TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4796-3p
miRNA Sequence: UAAAGUGGCAGAGUAUAGACAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr54987 969 288 141 ------
NM_000016chr13695 581 148 ----1222
NM_000038chr552070 1408 1353 161 62 --11980 --
NM_000043chr1011257 1105 1431 --
NM_000052chrX33420 1335 71 23058 2878 13308 --
NM_000059chr132288 186 1803 ----
NM_000061chrX257 29 ------
NM_000063chr61264 ------
NM_000070chr153503 470 75 ----1149
NM_000075chr122191 42 ------
NM_000081chr111583 135 11295 --
NM_000084chrX116960 5919 5835 4739 2443 2394 1671 1629 1472 1423 84 46589 6344 2023 1846 15871 12727
NM_000088chr1721114 287 ----1873
NM_000089chr75696 317 117 100 59 ------
NM_000092chr2104060 3908 3823 3359 3263 3111 1816 1034 712 94 44353 1553 1510 508 21258 736 --
NM_000098chr15471 226 117 91 31 ------
NM_000103chr1521207 1015 2467 118 1850 11253
NM_000104chr223108 619 22934 2874 1375 --
NM_000108chr751573 1541 763 499 227 1531 21678 1567 --
NM_000109chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_000110chr131161 379 112 21231 431 ----
NM_000115chr1351828 725 615 537 29 21861 166 ----
NM_000125chr6104225 3374 3360 3247 2931 2921 2886 386 368 336 147 --168
NM_000129chr621450 541 ------
NM_000134chr421554 1420 1230 ----
NM_000138chr1582592 2554 2465 2388 2287 2189 403 282 --1189 --
NM_000139chr1142313 2191 1123 525 12042 ----
NM_000141chr1031359 579 96 ------
NM_000151chr171275 11894 1355 1325
NM_000161chr1441876 1476 751 479 11628 31400 188 87 --
NM_000163chr572282 2274 1945 1890 1498 1464 332 --12092 --
NM_000165chr651545 1303 681 658 504 ------
NM_000167chrX81682 1665 1621 1427 713 674 359 120 ------
NM_000168chr773314 3095 2644 2549 2200 1316 205 12663 32773 1175 860 1978
NM_000170chr92409 341 ------
NM_000173chr171408 ------
NM_000176chr563903 2935 563 431 353 197 13357 11160 --
NM_000177chr91231 ------
NM_000183chr2160 ------
NM_000188chr103648 279 211 --2703 224 --
NM_000189chr222404 2094 1786 11587 --
NM_000196chr161132 1520 ----
NM_000208chr19134517 4319 4188 4105 3548 3436 3145 2986 1851 1803 1209 1175 47 --141 --
NM_000210chr252343 2034 1867 1722 949 --1862 --
NM_000214chr2041414 1185 1137 305 ------
NM_000216chrX53819 3145 1057 829 494 13639 --1573
NM_000217chr12115370 5127 4174 3944 3665 2093 1007 385 332 92 34 55333 4745 4340 4113 104 34530 4182 2012 --
NM_000222chr421740 1650 1143 1821 --
NM_000223chr172480 190 --1121 --
NM_000227chr182312 159 1346 ----
NM_000231chr131616 ------
NM_000232chr421134 372 32172 2162 182 --12252
NM_000233chr23765 651 317 ------
NM_000237chr8--21941 1706 ----
NM_000245chr74464 437 295 35 11578 ----
NM_000248chr31818 --1309 1461
NM_000252chrX11388 ------
NM_000255chr63373 323 107 1126 ----
NM_000259chr15115906 5647 5458 4015 2303 1104 1078 603 162 154 87 21514 628 26037 1630 --
NM_000266chrX4890 373 249 233 ------
NM_000267chr1753424 2521 2459 430 355 --23453 212 --
NM_000276chrX5735 477 420 378 181 ------
NM_000277chr123693 657 573 ------
NM_000280chr115855 769 247 223 115 ------
NM_000282chr13145 ------
NM_000286chr172195 157 ------
NM_000288chr62347 333 ------
NM_000289chr121265 --1344 --
NM_000291chrX6889 815 378 208 68 54 --1750 1603
NM_000293chr162766 640 ------
NM_000297chr461861 1835 1626 1442 1392 637 22054 139 ----
NM_000304chr1731079 884 201 ------
NM_000314chr1073275 3223 2712 2636 1232 661 278 22432 2350 ----
NM_000317chr11--1322 ----
NM_000321chr1341538 1398 230 171 --1343 --
NM_000325chr41643 1269 ----
NM_000329chr11844 2889 798 ----
NM_000330chrX62173 2118 1872 851 754 289 ------
NM_000332chr6165878 5543 5225 5112 4840 4725 2786 2752 2179 2132 1702 1481 1397 1391 603 590 45737 1845 1191 1142 11044 11672
NM_000333chr331137 724 40 --1417 --
NM_000337chr5156010 5810 5787 5060 4448 4424 2593 2264 1843 1704 1611 1471 879 796 270 26220 1715 15493 --
NM_000338chr1551031 936 865 807 225 269 26 ----
NM_000340chr361436 946 604 532 473 322 181 ----
NM_000345chr43948 682 289 ------
NM_000346chr1721912 224 --1479 --
NM_000361chr2071805 1753 855 705 625 544 469 11830 1428 --
NM_000362chr2283612 2785 2420 1159 858 464 336 26 22489 1171 12574 --
NM_000367chr662184 1849 1823 1612 1589 152 1891 12110 --
NM_000368chr974480 4454 4425 4247 3527 3294 281 --23124 366 --
NM_000378chr1151252 1246 808 445 263 --2372 196 --
NM_000387chr32190 25 ------
NM_000389chr651154 474 339 325 231 11187 ----
NM_000393chr281931 1652 1641 1546 1407 808 792 645 ------
NM_000396chr15532 397 140 68 35 --1170 --
NM_000399chr1021202 327 1465 ----
NM_000408chr2133252 3118 3077 3006 2774 2255 2118 1351 1285 744 570 370 235 42149 1297 814 179 ----
NM_000411chr2183145 3090 2318 2257 2160 1264 792 644 33000 2190 960 13110 --
NM_000414chr51119 ------
NM_000430chr1783250 2671 2650 1330 1021 948 697 447 32877 1369 322 ----
NM_000435chr194860 652 362 256 ------
NM_000439chr542008 1771 890 313 --1810 --
NM_000441chr762186 2017 1669 1587 1574 494 ------
NM_000444chrX2114 103 --1254 1297
NM_000448chr11153235 3089 3022 2973 2249 2136 2098 1240 1194 1052 945 816 462 444 383 ----12967
NM_000449chr161111 541 532 500 485 147 11539 11311 --
NM_000451chrX42042 1978 1943 419 --12141 --
NM_000461chr394297 4261 3041 2962 2818 1822 813 795 595 24197 3843 ----
NM_000462chr1551643 1223 431 333 282 --1465 --
NM_000480chr1151141 1060 447 353 173 31642 154 24 1464 --
NM_000484chr214828 716 210 69 ----1370
NM_000486chr1262357 2310 2090 959 564 522 --23062 631 12653
NM_000488chr1172 ------
NM_000489chrX123336 3062 2907 2472 2261 2160 1135 1014 459 443 167 139 43427 2939 1256 906 21384 713 13265
NM_000492chr721528 251 ------
NM_000495chrX1236 1713 ----
NM_000503chr861622 1241 636 476 436 324 11763 ----
NM_000508chr45966 864 749 382 227 ------
NM_000516chr201238 ------
NM_000522chr731111 946 131 3825 505 335 ----
NM_000523chr221165 1064 1373 ----
NM_000527chr19112429 2370 2196 2169 1773 1657 1635 821 795 642 249 ------
NM_000533chrX1202 ------
NM_000538chr1351804 1310 297 161 114 1619 ----
NM_000544chr6_cox_hap163116 2649 2416 1028 598 369 --11232 1702
NM_000546chr1741106 800 323 131 --21149 65 --
NM_000555chrX117883 7569 7220 5947 5921 5651 2591 2415 2061 1869 1330 22520 2181 56751 5825 4858 2534 2453 12002
NM_000565chr152278 1881 1763 908 674 ------
NM_000572chr15781 672 646 378 156 ------
NM_000573chr172170 2028 1437 612 518 473 424 12343 1818 --
NM_000585chr41224 1216 ----
NM_000586chr41186 ------
NM_000596chr7----1116 --
NM_000598chr72608 203 ------
NM_000599chr264530 4488 3925 1437 1144 785 --13883 11314
NM_000602chr721374 1219 ------
NM_000609chr1052576 2212 1248 151 133 --13094 --
NM_000610chr1172920 2400 2205 2173 1203 632 252 --1407 --
NM_000615chr1192821 2787 2405 1956 1215 529 473 420 231 12527 11015 --
NM_000617chr1232284 1553 366 32126 2006 1926 --1578
NM_000618chr12126464 6103 6006 5816 2555 2419 1947 1803 1565 1254 1029 712 35898 4426 627 16356 --
NM_000618chr12126464 6103 6006 5816 2555 2419 1947 1803 1565 1254 1029 712 35898 4426 627 16356 --
NM_000621chr1361428 1377 1237 1211 559 268 1135 ----
NM_000624chr143869 733 712 ------
NM_000627chr21372 1601 2882 807 --
NM_000633chr18135184 5068 5034 4176 3888 3735 3699 3422 3390 1735 489 374 325 25128 752 11323 --
NM_000635chr1921396 116 11478 ----
NM_000651chr172170 2028 1437 612 518 473 424 12343 1818 --
NM_000663chr1662826 2777 2494 989 139 83 ------
NM_000684chr1021244 1055 1525 1938 --
NM_000685chr32644 205 1866 197 --
NM_000685chr32644 205 1866 197 --
NM_000686chrX2533 38 --21464 346 --
NM_000693chr1561733 1453 1270 1248 738 241 ------
NM_000701chr1--1289 ----
NM_000719chr12146669 5326 5269 5093 4914 2497 2245 1719 1683 1509 1379 856 724 375 ------
NM_000721chr132426 2124 2112 --1317 --
NM_000724chr1042030 1389 272 176 ------
NM_000726chr241286 1000 408 242 2556 125 ----
NM_000739chr7--199 1640 --
NM_000740chr1------1165
NM_000756chr8195 ------
NM_000761chr1521353 475 1135 11456 --
NM_000788chr451406 1205 1071 1034 367 11338 11360 21418 986
NM_000794chr51322 1662 ----
NM_000800chr541610 1357 1288 155 ------
NM_000801chr2031077 796 268 1253 1118 --
NM_000806chr531842 711 531 ------
NM_000807chr41667 ------
NM_000808chrX4877 816 761 231 ------
NM_000809chr4259076 8452 8371 8248 8141 7844 7472 7171 6870 6850 6755 6426 6364 6018 3585 3463 3281 3078 2998 2927 2832 2640 2621 2062 119 58191 3519 2892 1823 332 1955 --
NM_000811chr51526 ------
NM_000813chr595399 5223 5086 3899 2144 2126 632 153 143 25166 1148 ----
NM_000814chr15113992 3708 3620 3514 3424 3250 2691 2674 774 509 261 24088 1643 22727 1115 13674
NM_000816chr52186 73 1455 ----
NM_000817chr2194 2904 315 ----
NM_000824chr45865 624 120 109 37 ------
NM_000826chr432486 2414 844 22335 1888 ----
NM_000827chr562397 2350 1889 1695 972 792 --1167 1503
NM_000829chr1121946 556 ------
NM_000831chr146141 5415 905 369 --34031 771 674 15310
NM_000833chr1631540 1302 1155 --11426 --
NM_000834chr122458 102 ------
NM_000838chr651861 1749 1682 1019 868 12547 ----
NM_000844chr341113 991 405 90 1181 ----
NM_000857chr42485 190 ------
NM_000859chr531718 1703 131 11640 ----
NM_000860chr431482 1304 424 41676 672 407 338 ----
NM_000868chrX22447 714 2454 145 1993 --
NM_000872chr102586 569 ------
NM_000875chr15136746 6413 6248 5987 5733 5664 5505 5118 4991 2209 1212 1126 678 --25775 2153 26023 572
NM_000876chr611403 1369 ----
NM_000877chr262940 2784 2031 968 860 264 11026 32926 2257 1983 --
NM_000879chr51233 151 ----
NM_000885chr221902 351 2852 508 1561 11940
NM_000891chr1753604 3357 3224 2299 844 43165 2824 2470 33 ----
NM_000899chr12124318 4106 3824 3388 3347 3013 2821 1115 939 671 332 28 44394 3831 3616 3512 14117 --
NM_000901chr432116 1919 599 12576 11771 --
NM_000908chr52801 776 2715 131 ----
NM_000917chr102698 160 ------
NM_000921chr122139 122 ------
NM_000922chr1131089 278 178 ------
NM_000926chr11199015 8827 8794 8596 8257 7945 7397 6819 5852 3721 3477 3055 2860 2825 2744 2243 1418 1375 1292 86204 6192 5945 3450 2601 2222 1831 1522 31446 1178 605 --
NM_000935chr341229 1130 1079 124 ----11039
NM_000944chr472361 2194 2054 1915 1690 848 454 11505 ----
NM_000945chr271357 1321 655 598 452 126 30 1200 1786 --
NM_000949chr52211 140 --1131 1877
NM_000950chrX113448 3335 2876 2588 1365 1310 1212 1163 184 121 32 43553 2726 2521 66 12457 --
NM_000958chr53996 871 147 ------
NM_000961chr2073203 1308 1282 892 571 542 117 ------
NM_000962chr972235 2043 1167 1111 749 494 92 12416 ----
NM_000965chr341200 848 217 74 ------
NM_000990chr1164006 3530 3262 3191 3171 2982 --31486 336 39 13961
NM_001001132chr2131059 967 498 1175 ----
NM_001001323chr1252918 2782 2550 1069 756 ------
NM_001001330chr1041136 889 496 128 ------
NM_001001331chr392316 1833 1783 1669 750 640 613 344 198 --156 --
NM_001001344chrX52482 2094 2035 744 394 --1845 11965
NM_001001389chr1172920 2400 2205 2173 1203 632 252 --1407 --
NM_001001390chr1172920 2400 2205 2173 1203 632 252 --1407 --
NM_001001391chr1172920 2400 2205 2173 1203 632 252 --1407 --
NM_001001392chr1162966 2446 2251 2219 678 298 --1453 --
NM_001001395chr1282805 2762 1095 693 582 360 349 260 3881 700 566 1724 12462
NM_001001396chr1114506 4280 3853 3237 2907 2710 1703 1639 654 553 545 --2772 329 --
NM_001001419chr5134992 4927 4082 3712 3688 3661 2005 1738 1491 1332 1020 854 418 45236 3815 746 283 21967 1656 --
NM_001001420chr5134992 4927 4082 3712 3688 3661 2005 1738 1491 1332 1020 854 418 45236 3815 746 283 21967 1656 --
NM_001001433chr2042038 1026 982 723 ----1965
NM_001001436chr162869 609 --1800 --
NM_001001481chr8103011 2949 2607 1165 1123 1025 970 137 121 57 32987 2920 487 1256 --
NM_001001484chr1062083 1931 1812 1633 650 320 11981 ----
NM_001001521chr21294 187 ----
NM_001001549chr741787 393 376 292 ------
NM_001001550chr741787 393 376 292 ------
NM_001001555chr741787 393 376 292 ------
NM_001001556chr1531453 1163 31 --11593 --
NM_001001557chr842221 2162 2017 668 --12036 --
NM_001001664chr2124143 3933 3617 3318 3089 2780 2588 2568 1066 845 278 200 1250 --13675
NM_001001668chr1953353 977 596 245 206 23907 510 12716 --
NM_001001787chr14339 182 172 132 ------
NM_001001872chr142519 443 ------
NM_001001877chrY139 ------
NM_001001890chr2163739 3693 3682 2696 857 729 --23652 2850 --
NM_001001924chr851756 1347 1290 805 38 ------
NM_001001925chr851756 1347 1290 805 38 ------
NM_001001928chr22207490 7418 7098 6994 6979 6322 6273 5145 3179 2726 2613 2001 1975 1607 1216 979 626 512 422 324 --35862 5321 377 1103
NM_001001931chr851756 1347 1290 805 38 ------
NM_001001933chr16617 434 229 184 167 124 ------
NM_001001971chr1071316 1090 1061 1021 880 422 25 1108 ----
NM_001001974chr1062273 2247 2206 1953 1869 1633 32078 2017 1892 2865 529 11576
NM_001001992chr212242 94 ------
NM_001001994chrX2451 206 ------
NM_001001995chrX41655 471 254 231 1710 --1217
NM_001001996chrX2451 206 ------
NM_001002009chr71213 --1394 --
NM_001002010chr71213 --1394 --
NM_001002032chr171750 1219 ----
NM_001002033chr171850 2319 114 ----
NM_001002233chr872225 1818 1780 1441 823 459 43 22044 1612 11583 --
NM_001002243chr21225 ------
NM_001002257chr2133463 2934 2925 2406 2219 1417 1271 1247 825 773 546 295 78 13432 21142 671 --
NM_001002295chr10165 --2912 145 --
NM_001002296chr861352 287 267 145 128 24 11325 1194 --
NM_001002811chr121615 456 --31471 1272 443 --
NM_001002812chr121615 456 --31471 1272 443 --
NM_001002812chr121615 456 --31471 1272 443 --
NM_001002814chr883778 2815 1441 1072 1046 823 459 43 ------
NM_001002838chrX61854 582 496 319 307 224 21483 119 11879 --
NM_001002843chr1521186 428 1128 ----
NM_001002857chr151308 2294 139 ----
NM_001002858chr151308 2294 139 ----
NM_001002860chr14154474 4080 3835 3814 2964 1816 1609 1585 1427 1004 935 582 383 262 238 22871 394 --149
NM_001002876chr221396 ------
NM_001002909chr1782130 2059 2012 1954 1791 1750 1380 367 --21742 484 --
NM_001002919chr22387 214 ------
NM_001002926chr772652 2469 2286 2068 1932 949 780 11772 1972 1209
NM_001003652chr18198714 8628 8083 7951 7739 6601 6112 5381 5330 3469 2844 2824 2272 2164 1640 1631 1312 451 360 --35406 1678 752 13254
NM_001003674chr1896979 6865 6345 5516 5320 4933 4495 4404 442 46614 5378 5307 742 ----
NM_001003675chr1896979 6865 6345 5516 5320 4933 4495 4404 442 46614 5378 5307 742 ----
NM_001003679chr142238 2068 569 82 11469 --1497
NM_001003681chr2222145 404 --1175 --
NM_001003688chr441233 1167 1143 796 1354 1776 --
NM_001003694chr31563 ------
