TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4790-5p
miRNA Sequence: AUCGCUUUACCAUUCAUGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr541302 472 322 169 1419 ----
NM_000038chr511920 ------
NM_000081chr111536 ------
NM_000090chr2186 ------
NM_000115chr1322496 2439 ------
NM_000125chr643999 3697 523 429 ------
NM_000163chr531765 1605 832 ----1345
NM_000176chr523762 3341 ------
NM_000183chr21499 ------
NM_000189chr21764 ------
NM_000192chr1231482 1162 1149 ------
NM_000194chrX1372 ------
NM_000210chr242125 2101 655 159 --1100 --
NM_000214chr2031333 1320 428 ------
NM_000216chrX1174 ------
NM_000217chr1255103 3558 1727 1689 994 ------
NM_000237chr83259 183 109 ------
NM_000240chrX12289 ------
NM_000242chr1022594 1065 ------
NM_000245chr732140 1493 760 --12248 --
NM_000259chr1555329 2552 947 844 666 ------
NM_000266chrX1309 ------
NM_000267chr1742730 936 409 262 ------
NM_000278chr10------11943
NM_000280chr111891 ------
NM_000284chrX11743 ------
NM_000291chrX----1283 --
NM_000304chr171443 ------
NM_000314chr1032972 2900 307 1707 ----
NM_000318chr831886 860 697 12212 ----
NM_000345chr42820 280 1197 ----
NM_000378chr11----1880 --
NM_000386chr171153 ------
NM_000390chrX1833 --1286 --
NM_000393chr211863 ----1660
NM_000408chr212453 ----13350
NM_000421chr171280 ------
NM_000439chr51525 1237 12481 --
NM_000452chr131153 ----1106
NM_000458chr171569 1663 1616 --
NM_000462chr151264 --11839 --
NM_000489chrX33290 2579 2293 --22628 473 --
NM_000493chr611150 1868 1163 --
NM_000496chr22183 ------
NM_000503chr821476 595 ------
NM_000522chr71322 ------
NM_000523chr211071 --11047 --
NM_000533chrX51974 1896 1619 527 365 ------
NM_000539chr31310 ------
NM_000599chr243852 3772 939 857 ----14543
NM_000600chr71309 ------
NM_000615chr1122264 553 12929 140 --
NM_000618chr1215392 11645 24964 1850 --
NM_000618chr1215392 11645 24964 1850 --
NM_000625chr171308 --1101 --
NM_000633chr1844229 3502 1630 1436 1888 ----
NM_000702chr132247 1747 637 ------
NM_000724chr102762 364 11566 ----
NM_000759chr171844 ------
NM_000793chr1423232 842 ------
NM_000800chr51294 ------
NM_000801chr2011111 ------
NM_000807chr41262 ----1252
NM_000808chrX----1854 --
NM_000813chr522167 219 --25314 101 --
NM_000826chr441683 911 362 229 22281 651 --11971
NM_000839chr31485 ------
NM_000840chr7150 ------
NM_000868chrX22563 112 ----1913
NM_000876chr61971 ------
NM_000882chr32459 279 ------
NM_000891chr1743466 2461 499 109 ----13095
NM_000899chr1213629 --13490 13311
NM_000902chr312106 12209 1857 --
NM_000912chr842617 2287 740 231 ----13302
NM_000919chr51637 ------
NM_000922chr112374 353 ------
NM_000924chr1231034 850 38 ------
NM_000944chr412228 ------
NM_000945chr21423 ------
NM_000947chr63663 134 74 ------
NM_000958chr51980 11321 ----
NM_000963chr11705 ------
NM_000983chr131626 1040 312 ------
NM_001001323chr121529 ------
NM_001001394chr21597 ------
NM_001001419chr554879 3601 3394 903 481 --11561 --
NM_001001420chr554879 3601 3394 903 481 --11561 --
NM_001001433chr2062963 2910 2744 2132 597 170 --32337 1953 1255 --
NM_001001481chr823030 98 --21382 468 --
NM_001001521chr21223 ------
NM_001001664chr223631 1525 ------
NM_001001668chr1923881 528 --12705 --
NM_001001852chr22----1886 --
NM_001001995chrX11172 ------
NM_001002244chr17--1130 ----
NM_001002245chr17--1165 ----
NM_001002246chr17--1165 ----
NM_001002247chr17--1165 ----
NM_001002248chr17--1165 ----
NM_001002249chr17--1165 ----
NM_001002258chr2----11961 11233
NM_001002295chr10------11160
NM_001002843chr151963 ------
NM_001002906chrY1433 ------
NM_001002909chr1731878 911 544 12000 --1734
NM_001003652chr1857364 2853 2520 2003 587 18135 27492 1184 16067
NM_001003656chr101573 ------
NM_001003676chr111393 ------
NM_001003688chr4--11003 ----
NM_001003712chr121762 --1199 --
NM_001003792chr331190 1070 915 ------
NM_001003793chr331190 1070 915 ------
NM_001003845chr2----1520 --
NM_001003927chr172566 76 ------
NM_001004065chr953576 1002 911 97 22 ----1935
NM_001004304chr1233210 920 666 --1881 --
NM_001004317chr621275 1163 14317 --14203
NM_001004356chr411536 ------
NM_001004358chr411536 ------
NM_001004419chr1221337 1115 12865 ----
NM_001005332chrX1215 ------
NM_001005333chrX1215 ------
NM_001005353chr111042 ------
NM_001005353chr111042 ------
NM_001005375chrY11364 ------
NM_001005463chr1022222 2060 --1274 11703
NM_001005476chr21161 ----1100
NM_001005526chr2137 ------
NM_001005739chr2------1106
NM_001005861chr32885 393 ----1823
NM_001006118chrY1222 ------
NM_001006120chrY1222 ------
NM_001006605chr121071 764 ------
NM_001006605chr121071 764 ------
NM_001006623chr21521 ----1220
NM_001006636chr2--1647 ----
NM_001007023chr1423232 842 ------
NM_001007072chr15184 ------
NM_001007075chr431007 252 118 ------
NM_001007246chr2121835 397 ------
NM_001007267chr2----1780 --
NM_001007471chr91762 ------
NM_001007526chrY1222 ------
NM_001007527chr53614 543 104 1457 ----
NM_001007538chr131678 11626 ----
NM_001008391chr111187 ------
NM_001008408chr786134 2323 1541 1214 1157 623 272 135 ----14604
NM_001008410chr222168 87 ------
NM_001008539chr835286 5037 3292 14823 1964 1846
NM_001008540chr21417 ------
NM_001008541chr101180 ----12072
NM_001008541chr101180 ----12072
NM_001008564chr1311832 ------
NM_001008660chr111324 ------
NM_001008693chr201292 ------
NM_001008707chr1411424 ------
NM_001008723chr101454 ------
NM_001008726chr14--11172 1538 21358 648
NM_001008738chr562467 2037 1902 1064 910 262 ------
NM_001009555chr421130 602 1339 ----
NM_001009566chr131449 1034 986 ----1565
NM_001009881chr1----1110 --
NM_001009882chr1----1110 --
NM_001009955chr1173 ------
NM_001009955chr1173 ------
NM_001009958chr7----1583 --
NM_001010853chr652556 1184 769 608 123 ----1171
NM_001010861chr1--190 --12000
NM_001010888chrX53353 3067 673 647 512 ------
NM_001010891chr566856 5802 5181 2761 2735 1454 1791 1530 --
NM_001010927chr6161 ------
NM_001010971chr11920 ------
NM_001011666chr735063 4135 1584 1902 --15374
NM_001011713chr14------11603
NM_001011724chr133245 225 43 ------
NM_001011725chr133245 225 43 ------
NM_001011885chr1511340 --11317 --
NM_001012267chr921321 1302 --1202 1555
NM_001012732chr411183 1446 ----
NM_001012751chr10--1689 ----
NM_001013406chr711091 ------
NM_001013438chr31777 ------
NM_001013439chr31623 ------
NM_001013620chr1276012 5986 3085 2374 2004 1636 840 12323 17673 --
NM_001013699chr12----1145 --
NM_001013717chr5--11124 1925 --
NM_001013843chr151583 ------
NM_001014434chr12547 217 1197 ----
NM_001014797chr1068020 7719 7482 7363 6779 1011 16566 26746 3111 13256
NM_001015881chrX--11069 ----
NM_001015892chr51171 ------
NM_001017395chr333487 3132 914 --11337 1616
NM_001017424chr11629 ------
NM_001017425chr11629 ------
NM_001017440chr758025 6469 5916 3155 2981 --15083 --
NM_001017523chr1211281 ------
NM_001017923chr1431246 657 459 ------
NM_001017977chr11249 ------
NM_001018038chr9--128 ----
NM_001018065chr935360 4392 4320 ------
NM_001018066chr935360 4392 4320 ------
NM_001018067chr135132 3546 1232 1837 15286 15087
NM_001018068chr135132 3546 1232 1837 15286 15087
NM_001018069chr135132 3546 1232 1837 15286 15087
NM_001018072chr1211281 ------
NM_001018074chr523762 3341 ------
NM_001018075chr523762 3341 ------
NM_001018076chr523762 3341 ------
NM_001018077chr523762 3341 ------
NM_001018090chr1531761 1098 625 ------
NM_001018102chr1531761 1098 625 ------
NM_001020658chr111397 11463 ----
NM_001020658chr111397 11463 ----
NM_001023567chr1542353 2290 2070 650 ------
NM_001024094chr523762 3341 ------
NM_001024380chr81205 ------
NM_001024381chr81205 ------
NM_001024463chr152839 25 ------
NM_001024649chr52668 489 ------
NM_001024947chr5----1788 --
NM_001024948chr111104 ------
NM_001025076chr1034870 4415 2124 25801 4083 --11074
NM_001025077chr1026228 5773 27159 5441 11343 12432
NM_001025079chr323567 3040 ------
NM_001025081chr1811547 ------
NM_001025090chr1811547 ------
NM_001025092chr1811547 ------
NM_001025101chr1811547 ------
NM_001025105chr5------1616
NM_001025201chr21613 ----1126
NM_001025203chr21136 ------
NM_001025204chr21136 ------
NM_001025233chr122494 380 32574 986 958 ----
NM_001025266chr363973 1680 1505 1130 294 285 --14693 --
NM_001025366chr611215 ------
NM_001025366chr611215 ------
NM_001025367chr611215 ------
NM_001025367chr611215 ------
NM_001025368chr611215 ------
NM_001025368chr611215 ------
NM_001025369chr611231 ------
NM_001025369chr611231 ------
NM_001025370chr611215 ------
NM_001025370chr611215 ------
NM_001025580chrX53647 3546 1668 1568 419 ------
NM_001025780chr921169 1013 ------
NM_001029863chr622614 229 ------
NM_001030001chr14------1417
NM_001030006chr1722086 381 ------
NM_001030007chr1643929 3278 910 838 13451 11527 --
NM_001030055chr1423063 1208 13256 1664 --
NM_001030272chr112177 41 ------
NM_001030273chr112177 41 ------
NM_001031684chr221022 76 ------
NM_001031689chr91129 ------
NM_001031695chr221411 15399 14816 1927
NM_001032221chr911357 ------
NM_001032280chr6----1618 1406
NM_001032288chr2021629 539 11550 ----
NM_001032293chr17--1255 ----
NM_001032380chr101533 ------
NM_001032393chrX1239 1756 --1539
NM_001032394chr612105 --12767 --
NM_001032395chr621972 1017 --12634 --
NM_001033044chr11458 ------
NM_001033056chr11458 ------
NM_001033112chr51149 ------
NM_001033557chr21436 ------
NM_001033564chr6185 ------
NM_001033578chr812335 ------
NM_001033756chr611149 ------
NM_001033756chr611149 ------
NM_001033925chr102668 484 ------
NM_001034845chr431179 989 501 ------
NM_001034850chr5----11535 --
NM_001035chr11944 ------
NM_001035260chr101285 ------
NM_001037132chr71191 ------
NM_001037133chr71191 ------
