135822 5399 5179 4806 4209 4200 4098 2270 1829 1732 762 616 300 65699 5384 4593 4544 1085 800 --24486 649
NM_182899chr7135822 5399 5179 4806 4209 4200 4098 2270 1829 1732 762 616 300 65699 5384 4593 4544 1085 800 --24486 649
NM_182907chr651777 633 617 472 325 1866 --1388
NM_182948chr162887 2224 1076 317 271 108 22218 732 21926 573 --
NM_182970chr2064190 3561 3080 2739 2733 2724 ------
NM_183011chr10--11356 --1506
NM_183012chr10--11356 --1506
NM_183013chr10--11356 --1506
NM_183060chr102327 270 1951 --1101
NM_183075chr423030 191 --11890 11878
NM_183227chr621644 1258 --11065 1625
NM_194247chr293042 1764 1495 991 835 579 570 500 487 1909 22782 962 13596
NM_194282chr463066 2517 2219 765 702 384 12303 12378 12437
NM_194291chr842950 2295 602 196 --12181 12153
NM_194298chr1041730 1643 95 22 1340 2438 236 --
NM_194314chr154125 3727 811 565 342 23451 543 ----
NM_194317chr26924 538 479 405 254 177 32540 2168 853 12263 --
NM_194434chr1885602 5078 4832 4688 3633 1655 1235 917 23916 414 2104 74 --
NM_194454chr741742 1553 504 427 11270 11388 --
NM_194455chr741742 1553 504 427 11270 11388 --
NM_194456chr741742 1553 504 427 11270 11388 --
NM_197941chr593006 2975 2773 2550 2257 757 585 369 324 12000 ----
NM_197970chr24470 418 281 21 11060 ----
NM_198066chr1432760 2722 1105 12705 1940 1687
NM_198128chr1832013 546 74 1338 31920 1872 1824 --
NM_198158chr372371 2024 945 886 541 459 308 ------
NM_198159chr372371 2024 945 886 541 459 308 ------
NM_198177chr372371 2024 945 886 541 459 308 ------
NM_198178chr372371 2024 945 886 541 459 308 ------
NM_198215chr1041341 1198 1191 1019 ------
NM_198268chr174093 3519 3501 2960 2696 864 652 --1715 --
NM_198269chr174093 3519 3501 2960 2696 864 652 --1715 --
NM_198270chrX43270 3208 1039 741 1331 32196 870 590 --
NM_198281chr44733 529 412 316 22761 2618 ----
NM_198392chr661968 1455 825 590 369 216 12341 11931 --
NM_198400chr1592957 2921 2832 2616 2102 1813 1095 770 474 ------
NM_198485chr372477 2434 2387 1799 747 709 460 11657 --11870
NM_198569chr672688 2595 2396 1651 451 428 389 22218 676 1753 12409
NM_198581chr287298 6766 4868 4813 2318 2290 1602 1135 37205 2510 1868 ----
NM_198595chr484326 4104 3772 3505 1972 1951 651 307 13077 ----
NM_198793chr393826 3776 3636 3469 3250 2937 2700 615 600 --23681 2593 --
NM_198859chr3134905 4843 4673 4625 4482 4467 4412 3872 1821 1415 921 693 520 --14359 --
NM_198889chr44996 534 224 179 11263 189 --
NM_198900chr1267282 6526 6064 4900 2205 558 1934 47017 6660 1955 272 16975
NM_198990chr772895 2402 1235 847 341 285 59 --2367 358 22260 414
NM_199000chr732214 1766 693 --12108 1556
NM_199040chr1251537 1042 831 561 305 33441 453 379 ----
NM_199053chr43799 630 259 ----1160
NM_199072chr743015 2792 2238 2039 1394 1314 --
NM_199132chr1962074 1903 1839 828 818 365 1554 ----
NM_199320chr472904 2806 2117 1786 1116 835 161 12732 22462 2088 1412
NM_199320chr472904 2806 2117 1786 1116 835 161 12732 22462 2088 1412
NM_199324chr453523 3145 2511 1033 974 33274 1252 208 22977 409 --
NM_199328chr213481 437 260 --11068 --
NM_199421chr14134983 4521 3507 3457 3436 3430 3401 1654 829 727 719 428 145 13113 34231 679 369 1520
NM_199436chr232428 2368 1166 ----12980
NM_199461chr1052237 1060 1007 466 204 ----12214
NM_201263chr121686 772 --11806 1359
NM_201266chr2103051 2674 2461 2354 1011 793 663 595 418 35 --11215 12930
NM_201279chr2103051 2674 2461 2354 1011 793 663 595 418 35 --11215 12930
NM_201428chr1111038 ----144
NM_201429chr1111038 ----144
NM_201437chr841505 1327 602 32 --11127 --
NM_203349chr1562174 1750 1682 1593 634 45 1696 1433 21431 887
NM_203350chr131545 542 292 1215 2250 231 --
NM_203364chr1121214 1090 ----1450
NM_203372chr23483 111 95 --1133 --
NM_203382chr531430 571 361 11455 --11602
NM_203391chrX31310 327 290 ----191
NM_203394chr1212406 --12080 12003
NM_203406chr572338 2052 1111 1039 924 106 49 11953 12107 --
NM_203446chr2162786 2465 2063 939 63 47 2340 277 ----
NM_203463chr284861 4585 4090 3371 3157 1106 489 38 23430 3295 1181 21565 522
NM_203464chr121054 1015 21286 39 21310 976 --
NM_203504chr482448 2386 1922 1882 1683 719 662 107 12242 1916 --
NM_203505chr482448 2386 1922 1882 1683 719 662 107 12242 1916 --
NM_206594chr1103538 3194 2509 2430 2349 822 792 361 304 291 32522 1084 916 --23023 2712
NM_206595chr1103538 3194 2509 2430 2349 822 792 361 304 291 32522 1084 916 --23023 2712
NM_206855chr666265 5594 1357 617 537 264 15675 14562 --
NM_206866chr2162591 2581 2092 2005 1175 466 1289 13002 --
NM_206907chr532836 189 71 33389 2169 2125 --23060 1245
NM_206909chr8117800 7595 6637 5921 5806 5789 5228 3096 2337 1738 665 16195 46675 6046 5989 2817 --
NM_207012chr1093432 2860 2497 2463 1120 731 590 519 63 12222 12246 --
NM_207043chr132299 1935 1879 32352 1755 1736 --12094
NM_207044chr132299 1935 1879 32352 1755 1736 --12094
NM_207047chr132299 1935 1879 32352 1755 1736 --12094
NM_207292chr373251 2771 2743 2227 2076 991 481 --1773 --
NM_207293chr373251 2771 2743 2227 2076 991 481 --1773 --
NM_207294chr373251 2771 2743 2227 2076 991 481 --1773 --
NM_207295chr373251 2771 2743 2227 2076 991 481 --1773 --
NM_207296chr373251 2771 2743 2227 2076 991 481 --1773 --
NM_207297chr373276 2796 2768 2252 2101 1016 506 --1798 --
NM_207303chr1063885 3830 3671 1234 857 614 11572 ----
NM_207304chr1332261 2088 1999 22557 2136 ----
NM_207406chr485119 4493 2334 2321 1211 637 149 96 25131 4269 2711 507 11666
NM_207411chr833446 3079 1093 23502 2978 1101 12966
NM_207481chr231248 960 365 2455 56 ----
NM_212554chr1041544 1182 551 449 --11323 --
NM_213651chr171172 722 625 610 457 443 330 ------