NM_001003698chr651965 1753 670 538 231 ------
NM_001003699chr651965 1753 670 538 231 ------
NM_001003712chr12123761 3691 3468 3039 2890 2814 2681 2664 2543 2502 1582 1008 13428 13149 --
NM_001003792chr33349 221 104 1822 1436 --
NM_001003793chr33349 221 104 1822 1436 --
NM_001003800chr951475 1171 1111 1009 757 ------
NM_001004019chr31347 1394 ----
NM_001004065chr973911 3345 904 771 553 449 371 21578 77 33080 2565 483 13726
NM_001004196chr33811 783 42 1344 ----
NM_001004303chr12765 227 3676 625 527 ----
NM_001004303chr12765 227 3676 625 527 ----
NM_001004304chr1263154 2933 2292 2179 2041 595 ----12226
NM_001004308chrX51480 1182 222 130 22 ----1104
NM_001004317chr663963 3514 3340 3176 1635 449 --24294 2932 --
NM_001004329chr1241310 1208 1029 375 21529 1046 ----
NM_001004354chr921029 699 ------
NM_001004360chr251791 1499 1415 1263 803 2423 325 --11761
NM_001004419chr1274613 4465 4445 4286 3421 3282 2906 1676 --1134
NM_001004720chr22948 153 1807 ----
NM_001004722chr221117 322 1976 ----
NM_001005158chr32517 132 ------
NM_001005159chr32517 132 ------
NM_001005207chr171225 ------
NM_001005266chr152491 481 ------
NM_001005267chr152491 481 ------
NM_001005268chr152491 481 ------
NM_001005269chr152491 481 ------
NM_001005271chr1731164 1062 1040 ------
NM_001005273chr1731164 1062 1040 ------
NM_001005291chr17----2474 43 --
NM_001005335chr191226 --163 --
NM_001005353chr131310 976 491 ------
NM_001005353chr131310 976 491 ------
NM_001005366chr123616 255 57 ------
NM_001005375chrY2579 474 2380 57 ----
NM_001005386chr262483 2230 1750 691 667 473 1298 --12071
NM_001005404chr17104380 4369 4120 3581 3368 3209 3140 3043 1243 100 23619 3328 ----
NM_001005463chr10122572 2487 2446 2338 2130 1992 1959 1044 967 759 405 189 12607 1363 22362 211
NM_001005473chr5126289 5322 5033 4904 4774 4582 4132 2597 1343 436 219 201 56524 5329 4217 4202 743 24853 2298 --
NM_001005474chr3177 ------
NM_001005476chr22626 511 --1705 --
NM_001005526chr21104 ------
NM_001005527chr34946 324 220 151 11237 ----
NM_001005609chrX33845 3620 942 1743 ----
NM_001005739chr23734 234 186 1335 1859 --
NM_001005743chr1421267 1261 ------
NM_001005744chr1421267 1261 ------
NM_001005745chr1421267 1261 ------
NM_001005746chr241286 1000 408 242 2556 125 ----
NM_001005747chr241286 1000 408 242 2556 125 ----
NM_001005753chr252127 1927 1840 904 195 --32041 305 97 21727 54
NM_001005781chr21245 1120 ----
NM_001005782chr22694 272 ------
NM_001005845chr841271 438 384 109 11292 ----
NM_001005849chr171197 ------
NM_001005861chr33264 196 52 ------
NM_001005862chr173593 487 101 --1585 --
NM_001006115chr342783 2048 1957 444 ------
NM_001006600chr571927 1717 1680 1541 902 820 538 22294 1843 22097 442 12148
NM_001006605chr111174 11165 2826 42 126
NM_001006605chr111174 11165 2826 42 126
NM_001006612chrX190 ------
NM_001006613chrX190 ------
NM_001006614chrX190 ------
NM_001006623chr262588 2405 2181 2073 1626 504 22352 994 1137 11937
NM_001006626chr7--199 1640 --
NM_001006627chr7--199 1640 --
NM_001006628chr7--199 1640 --
NM_001006629chr7--199 1640 --
NM_001006630chr7--199 1640 --
NM_001006631chr7--199 1640 --
NM_001006632chr7--199 1640 --
NM_001006634chr163670 493 30 ------
NM_001006641chr941158 1146 338 280 ------
NM_001006642chr941158 1146 338 280 ------
NM_001006643chr941158 1146 338 280 ------
NM_001006657chr263201 2655 2335 1037 638 543 1534 2915 705 --
NM_001006665chr13672 543 285 ------
NM_001006684chrX2435 56 --1165 182
NM_001006946chr221207 50 --1472 --
NM_001007024chr1784377 4291 4214 4025 3841 1752 1482 202 24139 3127 137 --
NM_001007025chr1784377 4291 4214 4025 3841 1752 1482 202 24139 3127 137 --
NM_001007067chr8--31111 1041 376 2959 813 --
NM_001007068chr8--31111 1041 376 2959 813 --
NM_001007069chr8--31111 1041 376 2959 813 --
NM_001007070chr8--31111 1041 376 2959 813 --
NM_001007075chr441116 1034 389 80 ------
NM_001007088chrX41079 1003 804 415 166 ----
NM_001007097chr9125095 4997 4897 4808 1889 1842 1760 1752 1633 1622 1396 578 25022 1249 44550 3817 3256 1904 --
NM_001007102chr651330 1193 653 388 336 11225 ----
NM_001007156chr1541478 669 612 395 21968 606 11880 --
NM_001007214chr151943 1808 1635 224 143 ------
NM_001007237chr152473 2099 1860 811 530 12864 21908 615 12151
NM_001007246chr2121820 1745 --21552 279 --
NM_001007257chr111183 11519 11047 11022
NM_001007267chr21128 --1788 --
NM_001007277chr1141038 438 417 57 ------
NM_001007278chr13135189 5181 4621 4411 3921 3702 3575 3511 2117 1356 894 873 356 34741 4029 3882 25113 4589 14341
NM_001007466chr674965 4781 4497 4171 3816 1480 1070 23321 1693 34508 3918 1800 --
NM_001007544chr1----172 --
NM_001007553chr121181 360 --1300 1190
NM_001007559chr1862044 1792 773 684 398 355 ------
NM_001007565chr31113 ------
NM_001007794chr1------1647
NM_001008222chrX51217 913 873 563 150 ------
NM_001008239chr1873380 3082 2918 2397 2387 176 42 13365 11442 --
NM_001008388chr42225 150 ------
NM_001008392chr362883 2619 1209 823 795 683 33136 729 218 ----
NM_001008401chr1941509 1226 1022 996 --11070 --
NM_001008405chr731458 1308 369 11500 ----
NM_001008408chr7106264 6004 5924 5502 5189 4110 4076 2029 1454 666 45089 4373 1966 1263 24161 4026 --
NM_001008491chr262046 1949 1535 487 185 39 1120 ----
NM_001008492chr262046 1949 1535 487 185 39 1120 ----
NM_001008495chr8102237 2028 1991 1601 803 586 497 365 162 61 21471 245 12119 --
NM_001008541chr1021974 890 32232 1697 1479 12169 --
NM_001008541chr1021974 890 32232 1697 1479 12169 --
NM_001008564chr1341801 1727 702 545 12147 ----
NM_001008566chr221385 1522 ----
NM_001008660chr1181592 1575 1535 1437 1403 1397 1046 966 ------
NM_001008708chr21545 1613 ----
NM_001008711chr831749 1708 30 1433 21627 1367 --
NM_001008738chr552804 2774 2106 1088 782 ----22462 774
NM_001008744chr143205 157 82 ------
NM_001008801chr1962116 1943 1905 1855 1363 734 11975 11437 --
NM_001008860chr153757 246 149 1221 ----
NM_001008892chr153757 246 149 1221 ----
NM_001008894chr153757 246 149 1221 ----
NM_001008895chr1351434 1108 1055 390 74 11080 ----
NM_001008897chr61136 2509 173 ----
NM_001008925chr442406 1228 1095 215 12830 33565 3424 2299 --
NM_001009185chr52581 256 ------
NM_001009552chr8--1611 ----
NM_001009554chr464654 4171 3970 3458 3033 1433 34124 1483 751 21033 518 1130
NM_001009554chr464654 4171 3970 3458 3033 1433 34124 1483 751 21033 518 1130
NM_001009555chr471775 1367 1243 611 443 360 41 31457 1307 369 11087 --
NM_001009880chr2294540 4046 3555 3270 3226 3002 1788 1720 907 --21293 518 --
NM_001009881chr11461 ------
NM_001009882chr11461 ------
NM_001009894chr1231731 588 113 ------
NM_001009899chr3126548 6068 5872 5824 5709 4283 4146 2002 1760 1503 766 215 46479 5232 4332 981 36021 5014 4805 --
NM_001009909chr1163842 3150 2979 440 143 32 12884 ----
NM_001009958chr72558 183 ------
NM_001009960chr772840 2404 2372 2229 1017 812 755 ------
NM_001009993chr224335 4009 1547 ----
NM_001010000chr18123327 3131 3106 2892 2809 2721 1412 889 783 670 280 56 23530 2632 21104 860 --
NM_001010844chr62188 53 ------
NM_001010853chr653141 2853 893 317 287 --21223 1042 --
NM_001010861chr162667 2498 1982 1797 973 591 3992 527 298 ----
NM_001010888chrX94571 4352 4001 3910 3810 3523 3165 1813 1405 41727 1220 868 99 34011 3205 1573 --
NM_001010891chr5116568 6420 6397 6100 6055 4315 1761 1188 1022 848 188 56706 5796 5015 2457 2205 36556 6147 2284 --
NM_001010895chr941856 1841 1529 135 12028 ----
NM_001010908chr101615 --1762 --
NM_001010924chr103887 780 380 ------
NM_001010927chr62454 125 139 1230 --
NM_001010934chr731131 749 138 ------
NM_001010942chr1241286 519 339 174 1323 11163 --
NM_001010986chrX62418 2412 2377 2247 708 653 --1349 --
NM_001010989chr16--1514 --1421
NM_001010990chr16--1514 --1421
NM_001011513chr494064 3932 3026 2990 2651 1174 721 560 205 12924 33735 3484 1051 13125
NM_001011515chr451004 419 386 123 51 ------
NM_001011516chr451004 419 386 123 51 ------
NM_001011537chr352358 2305 1884 1726 416 11771 11927 --
NM_001011538chr44894 829 797 172 1867 ----
NM_001011553chr72657 231 2777 280 ----
NM_001011657chrX61084 843 760 750 414 114 ------
NM_001011663chr101330 1706 195 --
NM_001011666chr7215698 4592 4335 4178 4123 4098 2272 2067 1829 1623 1569 1505 1323 1253 771 653 616 589 221 128 71 36276 4818 4684 1623 --
NM_001011708chr2112838 2828 2620 2530 2311 2191 2165 1950 1068 946 783 ----12903
NM_001011713chr1451433 1125 1051 1008 157 21622 304 --11101
NM_001011718chr201260 --1805 --
NM_001011885chr1521262 1139 11462 21301 391 --
NM_001012267chr931661 1507 728 ------
NM_001012398chr1651051 721 422 335 31 ------
NM_001012410chr31477 ------
NM_001012420chr1562515 611 579 503 211 109 22725 2664 ----
NM_001012423chr1562515 611 579 503 211 109 22725 2664 ----
NM_001012478chr192647 632 ------
NM_001012514chr23969 449 95 ------
NM_001012516chr23969 449 95 ------
NM_001012751chr1061774 1734 1521 1247 511 244 --21589 1582 --
NM_001012754chr1342047 1951 1930 1854 21605 865 ----
NM_001012755chrX73795 3473 1985 1876 941 499 460 11629 34816 4443 522 --
NM_001012759chr162119 101 ------
NM_001012761chr542313 1677 603 511 22697 272 ----
NM_001012762chr162150 132 ------
NM_001012968chrX72599 2390 2315 2094 637 465 177 11929 1185 --
NM_001012974chr6128 ------
NM_001012977chrX51346 1301 312 261 164 1884 1446 --
NM_001012989chrX130 --1629 --
NM_001013031chr1063545 3198 2971 2537 2341 1175 12170 1463 --
NM_001013398chr72608 203 ------
NM_001013399chr641086 1008 722 32 ------
NM_001013406chr751512 385 124 83 35 11086 ----
NM_001013415chr431569 475 238 ------
NM_001013437chr18180 1411 ----
NM_001013438chr341018 327 275 261 ------
NM_001013439chr34864 173 121 107 ------
NM_001013615chr131139 1054 1013 11036 11226 --
NM_001013659chr19134567 4432 4271 4132 3718 3692 3557 2161 1693 1551 1134 793 67 1378 14891 11036
NM_001013690chr1242427 2415 1681 326 --22165 1734 --
NM_001013691chr191722 1551 ----
NM_001013693chr122771 318 ------
NM_001013693chr122771 318 ------
NM_001013699chr123549 49 25 ------
NM_001013843chr153747 377 68 ------
NM_001014286chr13----172 --
NM_001014434chr13818 764 160 1587 ----
NM_001014443chr11249 ------
NM_001014797chr10118224 7684 5595 5517 5444 3183 2785 2633 2549 1961 1893 31114 989 376 --11369
NM_001014809chr42994 298 --1896 --
NM_001014831chr19--1657 ----
NM_001014832chr19--1657 ----
NM_001014834chr19--1657 ----
NM_001014835chr19--1657 ----
NM_001015045chr452373 2124 1558 207 131 11827 ----
NM_001015048chr1483202 2376 2220 2201 1073 581 554 471 22783 2209 ----
NM_001015049chr1483202 2376 2220 2201 1073 581 554 471 22783 2209 ----
NM_001015053chr1711260 --1245 --
NM_001015508chr83553 302 259 ------
NM_001015877chrX52666 2613 1143 927 774 12007 11019 --
NM_001015881chrX21190 424 --11197 --
NM_001015882chr94802 383 313 256 ------
NM_001015887chr371758 1725 1710 1655 1561 1506 1253 21685 1230 --11320
NM_001017369chr411092 --11017 1168
NM_001017371chr251069 943 510 210 151 ------
NM_001017395chr393649 3508 2657 2362 1364 715 575 548 219 12921 ----
NM_001017405chr42244 223 ------
NM_001017415chr13527 511 184 ------
NM_001017416chr13527 511 184 ------
NM_001017420chr831413 1100 938 31352 1256 1125 ----
NM_001017424chr181853 1781 1610 1225 583 396 175 80 --1208 --
NM_001017425chr181853 1781 1610 1225 583 396 175 80 --1208 --
NM_001017923chr1461688 1158 1108 619 610 323 11571 --11129
NM_001017926chr831338 1148 264 --11134 --
NM_001017962chr102698 160 ------
NM_001017969chr91210 ------
NM_001017977chr11355 ------
NM_001017979chr42559 204 1115 ----
NM_001017992chr531422 1333 31 21512 984 175 11042
NM_001017995chr594804 4584 4502 4346 1931 1729 906 784 712 34798 4439 3423 13362 13171
NM_001018003chr81272 ------
NM_001018004chr154738 225 201 90 ------
NM_001018006chr154738 225 201 90 ------
NM_001018007chr154738 225 201 90 ------
NM_001018009chr3------1404
NM_001018020chr154738 225 201 90 ------
NM_001018054chr131252 489 229 11275 ----
NM_001018056chr94576 392 194 166 ------
NM_001018064chr94729 532 494 480 ------
NM_001018065chr9175585 5483 5325 5293 5164 4923 4773 4638 4581 4569 4283 3822 3703 1384 1184 1095 813 11499 34842 2326 1319 24462 224
NM_001018066chr9175585 5483 5325 5293 5164 4923 4773 4638 4581 4569 4283 3822 3703 1384 1184 1095 813 11499 34842 2326 1319 24462 224
NM_001018067chr1205167 4842 4721 4656 4162 3721 2072 1571 1435 1308 1119 1015 950 807 735 719 577 554 354 274 24323 1618 --1760
NM_001018068chr1205167 4842 4721 4656 4162 3721 2072 1571 1435 1308 1119 1015 950 807 735 719 577 554 354 274 24323 1618 --1760
NM_001018069chr1205167 4842 4721 4656 4162 3721 2072 1571 1435 1308 1119 1015 950 807 735 719 577 554 354 274 24323 1618 --1760
NM_001018074chr563903 2935 563 431 353 197 13357 11160 --
NM_001018075chr563903 2935 563 431 353 197 13357 11160 --
NM_001018076chr563903 2935 563 431 353 197 13357 11160 --
NM_001018077chr563903 2935 563 431 353 197 13357 11160 --
NM_001018089chr1564015 3573 3475 2476 1274 100 --23497 446 --
NM_001018100chr152140 21 1700 1809 --
NM_001018108chr1562160 1905 1888 916 731 682 ------
NM_001018111chr7103982 3595 3257 3024 2881 2843 926 634 394 358 ------
NM_001020658chr121454 1446 1456 ----
NM_001020658chr121454 1446 1456 ----
NM_001020825chr521378 410 ------
NM_001023567chr1532464 506 219 32112 2046 912 21760 582 --
NM_001023587chr331158 1142 167 --2953 792 --
NM_001024094chr563903 2935 563 431 353 197 13357 11160 --
NM_001024218chr142810 343 ------
NM_001024226chr12822 409 --2988 374 --
NM_001024227chr12822 409 --2988 374 --
NM_001024228chr12822 409 --2988 374 --
NM_001024372chr872096 2089 1799 1488 581 452 293 1547 22268 2212 --
NM_001024380chr842383 1931 1752 687 22344 1650 11615 --
NM_001024381chr842383 1931 1752 687 22344 1650 11615 --
NM_001024455chrX51890 1694 1024 684 83 ------
NM_001024463chr154800 444 338 184 ------
NM_001024649chr5112894 2867 2227 1918 1114 1099 928 853 756 645 378 12677 22886 2202 --
NM_001024660chr311242 1644 ----
NM_001024680chr251726 1591 1532 1376 92 3670 464 166 --1359
NM_001024688chr851667 760 323 217 52 ----11452
NM_001024808chr1262804 1960 368 316 288 160 --1409 --
NM_001024847chr352177 2060 1851 1718 999 21933 275 1809 --
NM_001024916chr91312 2108 85 --1396
NM_001024934chr61562 1697 ----
NM_001024935chr61562 1697 ----
NM_001024936chr61562 1697 ----
NM_001024937chr173487 478 294 1501 ----
NM_001024948chr172553 955 728 514 508 241 172 21211 183 --22383 772