NM_001037164chr71190 ------
NM_001037290chr111756 ------
NM_001037317chr1--190 --12000
NM_001037872chr22148 68 ------
NM_001038640chr151717 ------
NM_001038702chr542447 2085 1998 22 12262 ----
NM_001039199chr2024994 3260 14777 ----
NM_001039538chr22640 484 ------
NM_001039547chr365528 5386 3086 2872 1874 1848 --25745 2318 --
NM_001039577chr143826 3499 2963 1544 ----13327
NM_001039590chrX53863 2856 2693 727 187 ------
NM_001039591chrX53863 2856 2693 727 187 ------
NM_001039618chr1134940 1355 134 --25726 1083 --
NM_001039675chr151365 ------
NM_001039711chr12432 145 2875 796 11067 --
NM_001039712chr12432 145 2875 796 11067 --
NM_001039762chr1022172 598 ------
NM_001039802chr1----1224 --
NM_001039840chrX36083 4527 1429 25673 1512 ----
NM_001040001chr652001 1868 1532 824 108 ------
NM_001040100chr31352 ------
NM_001040108chr1432686 2092 1176 22449 1275 ----
NM_001040151chr1131713 1259 464 ------
NM_001040152chr721848 75 --14978 14830
NM_001040159chr4--1369 1518 --
NM_001040202chr411629 ----1220
NM_001040214chr62748 730 ------
NM_001040284chr1665737 5476 4897 3894 1488 662 --25443 443 --
NM_001040429chr13------1934
NM_001040441chr135056 4902 573 --25274 4719 21899 1045
NM_001040624chr812556 --12231 --
NM_001040625chr812556 --12231 --
NM_001040626chr812556 --12231 --
NM_001040627chr812556 --12231 --
NM_001040628chr812556 --12231 --
NM_001040629chr812556 --12231 --
NM_001040630chr812556 --12231 --
NM_001040633chr72779 250 ------
NM_001040708chr81854 ------
NM_001040712chr923505 1355 --12900 1593
NM_001042355chr1644733 3549 1283 668 11432 14390 --
NM_001042412chr1644733 3549 1283 668 11432 14390 --
NM_001042425chr6----1618 1406
NM_001042453chrX11353 ------
NM_001042473chr1051897 1773 1475 707 605 ----11800
NM_001042475chr6182 ------
NM_001042492chr1742730 936 409 262 ------
NM_001042493chr61240 ------
NM_001042601chr311075 12793 ----
NM_001042603chr1245357 4994 4633 3772 11840 13746 --
NM_001042646chr311959 ------
NM_001042749chrX31256 456 64 ------
NM_001042750chrX31256 456 64 ------
NM_001042751chrX31256 456 64 ------
NM_001048183chr163273 2851 2691 2305 1055 968 13552 32507 1435 59 --
NM_001050chr17--11039 --1211
NM_001071775chr1321825 164 ----11230
NM_001078chr1----1744 --
NM_001079874chr121690 615 ------
NM_001083620chr441682 910 361 228 22279 650 --11969
NM_001085487chr1171 ------
NM_001096chr17161 ------
NM_001106chr3129377 8343 8306 7958 6779 6543 3526 2982 2493 1786 1211 788 --27621 3729 --
NM_001113490chrX13169 --1971 --
NM_001116chr1622221 534 ------
NM_001117chr1822498 299 ----1883
NM_001121chr1041441 1379 770 337 ------
NM_001122679chr541302 472 322 169 1419 ----
NM_001128chr1643929 3278 910 838 13451 11527 --
NM_001146chr811872 11526 ----
NM_001148chr42509 169 12096 ----
NM_001160chr1251790 1133 830 543 129 ----12180
NM_001167chrX95865 5730 5714 4702 2342 2115 1952 1816 579 24246 312 26187 560 --
NM_001173chr1423063 1208 13256 1664 --
NM_001174chrX72228 1918 1530 864 823 750 411 ----1348
NM_001178chr112177 41 ------
NM_001200chr20------1776
NM_001201chr423575 440 ------
NM_001204chr246411 5506 2662 281 ----16754
NM_001234chr31528 --1261 --
NM_001238chr191162 ------
NM_001241chr21568 ------
NM_001241chr21568 ------
NM_001253chr61286 ------
NM_001254chr171458 --1200 --
NM_001256chr172873 683 ------
NM_001259chr744787 4425 2349 473 --12190 --
NM_001262chr1--1136 ----
NM_001273chr121504 ------
NM_001282chr1722086 381 ------
NM_001293chr111479 ------
NM_001304chr1733609 2542 1258 --12519 --
NM_001310chr12--1779 ----
NM_001331chr1122135 489 1585 ----
NM_001345chr121208 ------
NM_001356chrX12540 --11841 --
NM_001386chr822320 1739 ----1379
NM_001390chr1843593 3292 2615 1104 13380 ----
NM_001391chr1811130 ------
NM_001396chr21171 ------
NM_001438chr112479 ------
NM_001443chr2------154
NM_001444chr81153 ------
NM_001448chrX123 ------
NM_001449chrX1291 ----1212
NM_001452chr61542 ------
NM_001460chr111351 12783 1700 --
NM_001482chr15183 1699 --1606
NM_001483chr711014 182 ----
NM_001493chrX----1624 1722
NM_001497chr912091 ------
NM_001514chr11521 ------
NM_001543chr524865 1548 ------
NM_001546chr6------11090
NM_001566chr2144 ------
NM_001584chr11----1296 --
NM_001604chr111891 ------
NM_001609chr1021542 520 1764 --14008
NM_001616chr243474 793 536 246 --1961 --
NM_001628chr72363 30 ------
NM_001650chr1833526 3477 2771 ------
NM_001656chr511628 2401 330 ----
NM_001663chr1432307 961 806 ------
NM_001664chr32682 657 ------
NM_001668chr121416 525 ------
NM_001677chr12949 167 ------
NM_001682chr121243 ------
NM_001688chr1----1323 --
NM_001689chr2----11961 11233
NM_001690chr332617 2039 720 ------
NM_001699chr194673 647 512 375 ------
NM_001706chr31726 1706 ----
NM_001730chr1321643 175 ------
NM_001730chr1321643 175 ------
NM_001731chr123724 579 159 ------
NM_001746chr52668 489 ------
NM_001759chr1275235 5103 4730 3907 3733 994 149 ------
NM_001773chr1----21554 1527 --
NM_001777chr323567 3040 ------
NM_001789chr311297 ------
NM_001791chr1----1224 --
NM_001797chr161162 1267 ----
NM_001806chr1921086 1020 ------
NM_001822chr21613 ----1126
NM_001839chr11620 ------
NM_001845chr132285 120 ------
NM_001850chr3--1128 ----
NM_001854chr111353 ----11446
NM_001855chr9--1869 ----
NM_001892chr5------1616
NM_001904chr32809 399 ------
NM_001921chr411183 1446 ----
NM_001923chr111462 ------
NM_001950chr161229 1774 ----
NM_001951chr81201 ----1444
NM_001964chr5----11131 --
NM_001981chr12778 488 ------
NM_002014chr121672 ------
NM_002024chrX22051 1867 ----11964
NM_002037chr61405 ------
NM_002048chr91463 ------
NM_002051chr10------11160
NM_002063chrX--11051 ----
NM_002065chr11458 ------
NM_002075chr121482 ------
NM_002094chr161269 ------
NM_002128chr1322223 918 11792 --12548
NM_002136chr122225 43 --1579 --
NM_002139chrX2510 50 ------
NM_002140chr91918 ------
NM_002154chr5--185 ----
NM_002158chr233562 1206 745 13686 ----
NM_002201chr15197 ------
NM_002202chr521053 42 1960 ----
NM_002203chr523418 553 ------
NM_002211chr101293 ------
NM_002214chr731541 1534 573 13805 --14242
NM_002223chr1221243 213 14020 31258 861 488 --
NM_002232chr111317 ------
NM_002235chr122622 204 ------
NM_002247chr1022250 2182 1760 ----
NM_002264chr324917 1618 ----24276 1521
NM_002267chr1322169 1671 12189 ----
NM_002270chr554132 4026 2009 1741 855 24608 4422 14428 --
NM_002293chr11209 ------
NM_002294chrX1190 ------
NM_002296chr111580 --1522 1516
NM_002310chr565176 2235 1598 1344 1292 145 --15988 --
NM_002317chr51381 ------
NM_002334chr1121981 1835 ----11644
NM_002336chr12--14776 ----
NM_002351chrX31747 1447 1196 ------
NM_002353chr1164 ------
NM_002356chr662616 2437 1863 770 416 336 ----12465
NM_002358chr4--1653 1658 --
NM_002372chr51505 ------
NM_002374chr22640 484 ------
NM_002381chr22820 726 ------
NM_002385chr1811547 ------
NM_002401chr171394 ------
NM_002402chr711134 ------
NM_002427chr1121222 956 ------
NM_002430chr2232552 2087 1628 ------
NM_002469chr121351 ------
NM_002480chr1231309 1029 308 ------
NM_002482chr1133 ------
NM_002487chr151587 ------
NM_002500chr22125 102 --11323 --
NM_002507chr1731971 1333 374 ------
NM_002508chr1180 ------
NM_002515chr14--183 ----
NM_002569chr15----11553 --
NM_002581chr923504 654 21507 581 1938 --
NM_002595chr121509 1641 ----
NM_002612chr7136 ------
NM_002628chr31416 ------
NM_002635chr12156 ------
NM_002641chrX----11577 11918
NM_002645chr11--1940 ----
NM_002655chr854866 4711 4548 2083 1312 ------
NM_002668chrX1122 ------
NM_002687chr141985 ------
NM_002703chr421269 165 ------
NM_002709chr212651 13404 --23362 463
NM_002710chr121199 ------
NM_002717chr8----1706 --
NM_002731chr121197 697 --1888 --
NM_002737chr1724937 4778 21281 61 24340 383 --
NM_002764chrX1979 ------
NM_002806chr141271 ------
NM_002839chr923505 1355 --12900 1593
NM_002844chr621207 22 11264 ----
NM_002845chr181142 ------
NM_002869chr1111909 ------
NM_002874chr9--11781 12066 --
NM_002886chr344576 4215 3168 740 ------
NM_002887chr5140 ------
NM_002888chr3136 ------
NM_002892chr14--1196 ----
NM_002893chrX1146 ------
NM_002906chr1111860 --12409 --
NM_002924chr1--1255 ----
NM_002938chr41617 ------
NM_002942chr3163 11210 ----
NM_002948chr31136 ------
NM_002958chr32885 393 ----1823
NM_002971chr33859 804 265 ------
NM_002976chr22502 214 ------
NM_002977chr212630 --2245 41 --
NM_002994chr41328 ------
NM_002998chr812193 ------
NM_003011chr911612 ------
NM_003017chr621076 899 11051 ----
NM_003026chr92527 131 ------
NM_003032chr311818 ------
NM_003040chr71144 1100 ----
NM_003042chr311848 --11401 --
NM_003046chr835286 5037 3292 14823 1964 1846
NM_003048chr212773 2526 401 11905 --
NM_003081chr2011174 ------
NM_003100chr5--1368 ----
NM_003107chr622315 770 1636 31898 414 326 159
NM_003108chr255887 4866 4694 1733 443 ----1226
NM_003110chr1711032 --1333 --
NM_003112chr722957 1240 ------
NM_003131chr612006 1732 ----
NM_003136chr143403 381 92 ------
NM_003161chr17--12384 ----
NM_003170chr172108 97 ------
NM_003182chr71130 ------
NM_003182chr71130 ------
NM_003187chr51171 ------
NM_003189chr12214 104 ----11347
NM_003193chr11154 ------
NM_003194chr62591 427 ------
NM_003199chr1851163 1135 569 431 208 13849 --13522
NM_003220chr6----1618 1406
NM_003221chr623355 1167 --12698 11536
NM_003222chr202474 291 ------
NM_003238chr11242 ------
NM_003239chr141201 ------
NM_003257chr1511280 1530 ----
NM_003262chr334670 4508 722 ----21945 656
NM_003269chr61482 ----11271
NM_003275chr911156 ------
NM_003291chr13------1841
NM_003298chr335404 5300 938 1880 --16254
NM_003338chr10--1527 11370 --
NM_003340chr421308 981 ------
NM_003347chr221158 --11754 --
NM_003349chr2021629 539 11550 ----
NM_003376chr611215 ------