NM_001024956chr11145562 5296 4954 4931 4883 4811 4576 4178 3677 3549 1423 988 978 862 34348 1294 641 45484 3807 2281 1928 --
NM_001025068chr341597 1143 720 265 1667 ----
NM_001025069chr341597 1143 720 265 1667 ----
NM_001025076chr10135837 5199 5186 4401 4178 4148 4076 2470 1674 997 577 529 459 133 85405 3940 2116 1657 1648 1568 1334 608 1565
NM_001025077chr10187195 6557 6544 5759 5536 5506 5434 5049 4807 4694 4611 3032 2355 1935 1887 1817 300 160 25112 33 86763 5298 3015 3006 2926 2692 1966 200 11923
NM_001025079chr3123913 3602 3370 2790 1469 1432 1226 943 862 677 499 366 23984 2610 13782 --
NM_001025100chr1873432 3080 3062 3013 2898 1396 1245 13325 ----
NM_001025105chr581255 1240 1085 966 956 483 255 116 ------
NM_001025107chr192502 2385 1805 800 701 449 332 297 157 1645 ----
NM_001025107chr192502 2385 1805 800 701 449 332 297 157 1645 ----
NM_001025108chr253925 3382 1653 495 354 11302 11558 --
NM_001025201chr24738 629 541 189 2584 495 ----
NM_001025205chr31423 ------
NM_001025252chr8103158 3081 2963 2040 1053 1047 924 915 717 692 --11108 --
NM_001025253chr8103158 3081 2963 2040 1053 1047 924 915 717 692 --11108 --
NM_001025266chr3144781 4748 4543 4031 3705 3666 3510 3192 1915 1351 1338 1242 900 221 34902 3091 3005 13290 --
NM_001025356chr1283029 2669 2006 883 678 398 122 91 53016 2988 2946 796 27 --12815
NM_001025366chr631896 584 183 ----1268
NM_001025366chr631896 584 183 ----1268
NM_001025367chr631896 584 183 ----1268
NM_001025367chr631896 584 183 ----1268
NM_001025368chr631896 584 183 ----1268
NM_001025368chr631896 584 183 ----1268
NM_001025369chr631912 600 199 ----1284
NM_001025369chr631912 600 199 ----1284
NM_001025370chr631896 584 183 ----1268
NM_001025370chr631896 584 183 ----1268
NM_001025389chr1151141 1060 447 353 173 31642 154 24 1464 --
NM_001025390chr1151141 1060 447 353 173 31642 154 24 1464 --
NM_001025580chrX93943 3880 3609 3077 3047 2988 2609 1273 561 34172 1490 825 23857 3002 31126 747 100
NM_001025595chr421613 437 1152 11307 --
NM_001025603chr161111 541 532 500 485 147 11539 11311 --
NM_001025616chr421202 505 --11177 --
NM_001029839chr331360 594 279 ------
NM_001029840chr331360 594 279 ------
NM_001029858chr662944 2604 2301 2257 1133 424 2652 442 33330 1092 407 --
NM_001029859chr1132409 1932 740 1816 1204 --
NM_001029860chr81325 2281 261 ----
NM_001029863chr673212 2783 933 786 593 483 76 12765 32810 1006 244 13074
NM_001029875chr583040 2994 2735 2674 1941 1181 811 125 2961 915 12803 --
NM_001029882chr11239 ------
NM_001029882chr11239 ------
NM_001029883chr233091 2070 353 ------
NM_001029884chr692646 2423 2217 2211 950 805 567 453 129 32580 926 405 2865 619 1533
NM_001029998chr451302 1155 911 535 411 ------
NM_001030chr1150 ------
NM_001030006chr1732290 1808 416 1402 1908 --
NM_001030007chr1693782 3681 3655 3400 2678 2620 2475 473 364 23517 1198 23092 222 --
NM_001030055chr14114650 4610 4301 4258 3835 3221 1234 1057 883 154 121 14186 24025 1160 --
NM_001030287chr1--151 1864 --
NM_001031665chr191390 ------
NM_001031677chr51402 ------
NM_001031679chr1283497 3304 3125 2862 1190 710 513 246 ------
NM_001031681chr1752328 2176 1469 544 30 --1155 --
NM_001031684chr211172 ----11272
NM_001031690chr762696 2690 1114 1001 978 419 --12886 --
NM_001031695chr22105106 4676 4620 3822 1240 1184 1047 594 235 150 --22031 1327 --
NM_001031700chr462486 1989 1971 840 200 45 1807 31895 1792 1648 --
NM_001031711chr551697 1550 1440 1368 1344 ------
NM_001031716chr241084 270 65 47 ------
NM_001031723chr42457 347 --1309 --
NM_001031732chr453630 1017 880 531 222 21425 902 --11112
NM_001031738chr25500 451 404 121 62 ------
NM_001031743chr62207 170 ------
NM_001031804chr1674277 4000 3858 3510 1082 527 474 --21318 906 --
NM_001031812chr592248 1874 1850 1605 1564 1523 296 141 128 1811 1674 12157
NM_001032280chr621545 526 11372 ----
NM_001032282chr821187 1072 21315 320 ----
NM_001032283chr1231020 285 204 ------
NM_001032284chr1231020 285 204 ------
NM_001032288chr2041333 1072 181 63 ------
NM_001032296chr13102834 2791 2682 2370 2294 1831 1120 589 450 245 1228 ----
NM_001032380chr1011846 1399 2136 58 --
NM_001032393chrX2735 609 1660 ----
NM_001032394chr662730 2717 2545 2350 625 596 1487 31785 935 523 22824 2224
NM_001032395chr662597 2584 2412 2217 492 463 1354 31652 802 390 22691 2091
NM_001032410chr212242 94 ------
NM_001032730chr13658 600 134 2689 625 ----
NM_001032999chr2095355 4211 4125 3890 3812 1993 1967 974 878 15254 21272 1232 1688
NM_001033045chr284261 4043 3774 3658 3093 1227 1154 382 34402 3403 2952 11386 11781
NM_001033047chr422517 480 2941 531 12440 --
NM_001033049chr2152194 1973 1808 433 352 11529 ----
NM_001033057chr331408 361 224 1134 1704 --
NM_001033059chr641605 591 507 149 --1462 --
NM_001033081chr121500 87 1554 ----
NM_001033082chr121500 87 1554 ----
NM_001033085chr2195 ------
NM_001033087chr2052290 1250 1043 513 148 12106 ----
NM_001033112chr51322 ------
NM_001033117chr364549 3226 3171 1491 1267 1060 11162 --11472
NM_001033503chr51363 ------
NM_001033506chr112413 47 ------
NM_001033518chr752511 2293 775 289 179 --42279 1774 536 337 --
NM_001033519chr752511 2293 775 289 179 --42279 1774 536 337 --
NM_001033520chr752511 2293 775 289 179 --42279 1774 536 337 --
NM_001033561chr172793 667 ------
NM_001033566chr172342 40 1109 ----
NM_001033568chr172342 40 1109 ----
NM_001033578chr871980 1810 1784 1511 765 631 105 ----12005
NM_001033581chr11295 ------
NM_001033581chr11295 ------
NM_001033582chr11295 ------
NM_001033602chr1332036 1870 404 ------
NM_001033659chr1761367 1302 1036 516 490 214 --179 11559
NM_001033723chr882567 2495 1942 1104 1086 943 487 454 --1379 1331
NM_001033756chr631830 518 117 ----1202
NM_001033756chr631830 518 117 ----1202
NM_001033925chr1051759 1743 705 522 301 --1325 --
NM_001034172chr18127 ------
NM_001034841chr16115490 5000 4815 4709 4362 3993 3767 2153 1685 1235 702 1680 ----
NM_001034850chr521228 1075 31360 1315 114 --11565
NM_001034852chr142626 133 1175 11915 --
NM_001034954chr1073131 2831 2606 759 277 253 240 ------
NM_001034955chr1073131 2831 2606 759 277 253 240 ------
NM_001034956chr1073131 2831 2606 759 277 253 240 ------
NM_001034957chr1073131 2831 2606 759 277 253 240 ------
NM_001035chr141258 825 182 84 --31187 1178 1091 --
NM_001035003chr451427 1038 575 472 461 1482 175 --
NM_001035004chr451427 1038 575 472 461 1482 175 --
NM_001035260chr1021402 277 11341 21264 344 --
NM_001035511chr131741 1661 1515 21776 647 21853 1474 22118 1454
NM_001035512chr131848 1768 1622 21883 754 21960 1581 22225 1561
NM_001035513chr131848 1768 1622 21883 754 21960 1581 22225 1561
NM_001037132chr782081 2027 1899 1879 1670 371 199 29 11987 1680 --
NM_001037133chr782081 2027 1899 1879 1670 371 199 29 11987 1680 --
NM_001037164chr781907 1614 1569 1403 786 691 544 232 --11666 --
NM_001037165chr7138763 7828 7286 6873 6520 5647 3396 3269 2910 1658 1038 559 154 --28852 6982 --
NM_001037172chr351143 1082 952 381 62 1231 11154 --
NM_001037174chr251776 599 298 230 140 12253 --1593
NM_001037317chr162667 2498 1982 1797 973 591 3992 527 298 ----
NM_001037331chr182375 113 ------
NM_001037334chr1861771 878 447 311 294 229 --11778 11652
NM_001037339chr171792 1304 1222 702 582 420 375 31785 622 569 ----
NM_001037340chr171792 1304 1222 702 582 420 375 31785 622 569 ----
NM_001037341chr171792 1304 1222 702 582 420 375 31785 622 569 ----
NM_001037341chr171792 1304 1222 702 582 420 375 31785 622 569 ----
NM_001037535chrX71507 1138 1025 249 180 165 73 11388 ----
NM_001037536chrX71507 1138 1025 249 180 165 73 11388 ----
NM_001037540chrX71507 1138 1025 249 180 165 73 11388 ----
NM_001037553chr2184906 4463 4164 4037 3965 3899 626 281 ------
NM_001037582chr421603 1327 11320 ----
NM_001037631chr21276 --1259 --
NM_001037872chr22581 526 ------
NM_001038493chr221421 967 ------
NM_001038603chr51401 --1262 --
NM_001038640chr153682 287 168 1979 ----
NM_001038707chr132336 1690 800 --11978 --
NM_001038707chr132336 1690 800 --11978 --
NM_001039091chrX41291 467 300 251 ------
NM_001039199chr20144981 4389 3957 3661 3635 3499 3429 3341 1646 1616 1294 598 402 349 33315 1708 175 53782 889 842 361 152 13977
NM_001039348chr211059 ------
NM_001039349chr211059 ------
NM_001039350chr741601 1492 546 497 ------
NM_001039372chr7--152 ----
NM_001039395chr992460 2332 2287 2272 2247 2134 949 205 85 ------
NM_001039457chr1132 ------
NM_001039459chr721045 223 ------
NM_001039538chr2103468 2819 1402 1302 1246 1157 805 664 291 192 ------
NM_001039547chr3207411 7310 6812 6671 6507 6482 6285 5829 5514 3178 2980 2357 2092 2051 1995 1476 1267 932 733 273 23221 1232 48086 7161 2488 1422 16199
NM_001039569chr262925 1303 1193 1167 491 407 22825 2171 ----
NM_001039570chr2244672 4641 1388 645 ------
NM_001039571chr2244672 4641 1388 645 ------
NM_001039573chr173462 396 345 ------
NM_001039577chr194549 4493 3858 1569 741 551 469 450 32 11204 ----
NM_001039585chr152944 2858 445 439 39 23121 3042 ----
NM_001039590chrX73833 3470 3404 2650 2639 1513 624 23886 2836 ----
NM_001039591chrX73833 3470 3404 2650 2639 1513 624 23886 2836 ----
NM_001039618chr11135974 5671 5447 5387 4877 4531 4187 4127 2308 2240 2187 1975 1171 34179 2344 844 14456 24314 341
NM_001039649chr131309 ------
NM_001039690chr1632104 1472 191 --11581 --
NM_001039693chr283739 3335 2992 2636 2504 1332 530 138 32821 1314 35 ----
NM_001039709chr2095355 4211 4125 3890 3812 1993 1967 974 878 15254 21272 1232 1688
NM_001039711chr15967 777 326 214 21 ------
NM_001039712chr15967 777 326 214 21 ------
NM_001039762chr106787 679 450 437 119 64 ------
NM_001039840chrX146036 5917 5053 4553 4103 4067 2213 1962 1663 852 517 505 372 360 24453 3686 65584 5204 4409 3924 2358 872 --
NM_001039885chr1931384 1248 1064 ----11541
NM_001039888chr13799 690 626 --1536 --
NM_001039916chr1231053 946 328 ------
NM_001039917chr1231053 946 328 ------
NM_001039918chr1231053 946 328 ------
NM_001039919chr1231053 946 328 ------
NM_001039920chr1231053 946 328 ------
NM_001039937chr13184115 3987 3976 3559 3050 2721 2569 1598 1392 1091 743 635 495 371 218 173 85 23 31381 795 152 ----
NM_001039960chr12--11463 21726 307 --
NM_001040001chr6101924 1714 1686 1546 1448 1405 1359 1307 197 22 1180 ----
NM_001040020chr721431 35 2475 383 ----
NM_001040057chr751353 1340 1028 461 284 11347 ----
NM_001040097chr72183 160 ------
NM_001040098chr72183 160 ------
NM_001040099chr72183 160 ------
NM_001040101chr43428 331 33 190 1222 --
NM_001040108chr1451210 941 848 481 269 22027 764 11147 12085
NM_001040110chr72162 38 ------
NM_001040135chr71169 1631 ----
NM_001040142chr272484 2264 2214 2065 1665 903 419 11568 125 12403
NM_001040143chr272484 2264 2214 2065 1665 903 419 11568 125 12403
NM_001040144chr1632104 1472 191 --11581 --
NM_001040146chr1632104 1472 191 --11581 --
NM_001040152chr794481 3870 3397 3352 1746 1436 1389 1346 1041 14638 ----
NM_001040153chr133911 700 274 2868 808 ----
NM_001040157chr462623 2093 1059 951 206 122 1665 ----
NM_001040158chr52475 104 ------
NM_001040159chr441486 1423 1271 1256 21210 601 ----
NM_001040179chr62954 811 2879 865 ----
NM_001040181chr321023 420 1190 133 1110
NM_001040182chr321023 420 1190 133 1110
NM_001040183chr321023 420 1190 133 1110
NM_001040199chr321023 420 1190 133 1110
NM_001040200chr321023 420 1190 133 1110
NM_001040214chr641826 616 453 197 12388 --11579
NM_001040272chr922338 834 187 ----
NM_001040284chr16105502 5188 4883 4613 4399 4393 1570 960 820 561 55311 4651 4413 1894 267 --1492
NM_001040402chr432444 2210 1974 22010 389 11137 12814
NM_001040409chr22878 284 3758 647 368 --1682
NM_001040429chr1363169 2869 2552 2506 969 31 1776 23117 696 184
NM_001040432chr31134 ------
NM_001040437chr6--191 ----
NM_001040438chr6--191 ----
NM_001040440chr52491 448 ------
NM_001040441chr1125371 5042 4515 4489 3704 1668 1553 1535 1395 814 318 255 55070 4889 3434 347 276 ----
NM_001040446chr572501 2088 986 879 620 515 343 ------
NM_001040450chr1542816 2681 2519 1068 1577 ----
NM_001040453chr1542816 2681 2519 1068 1577 ----
NM_001040458chr541552 123 104 48 1278 11838 --
NM_001040619chr1191 1501 11314 --
NM_001040665chr7174800 4685 4583 4575 4335 3994 3525 3409 3057 1875 1627 968 880 806 701 445 382 41510 1016 951 267 13367 --
NM_001040697chr11199 2616 561 ----
NM_001040708chr851071 301 269 157 112 ------
NM_001040709chr142484 2221 1880 774 ----1800
NM_001040712chr983589 3006 2550 2200 1042 719 623 115 1456 ----
NM_001040876chr451827 1653 1221 732 30 --31903 342 187 --
NM_001042355chr16145419 5183 4963 4847 4172 3841 3597 3481 1423 1329 1315 983 395 191 13960 45202 1995 1356 660 24981 4181
NM_001042357chr1081449 961 570 560 481 436 232 25 ------
NM_001042358chr1081449 961 570 560 481 436 232 25 ------
NM_001042360chr1081449 961 570 560 481 436 232 25 ------
NM_001042361chr1081480 992 601 591 512 467 263 56 ------
NM_001042363chr1081449 961 570 560 481 436 232 25 ------
NM_001042364chr1081480 992 601 591 512 467 263 56 ------
NM_001042365chr1081480 992 601 591 512 467 263 56 ------
NM_001042383chr352498 1153 438 165 152 --33449 2951 226 12839
NM_001042387chr1081480 992 601 591 512 467 263 56 ------
NM_001042388chr182898 307 ------
NM_001042389chr1081449 961 570 560 481 436 232 25 ------
NM_001042390chr1081449 961 570 560 481 436 232 25 ------
NM_001042392chr1081449 961 570 560 481 436 232 25 ------
NM_001042393chr1081480 992 601 591 512 467 263 56 ------
NM_001042395chr1081449 961 570 560 481 436 232 25 ------
NM_001042396chr1081480 992 601 591 512 467 263 56 ------
NM_001042397chr1081480 992 601 591 512 467 263 56 ------
NM_001042399chr12187 165 ----
NM_001042403chr12281 46 3809 317 119 2385 181 170
NM_001042404chr141715 788 778 195 --21996 755 --
NM_001042406chr61826 --1898 --
NM_001042412chr16145419 5183 4963 4847 4172 3841 3597 3481 1423 1329 1315 983 395 191 13960 45202 1995 1356 660 24981 4181
NM_001042413chr9103645 3469 3304 3291 3229 2602 1490 1448 1317 728 23279 623 12724 --
NM_001042414chr133295 202 60 ------
NM_001042425chr621545 526 11372 ----
NM_001042437chr2192 --2207 159 --
NM_001042440chr531869 1522 1482 ------
NM_001042441chr531869 1522 1482 ------
NM_001042442chr531869 1522 1482 ------
NM_001042443chr531869 1522 1482 ------
NM_001042444chr531869 1522 1482 ------
NM_001042445chr531869 1522 1482 ------
NM_001042446chr531869 1522 1482 ------
NM_001042453chrX21093 306 1168 ----
NM_001042459chr32263 103 2312 278 ----
NM_001042465chr1041022 998 128 53 --1435 --
NM_001042466chr1041022 998 128 53 --1435 --