NM_003376chr611215 ------
NM_003387chr252714 2294 2145 1950 855 1587 ----
NM_003391chr71360 ------
NM_003403chr142775 247 ------
NM_003404chr2012045 ----12063
NM_003409chr182303 35 ------
NM_003410chrX12464 12676 ----
NM_003411chrY11746 ------
NM_003412chr332613 2470 662 --1789 12215
NM_003413chrX11390 ------
NM_003423chr1922230 789 ----1326
NM_003432chr51454 ------
NM_003455chr1121167 375 ------
NM_003457chr17--1255 ----
NM_003463chr623203 965 13020 13215 --
NM_003467chr21417 ------
NM_003468chr233529 794 514 --1603 --
NM_003469chr21315 ------
NM_003478chr1123053 2034 12429 --1268
NM_003487chr172250 108 ------
NM_003507chr261723 1402 818 358 133 122 --21494 195 --
NM_003508chr71118 ------
NM_003557chr11127 --11625 --
NM_003583chr1233384 3200 1579 --1509 --
NM_003590chr212558 --11096 --
NM_003598chr191644 ----1483
NM_003615chr343206 2788 336 190 ------
NM_003620chr17----1445 --
NM_003622chr1222503 257 ------
NM_003626chr1111160 ------
NM_003628chr21161 ----1100
NM_003632chr171828 ------
NM_003646chr111592 ------
NM_003651chr121126 ------
NM_003659chr2--1757 --11228
NM_003664chr5144 ------
NM_003672chr121951 1235 --1543 --
NM_003692chr9----1806 --
NM_003705chr21590 ------
NM_003713chr11531 ----11722
NM_003714chr523025 2803 ------
NM_003722chr342354 1742 1688 244 --12247 --
NM_003743chr21718 ------
NM_003749chr13--1665 11657 --
NM_003760chr11669 ------
NM_003763chr2062963 2910 2744 2132 597 170 --32337 1953 1255 --
NM_003772chr1121272 1087 ------
NM_003787chr181150 ------
NM_003794chr3133 ------
NM_003799chr1824260 1276 --14170 --
NM_003816chr821434 1233 ------
NM_003825chr1511450 ------
NM_003877chr121964 ------
NM_003884chr321487 1298 --11159 --
NM_003913chr663295 2646 1153 983 962 743 13852 23285 1085 11199
NM_003934chr921254 368 ------
NM_003947chr311223 ------
NM_003987chr10------11943
NM_003988chr10------12020
NM_003989chr10------11879
NM_003990chr10------11879
NM_003992chr151218 ------
NM_003994chr1213629 --13490 13311
NM_004016chrX1325 ------
NM_004018chrX1325 ------
NM_004021chrX1325 ------
NM_004022chrX1325 ------
NM_004023chrX1325 ------
NM_004028chr1833526 3477 2771 ------
NM_004067chr7--11521 11032 1972
NM_004071chr2----1193 --
NM_004077chr12----237 23 --
NM_004081chrY11364 ------
NM_004087chr31368 ------
NM_004089chrX--11069 ----
NM_004093chr1322587 2212 ------
NM_004096chr1011355 --1847 --
NM_004100chr622700 541 ----1973
NM_004109chr11----167 --
NM_004113chr31601 ------
NM_004114chrX21157 1022 ------
NM_004124chr142316 192 --11193 --
NM_004133chr81359 12556 ----
NM_004145chr191968 ------
NM_004152chr19----1370 --
NM_004161chr2--156 ----
NM_004171chr1187895 3875 3779 2372 2200 2041 1097 412 16446 25931 1230 --
NM_004172chr521317 176 ------
NM_004210chr10----12164 --
NM_004229chrX12164 ------
NM_004232chr1833441 2552 1086 --13576 --
NM_004241chr101744 ------
NM_004261chr1----1709 --
NM_004272chr521658 1406 12008 ----
NM_004291chr52418 379 ------
NM_004293chr922890 689 ------
NM_004326chr1--11059 ----
NM_004330chr151444 ------
NM_004331chr812470 --22601 1997 --
NM_004362chr42477 207 ------
NM_004380chr1612309 ------
NM_004426chr1211458 --11567 --
NM_004432chr921994 281 ----11987
NM_004433chr131832 1280 663 ------
NM_004434chr1411424 ------
NM_004437chr1------11260
NM_004439chr4--130 ----
NM_004440chr6193 ------
NM_004441chr321111 1060 1255 ----
NM_004449chr213299 287 83 ------
NM_004456chr71186 ------
NM_004458chrX1445 ------
NM_004480chr141322 1601 ----
NM_004482chr2----1280 --
NM_004501chr173474 3395 3331 3284 2714 1568 1011 ----1191
NM_004503chr121316 ----1730
NM_004504chr222475 671 ------
NM_004505chr1721661 74 ------
NM_004506chr62562 466 ------
NM_004535chr2021734 469 --1236 11248
NM_004540chr212748 303 1761 ----
NM_004580chr1541324 1221 691 232 ------
NM_004586chrX44261 4061 3397 2002 24718 1184 23358 1444 --
NM_004593chr31737 ----186
NM_004596chr191196 ------
NM_004598chr521338 717 ------
NM_004600chr121187 325 ------
NM_004612chr924373 1748 --1390 24865 1185
NM_004645chr17----150 --
NM_004654chrY--1973 ----
NM_004677chrY1433 ------
NM_004686chr831143 292 143 ------
NM_004687chr1732026 370 323 ------
NM_004696chr1125 ------
NM_004703chr1752559 2453 2305 987 272 21700 629 1335 --
NM_004705chr111209 ------
NM_004709chrX11625 ------
NM_004719chr1221070 45 --12231 --
NM_004726chrX95486 5353 5053 3498 2064 1110 1094 1051 667 ------
NM_004734chr1332229 1994 236 ------
NM_004736chr11501 ------
NM_004739chr111119 ------
NM_004744chr421172 146 --23021 2586 --
NM_004745chr844981 4690 654 464 --1602 11439
NM_004748chr1544205 4154 3616 1099 2748 289 12662 --
NM_004760chr71332 --1894 --
NM_004772chr51517 1194 ----
NM_004775chr18------11648
NM_004781chr111774 ------
NM_004781chr111774 ------
NM_004788chr11--12432 ----
NM_004796chr1431957 1511 396 --1672 --
NM_004798chr2032429 240 117 --13638 1468
NM_004801chr22541 406 ------
NM_004815chr114727 ------
NM_004831chr192291 22 --1255 --
NM_004834chr213190 ------
NM_004849chr641707 1528 1312 394 ------
NM_004896chr101200 ------
NM_004904chr735063 4135 1584 1902 --15374
NM_004911chr7----1453 --
NM_004912chr711091 ------
NM_004947chr3----12416 --
NM_004953chr31135 ------
NM_004956chr724010 2808 --14092 --
NM_004962chr101240 ------
NM_004969chr10124 ------
NM_004974chr11129 ------
NM_004985chr1224472 1472 11304 ----
NM_004998chr152288 191 ------
NM_004999chr614452 ----24097 113
NM_005010chr71191 ------
NM_005023chr51529 11049 ----
NM_005028chr1022339 915 ------
NM_005038chr42456 187 ------
NM_005045chr71178 ------
NM_005053chr191164 1576 ----
NM_005056chr1245601 5238 4877 4016 12084 13990 --
NM_005058chrY1222 ------
NM_005063chr1043661 2847 789 698 1588 13320 23883 1263
NM_005065chr1434500 2105 1706 --25059 3639 13371
NM_005066chr13739 673 283 ------
NM_005087chr31623 ------
NM_005088chrX--1819 ----
NM_005116chr2023050 1130 ------
NM_005156chr965080 4766 4656 3506 1713 1430 15194 ----
NM_005168chr21181 1192 ----
NM_005171chr121163 --11020 --
NM_005197chr1444716 4319 1970 1726 21016 920 15782 --
NM_005201chr31468 1252 ----
NM_005222chr71650 ------
NM_005230chr12--1213 ----
NM_005238chr1142530 1327 359 330 ------
NM_005241chr3----1254 --
NM_005245chr42641 21 ------
NM_005249chr14--127 ----
NM_005252chr14------1730
NM_005259chr211535 --1292 11229
NM_005262chr162642 73 ------
NM_005277chr431323 607 93 ------
NM_005308chr10----2546 393 --
NM_005328chr81271 ------
NM_005342chrX1144 ------
NM_005358chr1321753 216 ------
NM_005359chr1886307 6248 5931 5311 4595 3955 2339 2313 ------
NM_005384chr91257 ------
NM_005402chr71562 ------
NM_005406chr1811626 ------
NM_005433chr1811748 --1733 21758 1034
NM_005436chr1012968 --11253 13868
NM_005442chr3----1520 --
NM_005456chr111728 ------
NM_005458chr912258 ----1977
NM_005465chr111863 1705 ----
NM_005475chr1263169 2476 2353 1274 426 142 1797 ----
NM_005499chr191218 ------
NM_005502chr9--1224 ----
NM_005504chr1246384 5040 651 445 --14740 --
NM_005520chr5--1748 --1535
NM_005521chr101828 ------
NM_005539chr1021408 1269 ------
NM_005542chr711315 --11818 --
NM_005561chr13----1842 --
NM_005562chr121474 575 ------
NM_005563chr12206 185 ------
NM_005578chr323963 1638 --11787 15010
NM_005582chr5--158 ----
NM_005587chr151627 ------
NM_005593chr121154 ------
NM_005595chr11800 ------
NM_005596chr935294 4242 1973 16409 22145 1549 13937
NM_005598chr1----11697 --
NM_005599chr111151 ------
NM_005602chr331187 1032 489 11309 ----
NM_005626chr12402 70 ------
NM_005644chr11271 ------
NM_005647chrX12131 13094 ----
NM_005662chr8198 141 ----
NM_005665chr133912 757 731 ----13810
NM_005668chr52917 169 --13420 11036
NM_005669chr511576 1632 1640 1932
NM_005690chr121142 ------
NM_005719chr121165 ------
NM_005721chr2----21110 185 1180
NM_005725chr132450 1962 1496 --31906 715 372 --
NM_005738chr71190 ------
NM_005748chr1213325 ----22944 2827
NM_005751chr7128 ------
NM_005765chrX1330 ------
NM_005796chr16--1311 ----
NM_005801chr17129 ------
NM_005832chr3--1454 ----
NM_005840chrX26588 697 21841 872 16757 --
NM_005841chr4----1850 --
NM_005853chr16------1493
NM_005857chr111233 ----11484
NM_005859chr51393 ----11246
NM_005868chr712365 --11992 --
NM_005870chr1321016 210 ------
NM_005871chr1011095 1959 ----
NM_005888chr12156 ------
NM_005900chr4--11003 ----
NM_005901chr1857364 2853 2520 2003 587 18135 27492 1184 16067
NM_005903chr554879 3601 3394 903 481 --11561 --
NM_005907chr611610 ------
NM_005909chr554320 1618 1455 951 330 ------
NM_005911chr211410 ------
NM_005920chr123362 468 --1506 --
NM_005924chr71167 ----11017
NM_005930chr14176 ------
NM_005933chr1133006 395 258 12904 12981 --
NM_005955chr125325 2103 1233 134 15492
NM_005962chr101180 ----12072
NM_005962chr101180 ----12072
NM_005966chr21480 ----1528
NM_006007chr924383 1618 14181 --1249
NM_006010chr31212 ------
NM_006011chr152470 120 ------
NM_006017chr42754 43 --11031 --
NM_006037chr244121 3168 990 936 --11777 14419
NM_006041chr171183 ------
NM_006061chr621341 851 ----1334
NM_006095chr423601 3377 --13729 --
NM_006106chr1143119 2966 2700 281 ------
NM_006107chr17------184
NM_006113chr121690 615 ------
NM_006129chr81588 ------
NM_006134chr2111089 ----1592
NM_006135chr1172 ----1938
NM_006141chr161461 12624 12578 --
NM_006145chr1911120 ------
NM_006147chr1------1348
NM_006148chr1712566 12946 ----
NM_006154chr1542911 2575 2017 580 --12116 --
NM_006158chr821575 1495 ------
NM_006162chr18----11102 --
NM_006178chr17140 --1248 --
NM_006187chr1233006 2785 598 ----12856
NM_006194chr141513 ------
NM_006201chrX11225 ------
NM_006202chr191128 ------
NM_006203chr522045 58 --35281 5137 958 --
NM_006204chr101184 ------
NM_006224chr172328 76 ------
NM_006245chr611044 ------
NM_006246chr1411189 ------
NM_006251chr533149 752 593 ------
NM_006256chr11172 ------
NM_006267chr231727 1502 512 ------
NM_006281chr81764 --1123 --
NM_006281chr81764 --1123 --
NM_006298chr61728 ------
NM_006313chr12--1163 ----
NM_006317chr51315 ------
NM_006321chr31265 ------
NM_006330chr821638 1294 ------
NM_006353chr62553 83 ------
NM_006379chr722200 126 ------
NM_006391chr11----1279 --
NM_006393chr1043847 3404 1374 995 ----11055
NM_006421chr8--1307 ----
NM_006424chr411897 --1767 --
NM_006439chr4--1417 2204 26 --
NM_006459chr10----11801 --
NM_006472chr111265 ------
NM_006482chr1233384 3200 1579 --1509 --
NM_006489chr14--183 ----
NM_006493chr1321302 1281 --1201 --
NM_006496chr11216 ------
NM_006534chr201140 ------
NM_006544chr1445286 5114 2315 1983 35157 1966 1161 1842 --
NM_006546chr1736291 5003 2541 ------
NM_006547chr721720 1664 ------
NM_006557chr91669 ------
NM_006561chr1034870 4415 2124 25801 4083 --11074
NM_006565chr16----11021 --
NM_006570chr9193 ------
NM_006575chr1411178 ------
NM_006589chr11124 ------
NM_006595chr1121848 1557 ------
NM_006599chr1635527 5365 5034 ----1497
NM_006601chr1221084 1031 --1408 --
NM_006603chrX31256 456 64 ------
NM_006612chr171344 ----1210
NM_006614chr353063 2758 953 773 732 ------
NM_006621chr111367 ------
NM_006622chr51477 ------
NM_006624chr101336 11352 11806 --
NM_006626chr922585 2011 --12374 --
NM_006633chr52641 594 ------
NM_006640chr1721889 628 ------
NM_006644chr131601 ------
NM_006646chr1332984 2677 415 ----1723
NM_006667chrX------1205
NM_006675chr1213434 ------
NM_006677chr31257 ------
NM_006699chr11803 ----12017
NM_006703chr61167 ------
NM_006706chr51702 ------
NM_006708chr62963 452 --21126 527 --
NM_006714chr61192 ----1297
NM_006729chrX34208 1529 70 21158 575 1712 --
NM_006731chr953862 1354 774 676 490 14916 15681 13792
NM_006738chr1554125 4085 3948 1157 1143 11079 --24517 840
NM_006751chr21956 ------
NM_006754chr721050 285 ------
NM_006756chr821498 1117 ------
NM_006758chr21136 ------
NM_006759chr21223 ------
NM_006765chr81265 ----189
NM_006766chr811885 --1585 1341
NM_006775chr661953 1155 894 614 498 219 1310 ----
NM_006805chr5----11493 --
NM_006811chr20--199 --1247
NM_006826chr221294 318 ------
NM_006852chr1722008 42 12498 --1636
NM_006874chr421197 1082 ------
NM_006922chr221815 150 ----1283
NM_006930chr5--1696 ----
NM_006939chr1421024 809 --21067 293 --
NM_006940chr1211461 ------
NM_006947chr421213 422 ------
NM_006978chrX----186 --
NM_006986chrX1215 ------
NM_006988chr21----2408 41 --
NM_006996chr141616 1506 319 77 11843 --1250
NM_007006chr1622716 2669 --13524 --
NM_007011chr1556455 5023 1704 1388 236 35902 5713 1404 12138 --
NM_007013chr82390 237 ------
NM_007017chr51248 135 ----
NM_007039chr1452043 933 348 60 38 21966 824 ----
NM_007042chr332372 1023 521 1509 --11632
NM_007050chr2055786 5204 1640 1271 888 ------
NM_007067chr1711094 11192 1991 --
NM_007073chr632821 1323 134 ------
NM_007078chr1022139 111 12793 1310 1283
NM_007114chr321247 99 12967 12041 23182 2501
NM_007124chr61315 ------
NM_007125chrY11272 --1248 --
NM_007166chr111324 ------
NM_007172chr223899 277 209 ----12087
NM_007175chr823064 2806 ----13575
NM_007200chr1554125 4085 3948 1157 1143 11079 --24517 840
NM_007203chr953576 1002 911 97 22 ----1935
NM_007224chr12------2692 225
NM_007231chrX51879 1853 1719 670 448 11805 --1631
NM_007236chr1542417 2283 1983 1735 --22180 300 --
NM_007246chr4166 ------
NM_007249chr1387935 7830 7575 5959 2838 2612 1913 1378 36739 2723 2368 17686 16587
NM_007257chr841918 1892 992 480 --22826 2151 --
NM_007269chr11222 ------
NM_007282chr32934 849 ------
NM_007287chr312106 12209 1857 --
NM_007288chr312106 12209 1857 --
NM_007289chr312106 12209 1857 --
NM_007294chr1721218 56 ------
NM_007295chr1721218 56 ------
NM_007296chr1721218 56 ------
NM_007297chr1721218 56 ------
NM_007298chr1721218 56 ------
NM_007299chr1721218 56 ------
NM_007300chr1721218 56 ------
NM_007302chr1721218 56 ------
NM_007303chr1721218 56 ------
NM_007304chr1721218 56 ------
NM_007305chr1721218 56 ------
NM_007308chr41280 1197 ----
NM_007347chr1542953 2793 2489 2326 13140 23227 224 --
NM_007358chr141604 1394 510 449 --11333 --
NM_007361chr141666 ------
NM_007363chrX2275 81 ------
NM_007372chr172720 93 ------
NM_007373chr101713 ----1638
NM_007375chr141901 1017 848 833 21063 323 --1232
NM_012062chr122854 142 ------
NM_012063chr121142 ------
NM_012081chr543240 3170 2524 1371 ------
NM_012082chr81168 ------
NM_012084chrX1439 ------
NM_012089chr131417 1146 130 ------
NM_012090chr121017 100 1252 ----
NM_012095chr1021182 76 1862 12823 --
NM_012104chr1133309 2866 2744 13579 1766 --
NM_012104chr1133309 2866 2744 13579 1766 --
NM_012156chr2012675 13433 ----
NM_012164chr952988 2467 2306 1226 645 27266 6495 25878 2647 --
NM_012183chr11525 ------
NM_012193chr1154184 4026 1390 478 122 ------
NM_012199chr12733 432 --1416 --
NM_012214chr246030 5670 1799 1117 ----1147
NM_012215chr101790 ------
NM_012234chr323544 608 1559 12366 --
NM_012245chr14------122
NM_012249chr23749 629 145 11186 11047 --
NM_012250chr11------1491
NM_012252chr71344 --21588 1547 --
NM_012253chrX--1238 ----
NM_012261chr20----1488 --
NM_012262chr143503 2043 1388 1016 ------
NM_012281chr71681 22304 1502 ----
NM_012287chr3----1304 --
NM_012290chr2----11129 --
NM_012297chr4------1266
NM_012300chr522564 1864 --11926 --
NM_012301chr732131 1357 473 11653 ----
NM_012302chr1----1937 1210
NM_012307chr181890 ------
NM_012309chr1134727 1954 1740 182 --13088
NM_012323chr2231563 1114 59 ------
NM_012325chr201135 ------
NM_012327chr1821255 505 ------
NM_012330chr1011770 ----11566
NM_012347chr62864 469 --32221 2113 1900 --
NM_012382chr521589 660 --12908 --
NM_012383chr9176 ------
NM_012399chr2231745 225 60 ------
NM_012414chr11154 ------
NM_012416chr9------1940
NM_012419chr61253 ------
NM_012428chr1531009 687 99 1275 ----
NM_012434chr651260 1234 1072 1029 63 --11400 --
NM_012454chr6161 ------
NM_012482chr1----1224 --
NM_013229chr1251790 1133 830 543 129 ----12180
NM_013231chr143798 172 28 ----13579
NM_013233chr221461 976 1320 ----
NM_013254chr121486 ----1578
NM_013255chr757799 6959 6686 3437 3107 11942 36544 2228 810 27313 215
NM_013257chr812335 ------
NM_013261chr423601 650 --13640 --
NM_013269chr1221264 1042 12792 ----
NM_013280chr111879 ------
NM_013281chr2021284 974 ----1336
NM_013293chr71568 ------
NM_013302chr1674726 4385 4260 4097 648 550 389 13708 --13025
NM_013336chr331994 142 41 --1553 1210
NM_013348chr191859 ------
NM_013372chr1523135 3111 22675 794 1824 --
NM_013377chr121587 ------
NM_013381chr12--1237 ----
NM_013390chr941482 1342 1305 135 ------
NM_013410chr111042 ------
NM_013423chrX31190 880 492 --1117 --
NM_013427chrX31190 880 492 --1117 --
NM_013438chr91651 ----1566
NM_013444chrX41110 1062 967 324 ------
NM_013448chr141108 ------
NM_013989chr1423232 842 ------
NM_013996chr71130 ------
NM_013996chr71130 ------
NM_013997chr71130 ------
NM_013997chr71130 ------
NM_013998chr71130 ------
NM_013998chr71130 ------
NM_014011chr222610 2032 ------
NM_014021chr113358 --1409 1475
NM_014028chr622656 2601 --11078 --
NM_014034chr6------11348
NM_014043chr31427 ------
NM_014059chr131286 ------
NM_014071chr201152 ------
NM_014089chr1311832 ------
NM_014112chr8----23891 181 --
NM_014117chr1622309 1680 1119 1285 --
NM_014153chr162212 58 ------
NM_014155chr1166433 5792 4825 2659 1484 310 --15986 --
NM_014157chr1632626 2600 1553 13227 21503 270 --
NM_014159chr31181 ------
NM_014181chr222575 376 --1956 --
NM_014191chr12--148 ----
NM_014210chr172566 76 ------
NM_014217chr11629 ------
NM_014240chr344190 3522 3496 3358 --14113 13940
NM_014243chr432104 138 83 ------
NM_014263chr10--11321 ----
NM_014264chr4----165 --
NM_014278chr41139 ------
NM_014283chr111150 ------
NM_014300chr151335 ------
NM_014305chr13176 ------
NM_014309chr221401 15389 14806 1917
NM_014310chr2211954 ------
NM_014333chr1142381 2274 1840 739 --12849 --
NM_014372chr121429 283 130 1655 --
NM_014381chr1432686 2092 1176 22449 1275 ----
NM_014415chr3128 ------
NM_014423chr534280 4248 1234 --1156 --
NM_014488chr111499 ------
NM_014491chr71684 ------
NM_014494chr1632399 2360 583 --12018 --
NM_014515chr12--2951 926 ----
NM_014548chr1511093 11410 ----
NM_014572chr13----11409 --
NM_014573chr171417 ----11849
NM_014574chr1421570 414 ------
NM_014577chr221578 ------
NM_014584chr1421557 1259 145 --1286
NM_014587chr1631582 1134 1118 ------
NM_014612chr91549 ------
NM_014613chr532864 2584 666 ----1384
NM_014614chr2--1567 ----
NM_014659chr152839 25 ------
NM_014663chr1------198
NM_014666chr5------1153
NM_014667chr332476 1981 1656 ------
NM_014670chr2------11300
NM_014671chr741268 1114 1104 515 ------
NM_014676chr111397 11463 ----
NM_014683chr1721946 1601 1510 1336 --
NM_014701chr15----1654 --
NM_014733chr511493 ------
NM_014735chrX11308 --1773 --
NM_014755chr243035 2993 983 43 1297 12790 --
NM_014764chr12----11312 --
NM_014765chr132445 1939 184 12702 --12357
NM_014783chr1521231 491 --140 --
NM_014810chr153076 3044 2855 842 346 11059 ----
NM_014819chr51337 ------
NM_014832chr13129 ------
NM_014836chr101533 ------
NM_014839chr132480 2075 284 ------
NM_014841chr611254 ----1160
NM_014857chr1174 ------
NM_014864chr134245 1444 1276 22982 22 23036 1685 --
NM_014876chr2271706 1425 908 830 804 670 266 12136 ----
NM_014877chr1786969 6163 6003 5755 5553 5347 4722 2913 --27547 3083 --
NM_014892chr6----1490 --
NM_014893chrY11788 2522 436 12371 --
NM_014903chr1212476 ------
NM_014905chr211313 --1732 --
NM_014906chr1734079 571 552 23976 3967 21070 967 --