NM_001042473chr1052046 2002 1658 778 530 1182 ----
NM_001042476chr161764 ------
NM_001042479chrX2676 168 21856 1741 ----
NM_001042480chrX2676 168 21856 1741 ----
NM_001042481chr1462686 2185 1993 959 744 346 41868 1803 259 168 12366 --
NM_001042486chr2021502 1463 ------
NM_001042492chr1753424 2521 2459 430 355 --23453 212 --
NM_001042493chr621911 387 11370 --1564
NM_001042494chr1553752 1419 1393 579 498 --13281 11120
NM_001042495chr1553752 1419 1393 579 498 --13281 11120
NM_001042496chr1553752 1419 1393 579 498 --13281 11120
NM_001042497chr1553752 1419 1393 579 498 --13281 11120
NM_001042506chrX51312 1169 312 261 164 --1446 --
NM_001042510chr832045 305 132 11487 --11905
NM_001042511chr832045 305 132 11487 --11905
NM_001042517chr131983 1364 1786 --
NM_001042537chrX41774 1635 588 234 31973 1861 910 ----
NM_001042543chr411566 --31540 1010 340 --
NM_001042548chr24852 824 630 312 1700 ----
NM_001042550chr91138 ------
NM_001042555chr12104769 4530 4193 4060 3558 3549 1067 972 839 70 44042 3704 1222 730 21772 1157 --
NM_001042599chr2197570 7381 7020 6786 6621 6462 5283 5239 2726 1633 1186 991 911 886 876 655 638 491 311 36977 2074 1570 46285 6141 5603 1127 22904 794
NM_001042601chr3103240 3211 3143 3122 2303 2186 716 602 511 352 11259 ----
NM_001042603chr1285340 4702 4446 3611 2000 1288 1149 84 1772 65369 3730 1970 1399 1119 456 --
NM_001042604chr3134662 4506 4104 3709 3657 3404 3340 3275 3171 1240 383 149 131 33160 877 190 --11727
NM_001042632chr2042391 2128 1755 1651 ------
NM_001042633chr2042391 2128 1755 1651 ------
NM_001042663chr161237 1114 1061 528 294 155 ------
NM_001042664chr161237 1114 1061 528 294 155 ------
NM_001042665chr161237 1114 1061 528 294 155 ------
NM_001042669chr421202 505 --11177 --
NM_001042681chr152622 1882 1867 913 814 --22171 881 --
NM_001042682chr152622 1882 1867 913 814 --22171 881 --
NM_001042682chr152622 1882 1867 913 814 --22171 881 --
NM_001042683chr631296 1259 299 --1487 --
NM_001042724chr192842 120 1718 ----
NM_001042749chrX41287 1263 633 37 --11271 --
NM_001042750chrX41287 1263 633 37 --11271 --
NM_001042751chrX41287 1263 633 37 --11271 --
NM_001042762chr721125 912 --2794 710 --
NM_001043318chr1464125 3764 3720 3621 3344 1467 --1869 --
NM_001044305chr651365 1184 1139 496 108 1195 ----
NM_001044385chr284001 3788 3683 3053 3019 2675 2513 404 13161 148 11511
NM_001044722chr592248 1874 1850 1605 1564 1523 296 141 128 1811 1674 12157
NM_001044723chr592248 1874 1850 1605 1564 1523 296 141 128 1811 1674 12157
NM_001046chr562792 2487 2468 2023 477 262 ----1436
NM_001048183chr1103564 3483 3046 1201 1110 1104 761 279 198 137 11510 ----
NM_001068chr3124 ------
NM_001071775chr1381834 1677 1412 1374 643 490 213 119 --21948 1516 --
NM_001077628chr11653 --1233 --
NM_001079874chr172122 2066 1987 1611 548 470 365 ------
NM_001083620chr432484 2412 843 22333 1886 ----
NM_001094chr17--1762 1816 --
NM_001099678chr3126251 6231 5971 5536 4770 4547 2065 1517 1195 887 845 139 36056 4344 1321 11070 11179
NM_001100108chr1147868 7505 6700 6673 6113 6087 5821 5447 5266 2760 1953 1338 1300 702 27339 3241 27478 3348 13012
NM_001106chr3209534 9219 8875 7826 7759 7263 7161 6602 6183 5952 3299 3214 2546 2455 2241 1923 1475 1005 891 726 57070 7018 6791 5910 1743 48570 7588 1619 337 --
NM_001109977chr41768 1679 --198
NM_001111chr192502 2385 1805 800 701 449 332 297 157 1645 ----
NM_001112808chr11380 193 ----
NM_001113490chrX52259 1077 340 148 52 12717 43644 3127 2232 1023 --
NM_001117chr1842320 463 456 197 22286 2147 ----
NM_001119chr441408 1249 1066 465 ------
NM_001121chr1021271 368 1177 ----
NM_001122679chr54987 969 288 141 ------
NM_001123chr104833 287 277 223 --198 --
NM_001124chr11--1540 ----
NM_001126chr121036 311 ------
NM_001128chr1693782 3681 3655 3400 2678 2620 2475 473 364 23517 1198 23092 222 --
NM_001140chr17--1161 ----
NM_001144chr1621127 178 ------
NM_001148chr451851 1675 1583 396 306 11537 ----
NM_001149chr1021284 219 1180 --11068
NM_001152chrX1168 ------
NM_001153chr27941 838 592 372 275 61 40 --1282 --
NM_001156chr102505 473 1427 1591 --
NM_001157chr102251 21 ------
NM_001159chr23315 203 163 ------
NM_001160chr1222664 1810 12808 ----
NM_001163chr91796 --1985 --
NM_001167chrX136666 6540 4622 4609 4415 4188 2381 2257 1758 957 883 847 830 34931 4732 1234 76460 6406 6356 838 571 511 202 11811
NM_001173chr14114650 4610 4301 4258 3835 3221 1234 1057 883 154 121 14186 24025 1160 --
NM_001179chr41189 ------
NM_001186chr2181261 1009 975 952 890 770 718 698 22250 1178 ----
NM_001187chr212128 117 1524 ----
NM_001198chr652347 2143 1957 1779 1560 --11595 11829
NM_001199chr8----1209 --
NM_001200chr20--2257 99 1331 --
NM_001201chr4113937 3861 3788 3384 3270 3068 2691 1201 1080 748 103 22409 1353 11394 --
NM_001204chr2257574 7331 6658 6075 5798 5643 5565 4859 4798 2501 2329 2236 2100 1897 1773 1610 1599 1529 954 888 765 678 615 593 212 12143 15811 46254 6099 3023 897
NM_001206chr952652 2583 1968 796 776 ------
NM_001219chr73812 382 230 --11902 11521
NM_001222chr1031785 762 569 --11461 --
NM_001231chr11453 --1181 --
NM_001233chr772247 2052 1968 872 672 414 239 2614 287 ----
NM_001235chr113704 672 182 ------
NM_001237chr42409 141 ------
NM_001237chr42409 141 ------
NM_001238chr19----1506 --
NM_001241chr252402 1963 714 590 132 ------
NM_001241chr252402 1963 714 590 132 ------
NM_001254chr1751081 1033 443 243 234 2824 66 11052 --
NM_001256chr1762615 2600 2413 2253 2170 113 --32805 2121 134 --
NM_001257chr1651367 558 541 173 153 --1285 --
NM_001259chr7226220 6192 5871 5803 5781 5347 5048 4588 4497 4331 4299 4190 4180 2235 1988 1415 1401 1328 1079 480 394 291 --25271 2082 --
NM_001260chr132281 239 ------
NM_001262chr11354 ----136
NM_001268chr136970 392 267 249 65 36 ------
NM_001269chr12990 956 ------
NM_001270chr57980 936 790 729 463 342 220 11081 ----
NM_001271chr1563286 3249 2947 2822 2525 203 --1245 --
NM_001280chr193251 235 155 --1109 --
NM_001282chr1732290 1808 416 1402 1908 --
NM_001284chr5------1525
NM_001288chr6----135 --
NM_001290chr41980 ------
NM_001304chr1793351 3313 2949 2943 2638 2366 972 723 462 11305 23427 238 1677
NM_001310chr1252285 2277 1236 902 90 11939 ----
NM_001313chr42994 298 --1896 --
NM_001315chr651775 1722 1661 808 31 11397 1377 --
NM_001326chr112366 80 1357 ----
NM_001329chr1011234 ------
NM_001331chr1152327 2168 1742 780 39 12435 21753 222 --
NM_001332chr521319 396 11276 ----
NM_001338chr212383 290 11101 ----
NM_001343chr571696 1241 648 566 551 172 154 11578 ----
NM_001346chr332260 1991 228 ------
NM_001351chr351659 1552 1310 481 375 1278 ----
NM_001356chrX51808 1771 1641 1544 870 ------
NM_001364chr11114609 3753 3653 3135 1181 1173 1022 925 668 421 70 44799 4792 4060 3435 23786 3095 11555
NM_001365chr17----1575 --
NM_001378chr21194 ------
NM_001385chr82392 321 2428 265 ----
NM_001386chr862340 2004 1873 1795 912 205 --1752 --
NM_001389chr211582 ------
NM_001390chr1893429 3398 3331 3325 2730 2691 1381 567 536 1408 ----
NM_001391chr1821093 152 31206 430 241 ----
NM_001396chr2162310 1825 1115 1010 888 873 ----21796 247
NM_001399chrX33845 3620 942 1743 ----
NM_001400chr131334 1008 928 51138 1050 507 500 389 ----
NM_001401chr961441 1148 1089 1016 415 281 --1495 --
NM_001406chr172705 183 --1151 --
NM_001407chr361502 1183 1150 1065 632 343 ------
NM_001408chr131344 325 222 ------
NM_001412chrX63396 3336 2841 2409 1316 295 12694 1200 --
NM_001416chr172129 106 1162 1445 --
NM_001417chr1231398 700 305 ------
NM_001418chr111692 ------
NM_001418chr111692 ------
NM_001419chr1973945 3917 3382 1170 1109 441 83 24708 4229 34610 4536 4221 --
NM_001420chr1923168 2087 ------
NM_001421chrX31597 660 52 --11266 --
NM_001422chr1121165 85 2473 27 ----
NM_001423chr1251915 1859 1576 327 208 --11548 --
NM_001427chr732084 1455 323 21982 1490 1450 --
NM_001429chr222970 402 1422 ----
NM_001430chr221506 767 31847 388 176 ----
NM_001431chr661130 1078 384 330 298 227 ------
NM_001432chr453654 2756 2655 2565 1229 --33675 3393 1354 22898 66
NM_001438chr153538 3022 1331 1083 823 13329 43685 2357 1073 191 --
NM_001444chr8--1133 ----
NM_001447chr521439 891 --1401 --
NM_001448chrX51495 1249 608 498 58 ------
NM_001449chrX41137 1112 309 62 ----1139
NM_001451chr1631259 929 426 --1969 --
NM_001452chr64681 636 458 121 ------
NM_001453chr631438 1265 461 11776 21469 224 --
NM_001463chr22643 332 ------
NM_001494chr101721 ------
NM_001497chr942274 1109 908 90 ------
NM_001498chr661287 980 562 477 425 260 ------
NM_001511chr4--1580 ----
NM_001527chr694815 3985 3367 3073 1806 1450 1348 1282 875 21038 91 1100 1896
NM_001530chr144964 752 208 146 2417 256 ----
NM_001533chr191226 --163 --
NM_001542chr152473 2099 1860 811 530 12864 21908 615 12151
NM_001546chr611233 11118 1360 --
NM_001554chr13642 252 214 ------
NM_001560chrX62595 1757 867 185 108 61 --22180 2064 1966
NM_001584chr1121146 182 --21037 52 --
NM_001587chrX5735 477 420 378 181 ------
NM_001604chr115855 769 247 223 115 ------
NM_001609chr1064267 3632 3470 2780 1678 432 74000 3903 2972 1131 965 941 737 1204 --
NM_001616chr253309 3208 3164 3148 3127 33350 990 570 12500 --
NM_001620chr111327 1771 1663 --
NM_001621chr752286 1909 1059 557 371 --32522 714 672 --
NM_001621chr752286 1909 1059 557 371 --32522 714 672 --
NM_001624chr62506 231 4625 468 401 321 ----
NM_001634chr641605 591 507 149 --1462 --
NM_001635chr7173 ------
NM_001642chr111291 11350 1888 --
NM_001650chr1873907 2870 1551 1298 1271 1082 560 23445 2955 1887 --
NM_001655chr1192124 2094 1745 1599 1496 1473 1405 1397 383 ------
NM_001656chr552083 1774 744 626 154 2591 521 ----
NM_001658chr12822 409 --2988 374 --
NM_001659chr1252487 2451 2268 2159 2026 --21737 730 --
NM_001660chr32815 800 ------
NM_001663chr1482602 2449 1765 1047 990 826 423 378 32089 1971 1864 32255 854 91 --
NM_001664chr34854 739 717 395 ----1335
NM_001668chr162116 1833 1508 923 698 654 ------
NM_001674chr1--151 1864 --
NM_001677chr16977 820 810 770 367 32 --2885 247 1403
NM_001678chr1731623 1229 492 11594 11168 --
NM_001679chr32667 52 ------
NM_001681chr122526 135 ------
NM_001682chr1262632 2496 2264 1087 783 470 ------
NM_001683chr392316 1833 1783 1669 750 640 613 344 198 --156 --
NM_001684chr1114223 3997 3570 2954 2624 1593 1420 1356 371 270 262 --2489 46 --
NM_001688chr13689 663 221 ------
NM_001690chr342487 539 465 413 ------
NM_001693chr811184 ------
NM_001695chr893834 3470 3365 1350 649 602 314 158 79 --12618 13958
NM_001701chr961464 1286 1103 471 158 104 31615 426 220 11267 --
NM_001704chr62485 386 1394 ----
NM_001706chr3--2276 71 ----
NM_001709chr1122041 2011 1408 11915 --
NM_001714chr122573 189 1430 ----
NM_001718chr61175 --11236 --
NM_001721chrX2246 53 164 ----
NM_001726chr12151 144 ------
NM_001729chr42350 124 ------
NM_001730chr13--1188 ----
NM_001730chr13--1188 ----
NM_001731chr121953 1234 ----
NM_001737chr5----1200 --
NM_001742chr71338 ------
NM_001743chr22527 486 ------
NM_001744chr52530 49 2445 41 ----
NM_001746chr5112894 2867 2227 1918 1114 1099 928 853 756 645 378 12677 22886 2202 --
NM_001748chr15840 294 284 277 77 ----11066
NM_001750chr531869 1522 1482 ------
NM_001752chr112599 526 --1131 --
NM_001753chr771686 1642 1599 678 504 214 136 41528 715 391 264 11551 --
NM_001754chr2163739 3693 3682 2696 857 729 --23652 2850 --
NM_001755chr1672300 2131 1937 1831 1588 519 428 31868 551 481 --1354
NM_001759chr1294462 2038 1786 1650 1423 1331 974 526 419 --14716 --
NM_001777chr3123913 3602 3370 2790 1469 1432 1226 943 862 677 499 366 23984 2610 13782 --
NM_001783chr192365 65 ------
NM_001788chr72657 231 2777 280 ----
NM_001794chr201246 ------
NM_001797chr161642 --1570 --
NM_001798chr1231054 858 841 --1782 --
NM_001799chr5--123 ----
NM_001801chr52543 427 131 ----
NM_001806chr1941942 997 964 94 --12771 --
NM_001810chr201229 ------
NM_001822chr24738 629 541 189 2584 495 ----
NM_001826chr11100 ----1415
NM_001830chrX93646 3598 3471 2777 1426 1335 969 921 491 23619 189 --13077
NM_001839chr12305 116 ------
NM_001845chr1351096 897 229 171 40 --1351 --
NM_001851chr61147 1613 ----
NM_001854chr131100 420 127 11242 162 --
NM_001855chr91756 ------
NM_001858chr6124887 4702 4428 4192 3507 3392 3230 3156 1751 1010 540 182 21667 574 44997 3755 497 341 --
NM_001859chr9133595 3496 3391 3041 2978 2444 1307 1079 988 980 707 545 228 ------
NM_001873chr43631 513 209 ------
NM_001875chr251055 285 223 169 120 2404 358 ----
NM_001880chr22291 79 ------
NM_001884chr51132 ------
NM_001885chr11124 ------
NM_001890chr42266 129 1370 ----
NM_001892chr581255 1240 1085 966 956 483 255 116 ------
NM_001893chr172383 358 ------
NM_001894chr2221200 1141 ------
NM_001895chr2011197 1399 1865 1981
NM_001901chr62900 63 --1986 --
NM_001903chr53706 656 200 ------
NM_001904chr32145 51 ------
NM_001923chr112479 195 ------
NM_001931chr1131193 1004 958 1466 11048 11177
NM_001935chr231031 45 23 1935 ----
NM_001936chr741601 1492 546 497 ------
NM_001938chr141890 1746 1331 683 ------
NM_001939chrX83510 3335 3076 2483 1300 764 611 289 23503 3231 11101 --
NM_001944chr1862364 2347 2300 2115 753 457 22103 322 ----
NM_001945chr551424 1375 1096 934 272 ------
NM_001946chr1221055 982 1886 ----
NM_001949chr6113217 2825 2746 2685 2094 2073 1200 879 860 831 783 22454 150 ----
NM_001950chr163729 665 490 ------
NM_001951chr83530 434 138 2515 51 1553 --
NM_001954chr64756 740 594 587 ------
NM_001957chr421776 473 22174 2127 42064 1416 419 303 11587
NM_001962chr52545 21 ------
NM_001963chr4--1606 ----
NM_001967chr32624 454 ------
NM_001968chr42850 179 1359 ----
NM_001969chr14103743 3433 3033 2990 2755 2693 2546 2539 779 757 2358 117 ----
NM_001977chr441428 676 366 344 21721 480 --1503
NM_001980chr1282221 2145 2070 1802 1546 1387 392 23 1284 1857 --
NM_001981chr152137 913 510 494 226 2955 773 ----
NM_001982chr125855 829 334 195 155 --11270 --
NM_001991chr1721593 1578 12214 12099 --
NM_001992chr541728 1536 1503 248 42114 1644 689 349 1501 --
NM_001993chr11185 21120 904 ----
NM_001995chr441357 1162 375 220 11213 ----
NM_001998chr31347 1394 ----
NM_001999chr531519 458 347 21129 238 11077 --
NM_002006chr4105196 4964 4378 3788 2109 1952 1166 1088 1063 873 24706 1317 44282 2333 1823 1513 --
NM_002009chr151521 42277 2061 763 489 ----
NM_002015chr13112291 2239 2186 2060 1286 1073 969 957 901 780 177 --21295 832 --
NM_002017chr1121161 144 ------
NM_002024chrX52096 1429 517 229 37 21419 663 2465 305 --