NM_014912chr1013428 --23523 1205 12513
NM_014917chr11683 ------
NM_014920chr6----1533 --
NM_014923chr1311762 1379 --12255
NM_014924chr1432614 2124 115 ------
NM_014926chr31231 ------
NM_014935chr133674 3252 3042 ------
NM_014939chr1811126 ------
NM_014944chr131449 1034 986 ----1565
NM_014945chr511663 11395 11641 --
NM_014961chr412133 --12195 --
NM_014969chr1199 ------
NM_014975chr19166 ------
NM_014977chr141143 ------
NM_014982chr1434069 3408 115 12153 --25168 762
NM_014988chr432456 1015 409 ------
NM_014989chr61626 11821 ----
NM_014992chr14----152 --
NM_014994chr15--125 ----
NM_015008chr333487 3132 914 --11337 1616
NM_015009chr31274 ------
NM_015020chr1653938 2555 1110 459 368 ----1678
NM_015024chr81393 ------
NM_015025chr222400 77 ------
NM_015026chr1254682 4037 3948 1241 1137 --24279 288 --
NM_015032chr1331795 1101 213 --12104 --
NM_015042chr1513454 --21594 1396 --
NM_015069chr16188 ------
NM_015071chr556202 5307 5209 2498 491 --15426 --
NM_015076chr644441 2836 593 249 13267 --11315
NM_015092chr1624187 33 1156 21588 1120 --
NM_015093chr61666 ------
NM_015107chrX--12092 12465 --
NM_015132chr731706 545 315 --11547 11807
NM_015156chr1443792 2446 1183 487 13420 ----
NM_015161chr16--1328 ----
NM_015176chr11459 ------
NM_015180chr14----1779 --
NM_015185chrX1202 1227 ----
NM_015199chr322323 2109 --12398 11043
NM_015200chr432446 2338 1964 --1607 --
NM_015216chr521545 435 ------
NM_015231chr11------1817
NM_015236chr421309 1207 ----11492
NM_015238chr51727 ------
NM_015247chr1644733 3549 1283 668 11432 14390 --
NM_015265chr222631 248 12352 --1744
NM_015269chr1----1110 --
NM_015270chr121210 ------
NM_015271chr424186 2653 ----23516 881
NM_015285chr18------11641
NM_015288chr5----13500 --
NM_015305chr1411487 ----11921
NM_015308chr11------1334
NM_015310chr848192 8065 6180 601 16699 37662 3357 1168 --
NM_015314chr712453 --11700 --
NM_015315chr523402 3003 ------
NM_015317chr221788 591 ----1945
NM_015328chr713083 ------
NM_015335chr1211046 ------
NM_015336chr1212631 ------
NM_015344chr811783 1840 ----
NM_015355chr1711859 ------
NM_015358chr2121245 362 1495 ----
NM_015365chrX53647 3546 1668 1568 419 ------
NM_015375chr1104797 4768 4478 3824 3055 1752 1163 342 233 206 --23872 2000 --
NM_015387chr21477 12064 ----
NM_015397chr91280 --1717 --
NM_015423chr1131562 1420 1110 --1242 --
NM_015435chr81201 1188 ----
NM_015443chr1711269 ------
NM_015455chr5------11493
NM_015460chr311958 ------
NM_015461chr181198 ------
NM_015472chr3----165 --
NM_015472chr3----165 --
NM_015508chr31133 ----11187
NM_015509chr1221681 1634 ------
NM_015525chr62775 283 ------
NM_015532chr1531761 1098 625 ------
NM_015534chr12947 736 ------
NM_015550chr723396 1121 ------
NM_015554chr1532748 2200 131 --1124 1408
NM_015560chr311147 --1226 --
NM_015564chr51672 ----12610
NM_015570chr711463 ----11789
NM_015575chr233376 2510 318 ------
NM_015576chr322761 2588 --1282 --
NM_015601chr10----1915 --
NM_015609chr12969 525 --11914 1856
NM_015626chr171359 ------
NM_015630chr2--11156 ----
NM_015633chr1211039 155 --1868
NM_015640chr135132 3546 1232 1837 15286 15087
NM_015691chrX32106 991 315 ----22610 902
NM_015872chr131808 1684 254 --21568 1150 --
NM_015878chr81731 ------
NM_015879chr1888232 7547 5300 3158 2055 1079 1042 41 --13444 --
NM_015884chrX199 ------
NM_015888chr112487 --12903 --
NM_015906chr134586 4140 1712 --14175 1240
NM_015915chr14182 ------
NM_015932chr13--1573 ----
NM_015939chr20----1653 --
NM_015990chr431007 252 118 ------
NM_015999chr1170 ------
NM_016009chr134937 4771 3680 ------
NM_016025chr1631853 1686 1653 11509 --11337
NM_016038chr7137 ------
NM_016041chr17182 ------
NM_016045chr20--11518 ----
NM_016048chr51310 ------
NM_016061chr21325 --11425 --
NM_016066chr1147 ------
NM_016072chr121439 1192 ----
NM_016075chr1331952 817 581 11123 11012 1199
NM_016083chr643622 2642 842 224 --11137 --
NM_016090chr112848 232 ------
NM_016120chrX1417 1997 ----
NM_016121chr121083 458 1403 ----
NM_016131chr21670 11556 ----
NM_016133chr21262 ------
NM_016141chr3174 ------
NM_016203chr72779 250 ------
NM_016217chr643377 3367 997 533 1424 12788 --
NM_016227chr111150 ------
NM_016230chr61478 ------
NM_016231chr172340 185 ------
NM_016242chr4----1154 --
NM_016271chr1812363 ----1597
NM_016275chr322484 666 ------
NM_016281chr1221187 333 ------
NM_016289chr232244 1991 562 1114 --12306
NM_016308chr1--21671 406 ----
NM_016316chr22148 68 ------
NM_016322chr911294 ------
NM_016353chr832506 2137 1670 ------
NM_016357chr12------1845
NM_016376chr1723883 977 ------
NM_016395chr151316 --1427 11933
NM_016410chr9----1443 --
NM_016424chr17------11589
NM_016476chr17--1165 ----
NM_016480chr51149 ------
NM_016486chr13153 64 24 ------
NM_016488chr1231977 798 778 ------
NM_016505chr1--1229 ----
NM_016507chr1743194 3044 2645 162 1585 191 --
NM_016513chr6----1533 --
NM_016516chr2------1106
NM_016522chr1111659 ----11237
NM_016531chr413500 --11547 --
NM_016542chrX11353 ------
NM_016570chr12--1341 ----
NM_016577chr311363 --14402 --
NM_016578chr111157 ------
NM_016603chr532045 461 191 --1561 11702
NM_016605chr522633 2028 ------
NM_016607chrX31413 1394 263 ------
NM_016618chr22463 136 ------
NM_016620chr11591 ----1121
NM_016626chr181321 ------
NM_016644chr51122 ------
NM_016824chr1041441 1379 770 337 ------
NM_016937chrX2664 333 ------
NM_016940chr21----1511 --
NM_016946chr163460 3365 1459 457 438 230 --22884 2352 --
NM_016950chr4--1369 1518 --
NM_016954chrX1143 ------
NM_017412chr821111 548 1473 ----
NM_017420chr141595 1778 11538 1268
NM_017450chr1711414 ------
NM_017455chr1531009 687 99 1275 ----
NM_017512chr18--138 ----
NM_017519chr61890 ------
NM_017545chr201426 ------
NM_017548chr341647 1483 516 152 ------
NM_017553chr15--1248 ----
NM_017582chr1--11392 ----
NM_017594chr943251 715 466 363 1214 ----
NM_017599chr1241306 701 50 23 --1688 --
NM_017617chr9--1606 11546 --
NM_017633chr63821 714 364 ----13290
NM_017634chr811823 11525 ----
NM_017637chr968969 8688 7902 6617 5756 3753 18388 17022 --
NM_017641chr121391 ------
NM_017643chr1722955 703 ------
NM_017646chr1--1503 ----
NM_017649chr101372 ------
NM_017658chr1474569 3521 3306 1872 1415 908 390 14311 ----
NM_017661chr151963 ------
NM_017666chrX22231 1568 ------
NM_017667chr71132 --1544 --
NM_017669chrX----1297 133
NM_017672chr1511307 ------
NM_017679chr171667 ------
NM_017684chr1521977 669 ------
NM_017694chr242053 1625 743 345 --11431 12085
NM_017709chr11627 --11543 --
NM_017719chr32746 94 32426 2152 2095 12562 --
NM_017738chr9--1163 ----
NM_017742chr1831749 1250 799 ------
NM_017753chr91152 ------
NM_017772chr6------11763
NM_017776chrX41367 1139 1087 181 ----11154
NM_017780chr81344 --1951 --
NM_017784chr33462 301 152 ------
NM_017813chr832040 682 248 --24247 2204 --
NM_017822chr12----1259 --
NM_017826chr13167 ------
NM_017831chr1832989 1893 406 14592 14012 --
NM_017848chrX--1676 ----
NM_017907chr111167 ------
NM_017919chr925035 4566 ------
NM_017938chrX41935 1815 633 86 ------
NM_017944chr1122935 2533 ----1219
NM_017953chr1------127
NM_017964chr21712 ------
NM_018017chr1022644 1939 12699 12853 --
NM_018025chr191236 ------
NM_018043chr1111097 --1333 11463
NM_018070chr1173 ------
NM_018084chr2246 36 ------
NM_018085chr166707 5652 5627 2423 839 99 11863 26366 5889 11905
NM_018086chr221893 167 --1634 --
NM_018098chr31964 ------
NM_018105chr8--11128 ----
NM_018120chr811540 ------
NM_018133chr312060 ------
NM_018157chr1232962 2653 442 12003 21087 282 --
NM_018158chr21199 --1252 --
NM_018159chrX11285 ----11139
NM_018164chr121236 ------
NM_018176chr4------11471
NM_018208chr1----21150 82 --
NM_018214chr621253 339 ------
NM_018234chr222168 87 ------
NM_018237chr101233 ------
NM_018243chr432838 1012 315 --24075 3976 --
NM_018244chr20189 ----11001
NM_018247chr613073 12386 ----
NM_018299chr823030 98 --21382 468 --
NM_018302chr422056 471 --11742 --
NM_018312chr11--1740 1525 1337
NM_018313chr312695 --11721 --
NM_018318chr122266 160 ------
NM_018328chr2----1492 --
NM_018339chr911871 ------
NM_018362chr1133429 1387 1319 ------
NM_018364chr123061 2881 ------
NM_018371chr8159 ------
NM_018374chr724301 782 --14176 --
NM_018388chrX21097 551 ------
NM_018400chr1131713 1259 464 ------
NM_018403chr353774 2711 1223 1068 150 1537 1245 --
NM_018413chr12--1214 ----
NM_018416chr1222437 2357 --1631 --
NM_018429chr5----12803 --
NM_018436chr2195 ------
NM_018440chr858063 2196 1459 1109 74 ------
NM_018442chr11249 ------
NM_018461chr101573 ------
NM_018462chr31136 ------
NM_018475chr41711 --182 --
NM_018482chr81533 --11713 --
NM_018490chr1111830 ------
NM_018557chr211130 ------
NM_018566chr125138 1788 15166 --13927
NM_018569chr4169 ------
NM_018590chr10----11573 11172
NM_018638chr1235583 4038 1945 33583 2124 1768 13640 --
NM_018650chr131590 1401 437 ------
NM_018671chr151365 ------
NM_018672chr17--2584 196 ----
NM_018674chr21693 ------
NM_018682chr7--1213 ----
NM_018683chr20----11683 --
NM_018685chr72925 846 ------
NM_018704chr141680 1533 1489 387 ----1271
NM_018834chr5--1983 ----
NM_018845chr11557 ------
NM_018898chr511569 ------
NM_018899chr511569 ------
NM_018900chr511569 ------
NM_018901chr511569 ------
NM_018902chr511569 ------
NM_018903chr511569 ------
NM_018904chr511569 ------
NM_018905chr511569 ------
NM_018906chr511569 ------
NM_018907chr511569 ------
NM_018908chr511569 ------
NM_018909chr511569 ------
NM_018910chr511569 ------
NM_018911chr511569 ------
NM_018932chr51539 ------
NM_018963chr21--1352 ----
NM_018970chr72976 918 ------
NM_018976chr121242 1147 ----
NM_018983chr41292 ------
NM_019000chr5----11535 --
NM_019022chr1842586 2114 1126 865 22368 2157 ----