NM_002025chrX158066 7047 6827 6601 6030 5991 5785 3028 2892 2450 2334 1881 1457 1095 208 49182 7763 5727 1424 36166 3190 1125 --
NM_002028chr1441337 1260 363 132 ------
NM_002031chr63618 562 282 1164 ----
NM_002033chr1174060 3476 2825 2525 1631 1493 959 22909 673 1116 13597
NM_002035chr1873660 3162 2896 1487 903 365 216 --13671 23958 893
NM_002039chr41286 ----1371
NM_002040chr2193047 2983 2537 2295 2141 2061 1050 1043 170 52837 2165 1173 1116 951 ----
NM_002044chr1531453 1163 31 --11593 --
NM_002045chr31278 --1344 --
NM_002048chr941091 971 832 534 ------
NM_002051chr10165 --2912 145 --
NM_002056chr22300 181 --1777 --
NM_002062chr641102 1075 481 207 ------
NM_002063chrX2973 80 ----1806
NM_002069chr741199 1168 666 29 ----1682
NM_002073chr222342 313 --1541 11577
NM_002074chr131152 345 151 ------
NM_002076chr1253263 3134 2605 1012 554 22906 358 1720 11083
NM_002077chr972134 1988 1603 1528 801 149 41 11889 --2735 628
NM_002086chr1772109 1797 1558 1551 797 668 138 ------
NM_002089chr42234 131 1585 ----
NM_002090chr43511 445 159 1539 ----
NM_002092chr494892 4108 4102 4021 3957 3552 1023 838 682 55010 3843 3684 3290 1856 ----
NM_002094chr162328 59 ------
NM_002107chr12426 390 --1183 --
NM_002114chr6183 --1167 --
NM_002126chr1763891 2941 2717 1201 1120 556 23578 98 43216 1086 1017 130 1228
NM_002128chr1351936 1744 1015 771 707 11649 22001 536 --
NM_002129chr42436 158 1424 ----
NM_002130chr541547 1106 393 274 ------
NM_002131chr62844 293 --2944 823 --
NM_002137chr732224 1883 957 --1177 --
NM_002139chrX2627 107 --1560 --
NM_002140chr921201 1075 --1780 --
NM_002141chr72692 276 ------
NM_002146chr1751400 1161 1053 942 536 2967 342 ----
NM_002148chr21430 1449 ----
NM_002154chr51156 ------
NM_002156chr21305 ------
NM_002158chr2113692 2789 2392 2385 2324 1521 942 479 362 126 33 13016 33376 2964 848 --
NM_002163chr164886 480 296 117 1491 ----
NM_002165chr20--1272 ----
NM_002167chr12484 123 ------
NM_002182chr392794 2751 2635 2203 2072 1962 858 717 533 1462 12005 --
NM_002193chr211499 1219 ----
NM_002199chr41929 --1641 --
NM_002202chr52943 325 --1924 --
NM_002203chr583155 3014 2769 2754 1509 1491 693 445 11450 34160 4105 1516 13633
NM_002204chr1721230 997 ------
NM_002210chr283374 2592 2482 1300 992 872 667 465 13106 22315 2185 1292
NM_002211chr1041120 1051 1005 909 1761 ----
NM_002214chr7195531 5261 5216 5067 4961 4902 4833 4638 4487 4348 4221 4055 3761 2286 2216 2096 1015 971 906 65161 4690 4356 767 306 238 --13914
NM_002222chr341340 1331 1052 525 11153 ----
NM_002227chr151295 1228 1171 288 71 --1827 --
NM_002232chr131222 1107 1007 ------
NM_002233chr111379 ------
NM_002234chr12--1719 1159 --
NM_002235chr1251320 1233 569 385 210 --11247 11064
NM_002239chr211047 11094 --11078
NM_002241chr143055 2166 447 194 12228 13138 --
NM_002242chr251849 1763 1451 643 360 11977 155 --
NM_002245chr1173 1108 ----
NM_002247chr1031797 839 159 ------
NM_002250chr19----2470 31 --
NM_002253chr411376 11436 ----
NM_002254chr261783 1556 1549 813 440 78 --2846 538 --
NM_002264chr3124793 4296 3699 3158 1953 1774 1255 1048 755 677 471 423 21987 1226 23556 3088 --
NM_002265chr1711226 ------
NM_002267chr1352313 2277 607 380 149 ----11641
NM_002268chr3----11705 11446
NM_002269chr6----1402 --
NM_002270chr595254 5095 4000 3889 3599 3504 1661 1614 847 24854 4514 32183 1964 1857 15521
NM_002271chr1332104 1796 523 11669 --1841
NM_002283chr124759 626 250 239 ------
NM_002285chr253925 3382 1653 495 354 11302 11558 --
NM_002291chr71115 153 ----
NM_002293chr172742 2076 2022 1986 1042 245 85 12674 ----
NM_002294chrX2133 78 ------
NM_002296chr1111796 1713 1386 1313 1239 716 560 394 335 110 50 21372 237 ----
NM_002298chr1341037 574 514 289 --11408 --
NM_002310chr5116326 6155 5881 5144 5119 4920 4768 1710 1099 810 296 36406 1968 825 12264 15204
NM_002314chr731082 1025 155 --11018 --
NM_002332chr12--1136 ----
NM_002333chr192282 250 11173 137 --
NM_002336chr1274958 4950 4523 4476 3616 3519 768 24109 3170 24541 1055 14067
NM_002349chr271161 1037 511 471 265 111 55 21415 1323 1374 --
NM_002351chrX21681 1488 2271 26 21541 343 --
NM_002354chr21372 1400 ----
NM_002355chr122906 344 --1495 --
NM_002356chr652576 1843 677 317 136 --1877 --
NM_002359chr1753420 3337 1677 1236 846 --12911 --
NM_002360chr732483 2470 936 ------
NM_002374chr2103468 2819 1402 1302 1246 1157 805 664 291 192 ------
NM_002376chr142591 215 ------
NM_002381chr21306 1701 ----
NM_002382chr1441056 846 187 89 --1449 --
NM_002395chr631190 282 189 21120 115 3454 384 369 --
NM_002397chr551763 1704 1429 692 145 --12061 --
NM_002398chr221345 1083 ------
NM_002399chr1531463 453 444 ------
NM_002402chr741083 333 209 63 11011 --1126
NM_002408chr144702 584 316 191 1807 1324 --
NM_002409chr2223155 394 --12304 --
NM_002430chr2242135 866 713 334 12033 ----
NM_002435chr152490 400 ------
NM_002444chrX81953 1811 1546 561 292 286 266 174 11498 ----
NM_002449chr531070 401 293 ------
NM_002467chr81396 ------
NM_002479chr1162 ------
NM_002480chr1261442 1051 420 369 154 106 ----11266
NM_002481chr1187944 7651 7262 6712 6141 2960 2804 2607 1848 1619 1311 1253 1147 978 908 647 169 158 11881 32445 2405 320 17638
NM_002482chr1161 ------
NM_002485chr851667 760 323 217 52 ----11452
NM_002486chr981821 1687 1574 1568 754 507 155 104 ------
NM_002487chr152577 235 2602 594 ----
NM_002489chr7173 --1320 --
NM_002499chr1562494 2241 2231 866 555 305 ------
NM_002500chr241136 913 412 22 1406 ----
NM_002501chr1933717 1343 659 12686 11244 --
NM_002508chr161788 1636 1512 1498 388 52 11875 ----
NM_002514chr861189 1160 1118 881 298 234 1944 ----
NM_002515chr1451792 1700 1298 218 72 12040 150 1274
NM_002516chr191311 ------
NM_002519chr1141298 1229 391 104 2615 127 11312 --
NM_002522chr17113919 3793 3760 3337 3179 3118 3059 2912 2706 2647 202 ----12775
NM_002523chr721150 75 --1865 --
NM_002524chr14998 888 199 129 --3914 799 39 --
NM_002526chr641482 1159 307 41 1658 11740 --
NM_002536chrX71529 1458 1032 643 597 339 228 ------
NM_002538chr53475 400 167 1156 ----
NM_002543chr1281505 1393 1331 1324 596 547 177 73 --1246 11027
NM_002546chr81577 1653 ----
NM_002547chrX94170 4127 3678 1648 677 434 300 129 93 12784 13196 --
NM_002553chr74394 350 324 68 ------
NM_002556chr1141761 394 315 126 --2812 703 --
NM_002564chr112994 942 ------
NM_002570chr151872 11019 --1881
NM_002572chr112393 91 ------
NM_002576chr113836 206 109 --1796 --
NM_002577chr383722 3239 2853 2571 1606 1071 537 269 43018 2835 1334 293 33352 785 37 --
NM_002578chrX1421 ------
NM_002581chr9114725 4652 4149 3808 3763 3497 2077 1655 965 948 277 15663 21543 844 --
NM_002582chr1641009 949 917 705 ------
NM_002583chr122511 477 ------
NM_002586chr641577 410 355 244 --1392 1640
NM_002589chr41118 1131 ----
NM_002594chr2052281 2191 1579 916 317 ----11554
NM_002595chr1261896 1648 1614 1315 654 438 31387 725 527 ----
NM_002600chr171792 1304 1222 702 582 420 375 31785 622 569 ----
NM_002601chr22419 65 ------
NM_002605chr1531227 920 441 21177 1037 ----
NM_002608chr2221507 1240 ------
NM_002612chr762048 1817 1348 832 474 406 3704 570 23 ----
NM_002613chr16125064 4608 4523 4390 4363 3450 3403 3347 1288 737 220 135 ------
NM_002618chr22347 46 2183 37 ----
NM_002623chr201518 --1140 --
NM_002628chr341151 1136 356 259 ----11048
NM_002629chr101561 1152 2160 145 --
NM_002636chr61432 ------
NM_002639chr184883 876 225 81 11129 ----
NM_002645chr1192902 2478 2323 2220 2073 2033 1953 1236 703 33041 2360 1098 ----
NM_002647chr18--1331 ----
NM_002648chr611100 ----1409
NM_002655chr873795 3633 2131 692 333 311 177 35155 3242 237 31342 300 62 181
NM_002657chr20133893 3748 3642 3599 3128 3091 2752 1358 797 717 607 461 244 --11365 11306
NM_002660chr2011151 ------
NM_002667chr62340 97 ------
NM_002670chr321205 466 31603 1300 637 11239 --
NM_002687chr1441281 1199 442 163 ------
NM_002693chr15----1118 --
NM_002698chr191227 --22530 1167 --
NM_002703chr461659 1601 1322 600 575 370 --11935 --
NM_002709chr263185 2258 1081 521 453 89 13268 ----
NM_002710chr123447 352 59 1828 1130 --
NM_002711chr73568 350 302 ------
NM_002713chr12750 301 --1288 --
NM_002714chr63990 261 134 --188 --
NM_002715chr55902 447 415 342 269 ----1186
NM_002716chr1143676 3140 1095 502 --1996 --
NM_002717chr83225 205 30 ------
NM_002718chr3102285 2246 1985 1960 1890 1822 1721 1079 814 393 1587 ----
NM_002719chr1431530 909 584 2884 393 11664 11712
NM_002721chr9295 81 --129 --
NM_002729chr101615 ------
NM_002730chr192426 284 --21171 231 --
NM_002731chr13986 778 271 --1227 22232 319
NM_002734chr1762253 1730 1481 1415 672 79 11646 2544 155 --
NM_002736chr7152156 1948 1911 1750 1597 1576 1490 1401 845 706 588 470 428 180 91 ------
NM_002737chr17196646 6552 6121 6021 5735 5435 5263 5060 4995 4449 4394 4243 2326 1467 1121 1087 898 694 321 1796 24130 300 16074
NM_002738chr1631080 388 67 --11148 --
NM_002740chr3112820 2669 2383 2242 2165 1975 1816 905 653 627 41 ----189
NM_002744chr11295 ------
NM_002745chr2283824 3324 3219 1765 1075 946 737 677 2452 420 1110 --
NM_002747chr1851817 1478 665 229 151 --11793 --
NM_002748chr1541068 761 381 80 3939 854 180 ----
NM_002750chr10----1197 --
NM_002755chr152157 57 ----1854
NM_002758chr171379 ----1429
NM_002763chr13556 462 161 ------
NM_002765chrX41291 467 300 251 ------
NM_002778chr1041022 998 128 53 --1435 --
NM_002786chr112213 80 ------
NM_002806chr141254 ------
NM_002815chr17----199 --
NM_002822chr1241155 133 127 110 21834 1821 1335 --
NM_002825chr71587 ------
NM_002827chr2061473 1465 721 712 447 191 --31829 232 207 --
NM_002828chr182999 982 1933 1620 1717
NM_002829chr931209 857 842 1135 ----
NM_002830chr2--2148 90 ----
NM_002833chr1511531 ------
NM_002834chr1273883 3815 2761 1243 1146 511 164 12562 14112 --
NM_002837chr12123847 3635 3583 3479 3383 3347 3053 2925 1224 1017 947 901 24570 4347 --14406
NM_002839chr983589 3006 2550 2200 1042 719 623 115 1456 ----
NM_002841chr32571 104 ----1147
NM_002843chr1153434 1339 785 698 241 22357 1020 1730 --
NM_002844chr63901 362 348 ------
NM_002847chr751566 1226 1102 258 240 --1365 --
NM_002848chr1271279 1231 1222 938 518 200 85 21127 1103 11016 --
NM_002849chr121816 1757 1921 --
NM_002851chr71721 ------
NM_002857chr182485 2133 2014 1965 1882 833 292 199 ----11940
NM_002858chr131328 1206 430 ------
NM_002863chr14152 ------
NM_002868chr1272323 2241 2157 1912 907 269 151 1971 1337 --
NM_002869chr1161785 1778 530 403 274 263 ----1374
NM_002873chr54460 413 43 29 1400 ----
NM_002874chr951739 1630 1604 839 709 ------
NM_002880chr31199 --161 --
NM_002882chr22198 ------
NM_002886chr3135163 4499 4477 4414 4344 4247 3890 3492 1849 1469 1271 1128 868 24657 1444 25157 100 --
NM_002890chr53919 101 57 ----1782
NM_002892chr1451652 1176 394 242 121 11572 21606 611 --
NM_002893chrX3332 279 139 ------
NM_002894chr182184 178 1212 ----
NM_002895chr202962 32 --1673 --
NM_002902chr153652 436 61 ------
NM_002906chr1192204 2050 1919 1694 1635 1560 744 424 247 31986 362 340 22168 1629 11683
NM_002912chr64927 734 676 181 1710 ----
NM_002922chr1----1648 --
NM_002923chr12648 627 ------
NM_002938chr431570 1534 1373 11448 2644 76 11752
NM_002940chr451827 1653 1221 732 30 --31903 342 187 --
NM_002941chr321170 324 41328 1138 482 148 ----
NM_002942chr321144 917 --11363 --
NM_002945chr172764 726 ------
NM_002953chr13672 543 285 ------
NM_002955chr651965 1753 670 538 231 ------
NM_002956chr122453 349 --1446 11424
NM_002958chr33264 196 52 ------
NM_002959chr161774 1473 1255 562 341 189 1225 ----
NM_002968chr1651108 1006 881 752 440 ------
NM_002973chr122535 155 ------
NM_002977chr242367 1355 1201 1065 ------
NM_002988chr171174 ------
NM_002994chr451921 712 461 190 156 1558 11870 --
NM_002995chr12151 129 150 ----
NM_002996chr1611750 --11978 --
NM_002997chr221207 50 --1472 --
NM_002998chr861963 1884 1839 1814 1699 376 31982 1916 118 1548 1582
NM_003001chr131848 1768 1622 21883 754 21960 1581 22225 1561
NM_003010chr1751983 1796 1500 750 498 1958 ----
NM_003011chr93644 569 231 --21516 469 --
NM_003013chr43616 594 54 3682 533 290 ----
NM_003016chr1732023 1272 273 ------
NM_003017chr62373 106 21151 223 11091 11261
NM_003020chr151452 ------
NM_003022chrX21309 1222 11178 ----
NM_003026chr941131 872 833 309 --21097 962 --
NM_003034chr12207921 7028 6894 6763 6690 6529 6220 5237 3233 3209 2853 2644 2132 2058 1864 1629 1511 1079 790 152 47602 7064 2215 205 1718 --
NM_003036chr14977 878 347 288 ------
NM_003042chr351710 615 452 289 64 12188 ----
NM_003043chr3104031 3908 3799 3367 1637 1625 1380 404 369 361 --1757 --
NM_003045chr1394978 4528 3057 1744 1536 1482 1429 1358 257 24992 4884 23679 3127 --
NM_003047chr11215 ------
NM_003048chr262817 2786 2535 2190 1098 720 12455 12047 --
NM_003051chr181611 1592 1526 1394 1299 1256 753 459 --1334 --
NM_003068chr8181 1719 ----
NM_003069chrX2564 29 1504 --174
NM_003070chr91536 ----1545
NM_003071chr332025 344 244 ----1647
NM_003074chr352311 1996 1868 1468 170 --1332 --
NM_003075chr122335 300 ------
NM_003079chr174848 716 135 33 ------
NM_003081chr2061184 974 812 263 256 161 ------
NM_003092chr201325 178 ----
NM_003095chr121375 --1352 --
NM_003096chr2186 ------
NM_003100chr51396 1175 ----
NM_003106chr311054 --1840 --
NM_003107chr632224 2105 1682 ----11610
NM_003108chr2156807 6463 6347 5721 5596 5423 5066 5037 5001 1838 1424 917 825 782 248 --26566 6557 15650
NM_003110chr1721062 883 ------
NM_003111chr251069 943 510 210 151 ------
NM_003112chr773247 2866 2375 989 654 646 368 12241 12632 23075 1072
NM_003115chr11187 ------
NM_003128chr272603 2576 1775 1738 560 544 408 1177 12592 --
NM_003131chr642306 2202 225 45 ------
NM_003133chr12200 125 31029 151 85 2836 382 --
NM_003137chr662197 1987 1612 1391 519 65 1824 21802 1557 1588
NM_003142chr2192 129 ----
NM_003144chr681930 1878 1678 1465 468 338 175 110 ------
NM_003149chr321679 1424 ------
NM_003150chr1752180 629 454 164 135 ----12388
NM_003154chr43296 265 197 --1104 --
NM_003155chr842680 2558 1977 883 22550 45 12161 --
NM_003156chr1131047 943 251 --21143 1036 --
NM_003157chr33947 758 726 ------
NM_003161chr1753479 3345 2656 1218 794 --12262 --
NM_003162chr21909 1852 ----
NM_003168chr1711061 2154 146 2928 839 --
NM_003174chr102845 743 ------
NM_003176chr11226 ------
NM_003176chr11226 ------
NM_003178chr341945 601 494 201 ------
NM_003179chrX----11336 --
NM_003182chr7--1529 ----
NM_003182chr7--1529 ----
NM_003184chr821108 449 ------
NM_003185chr2031287 1079 339 --11237 --
NM_003188chr64690 235 138 22 ------