NM_019027chr421610 521 ----1107
NM_019035chr42429 331 11881 11771 1562
NM_019044chr254542 4498 4248 3447 3015 --187 --
NM_019053chr101242 ------
NM_019071chr7----1719 --
NM_019072chr534022 1592 1425 ------
NM_019074chr151389 ------
NM_019084chr101678 ------
NM_019590chr1011499 1384 ----
NM_019593chr2012698 12584 ----
NM_019596chr21--12204 --22144 737
NM_019597chrX1239 1756 --1539
NM_019600chr151314 ------
NM_019606chr7272 22 ------
NM_019609chr20----181 --
NM_019610chr11518 11387 --1845
NM_019891chr1----138 --
NM_019903chr1041441 1379 770 337 ------
NM_020064chr91507 ------
NM_020116chr441727 701 155 31 ------
NM_020123chr1021540 1523 ----11459
NM_020141chr112098 ------
NM_020156chr7--1108 ----
NM_020159chr4--11117 --11104
NM_020177chr512902 --22921 877 --
NM_020204chr12547 217 1197 ----
NM_020205chr123209 2168 ------
NM_020214chr15161 ------
NM_020226chr41663 ------
NM_020240chr542447 2085 1998 22 12262 ----
NM_020336chr2043732 3718 3036 1291 --1259 --
NM_020337chr413006 --12602 13179
NM_020342chr211833 ------
NM_020346chr1121728 434 1449 11655 --
NM_020351chr3--1128 ----
NM_020363chrY11364 ------
NM_020381chr62791 631 ------
NM_020382chr12155 ------
NM_020403chr13----11343 --
NM_020420chrY11364 ------
NM_020425chr61240 ------
NM_020428chr1911157 ------
NM_020432chr711634 1828 ----
NM_020449chrX1240 ------
NM_020455chr612105 --12767 --
NM_020456chr1341931 1889 1730 1606 1882 22342 449 --
NM_020463chr211177 11064 ----
NM_020466chr624535 3364 24334 877 --11582
NM_020473chrX----11577 11918
NM_020474chr1821959 96 ------
NM_020548chr21209 ------
NM_020640chr311991 ------
NM_020647chr8----12017 --
NM_020651chr2148 ------
NM_020665chrX----1445 1142
NM_020666chr52900 312 ------
NM_020673chr2036800 6225 4871 21425 795 ----
NM_020676chr3----1927 --
NM_020699chr134881 4539 1081 14455 14573 --
NM_020718chr1676592 6489 6399 6289 4547 1084 179 ------
NM_020732chr61890 ------
NM_020734chr1211036 ----1866
NM_020739chr1544205 4154 3616 1099 2748 289 12662 --
NM_020742chrX31984 1854 1063 22406 454 12444 --
NM_020748chr1721440 723 22127 316 ----
NM_020766chrX43884 3238 1208 694 ----23804 373
NM_020768chr522667 2622 ------
NM_020772chr1756632 5505 612 438 310 12111 17229 --
NM_020781chr763145 2998 2667 2618 1006 478 --12460 12409
NM_020783chr1812017 ------
NM_020787chr171210 ----1986
NM_020794chr11615 ------
NM_020801chr542651 2481 1946 1763 ------
NM_020802chr1112073 --1971 --
NM_020805chr1811492 ----21884 1877
NM_020810chr1442532 2245 989 778 12865 11389 --
NM_020821chr1521977 669 ------
NM_020830chr223112 2880 ----1326
NM_020839chr321489 146 ------
NM_020841chr121762 --1199 --
NM_020844chr867483 7238 6914 6506 1797 968 11225 37318 1681 385 --
NM_020850chr1632088 786 598 ------
NM_020854chr1831525 1288 403 ------
NM_020856chr1911388 ------
NM_020860chr41181 ------
NM_020866chr1311027 ------
NM_020871chrX32366 1782 48 ------
NM_020872chr32706 54 ------
NM_020873chr3------169
NM_020888chr11409 ------
NM_020897chr11289 ------
NM_020909chr214064 ------
NM_020924chr9--1384 ----
NM_020927chr16--12298 1878 --
NM_020948chr131387 1171 735 ----21313 1241
NM_020952chr91762 ------
NM_020956chr1953924 1858 1780 1702 1570 11533 14230 --
NM_020977chr42509 169 12096 ----
NM_020981chr2----1251 --
NM_020983chr121210 ------
NM_021003chr141285 ------
NM_021005chr151318 ----1833
NM_021032chr31601 ------
NM_021033chr1333100 2249 1227 12624 --11119
NM_021038chr322582 494 ----13382
NM_021047chr191496 ------
NM_021061chr831697 899 873 12840 1483 --
NM_021064chr621414 680 --2538 119 11815
NM_021072chr521808 1680 --12441 --
NM_021111chr911065 ------
NM_021116chr738803 3014 1812 17407 18430 19000
NM_021120chrX1381 21057 320 12492 --
NM_021131chr92200 192 ------
NM_021132chr1011325 ------
NM_021136chr142255 214 ------
NM_021183chrX21928 1638 11858 12199 11766
NM_021184chr6152 --1728 --
NM_021205chr152894 2252 2075 1095 709 --2784 513 --
NM_021222chr11322 ----1149
NM_021224chr9152 ------
NM_021229chr12198 ------
NM_021238chr122485 177 ------
NM_021240chr9----1113 --
NM_021242chrX1790 ------
NM_021269chr1931696 1655 1277 ------
NM_021629chr395113 4870 3439 1973 1612 1183 596 183 157 ------
NM_021648chr622750 650 ------
NM_021728chr14----1254 --
NM_021784chr202651 56 ------
NM_021785chrX1302 ------
NM_021813chr625622 4453 ----23853 2043
NM_021814chr621653 1291 ------
NM_021815chr21134 23066 877 --11201
NM_021911chr522167 219 --25314 101 --
NM_021913chr194673 647 512 375 ------
NM_021923chr411536 ------
NM_021954chr1363712 2351 735 605 114 65 11079 --11086
NM_021961chr1187508 7436 7255 5034 5002 4641 2170 1901 --27408 5508 17187
NM_021963chrX1302 --1725 --
NM_021964chr334395 2390 1225 --12664 16230
NM_021972chr17----1261 --
NM_021977chr612472 ----2905 846
NM_021988chr2021629 539 11550 ----
NM_022075chr1----1105 --
NM_022079chr10----1915 --
NM_022118chr131600 ------
NM_022133chr821498 1157 --1614 11731
NM_022140chr54837 404 378 242 ------
NM_022143chr721571 1286 ------
NM_022169chr111375 ------
NM_022351chr833838 3194 348 ----1618
NM_022373chr7148 ------
NM_022442chr2021629 539 11550 ----
NM_022459chr1335232 1853 43 15309 16340 --
NM_022473chr1523630 109 ------
NM_022552chr2--11011 11257 --
NM_022725chr1121976 197 --22148 316 --
NM_022726chr62253 151 11336 11269 --
NM_022756chr1----1961 --
NM_022763chr322643 1003 ------
NM_022766chr2222560 34 ------
NM_022771chr121119 ------
NM_022776chr31169 ----1378
NM_022780chr2--133 ----
NM_022781chr932022 781 340 ------
NM_022824chr53417 183 159 ------
NM_022826chr21382 --11156 --
NM_022841chr1532752 2541 113 --12105 --
NM_022843chr1311347 1194 --1967
NM_022893chr212469 ------
NM_022894chr2--126 1109 --
NM_022898chr1453677 3323 1927 716 555 --13150 --
NM_022977chrX1445 ------
NM_023000chr14--1196 ----
NM_023001chr14--1196 ----
NM_023016chr22167 74 12862 ----
NM_023037chr132358 282 ------
NM_023039chr51405 ------
NM_023923chr163273 2851 2691 2305 1055 968 13552 32507 1435 59 --
NM_023929chr812442 11024 ----
NM_024007chr51700 ------
NM_024052chr1711211 11900 ----
NM_024061chr7----1583 --
NM_024092chr1111232 ------
NM_024293chr21849 ------
NM_024297chr171475 ------
NM_024345chr964417 1988 1884 1798 1379 1274 --24902 1806 --
NM_024424chr11----1880 --
NM_024425chr11----1880 --
NM_024426chr11----1880 --
NM_024429chr72779 250 ------
NM_024545chr23507 242 84 1584 ----
NM_024548chr321480 661 ------
NM_024551chr12--1406 1611 --
NM_024551chr12--1406 1611 --
NM_024567chr81286 ------
NM_024582chr41429 ------
NM_024657chrX1485 ------
NM_024659chr2--1647 ----
NM_024665chr344444 3546 3221 3114 ------
NM_024674chr172915 2826 2345 2187 297 208 69 ------
NM_024686chr11560 ------
NM_024751chr421867 1347 ------
NM_024755chr151583 ------
NM_024757chr9----1861 --
NM_024779chr121429 ------
NM_024811chr1111690 ------
NM_024893chr202954 357 ------
NM_024909chr621602 152 ------
NM_024945chr931168 284 136 ------
NM_024947chr3109277 8533 8312 8286 7535 7399 6138 2523 1340 569 13311 ----
NM_024960chr201213 --1109 --
NM_024971chr91762 ------
NM_024989chr286643 6053 4975 2437 2277 1780 842 540 --13274 --
NM_025004chr11----1688 1672
NM_025054chr823248 780 ------
NM_025115chr8--1108 ----
NM_025133chr221047 166 1242 1737 --
NM_025146chr311022 ------
NM_025160chr1----1708 --
NM_025179chr154856 4071 3587 1569 79 ------
NM_025191chr122581 489 ------
NM_025208chr1111780 ----1939
NM_025235chr1021563 837 12168 ----
NM_025238chr1511137 --11114 --
NM_030621chr1423183 1657 ----1673
NM_030625chr1011911 ------
NM_030627chr533132 1399 1210 13761 --11196
NM_030629chr1621955 233 --1510 --
NM_030647chr736156 6070 1466 15345 --12334
NM_030674chr1245751 3828 3703 685 --35452 4150 3997 14302
NM_030758chr221478 ----21309 1056
NM_030762chr1222017 614 ------
NM_030780chr811434 ----11674
NM_030806chr179367 2474 1902 1264 1101 922 602 --23325 2324 17297
NM_030920chr121342 123 ------
NM_030939chr6--1403 ----
NM_030978chr91436 ------
NM_031157chr122225 43 --1579 --
NM_031217chr111581 ------
NM_031262chr91861 ------
NM_031263chr91918 ------
NM_031284chr15169 ------
NM_031291chr41111 ------
NM_031296chr442154 1922 1042 883 ------
NM_031411chr511569 ------
NM_031422chr181483 ------
NM_031438chr52140 62 ------
NM_031439chr81236 --1515 --
NM_031442chrX22840 1037 12489 23229 2272 --
NM_031449chr7------1884
NM_031453chr1022139 275 ------
NM_031468chr758025 6469 5916 3155 2981 --15083 --
NM_031844chr173474 3395 3331 3284 2714 1568 1011 ----1191
NM_031845chr22640 484 ------
NM_031847chr22640 484 ------
NM_031849chr511569 ------
NM_031857chr511569 ------
NM_031860chr511569 ------
NM_031889chr411346 ------
NM_031938chr111756 ------
NM_031940chr81205 ------
NM_032012chr944155 3253 1723 1148 2788 702 11127 --
NM_032021chr11----11038 --
NM_032041chr812556 --12231 --
NM_032124chr18------1497
NM_032144chr211765 ------
NM_032160chr1843710 3449 1363 1148 --13167 12967
NM_032182chr10------1272
NM_032186chr11591 ----1121
NM_032189chr1314576 11412 ----
NM_032211chr1011169 1897 ----
NM_032221chr2021625 517 ------
NM_032228chr1122926 958 ----1718
NM_032229chr131271 ------
NM_032233chr141752 ------
NM_032236chr11775 ------
NM_032239chr4----11235 --
NM_032276chr21852 ------
NM_032294chr1731849 1800 744 ------
NM_032312chr21367 ------
NM_032319chr2132 ------
NM_032352chr141981 --11326 --
NM_032373chr1065554 3763 2316 2009 473 236 25629 5095 13609 14659
NM_032410chr811132 ------
NM_032424chr1131345 1171 633 ------
NM_032440chr1022400 783 --11037 12642
NM_032446chr563536 3256 1342 998 587 429 12735 ----
NM_032449chr121936 1881 ------
NM_032457chr422915 1018 13100 23545 517 --