NM_003189chr193262 3213 2934 2491 1166 1099 470 433 225 --12263 --
NM_003193chr11160 ------
NM_003199chr1895500 5120 5094 5038 4672 4613 2147 1465 46 14130 35294 4577 103 --
NM_003200chr192376 325 12408 134 --
NM_003202chr541899 1591 1430 58 --11302 11748
NM_003203chr232303 904 661 21782 1675 1776 --
NM_003204chr1741215 1183 613 211 ------
NM_003206chr61386 1140 1424 --
NM_003211chr121285 ------
NM_003216chr2233077 2496 438 --11190 --
NM_003217chr1231579 715 122 --31902 1854 322 --
NM_003220chr621545 526 11372 ----
NM_003221chr6103472 3422 3199 3193 2858 1628 1480 977 655 252 --13536 --
NM_003223chr162861 302 ------
NM_003234chr382289 2090 2068 1699 1584 708 376 202 11750 ----
NM_003236chr262549 2529 2342 2298 1015 111 --11123 --
NM_003238chr1----1234 --
NM_003242chr352177 2060 1851 1718 999 21933 275 1809 --
NM_003244chr18----1398 --
NM_003246chr1582004 1470 1457 1357 539 364 268 93 --11951 12015
NM_003247chr641992 1677 1670 1607 --1425 --
NM_003253chr2141666 1308 1241 167 11392 ----
NM_003255chr1732321 1967 376 ------
NM_003257chr1541173 1137 563 441 1407 1970 --
NM_003259chr19----1127 --
NM_003262chr3134338 4322 3975 3652 1640 1605 1588 987 702 405 272 249 215 74361 4159 1995 1524 1423 756 157 ----
NM_003264chr42710 510 ------
NM_003269chr631185 1176 1157 11103 ----
NM_003272chr12245 83 ------
NM_003274chr2162926 2701 2118 350 237 27 23013 48 22900 2660 --
NM_003275chr921474 954 1409 ----
NM_003286chr2051094 1035 861 449 74 --1782 --
NM_003290chr196784 762 339 307 288 99 ------
NM_003291chr132621 77 ------
NM_003298chr386028 5775 2029 1302 953 743 421 111 76175 5961 5136 4871 1928 1847 1346 14248 --
NM_003304chr361594 1374 1024 658 614 584 1635 ----
NM_003305chr4--1177 ----
NM_003317chr143721 675 45 ------
NM_003318chr61230 1242 ----
NM_003319chr22618 249 2632 265 ----
NM_003320chr1133485 2740 1324 14402 13988 --
NM_003334chrX172 ------
NM_003336chrX41132 1082 989 409 2296 90 ----
NM_003337chr581505 1393 1367 674 441 304 289 172 ----11449
NM_003338chr1061779 1592 1495 478 202 110 31895 1233 411 --1127
NM_003339chr531337 399 77 3996 533 461 ----
NM_003340chr411361 ------
NM_003341chr31655 --1532 --
NM_003342chr1763121 915 520 476 210 29 --13048 12376
NM_003344chr72622 216 --1597 --
NM_003345chr162493 66 ------
NM_003347chr2231833 406 247 --1381 --
NM_003348chr1251662 1555 1109 1082 30 --2686 619 --
NM_003349chr2041333 1072 181 63 ------
NM_003350chr82839 756 --11055 --
NM_003352chr22694 272 ------
NM_003368chr13527 511 184 ------
NM_003369chr1142686 2578 2521 2188 ----12594
NM_003370chr194496 133 74 25 --1680 --
NM_003372chrX2354 320 ----2374 129
NM_003373chr1021692 182 11789 ----
NM_003374chr51301 1766 2780 529 --
NM_003376chr631896 584 183 ----1268
NM_003376chr631896 584 183 ----1268
NM_003380chr101226 ------
NM_003383chr94576 392 194 166 ------
NM_003387chr262873 2623 2460 2080 1103 732 12576 ----
NM_003390chr1121008 87 ------
NM_003392chr384350 3892 1742 1164 641 548 348 42 24368 4080 24277 127 --
NM_003400chr22856 234 --1260 --
NM_003403chr142702 606 ----1695
NM_003404chr2031643 1253 555 --1765 --
NM_003406chr861819 1388 1306 1283 273 54 31797 652 417 --21850 564
NM_003407chr191686 ------
NM_003409chr1841477 1433 1101 23 --1317 --
NM_003410chrX92917 1012 786 605 545 525 393 233 159 22583 58 ----
NM_003411chrY61492 1346 557 363 353 54 1149 1136 --
NM_003412chr352787 827 774 591 195 2956 694 12717 --
NM_003413chrX51960 1673 1416 217 47 1300 1240 --
NM_003418chr32754 714 ------
NM_003427chr61473 --1663 --
NM_003439chr7103578 2891 2690 2439 2413 2277 1405 1225 393 26 --1414 --
NM_003442chr113845 158 121 1145 ----
NM_003445chr197829 698 645 592 539 136 107 ------
NM_003453chr13--1525 ----
NM_003454chr1631369 536 289 ------
NM_003458chr333274 3253 918 ------
NM_003463chr621345 616 32996 2244 500 1644 --
NM_003466chr242394 1736 848 561 21920 1637 ----
NM_003468chr273345 2961 2833 1442 353 285 78 24008 3718 ----
NM_003471chr392162 2108 1843 1725 911 877 741 608 91 1890 ----
NM_003473chr103988 761 213 1835 1362 --
NM_003474chr1042132 1636 247 175 12202 --12316
NM_003477chr112746 619 --1244 --
NM_003478chr1122865 1173 --12200 --
NM_003482chr1211805 12798 11115 --
NM_003483chr12112847 2712 2551 2486 1818 1107 815 792 778 660 75 --2536 104 --
NM_003488chr17----1647 --
NM_003489chr21133072 2520 2476 2126 1360 1260 949 643 521 515 393 333 119 1356 53345 3191 3162 2272 710 1729
NM_003496chr72729 607 --1804 --
NM_003498chr16102302 2235 2218 2108 1090 1038 914 799 661 256 --22436 897 --
NM_003503chr131167 1121 56 1119 ----
NM_003505chr751615 1362 559 372 255 31956 1631 1372 ----
NM_003506chr85960 930 870 485 330 21284 1093 ----
NM_003507chr261987 1981 1755 1556 754 702 11737 31948 1316 746 12028
NM_003557chr121559 96 --21588 582 --
NM_003559chr1733559 3104 252 --23858 1575 --
NM_003566chr12153308 3282 3237 2873 2602 2214 2131 1120 992 781 555 486 404 215 205 12321 12753 12638
NM_003567chr1------1309
NM_003569chr63569 517 119 ------
NM_003574chr1874038 1914 1211 1177 977 669 74 34082 2263 1450 55738 4690 3689 1010 105 15064
NM_003575chr731264 495 466 1460 21460 1411 --
NM_003576chr13102834 2791 2682 2370 2294 1831 1120 589 450 245 1228 ----
NM_003580chr83464 382 50 ------
NM_003581chr22948 153 1807 ----
NM_003583chr12123786 3413 3152 3087 2854 2721 1253 1118 1019 959 204 158 23345 1295 13281 --
NM_003589chr1351434 1108 1055 390 74 11080 ----
NM_003590chr293588 3480 2914 1620 1614 1265 928 556 393 ------
NM_003591chr10149 ------
NM_003592chr73412 393 344 ------
NM_003595chr221385 1522 ----
NM_003597chr262002 1972 1948 1751 432 168 12154 ----
NM_003601chr41156 ------
NM_003603chr461914 1608 679 439 360 222 1527 ----
NM_003607chr194356 4124 3618 3490 3241 1571 944 863 59 44342 4061 2997 268 --13838
NM_003612chr152634 101 ------
NM_003615chr3144036 3543 3310 2648 2485 2459 1339 1262 1140 999 976 693 399 342 21236 955 1289 --
NM_003618chr251181 1123 978 302 111 ------
NM_003622chr1252177 973 813 467 48 32139 1707 1666 12242 --
NM_003626chr1161396 1129 1070 252 74 28 --21335 1095 --
NM_003628chr22626 511 --1705 --
NM_003629chr153166 2891 2856 2296 37 ----13360
NM_003630chr62728 41 ------
NM_003631chr102944 783 ------
NM_003632chr171598 ------
NM_003633chr5102535 2357 2237 2203 1866 939 762 593 375 73 11772 ----
NM_003642chr2195 ------
NM_003651chr122524 427 ------
NM_003659chr221239 983 1217 ----
NM_003663chr383480 3407 3348 3308 904 813 405 75 3980 832 745 --1595
NM_003664chr52439 179 ------
NM_003670chr32422 45 ------
NM_003672chr11226 11797 ----
NM_003677chr1272247 2221 2114 2001 1610 797 294 ------
NM_003679chr183140 2802 2760 2458 2396 763 409 268 31077 524 179 ----
NM_003692chr95708 379 313 284 104 ----1693
NM_003701chr132432 50 ------
NM_003702chr83806 525 189 --1779 --
NM_003704chr4----1632 --
NM_003705chr23844 666 596 ------
NM_003709chr21116 ------
NM_003711chr51246 ------
NM_003713chr11696 --11677 --
NM_003714chr562965 2642 2411 1140 941 722 --22271 46 --
NM_003716chr31903 ----1135
NM_003718chr72513 30 ------
NM_003722chr362672 2640 2132 1875 1773 613 --1441 11677
NM_003737chr111415 ------
NM_003743chr232164 1597 382 --11866 --
NM_003744chr1421267 1261 ------
NM_003749chr1342147 2061 1687 1673 11766 1735 --
NM_003750chr101334 1760 1203 --
NM_003758chr151383 ------
NM_003758chr151383 ------
NM_003759chr494024 4004 3529 2656 1561 1273 1265 857 586 1691 23972 1099 --
NM_003762chr12926 132 ------
NM_003763chr2042038 1026 982 723 ----1965
NM_003764chr63660 608 562 ------
NM_003766chr173501 495 169 ----1141
NM_003768chr141639 365 306 101 ----1251
NM_003772chr112333 242 --11228 --
NM_003774chr12102993 2731 2354 2135 2070 1316 1302 769 661 144 --1383 --
NM_003783chr141210 955 886 823 31040 383 364 ----
NM_003787chr1851450 1394 537 531 59 21239 1139 --1204
NM_003794chr31965 ------
NM_003796chr192457 114 3444 433 182 ----
NM_003799chr18194239 4196 4121 3651 3619 2903 2850 1558 1319 1123 1009 941 908 863 799 562 432 391 252 1611 --13689
NM_003800chr642220 2102 1978 813 22020 570 2615 65 --
NM_003822chr11966 ----1670
NM_003825chr1531254 980 35 11007 ----
NM_003829chr931205 204 185 11152 --11111
NM_003831chr1811638 11855 11335 --
NM_003848chr33632 392 222 --2720 39 --
NM_003860chr112304 283 ------
NM_003861chr1452495 2308 2182 1852 407 11940 ----
NM_003867chr8----1552 --
NM_003872chr231215 596 66 --1430 22357 666
NM_003873chr1012569 12316 ----
NM_003877chr122913 187 ------
NM_003884chr361705 666 409 354 193 126 --1381 --
NM_003885chr1752562 2208 2090 167 42 --32413 2115 238 --
NM_003887chr272343 2199 2044 1504 1437 873 547 ------
NM_003888chr1541527 1105 520 377 ------
NM_003895chr2131527 769 744 2536 263 ----
NM_003896chr2192 --2207 159 --
NM_003899chr1342479 2330 2304 1743 --1357 --
NM_003901chr1082705 2623 2437 1822 980 851 834 264 ----12400
NM_003902chr14585 539 311 296 ------
NM_003908chr2031101 1065 923 --21337 437 1187
NM_003909chr883025 2749 2727 1015 1006 965 295 83 21093 830 21038 678 --
NM_003913chr694287 4217 3402 1574 1186 955 814 777 344 24307 3273 22992 1305 13617
NM_003916chrX61367 1332 1144 1091 917 127 1936 ----
NM_003919chr71192 ------
NM_003922chr154305 284 72 49 ------
NM_003927chr1811059 2972 418 ----
NM_003931chr61562 1697 ----
NM_003934chr92508 190 11284 ----
NM_003939chr1053502 2910 2801 2693 432 ------
NM_003941chr762456 1729 1718 928 915 237 11890 2361 55 --
NM_003947chr331353 998 980 ------
NM_003953chr162260 961 709 539 495 262 1626 1511 --
NM_003958chr632874 1582 152 12676 33890 3356 3097 --
NM_003966chr5157858 7726 7688 7170 6823 6678 6012 5711 4953 4894 4788 4763 2013 857 386 66322 6146 2616 2085 2032 1025 25461 2289 --
NM_003968chr33190 78 45 ------
NM_003971chr172526 121 1516 ----
NM_003972chr101318 1347 ----
NM_003980chr641101 1066 575 122 1225 --11140
NM_003983chr1684323 4295 4247 3730 3285 3169 1113 448 1748 13451 --
NM_003994chr12124318 4106 3824 3388 3347 3013 2821 1115 939 671 332 28 44394 3831 3616 3512 14117 --
NM_003998chr44677 595 441 193 1631 --1455
NM_004006chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004007chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004009chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004010chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004011chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004012chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004013chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004014chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004015chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004016chrX62512 2044 1914 1858 273 253 32291 2121 833 1673 11645
NM_004017chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004018chrX62512 2044 1914 1858 273 253 32291 2121 833 1673 11645
NM_004019chrX4433 393 321 174 --1162 --
NM_004020chrX62598 2130 2000 1944 359 339 32377 2207 919 1759 11731
NM_004021chrX62512 2044 1914 1858 273 253 32291 2121 833 1673 11645
NM_004022chrX62512 2044 1914 1858 273 253 32291 2121 833 1673 11645
NM_004023chrX62512 2044 1914 1858 273 253 32291 2121 833 1673 11645
NM_004024chr1191 1410 11223 --
NM_004028chr1873907 2870 1551 1298 1271 1082 560 23445 2955 1887 --
NM_004034chr102505 473 1427 1591 --
NM_004039chr151308 2294 139 ----
NM_004040chr21955 --1321 --
NM_004047chr1132 ------
NM_004050chr1452596 2565 2394 2388 1058 --12430 --
NM_004055chr1182160 2119 1790 1608 550 411 328 282 ------
NM_004056chr82834 776 2820 427 1874 --
NM_004067chr761530 1126 518 376 370 81 ------
NM_004068chr31423 ------
NM_004071chr22276 103 --1265 --
NM_004077chr1241179 1145 356 63 ------
NM_004079chr172704 2416 875 656 460 313 45 --11946 --
NM_004080chr721317 81 ------
NM_004081chrY2579 474 2380 57 ----
NM_004085chrX1793 ------
NM_004087chr372029 1754 1652 1382 664 568 518 --2208 42 --
NM_004089chrX21190 424 --11197 --
NM_004093chr1332426 2069 831 22114 1148 12011 --
NM_004094chr1472926 1934 806 742 283 209 200 1462 42596 2486 2348 2214 --
NM_004099chr932119 2015 1809 --1843 --
NM_004100chr611788 1217 128 --
NM_004103chr82875 728 --1126 --
NM_004105chr211059 ------
NM_004111chr112229 187 ------
NM_004112chr1751653 1633 505 398 250 ------
NM_004113chr351650 734 585 66 58 21728 352 ----
NM_004114chrX31048 806 276 1219 ----
NM_004116chr23437 405 317 ------
NM_004117chr652208 1620 1457 591 499 ------
NM_004124chr1483239 3182 2720 2514 2183 871 578 407 32791 1391 734 1228 --
NM_004133chr872518 2316 2105 1919 1659 612 76 22583 949 ----
NM_004134chr52597 229 ------
NM_004136chr1573118 3098 2879 2515 1009 965 107 --22547 282 --
NM_004137chr53447 73 26 ------
NM_004156chr8--1611 ----
NM_004157chr34911 871 562 227 1717 1197 --
NM_004161chr251636 1431 1229 402 195 11334 1370 --
NM_004162chr32932 322 21142 503 ----
NM_004171chr11129493 8064 7830 7385 6880 6051 6023 3716 3219 2821 1829 221 23298 996 36675 6334 3096 --
NM_004172chr552023 1927 1786 1384 21 1354 ----
NM_004176chr17----2474 43 --
NM_004187chrX31465 1411 1165 --11004 --
NM_004193chr103356 120 59 ------
NM_004200chr111222 --22222 345 163
NM_004208chrX170 ------
NM_004225chr82963 258 --11208 --
NM_004227chr742756 2579 2291 579 1867 ----
NM_004229chrX61872 1560 1496 1382 551 387 --1447 --
NM_004232chr18153848 3752 3719 3484 3298 2927 2848 2742 2483 1523 1251 929 862 593 29 1511 22462 423 11559
NM_004235chr94829 637 553 58 ------
NM_004236chr152562 460 ------
NM_004240chr19--179 1255 --
NM_004241chr103796 625 590 ------
NM_004242chr6--1141 ----
NM_004244chr122175 97 1433 ----
NM_004249chr41107 ------
NM_004255chr15145 ------
NM_004268chr113840 375 144 1160 ----
NM_004272chr51675 1735 11524 1723
NM_004273chr1045047 4433 1909 1103 ------
NM_004274chr1462614 2097 1262 767 693 687 ----22186 580
NM_004277chr651646 575 542 471 244 21433 142 21536 273 11413
NM_004279chr792116 1550 942 921 722 597 316 208 116 1428 ----
NM_004286chr222897 247 1603 1145 --
NM_004293chr9133788 3673 3507 2973 2598 2494 2456 2425 2379 2354 1180 468 143 2783 246 13161 23721 824
NM_004296chr1444056 1391 1209 338 ------
NM_004301chr32126 105 ------
NM_004302chr1222846 473 22856 2819 1535 --
NM_004311chr1052752 2233 2217 2127 196 ------
NM_004323chr982164 2084 2062 999 973 830 496 112 --1886 --
NM_004326chr1--1496 1267 --
NM_004329chr101565 11046 ----
NM_004330chr15--3972 770 262 ----
NM_004331chr842689 2635 2387 873 31986 213 177 1596 --
NM_004338chr1896979 6865 6345 5516 5320 4933 4495 4404 442 46614 5378 5307 742 ----
NM_004341chr21232 ------
NM_004342chr762312 2219 1942 552 481 464 2674 417 ----
NM_004343chr192488 99 ------
NM_004346chr461018 545 504 494 363 84 1115 11544 --
NM_004349chr81919 2972 497 ----
NM_004354chr42824 297 5859 705 343 229 214 1256 --
NM_004359chr19------1530
NM_004360chr1632009 1832 349 --1778 1160
NM_004364chr1911144 1356 --11030
NM_004365chr52309 292 ------
NM_004370chr662197 1585 1551 576 484 443 ----1340
NM_004374chr81136 ------
NM_004379chr241546 1233 704 194 31394 1309 80 11376 --
NM_004380chr1632655 1661 1037 ----11842
NM_004384chr592248 1874 1850 1605 1564 1523 296 141 128 1811 1674 12157
NM_004385chr54689 491 275 126 1153 ----
NM_004386chr1931901 1649 1502 22301 594 --11511
NM_004388chr13423 90 69 ------
NM_004389chr21723 --169 --
NM_004392chr1331970 632 581 --21031 343 12325
NM_004393chr341702 1608 795 265 --11563 --
NM_004397chr1193697 3594 3529 3429 3384 1703 1159 198 135 --21592 666 --
NM_004404chr262046 1949 1535 487 185 39 1120 ----
NM_004405chr22678 42 ------
NM_004408chr91515 ------
NM_004411chr7--1715 1274 --
NM_004414chr2111304 ------
NM_004415chr6--1644 --157
NM_004423chr372554 2238 1762 1736 1666 400 82 --1318 12606
NM_004426chr1271975 1767 1646 1393 512 240 192 ----1209
NM_004429chrX61379 1198 1154 540 409 390 ------
NM_004430chr862696 2655 2141 2097 767 224 11832 41878 1847 266 26 --
NM_004431chr12786 590 ------
NM_004432chr9102414 2048 1575 1503 890 831 730 491 124 24 12256 ----
NM_004436chr1--1562 ----
NM_004437chr173328 3204 2294 1244 866 839 317 --13256 --
NM_004438chr272944 2339 2278 447 360 236 76 21306 58 12217 --
NM_004440chr621962 782 11871 --1606
NM_004441chr321232 167 --1382 --
NM_004444chr71103 --143 --
NM_004446chr1138 ------
NM_004447chr12192 1235 --1845
NM_004448chr173593 487 101 --1585 --
NM_004449chr2131473 1403 1084 ----1422
NM_004450chr141258 --1102 1298
NM_004454chr322236 722 11700 ----
NM_004456chr71231 ------
NM_004457chr231391 1370 196 1217 1134 --
NM_004458chrX72570 2137 1822 1058 841 748 478 22202 168 ----
NM_004459chr1731796 1681 418 11852 ----
NM_004464chr484248 4205 3342 3036 584 566 466 353 41369 943 640 503 13390 13606
NM_004469chrX134 ----1105
NM_004472chr52665 470 --1123 --
NM_004480chr14161 --1265 --
NM_004481chr142659 2595 952 271 --1422 12605
NM_004482chr24708 639 616 124 ------
NM_004485chr194374 4359 4180 3493 3347 1460 408 187 172 ------
NM_004487chr331057 386 97 --1924 --
NM_004491chr1952843 1236 893 624 222 11523 ----
NM_004496chr1431099 935 134 1176 --11055
NM_004500chr1441708 1584 1446 1321 --21901 177 --
NM_004501chr1124143 3582 3533 3507 3407 3381 930 768 736 724 354 170 43706 1542 1062 258 ----
NM_004503chr12--1582 ----
NM_004504chr262820 2754 2668 2357 1993 1163 22997 433 22765 386 12914
NM_004506chr6179 --1253 --
NM_004514chr1762865 2341 930 924 681 481 12817 ----
NM_004516chr19--2369 340 ----
NM_004519chr8157 ------
NM_004520chr56754 588 568 249 219 76 ------
NM_004525chr231490 1313 39 191 1460 --
NM_004529chr921391 1120 --1549 --
NM_004535chr2021464 1179 --11483 --
NM_004537chr122474 391 --21492 1323 --
NM_004540chr213643 591 247 ------
NM_004566chr1062256 1013 814 788 33 27 --22036 1594 --
NM_004569chr143643 625 284 --1670 1216
NM_004571chr2173235 3096 2688 2143 1330 345 104 31022 875 52 1320 --
NM_004575chr441149 1042 399 76 --11124 --
NM_004576chr51395 ------
NM_004578chr12823 247 1934 ----
NM_004583chr172255 221 --1283 --
NM_004586chrX155075 5041 4545 4450 4430 4043 3945 3659 3375 1929 1829 1517 842 822 449 35302 4104 166 24369 4145 --
NM_004593chr31872 --1137 --
NM_004598chr5133348 3015 2719 2674 2616 2593 2498 2455 2442 2176 934 480 49 22086 606 22938 2339 --
NM_004600chr131024 955 68 ------
NM_004602chr201928 ------
NM_004607chr5--1196 --151
NM_004612chr9104338 4040 3448 3206 1755 1473 1324 955 655 598 2995 932 11084 --
NM_004615chrX1783 --1207 --
NM_004620chr112484 136 ------
NM_004622chr262183 1835 1619 1495 651 156 1111 ----
NM_004627chr213668 565 290 ------
NM_004631chr131252 489 229 11275 ----
NM_004634chr31563 ------
NM_004635chr321235 799 --1764 --
NM_004640chr61149 ------
NM_004642chr122595 129 1194 ----
NM_004646chr1941096 443 382 307 ------
NM_004650chrX101901 1703 1670 1579 1266 1245 1209 1201 317 230 1174 1507 --
NM_004654chrY31085 1037 558 ----11207
NM_004655chr1741304 1295 1009 86 ------
NM_004660chrY21738 1703 --1337 --
NM_004663chr1581446 1070 600 311 259 165 86 42 --21525 377 11469
NM_004664chr12121 ------
NM_004666chr641297 1283 439 365 --1345 11018
NM_004685chr1372804 2685 2535 2227 2214 1194 391 32986 1960 172 1679 --
NM_004687chr1721899 662 11770 11469 --
NM_004689chr141351 ----1331
NM_004694chr172702 158 2632 118 1103 --
NM_004696chr12835 792 ------
NM_004703chr1762521 2234 945 895 720 32 11922 --1539
NM_004705chr112309 73 1274 ----
NM_004709chrX51521 1232 1141 363 103 11707 --11276
NM_004713chr142549 258 ------
NM_004715chr181474 --1196 --
NM_004717chr731569 530 524 --11335 21376 1164
NM_004718chr21105 1600 1449 --
NM_004719chr1282708 2514 2356 2190 2135 2124 1757 806 12170 ----
NM_004721chr32304 92 1297 ----
NM_004723chr12867 154 ------
NM_004726chrX64941 4394 1683 396 156 78 44372 2311 2209 1349 31308 817 579 15378
NM_004730chr581878 1567 1438 576 524 460 270 180 21448 356 1235 --
NM_004731chr1241530 1423 395 61 --31681 1513 1431 1603
NM_004734chr1333112 2812 2276 13141 ----
NM_004736chr121399 117 22156 1471 1538 --
NM_004738chr2032407 635 606 1297 ----
NM_004741chr103323 251 47 --1614 --
NM_004744chr463768 3582 1263 1053 650 398 23422 579 --1732
NM_004745chr8146832 6755 6503 6196 6064 5456 4315 2782 2741 1964 1752 1548 875 337 22073 1574 56165 6103 5732 5677 39 --
NM_004747chr1031596 616 418 21277 1249 ----
NM_004748chr15114255 3716 3461 1335 1303 946 606 415 326 169 24 23699 1350 2549 234 11044
NM_004755chr1441139 927 841 830 1755 1878 1849
NM_004756chr1971425 1334 1094 1068 974 321 225 ------
NM_004757chr43532 96 69 ------
NM_004760chr772096 1990 810 767 431 307 110 --1424 11917
NM_004762chr1721621 1273 --11582 --
NM_004768chr151096 949 928 462 338 1908 ----
NM_004770chr81193 ------
NM_004772chr521152 1090 ------
NM_004773chr171253 ------
NM_004774chr17103091 3076 2838 2786 1230 1209 1067 1032 893 514 1378 1353 --
NM_004775chr1882225 2120 2019 1852 1786 919 441 233 ------
NM_004776chr20103311 3257 3221 3039 2700 1119 774 702 598 507 ------
NM_004779chr52885 537 11222 21163 910 --
NM_004781chr131489 594 196 1352 1487 --
NM_004781chr131489 594 196 1352 1487 --
NM_004788chr1132374 1041 374 32482 1725 799 --1901
NM_004789chr93440 356 338 1110 ----
NM_004791chr13--2765 706 --1572
NM_004795chr135424 351 125 66 29 21861 1448 ----
NM_004796chr1442414 2212 1598 308 ------
NM_004798chr2053220 2976 2232 1322 1225 21291 795 ----
NM_004801chr241050 971 416 77 147 ----
NM_004805chr231441 1095 361 --1902 --
NM_004808chr1093370 2966 2940 2852 2255 2070 750 632 442 --23310 2387 --
NM_004814chr14365 165 154 31 ------
NM_004815chr1104810 4267 4094 3968 3909 3663 3560 1134 494 300 2920 609 21909 1885 --
NM_004816chr93646 586 57 ------
NM_004817chr91529 ------
NM_004822chr1723403 1598 ------
NM_004824chr61952 ------
NM_004831chr1931111 435 326 ------
NM_004834chr22802 698 --1649 --
NM_004835chr32644 205 1866 197 --
NM_004835chr32644 205 1866 197 --
NM_004836chr25906 833 610 272 51 --1124 --
NM_004840chrX82446 2065 1938 1918 919 864 227 83 32121 2085 956 ----
NM_004842chr651774 1310 1237 343 133 1593 --1374
NM_004844chr3------1404
NM_004846chr21174 1121 ----
NM_004849chr661668 1209 679 654 642 175 11110 --11536
NM_004850chr231678 1544 1106 11172 --1527
NM_004856chr152567 31 1464 --1530
NM_004857chr14144692 4230 4093 3486 3478 3417 3361 3190 1834 1055 804 669 540 189 33500 1805 1433 34043 1020 472 --
NM_004859chr1792921 2573 2335 2323 2056 1203 649 236 60 22885 192 ----
NM_004860chr171391 ------
NM_004863chr14164692 4525 4302 4156 3967 3621 2053 1686 1576 1550 1261 1106 442 278 228 156 1259 23723 624 11360
NM_004865chr61368 --1328 --
NM_004866chr5174974 4575 4270 4132 3743 3663 3517 3466 3457 3075 1949 1469 1098 1058 852 509 122 33674 3279 167 11889 --
NM_004867chrX3573 470 228 ------
NM_004869chr183641 154 123 31565 1545 1411 ----
NM_004871chr1784377 4291 4214 4025 3841 1752 1482 202 24139 3127 137 --
NM_004873chr1483202 2376 2220 2201 1073 581 554 471 22783 2209 ----
NM_004874chr81408 ------
NM_004879chr113916 316 295 ------
NM_004883chr5--1154 ----
NM_004884chr1551751 1362 1294 664 288 ------
NM_004888chr95780 737 709 688 385 136 1136 --
NM_004893chr52475 104 ------
NM_004896chr1021317 192 11256 21179 259 --
NM_004897chr103768 625 269 ------
NM_004898chr482455 2027 1988 1075 759 727 598 508 ------
NM_004904chr7215698 4592 4335 4178 4123 4098 2272 2067 1829 1623 1569 1505 1323 1253 771 653 616 589 221 128 71 36276 4818 4684 1623 --
NM_004906chr64557 249 226 76 --1201 --
NM_004912chr751512 385 124 83 35 11086 ----
NM_004921chr162555 2379 2318 2261 425 106 12250 ----
NM_004924chr19--1779 ----
NM_004926chr1441770 1375 1358 251 ------
NM_004929chr82987 21 ------
NM_004932chr551719 1650 296 272 166 ------
NM_004937chr1762693 2541 1834 1699 909 395 --1520 --
NM_004946chr51430 1424 ----
NM_004947chr372594 2568 2382 2005 712 336 232 --12092 --
NM_004949chr1852160 1999 1967 862 757 22109 1623 22099 831 --
NM_004956chr7174523 4470 4272 4237 4028 3094 3052 2851 1223 1162 884 786 535 438 413 266 36 1177 23889 1807 --
NM_004958chr11265 151 ----
NM_004964chr11545 --1406 --
NM_004965chr211116 --1149 --
NM_004966chr102226 36 1677 197 --
NM_004969chr101448 ----181
NM_004973chr621724 1597 --21485 354 --
NM_004976chr1185191 3983 3939 3815 3673 3556 3305 1452 --22034 908 --
NM_004979chrX2204 38 ------
NM_004985chr12134306 4199 4191 3771 3697 3249 2823 1653 1581 1570 1374 1225 661 --1758 12811
NM_004990chr12127 ------
NM_004992chrX118451 7236 5666 5517 2556 2452 1261 1231 1005 943 248 28302 2947 17403 --
NM_004992chrX118451 7236 5666 5517 2556 2452 1261 1231 1005 943 248 28302 2947 17403 --
NM_004993chr1431298 294 34 11487 2457 74 --
NM_004999chr694025 3999 3865 3096 2818 492 482 424 350 33666 3405 472 14270 --
NM_005006chr21784 --1355 --
NM_005010chr782081 2027 1899 1879 1670 371 199 29 11987 1680 --
NM_005011chr72162 38 ------
NM_005014chr9------1769
NM_005017chr32300 233 ------
NM_005020chr72603 453 1439 --1416
NM_005022chr17------178
NM_005023chr531067 1023 132 11367 ----
NM_005026chr122018 1684 --1510 --
NM_005028chr1072219 2132 1526 1473 785 594 302 42288 1796 270 164 ----
NM_005032chrX3854 770 119 1248 ----
NM_005036chr22207490 7418 7098 6994 6979 6322 6273 5145 3179 2726 2613 2001 1975 1607 1216 979 626 512 422 324 --35862 5321 377 1103
NM_005037chr31171 ------
NM_005044chrX63843 3413 3227 2810 988 827 33748 578 466 1119 11827
NM_005045chr71725 --2788 151 1681
NM_005052chr17--1351 ----
NM_005054chr271700 1677 1653 1597 1340 338 311 11530 1462 --
NM_005056chr1285584 4946 4690 3855 2244 1532 1393 328 11016 65613 3974 2214 1643 1363 700 --
NM_005057chr161810 1491 1331 374 348 32 1469 11791 --
NM_005063chr1043514 3407 2675 1450 2772 246 ----
NM_005065chr14145319 5138 5126 5027 4798 4160 3581 2153 1996 1969 1863 1831 935 893 34327 4189 1332 11191 --
NM_005066chr12769 752 177 ----
NM_005069chr2141680 1392 1219 1102 --2622 366 --
NM_005077chr91362 --1136 --
NM_005078chr1511562 ------
NM_005079chr8103158 3081 2963 2040 1053 1047 924 915 717 692 --11108 --
NM_005080chr223949 628 334 ------
NM_005087chr34864 173 121 107 ------
NM_005088chrX2890 641 ------
NM_005093chr2095355 4211 4125 3890 3812 1993 1967 974 878 15254 21272 1232 1688
NM_005095chr162123 1831 1604 1469 888 647 --22201 391 --
NM_005097chr103348 299 292 ------
NM_005102chr24852 824 630 312 1700 ----
NM_005105chr132224 175 42 12007 22133 150 --
NM_005109chr342570 1965 1860 1813 ------
NM_005110chr53720 666 635 ------
NM_005113chr142505 435 ------
NM_005114chr43535 193 174 ------
NM_005116chr2053120 2799 1436 1296 139 13476 ----
NM_005121chr1763796 2921 1406 982 944 235 43628 2563 1139 805 11326 --
NM_005124chr63815 688 71 ------
NM_005126chr332175 1659 45 11433 1302 11638
NM_005134chr182898 307 ------
NM_005135chr1553752 1419 1393 579 498 --13281 11120
NM_005141chr4145 --1353 --
NM_005151chr1861771 878 447 311 294 229 --11778 11652
NM_005154chr153209 196 96 ------
NM_005155chr61720 --1123 --
NM_005156chr9175022 4867 4804 4777 4727 4720 4468 4237 3782 1894 1838 1697 1674 1136 840 426 369 23465 1555 25300 852 --
NM_005157chr941904 599 412 363 11558 ----
NM_005160chr22136771 5379 4658 4513 4343 4300 1613 1569 1495 1425 1061 264 226 25578 4854 25445 5278 --
NM_005164chr1241799 1671 914 419 41022 895 821 682 32563 2497 975 --
NM_005168chr251751 1681 1482 1097 327 11541 1372 --
NM_005171chr1221131 341 ------
NM_005178chr192390 262 ------
NM_005180chr1021520 653 11134 1518 --
NM_005181chr85732 710 251 173 101 ------
NM_005188chr11108194 6868 3083 2730 2628 2086 2061 1854 1618 1006 38201 7226 5950 35809 2775 2712 18212
NM_005189chr1722340 925 --12386 --
NM_005190chr641086 1008 722 32 ------
NM_005191chr341447 1383 142 53 ------
NM_005197chr1486153 6086 5717 5642 4697 4655 3817 38 ------
NM_005201chr351152 1117 1052 955 33 ------
NM_005203chr10171 ------
NM_005204chr102946 292 2616 385 1100 --
NM_005206chr1731220 978 72 ------
NM_005207chr2232824 1118 73 23250 1151 12398 --
NM_005214chr21239 --1222 --
NM_005215chr181238 ------
NM_005222chr71943 ------
NM_005229chrX1247 --2819 350 --
NM_005230chr122545 119 1157 ----
NM_005231chr1151416 1405 1275 1114 163 ------
NM_005233chr352106 1929 1898 796 570 32497 2209 2170 ----
NM_005235chr2197570 7381 7020 6786 6621 6462 5283 5239 2726 1633 1186 991 911 886 876 655 638 491 311 36977 2074 1570 46285 6141 5603 1127 22904 794
NM_005238chr1193510 3231 3063 2966 2856 2555 2430 307 112 --22594 1197 --
NM_005241chr321312 1285 ----1857
NM_005242chr571324 1273 1254 997 600 541 314 ------
NM_005244chr202708 583 ------
NM_005245chr44625 512 205 155 ------
NM_005249chr144866 697 263 108 ------
NM_005254chr1531181 505 31 2900 171 21343 1081 --
NM_005256chr115793 736 611 390 49 ------
NM_005257chr1851427 442 432 329 250 1974 ----
NM_005259chr261547 1384 1200 1087 1005 116 11172 ----
NM_005261chr81856 --1986 2976 919
NM_005264chr102910 133 ------
NM_005271chr102928 836 --21205 231 --
NM_005274chr1----1132 --