NM_032486chr1632686 1053 665 --21929 60 --
NM_032491chr12----1903 --
NM_032505chr33697 631 201 ------
NM_032521chr2023158 1123 ------
NM_032539chrX2780 542 ------
NM_032547chr41895 --1346 --
NM_032560chr14182 ----11136
NM_032595chr17--11102 ----
NM_032646chr1721651 1203 ------
NM_032682chr311427 ------
NM_032689chr1941230 1207 652 419 --11313 11540
NM_032800chr12348 49 ------
NM_032842chr71641 ------
NM_032846chr142252 107 ------
NM_032857chr151223 ------
NM_032859chr1343853 3666 2684 290 1584 12789 --
NM_032870chr6168 ------
NM_032875chr17----1113 --
NM_032927chr4163 2225 145 ----
NM_032940chr161855 ------
NM_032947chr511290 ------
NM_032961chr41556 ------
NM_032967chrX1394 ------
NM_032971chrY1421 ------
NM_032972chrY1421 ------
NM_032975chr1843593 3292 2615 1104 13380 ----
NM_032978chr1811130 ------
NM_032979chr1811130 ------
NM_032980chr1843593 3292 2615 1104 13380 ----
NM_032981chr1811130 ------
NM_032993chr41292 ------
NM_032998chr12432 145 2875 796 11067 --
NM_033018chrX11225 ------
NM_033020chr134586 4140 1712 --14175 1240
NM_033036chr1121354 1207 ------
NM_033044chr121017 100 1252 ----
NM_033055chr12988 951 ------
NM_033083chr343158 1071 782 483 ----13445
NM_033103chr1941342 1096 934 477 ------
NM_033132chr131785 127 ----
NM_033135chr1111780 ----1939
NM_033181chr643622 2642 842 224 --11137 --
NM_033211chr51670 ------
NM_033224chr736829 6693 1942 25286 1357 --18111
NM_033225chr833102 2132 213 ------
NM_033227chr51158 ------
NM_033238chr1532763 2730 467 ------
NM_033274chr5------12813
NM_033285chr854494 3507 1748 1103 874 11651 12946 --
NM_033326chr111134 ------
NM_033343chr1----1461 --
NM_033360chr1234593 1593 108 11425 ----
NM_033389chr1723512 1299 ------
NM_033394chr22403 388 ----11382
NM_033430chr42898 285 --1873 --
NM_033437chr42898 285 --1873 --
NM_033480chr62864 469 --32221 2113 1900 --
NM_033481chr62864 469 --32221 2113 1900 --
NM_033495chrX2668 183 ------
NM_033551chr523402 3003 ------
NM_033626chrX31634 482 305 ------
NM_033642chrX21157 1022 ------
NM_033644chr522564 1864 --11926 --
NM_033645chr522564 1864 --11926 --
NM_052834chr18------11641
NM_052869chr1721651 1203 ------
NM_052879chr1213789 --1547 21639 500
NM_052880chr22----11079 --
NM_052885chr1234942 4757 532 ------
NM_052886chr812097 ------
NM_052898chr811431 --11173 --
NM_052903chr151514 ----177
NM_052904chr611042 ----11447
NM_052907chr1213714 --14252 14004
NM_052911chr181645 ------
NM_052917chr242200 1335 721 28 ----11204
NM_052937chr832655 2046 242 22333 673 --12691
NM_052954chr2122244 1815 1680 --12267
NM_052958chr8--1746 ----
NM_052971chr51362 1100 ----
NM_053016chr925681 497 12385 ----
NM_053023chr11----1260 --
NM_053043chr786134 2323 1541 1214 1157 623 272 135 ----14604
NM_053046chr191432 ------
NM_054016chr1----11463 1399
NM_054016chr1----11463 1399
NM_054016chr1----11463 1399
NM_057175chr422689 971 ------
NM_057182chr191162 ------
NM_057749chr81387 --1961 --
NM_058170chr111188 ------
NM_058241chr21468 ------
NM_058241chr21468 ------
NM_078473chr81205 ------
NM_078626chr1--1136 ----
NM_080422chr18----191 --
NM_080423chr18----191 --
NM_080629chr111353 ----11446
NM_080630chr111353 ----11446
NM_080666chr14--11172 1538 21358 648
NM_080671chr221780 799 --12165 --
NM_080682chr1----1744 --
NM_080717chr1231482 1162 1149 ------
NM_080732chr191432 ------
NM_080738chr1------11549
NM_080822chr171311 ------
NM_080832chrX1240 1110 ----
NM_080872chr822907 776 --22741 273 14084
NM_080927chr313150 ------
NM_080928chr7194 ------
NM_130391chr923505 1355 --12900 1593
NM_130392chr923505 1355 --12900 1593
NM_130393chr923505 1355 --12900 1593
NM_130436chr21171 ------
NM_130438chr211648 ------
NM_130439chr101180 ----12072
NM_130439chr101180 ----12072
NM_130798chr1511450 ------
NM_130811chr2011174 ------
NM_130831chr311147 --1226 --
NM_130832chr311147 --1226 --
NM_130833chr311147 --1226 --
NM_130834chr311147 --1226 --
NM_130835chr311147 --1226 --
NM_130836chr311147 --1226 --
NM_130837chr311147 --1226 --
NM_130838chr151264 --11839 --
NM_130839chr151264 --11839 --
NM_130847chr1144994 4669 4595 4349 --21340 52 --
NM_133170chr2055786 5204 1640 1271 888 ------
NM_133265chrX13169 --1971 --
NM_133367chr622550 2524 --13486 --
NM_133372chr562467 2037 1902 1064 910 262 ------
NM_133445chr933231 1411 152 53703 3240 3105 2324 681 ----
NM_133496chr143162 3001 934 600 ------
NM_133509chr1431167 973 91 ------
NM_133625chr31139 ------
NM_134265chr171359 ------
NM_138270chrX33290 2579 2293 --22628 473 --
NM_138286chr1923550 1368 14360 --2803 300
NM_138288chr1432262 1485 594 ----12247
NM_138375chr181968 ------
NM_138423chr1531884 695 33 ------
NM_138426chr71877 1967 ----
NM_138444chr1313063 23260 1715 21588 723 --
NM_138455chr81131 ------
NM_138459chr62139 55 ------
NM_138473chr1213706 ----12072
NM_138576chr1453677 3323 1927 716 555 --13150 --
NM_138713chr1635527 5365 5034 ----1497
NM_138714chr1635527 5365 5034 ----1497
NM_138735chr22541 406 ------
NM_138766chr51637 ------
NM_138773chr5--179 ----
NM_138782chr521571 583 --1154 --
NM_138798chr2--141 ----
NM_138807chr3143 ------
NM_138821chr51637 ------
NM_138822chr51637 ------
NM_138927chr211658 ------
NM_138931chr31726 1706 ----
NM_138959chr155553 1465 1179 586 276 ------
NM_138966chr18180 --1490 --
NM_138970chr1431957 1511 396 --1672 --
NM_138971chr1133309 2866 2744 13579 1766 --
NM_138971chr1133309 2866 2744 13579 1766 --
NM_138972chr1133309 2866 2744 13579 1766 --
NM_138972chr1133309 2866 2744 13579 1766 --
NM_138973chr1133309 2866 2744 13579 1766 --
NM_138973chr1133309 2866 2744 13579 1766 --
NM_138980chr41299 ------
NM_138982chr41299 ------
NM_139015chr121540 ------
NM_139076chr41493 --1276 --
NM_139126chr61724 ------
NM_139168chr5----21366 740 --
NM_139207chr1211549 ----12061
NM_139215chr172250 108 ------
NM_139244chr61706 --1774 --
NM_139245chr3175 1282 ----
NM_139312chr10--11321 ----
NM_139323chr2012045 ----12063
NM_144571chr476757 6609 6251 5577 5336 5177 1827 ------
NM_144578chr1435521 1170 909 14554 21936 252 --
NM_144609chr17----1921 --
NM_144618chr11389 ------
NM_144635chr31156 ------
NM_144658chrX--1351 ----
NM_144664chr1111714 ----11658
NM_144726chr531142 804 349 ------
NM_144767chr1554125 4085 3948 1157 1143 11079 --24517 840
NM_144778chr131623 ------
NM_144949chr222610 2032 ------
NM_144963chr832675 1010 191 ------
NM_144982chr121514 --1271 --
NM_145176chr621221 208 ------
NM_145203chr131187 ------
NM_145243chr1--189 ----
NM_145259chr257066 2202 2188 1442 545 --11468 --
NM_145284chrX32552 887 634 --12326 --
NM_145296chr191189 ------
NM_145307chr1054275 3857 1051 773 197 ------
NM_145320chr723396 1121 ------
NM_145321chr723396 1121 ------
NM_145322chr723396 1121 ------
NM_145686chr213190 ------
NM_145687chr213190 ------
NM_145698chr1051897 1773 1475 707 605 ----11800
NM_145716chr1173 ------
NM_145861chr1------11549
NM_145891chr161384 ------
NM_145892chr161384 ------
NM_145893chr161506 ------
NM_147147chr632821 1323 134 ------
NM_147150chr953576 1002 911 97 22 ----1935
NM_147156chr102580 353 --1608 --
NM_147171chr7128 ------
NM_147175chrX31545 75 38 ----1316
NM_147185chr7128 ------
NM_147223chr21901 ------
NM_147233chr21718 ------
NM_148174chr81731 ------
NM_148898chr71684 ------
NM_148899chr71684 ------
NM_152263chr175814 5659 5159 3776 2370 794 549 14506 26030 2397 --
NM_152267chr22----12393 --
NM_152271chr8----129 --
NM_152277chr521882 1380 11726 ----
NM_152283chr521149 882 ------
NM_152291chr4121 ------
NM_152298chr1133 ------
NM_152309chr101440 1188 ----
NM_152373chr11154 1537 ----
NM_152380chr1--11406 ----
NM_152387chr2170 ------
NM_152407chr542472 2209 903 35 12691 ----
NM_152414chr82550 266 --21398 585 150
NM_152462chr172728 83 ------
NM_152556chr722060 636 ------
NM_152594chr151376 ----1887
NM_152606chr192322 202 ------
NM_152622chr51992 ------
NM_152624chr546475 2405 1526 994 26895 6406 ----
NM_152641chr1212544 ------
NM_152653chr31648 ------
NM_152660chr1----1671 --
NM_152667chr2041546 1507 1159 1025 1447 ----
NM_152678chr331752 258 183 ------
NM_152756chr523998 1701 ----12681
NM_152758chr822654 2180 22131 1042 ----
NM_152765chr831852 698 358 --21957 229 --
NM_152774chr722457 362 ------
NM_152787chrX13026 ----133
NM_152793chr754575 4143 3872 1989 186 21856 451 ----
NM_152835chr121155 691 12086 12948 --
NM_152836chr821498 1157 --1614 11731
NM_152837chr821498 1157 --1614 11731
NM_152878chr2231563 1114 59 ------
NM_152903chr13----12879 --
NM_152924chr1556455 5023 1704 1388 236 35902 5713 1404 12138 --
NM_152989chr1211461 ------
NM_152998chr71186 ------
NM_153047chr61405 ------
NM_153181chr18180 --1490 --
NM_153184chr3--1448 --11423
NM_153188chr554132 4026 2009 1741 855 24608 4422 14428 --
NM_153211chr181439 ------
NM_153215chr3153 --1898 --
NM_153251chr13----1208 --
NM_153261chr16153 ------
NM_153321chr171443 ------
NM_153322chr171443 ------
NM_153346chrX31901 1720 1710 ----11636
NM_153354chr5----1930 --
NM_153374chr152383 157 ------
NM_153607chr512318 23136 148 ----
NM_153620chr7--1204 ----
NM_153634chr1221259 41 ------
NM_153640chr201213 --1109 --
NM_153645chr223899 277 209 ----12087
NM_153675chr202651 56 ------
NM_153693chr121316 ----1730
NM_153759chr2--11011 11257 --
NM_153812chr152376 2183 1855 458 42 ----12300
NM_170686chr763145 2998 2667 2618 1006 478 --12460 12409
NM_170709chr812335 ------
NM_170720chr191859 ------
NM_170721chr172955 25 ------
NM_171998chrX1113 11867 ----
NM_172037chr821022 142 1190 ----
NM_172058chr821476 595 ------
NM_172059chr821476 595 ------
NM_172060chr821476 595 ------
NM_172070chr2--11879 ----
NM_172071chr146567 5391 2294 98 26908 6655 16831 16270
NM_172103chr622700 541 ----1973
NM_172105chr622700 541 ----1973
NM_172128chr41521 ------
NM_172164chr1133 ------
NM_172206chr1731849 1800 744 ------
NM_172219chr171844 ------
NM_172220chr171844 ------
NM_172232chr17--2584 196 ----
NM_172337chr14----1254 --
NM_172387chr18----11055 --
NM_172388chr18----11102 --
NM_172389chr18----11102 --
NM_173054chr71178 ------
NM_173078chrX150 ------
NM_173156chr1--1323 ----
NM_173214chr1635527 5365 5034 ----1497
NM_173216chr311818 ------
NM_173217chr311818 ------
NM_173355chr23718 678 404 ------
NM_173359chr31153 ------
NM_173469chr1521366 1165 ----1277
NM_173470chrX22332 496 1889 11076 --
NM_173478chr1711090 1730 ----
NM_173496chr1043019 2261 1997 505 11152 ----
NM_173500chr15------1381
NM_173519chr812003 11690 ----
NM_173546chr31672 ------
NM_173552chr31867 12248 12089 --
NM_173559chr6----148 --
NM_173570chr312233 ----11738
NM_173582chr1156143 5935 2292 831 473 14898 24751 299 --
NM_173602chr1222450 700 --11430 --
NM_173626chr17----1525 --
NM_173642chr168364 8103 7948 7410 2613 2117 15668 22950 585 --
NM_173647chr2----1994 --
NM_173667chr541522 948 789 324 ------
NM_173683chr811542 ----1587
NM_173797chr5------1434
NM_173822chr211518 --12202 --
NM_173825chr322867 155 ------
NM_173830chr62759 62 ------
NM_174911chr812874 --13238 --
NM_174929chr7------1884
NM_175061chr71867 ------
NM_175610chr1511280 1530 ----
NM_175629chr2--11011 11257 --
NM_175863chr61890 ------
NM_175876chr142335 1917 1723 119 --12824 --
NM_175907chr1852326 2113 846 790 366 ------
NM_176787chr1821255 505 ------
NM_176792chr10--11320 ----
NM_176812chr201640 ------
NM_176814chr71337 ------
NM_177414chr11531 ----11722
NM_177438chr1423183 1657 ----1673
NM_177478chr5----1127 --
NM_177524chr711134 ------
NM_177525chr711134 ------
NM_177538chr2118557 7554 7436 7394 7083 5889 5533 5394 3494 3179 1165 26775 3001 12507 --
NM_177947chrX31413 1394 263 ------
NM_177948chrX31413 1394 263 ------
NM_177952chr141285 ------
NM_177974chr1531884 695 33 ------
NM_177996chr2012675 13433 ----
NM_178000chr92200 192 ------
NM_178001chr92200 192 ------
NM_178003chr92200 192 ------
NM_178010chr1211461 ------
NM_178135chr411156 ------
NM_178140chr51718 12391 ----
NM_178154chr141322 1601 ----
NM_178155chr141322 1601 ----
NM_178156chr141322 1601 ----
NM_178157chr141322 1601 ----
NM_178234chr81203 ----127
NM_178426chr121516 625 ------
NM_178427chr121416 525 ------
NM_178509chr1724018 4003 24090 2779 --2980 440
NM_178812chr81439 ------
NM_178819chr8------1282
NM_180976chr611044 ------
NM_180977chr611044 ------
NM_181054chr14136 ------
NM_181077chr1532283 2186 650 ------
NM_181093chr1198 ------
NM_181332chrX31984 1854 1063 22406 454 12444 --
NM_181351chr1122264 553 12929 140 --
NM_181354chr821310 1066 ------
NM_181361chr3--1454 ----
NM_181457chr211341 ------
NM_181459chr211240 ------
NM_181486chr1231482 1162 1149 ------
NM_181504chr53621 611 389 33220 3127 1360 --11375
NM_181521chr1686945 6222 5420 4567 2604 2536 1972 1497 14601 --24536 1165
NM_181523chr53621 611 389 33220 3127 1360 --11375
NM_181524chr53621 611 389 33220 3127 1360 --11375
NM_181598chr14182 ------
NM_181659chr201140 ------
NM_181659chr201140 ------
NM_181704chr2131244 568 322 1524 --11184
NM_181723chr81709 ------
NM_181746chr1----1105 --
NM_181787chr883513 3316 2870 2603 2442 1262 676 614 --1537 --
NM_181861chr1251790 1133 830 543 129 ----12180
NM_181868chr1251790 1133 830 543 129 ----12180
NM_181869chr1241875 915 628 214 ----12265
NM_181886chr421308 981 ------
NM_181887chr421308 981 ------
NM_181888chr421308 981 ------
NM_181889chr421308 981 ------
NM_181890chr421308 981 ------
NM_181891chr421308 981 ------
NM_181892chr421355 1028 ------
NM_181893chr421308 981 ------
NM_182472chr4--130 ----
NM_182481chr2141149 1058 353 107 1309 --11089
NM_182482chr2141149 1058 353 107 1309 --11089
NM_182484chr2131244 568 322 1524 --11184
NM_182493chr1695030 4870 4672 4005 1957 1931 1820 579 161 158 ----
NM_182503chr644310 2154 1197 27 --21838 37 11735
NM_182515chr1965288 4936 4849 2627 1814 1141 14211 --11595
NM_182540chrX2812 619 ------
NM_182568chr17129 ------
NM_182607chrX41801 1423 431 252 11434 11514 --
NM_182648chr141108 ------
NM_182691chr721442 94 ------
NM_182692chr721442 94 ------
NM_182715chr721050 285 ------
NM_182757chr663234 2839 2813 2431 924 107 ------
NM_182758chr1533484 1457 854 --23434 153 --
NM_182767chr1211426 ------
NM_182847chr21693 ------
NM_182898chr735063 4135 1584 1902 --15374
NM_182899chr735063 4135 1584 1902 --15374
NM_182910chr14----1779 --
NM_182913chr14----1779 --
NM_182914chr14----1779 --
NM_182915chr222168 87 ------
NM_182917chr31135 ------
NM_182918chr213299 287 83 ------
NM_182931chr7--1213 ----
NM_182948chr121197 697 --1888 --
NM_182965chr17----1261 --
NM_182972chr152726 2644 2281 781 560 ------
NM_183234chr1541324 1221 691 232 ------
NM_183235chr1541324 1221 691 232 ------
NM_183236chr1541324 1221 691 232 ------
NM_183353chrX1417 1997 ----
NM_183381chr32934 849 ------
NM_183383chr32934 849 ------
NM_183384chr32934 849 ------
NM_183419chr81201 1188 ----
NM_194298chr1041767 1533 1300 500 --1386 --
NM_194314chr123665 3612 ----12249
NM_194328chr932022 781 340 ------
NM_194329chr932022 781 340 ------
NM_194330chr932022 781 340 ------
NM_194332chr932022 781 340 ------
NM_194442chr111580 --1522 1516
NM_194454chr711091 ------
NM_194455chr711091 ------
NM_194456chr711091 ------
NM_197941chr51197 1425 ----
NM_198057chrX--11069 ----
NM_198081chr622856 272 124 --11963
NM_198128chr1812363 ----1597
NM_198181chr1542947 2663 2062 660 ------
NM_198225chr101533 ------
NM_198241chr31135 ------
NM_198242chr31135 ------
NM_198244chr31135 ------
NM_198264chr11124 ------
NM_198270chrX33493 2359 164 --12458 --
NM_198275chr11185 ------
NM_198324chr12----237 23 --
NM_198336chr711227 --11730 --
NM_198390chr1621955 233 --1510 --
NM_198391chr2021284 974 ----1336
NM_198400chr1542911 2575 2017 580 --12116 --
NM_198401chr81275 ------
NM_198404chr131825 ------
NM_198474chr11----11134 2843 703
NM_198503chr111556 ------
NM_198513chr8------1543
NM_198549chr122151 2113 11252 11057 12097
NM_198568chr6----1485 --
NM_198569chr621972 1017 --12634 --
NM_198571chr7----11198 --
NM_198581chr276671 5727 5701 5399 5373 5099 4939 11521 16891 36747 6089 660
NM_198715chr165238 4176 2346 1612 991 837 ----11896
NM_198793chr323563 3036 ------
NM_198794chr1411178 ------
NM_198830chr17161 ------
NM_198859chr364786 4076 2065 1748 756 82 --21458 904 --
NM_198892chr4146 ------
NM_198896chr1111909 ------
NM_198947chr111281 1822 --191
NM_198991chr18------1816
NM_199000chr721531 675 ------
NM_199003chr8--11412 ----
NM_199039chr431007 252 118 ------
NM_199076chr101372 ------
NM_199133chr51253 ----1961
NM_199144chr2021629 539 11550 ----
NM_199188chr1213789 --1547 21639 500
NM_199189chr5--1983 ----
NM_199190chr1213789 --1547 21639 500
NM_199203chr2021629 539 11550 ----
NM_199320chr4--1892 --11058
NM_199320chr4--1892 --11058
NM_199327chr4----1850 --
NM_199328chr211756 --1774 1792
NM_199459chr10------1451
NM_199462chr1104797 4768 4478 3824 3055 1752 1163 342 233 206 --23872 2000 --
NM_199478chrX51974 1896 1619 527 365 ------
NM_199482chr21477 12064 ----
NM_199487chr20189 ----11001
NM_201269chr11591 ----1121
NM_201437chr821498 1117 ------
NM_201439chr122412 276 ------
NM_201440chr122412 276 ------
NM_201444chr121208 ------
NM_201445chr121208 ------
NM_201515chr122412 276 ------
NM_201532chr111592 ------
NM_201533chr111592 ------
NM_201554chr121208 ------
NM_201567chr311297 ------
NM_201568chr1--1323 ----
NM_201569chr1--1323 ----
NM_201570chr102762 364 11566 ----
NM_201571chr102762 364 11566 ----
NM_201572chr102762 364 11566 ----
NM_201590chr102762 364 11566 ----
NM_201591chr431323 607 93 ------
NM_201592chr431323 607 93 ------
NM_201593chr102762 364 11566 ----
NM_201596chr102762 364 11566 ----
NM_201597chr102762 364 11566 ----
NM_201999chr421197 1082 ------
NM_203301chr14----1188 --
NM_203327chr2023050 1130 ------
NM_203341chr1----1782 --
NM_203342chr1------11260
NM_203343chr1------11260
NM_203351chr171394 ------
NM_203354chr14176 ------
NM_203355chr14176 ------
NM_203356chr14176 ------
NM_203364chr112457 229 ------
NM_203399chr12206 185 ------
NM_203401chr12206 185 ------
NM_203406chr512209 ----1706
NM_203459chr11188 1860 ----
NM_203463chr213217 --13874 133
NM_203464chr111042 ------
NM_203487chr13----11343 --
NM_203499chr172720 93 ------
NM_203504chr4------1266
NM_203505chr4------1266
NM_206594chr112479 ------
NM_206595chr112479 ------
NM_206852chr142255 214 ------
NM_206853chr634012 1418 345 --11365 --
NM_206854chr625273 1606 ------
NM_206855chr636238 4072 880 1390 ----
NM_206857chr142255 214 ------
NM_206876chr212651 13404 --23362 463
NM_206907chr533149 752 593 ------
NM_206909chr848192 8065 6180 601 16699 37662 3357 1168 --
NM_206944chr91762 ------
NM_206945chr91762 ------
NM_206946chr91762 ------
NM_206947chr91762 ------
NM_207012chr1021182 76 1862 12823 --
NM_207032chr2021348 1308 1184 11282 --
NM_207033chr2021256 1216 192 11190 --
NM_207034chr2021256 1216 192 11190 --
NM_207292chr322582 494 ----13382
NM_207293chr322582 494 ----13382
NM_207294chr322582 494 ----13382
NM_207295chr322582 494 ----13382
NM_207296chr322582 494 ----13382
NM_207297chr322607 519 ----13407
NM_207299chr91152 ------
NM_207304chr131510 ------
NM_207325chr1921956 683 ------
NM_207334chr111031 ------
NM_207371chr1031422 1129 414 ------
NM_207645chr1111100 --1955 --
NM_212460chr71190 ------
NM_212554chr1011423 --11632 --
NM_212559chrX1646 1741 1301 --
NM_213594chr12----1903 --
NM_213609chr321098 203 ------
NM_213611chr12156 ------