NM_005277chr491953 1788 1640 1594 1357 635 389 318 28 ------
NM_005278chrX2451 206 ------
NM_005279chr24779 583 310 144 1748 1103 --
NM_005281chr11788 1331 ----
NM_005284chr6--2357 178 1396 --
NM_005292chr132151 41 1130 ----
NM_005296chrX2852 807 ------
NM_005308chr101367 1455 ----
NM_005311chr741787 393 376 292 ------
NM_005313chr152999 476 --2932 22 11081
NM_005316chr113860 433 371 ------
NM_005318chr223922 249 166 ------
NM_005324chr172550 49 --11698 --
NM_005328chr82565 243 ------
NM_005329chr1642231 2149 949 926 --11468 --
NM_005338chr753639 3478 3085 1610 1045 ------
NM_005339chr464286 4249 3646 3357 2904 717 1213 13863 31269 497 282
NM_005342chrX112822 2659 2451 2150 1010 982 850 549 325 282 237 12716 ----
NM_005349chr41420 ------
NM_005358chr1321591 551 21724 1613 ----
NM_005359chr18126480 5075 4793 4654 4480 4360 4286 2572 1631 1363 741 88 --15921 22396 1980
NM_005375chr63847 797 385 ------
NM_005376chr131106 994 395 1347 ----
NM_005378chr24865 689 96 43 2683 598 134 --
NM_005380chr121025 512 11080 ----
NM_005381chr2131 --1276 --
NM_005384chr9----163 --
NM_005385chr372661 2526 2324 1058 876 740 238 1206 ----
NM_005386chr202694 636 ------
NM_005388chr951694 1503 1289 1167 398 ------
NM_005392chr931564 1319 262 ----1273
NM_005397chr7103982 3595 3257 3024 2881 2843 926 634 394 358 ------
NM_005398chr1041408 1040 1028 248 11463 ----
NM_005399chr183885 3088 1423 1371 1309 987 810 440 11215 54215 1452 1399 872 733 11732
NM_005400chr262964 2590 2584 2191 722 92 ------
NM_005402chr741847 1318 1194 100 3371 163 93 1438 --
NM_005406chr182521 359 ------
NM_005407chr1411000 --11307 --
NM_005409chr441070 957 950 830 ------
NM_005410chr52522 61 ------
NM_005414chr33304 210 121 ------
NM_005415chr2----1272 --
NM_005417chr2042003 660 646 373 ------
NM_005418chr111535 ------
NM_005433chr1842579 1126 965 680 32431 1920 853 22047 151 --
NM_005436chr1073533 3065 2664 1240 1157 729 567 --11511 --
NM_005438chr111252 ------
NM_005440chr1733056 973 403 --12856 --
NM_005442chr33600 452 195 ------
NM_005443chr41210 --1121 --
NM_005445chr101284 ------
NM_005455chr151575 673 375 355 336 31417 1371 284 1398 136
NM_005456chr111734 ------
NM_005458chr932342 2313 2270 22371 897 12218 --
NM_005460chr5186 --2584 525 1380
NM_005465chr13752 399 21 11999 ----
NM_005466chr142203 177 186 ----
NM_005474chr1711260 --1245 --
NM_005475chr12--1574 12006 --
NM_005476chr94875 433 362 137 1225 ----
NM_005487chr2222145 404 --1175 --
NM_005491chrX41589 1581 1353 40 22117 1730 ----
NM_005493chr61560 1124 1785 --
NM_005494chr73241 70 49 --1199 --
NM_005497chr17205632 5503 5161 5058 4806 4417 4259 4107 4073 3872 3758 3730 2425 1954 1285 1039 946 437 378 317 24044 1407 ----
NM_005499chr191141 ------
NM_005502chr983182 2786 2420 1272 1038 903 549 308 43086 2319 2185 2099 12869 --
NM_005504chr12104307 4252 4139 2399 2270 2174 1621 1064 922 755 12168 --25614 5532
NM_005509chr551466 735 396 376 294 11365 ----
NM_005511chr93901 437 49 ------
NM_005513chr3--11496 ----
NM_005517chr161283 1264 1174 553 507 101 --1543 --
NM_005519chr10--1543 1157 --
NM_005520chr51542 ------
NM_005521chr103762 747 668 1269 --1821
NM_005522chr751030 523 490 225 92 ------
NM_005530chr1521396 114 ----1289
NM_005537chr1321060 958 2366 214 ----
NM_005540chr151391 1316 1252 1226 96 1442 ----
NM_005542chr731946 1939 1244 11626 ----
NM_005544chr22358 148 1164 ----
NM_005563chr13787 669 253 174 1701 --
NM_005574chr112631 84 ------
NM_005575chr52870 23 1837 2262 66 --
NM_005576chr152241 192 ------
NM_005578chr3164644 4413 4106 3430 2002 1472 1364 1213 1180 1084 885 869 751 306 265 235 --44830 3661 1405 1022 --
NM_005584chr134787 626 582 535 ------
NM_005585chr151318 ------
NM_005587chr153378 285 26 --1873 --
NM_005593chr122552 191 ----1144
NM_005595chr12685 301 1158 ----
NM_005596chr9126271 6045 5742 5163 4929 4662 2578 2533 2433 2092 1723 1400 11588 34083 2521 1603 26029 573
NM_005599chr121041 283 --11308 --
NM_005602chr391133 1108 1066 942 924 377 222 163 140 11296 11152 --
NM_005604chr662476 2335 1900 1710 931 680 11009 --1854
NM_005607chr831036 185 169 --1795 --
NM_005610chr1----1861 --
NM_005611chr1621049 131 1178 ----
NM_005613chr152038 1856 879 573 143 ------
NM_005625chr8--31111 1041 376 2959 813 --
NM_005626chr12392 102 --2428 356 --
NM_005627chr61203 ----1899
NM_005629chrX21369 100 --1168 --
NM_005637chr1862044 1792 773 684 398 355 ------
NM_005638chrX71467 1296 1223 1127 568 287 125 21768 1290 ----
NM_005639chr1241784 1728 1674 89 ----11799
NM_005647chrX63314 3169 3103 904 819 525 ------
NM_005648chr81199 ------
NM_005649chr5--1398 ----
NM_005650chr2221104 1076 11384 ----
NM_005652chr163918 461 455 ------
NM_005655chr831187 1072 812 21315 320 ----
NM_005662chr8----1338 --
NM_005665chr174865 3958 3746 3463 1648 1620 1607 11086 --24954 3235
NM_005668chr5103362 3003 2863 2822 1756 1749 1326 959 640 218 11265 11165 34204 4144 3044
NM_005669chr55910 386 346 158 111 41651 604 322 187 ----
NM_005688chr33950 413 149 ------
NM_005698chr1132 ------
NM_005707chr1531329 1256 922 ------
NM_005708chr132412 58 134 ----
NM_005715chr682495 2324 2077 1751 844 718 537 408 22548 1745 12731 11865
NM_005717chr141279 1059 911 234 --1846 --
NM_005719chr12146 ------
NM_005721chr24986 967 398 389 11082 ----
NM_005722chr262483 2230 1750 691 667 473 1298 --12071
NM_005724chr151154 ------
NM_005734chr112665 151 ------
NM_005736chr10157 --1509 146
NM_005738chr781907 1614 1569 1403 786 691 544 232 --11666 --
NM_005739chr1582284 2276 1963 1734 1726 1548 471 393 1111 ----
NM_005742chr21270 1832 129 --
NM_005746chr732201 1853 132 ------
NM_005748chr12123104 2709 2647 2441 2397 1265 1160 1106 277 199 79 30 ------
NM_005749chr171148 ------
NM_005751chr72418 345 --1507 --
NM_005754chr561131 910 320 278 198 131 11094 ----
NM_005756chrX2979 448 2222 98 ----
NM_005759chr2154742 4605 4301 4166 3749 3570 3384 3285 3226 1853 1807 1660 602 456 122 13130 44546 968 504 240 23322 2984
NM_005760chr2135 ------
NM_005765chrX3726 703 236 196 1821 --
NM_005766chr133543 491 478 1403 1512 --
NM_005767chr13--1117 1214 --
NM_005768chr121700 --1666 --
NM_005775chr81272 ------
NM_005776chr141155 1117 ----
NM_005779chr543488 3470 3034 2951 11397 21263 23 --
NM_005786chr1831237 1203 429 11015 --1946
NM_005788chr112586 215 ------
NM_005789chr1732041 1650 1375 21456 332 21925 539 --
NM_005795chr252734 2446 2400 822 702 42582 2525 2036 853 ----
NM_005797chr1161750 723 716 520 296 277 11538 ----
NM_005798chr13135189 5181 4621 4411 3921 3702 3575 3511 2117 1356 894 873 356 34741 4029 3882 25113 4589 14341
NM_005802chr92627 205 2737 607 ----
NM_005807chr12480 194 170 ----
NM_005808chr362883 2619 1209 823 795 683 33136 729 218 ----
NM_005813chr242473 2391 308 291 32660 274 38 ----
NM_005814chr151398 1190 537 280 54 ------
NM_005822chr621982 382 ------
NM_005826chr12116 106 1263 ----
NM_005828chr1795073 4933 4690 4539 4249 4132 3125 1802 969 --24235 3887 --
NM_005832chr351170 561 492 384 250 --1549 --
NM_005834chrX129 ------
NM_005836chr81193 141 ----
NM_005840chrX187715 7685 7652 7202 6962 6216 6205 5951 5767 5655 5311 5144 3069 2787 2144 2076 1399 560 36716 5686 2370 13013 --
NM_005843chr281931 1814 1554 1524 1347 1249 615 254 1522 ----
NM_005852chr1731164 1062 1040 ------
NM_005857chr131080 980 434 1146 21153 1040 --
NM_005859chr52528 306 11427 --1222
NM_005862chr35893 811 785 422 89 1751 2936 721 --
NM_005863chr102898 114 2578 96 ----
NM_005869chr5183 ------
NM_005871chr104691 430 317 298 ------
NM_005875chr32399 279 ------
NM_005877chr2252575 2325 2306 552 368 --32066 886 35 32378 906 897
NM_005880chr1621253 195 ----11602
NM_005881chr161294 ------
NM_005882chr42244 223 ------
NM_005884chr19--1657 ----
NM_005896chr23532 276 63 --1638 --
NM_005898chr1153008 2799 2535 733 687 22978 284 13172 --
NM_005899chr1711372 1195 1296 --
NM_005900chr441233 1167 1143 796 1354 1776 --
NM_005901chr18198714 8628 8083 7951 7739 6601 6112 5381 5330 3469 2844 2824 2272 2164 1640 1631 1312 451 360 --35406 1678 752 13254
NM_005902chr1553763 3047 1617 716 696 11485 1225 13634
NM_005903chr5134992 4927 4082 3712 3688 3661 2005 1738 1491 1332 1020 854 418 45236 3815 746 283 21967 1656 --
NM_005904chr1821372 327 --155 --
NM_005909chr594162 4007 3702 3524 2707 1624 1133 833 521 --43348 3226 1658 570 --
NM_005910chr1753316 3217 2704 1638 133 13301 1977 --
NM_005911chr22511 400 ------
NM_005920chr142457 292 199 99 --1247 --
NM_005923chr61275 1105 ----
NM_005927chr54197 186 170 81 ------
NM_005930chr144799 585 85 46 ------
NM_005933chr1131911 920 532 11074 ----
NM_005937chr1713855 13294 23796 220 1448
NM_005941chr864163 3276 2881 1604 1525 372 23615 3135 43299 709 647 588 11406
NM_005943chr621128 56 --11194 1126
NM_005944chr33811 783 42 1344 ----
NM_005955chr1105447 4834 4230 3961 3653 1931 1583 928 610 259 25471 3587 24860 4550 24366 166
NM_005962chr1021974 890 32232 1697 1479 12169 --
NM_005962chr1021974 890 32232 1697 1479 12169 --
NM_005964chr1721037 589 ----1272
NM_005966chr242312 2237 1898 742 42335 1603 1585 252 1410 --
NM_005968chr191158 ----167
NM_005969chr1151055 797 498 391 208 ------
NM_005977chr132934 281 ------
NM_005982chr142225 91 --1217 --
NM_005985chr205752 717 617 215 120 --1162 --
NM_005986chr1352857 2618 1936 1782 373 --3802 615 348 12416
NM_005989chr711115 11526 ----
NM_005994chr172896 210 1729 ----
NM_005999chr131231 578 319 ------
NM_006003chr191179 ------
NM_006007chr984389 3513 1503 1327 1290 1159 1011 427 23534 1567 23079 85 --
NM_006011chr1563732 3108 2775 1206 1196 802 14144 13273 --
NM_006016chr632061 1719 886 ------
NM_006022chr134927 842 333 93 ------
NM_006023chr101174 ------
NM_006029chr141708 --147 --
NM_006035chr1441285 1232 310 106 ------
NM_006036chr282377 2288 2013 1923 1828 870 539 161 3927 550 404 22390 1973 --
NM_006037chr2124847 4369 4324 4304 4229 3914 3884 3435 1671 1605 1593 1428 34259 3176 1435 13371 --
NM_006038chr2041892 1452 239 160 ------
NM_006040chr1631103 467 88 ------
NM_006047chr2043140 2779 468 253 23350 2198 22211 850 --
NM_006048chr151189 1088 445 398 183 ------
NM_006054chr1121038 43 ------
NM_006060chr794407 3948 3762 3529 3082 2706 1722 1709 1578 23391 1028 23181 816 --
NM_006063chr21486 --1197 --
NM_006067chr162801 332 ------
NM_006070chr31113 ------
NM_006076chr732825 479 72 1592 11037 --
NM_006079chr65809 711 587 296 90 --1177 --
NM_006080chr753003 2765 2431 2215 1828 42627 1039 784 237 ----
NM_006085chr13187 81 55 1385 ----
NM_006088chr91144 ------
NM_006089chrX71853 1708 1660 1599 1212 1197 218 31734 702 55 ----
NM_006090chr1------1647
NM_006094chr882293 2270 953 927 692 630 151 23 31969 1776 355 ----
NM_006095chr4124494 4171 4162 4011 3666 3564 3544 2964 1400 1183 1175 896 33575 3074 1769 11700 14151
NM_006099chr12870 691 --1133 --
NM_006106chr1173147 2854 2241 1030 702 541 263 33281 341 133 ----
NM_006107chr172426 408 ------
NM_006108chr1182146 2095 1754 1594 1485 951 934 107 32352 2271 1922 11791 --
NM_006113chr172122 2066 1987 1611 548 470 365 ------
NM_006114chr19--1471 1415 --
NM_006116chr2231607 446 216 --31484 1368 1196 --
NM_006134chr2161452 1371 1078 362 123 23 1299 11334 --
NM_006135chr121371 377 1307 ----
NM_006136chr76918 887 514 482 175 106 129 11256 --
NM_006139chr292521 2410 2294 2146 887 861 734 617 165 2796 373 12200 --
NM_006141chr1642499 1981 829 390 22517 2283 22061 306 --
NM_006147chr12471 413 ------
NM_006148chr1742850 2668 432 166 ------
NM_006154chr15112923 2818 2618 2265 2222 2009 996 786 636 431 173 22906 469 ----
NM_006155chr262046 1949 1535 487 185 39 1120 ----
NM_006158chr851505 1194 1146 1131 560 ------
NM_006161chr54655 247 141 24 1568 ----
NM_006164chr23397 362 190 188 ----
NM_006166chr1292095 2069 1898 1671 1616 725 562 418 343 1889 ----
NM_006180chr94729 532 494 480 ------
NM_006186chr241070 817 219 118 ------
NM_006191chr12----1646 1223
NM_006194chr1411023 1882 1935 --
NM_006195chr921134 911 1213 ----
NM_006202chr193622 352 268 1698 31936 1239 346 --
NM_006203chr5144352 3724 3715 2193 2002 1701 1660 1228 1113 979 894 887 596 557 24635 3541 ----
NM_006204chr101212 137 ----
NM_006206chr452763 2273 636 543 29 11833 22478 509 168
NM_006216chr21665 --140 --
NM_006223chrX136 ------
NM_006224chr1782458 2439 2418 771 514 334 295 24 11946 187 --
NM_006232chr32276 238 ------
NM_006237chr1331957 544 52 ------
NM_006241chr382417 2249 2226 1995 1529 528 351 250 1205 12388 --
NM_006243chr11222 ------
NM_006246chr142982 862 ------
NM_006251chr5113388 3059 2734 2197 2168 1244 1190 1083 523 191 71 22444 863 ----
NM_006252chr1127395 7150 7106 6106 6043 5258 4896 4840 2904 2857 2796 71 12751 27296 6087 --
NM_006255chr1421136 788 11027 ----
NM_006256chr1102728 2530 2478 2207 1921 1900 1033 1025 374 272 22415 1098 1316 --
NM_006257chr101173 1968 ----
NM_006258chr1031099 1059 162 11531 ----
NM_006264chr43570 501 32 ----1186
NM_006265chr831462 1212 137 ------
NM_006267chr22370 146 21215 640 ----
NM_006275chr2072235 969 748 573 549 46 39 11755 22447 836 --
NM_006279chr12328 297 ------
NM_006281chr821062 435 ------
NM_006281chr821062 435 ------
NM_006282chr2043646 3389 1814 232 14131 11903 11893
NM_006283chr8124411 4151 4118 3409 3276 1922 1728 1493 1200 999 904 319 23870 1664 1149 --
NM_006287chr2102418 2315 2271 2144 2090 1883 1844 1783 637 309 --11899 --
NM_006298chr673286 2725 2632 821 629 541 391 22753 2188 --13393
NM_006301chr122499 484 ------
NM_006306chrX44134 2030 855 702 31765 1391 1294 25864 846 --
NM_006310chr1731288 432 381 1984 ----
NM_006313chr1271680 1448 1377 1205 687 511 33 1635 ----
NM_006315chr4103843 3697 2800 2754 1722 1368 1239 1040 793 349 ------
NM_006317chr53649 562 33 ------
NM_006320chr41732 ----11151
NM_006321chr31173 --1859 --
NM_006322chr132602 334 1322 ----
NM_006323chr41484 ------
NM_006328chr112578 422 --1178 --
NM_006330chr831565 1529 1046 21203 1146 ----
NM_006333chr23575 447 147 2544 466 ----
NM_006334chr92221 98 ------
NM_006335chr12879 138 ------
NM_006338chr1----145 --
NM_006345chr44916 313 254 182 11199 ----
NM_006346chr133355 348 97 1182 ----
NM_006348chr72678 320 1163 130 --
NM_006350chr51268 ------
NM_006352chr111478 1135 ----
NM_006359chrX41774 1635 588 234 31973 1861 910 ----
NM_006364chr1471312 1022 894 478 425 72 57 ------
NM_006366chr641290 392 329 168 --11177 --
NM_006367chr111040 1285 ----
NM_006371chr344439 3517 964 839 15072 2927 624 15150
NM_006372chr62491 133 --1483 --
NM_006375chrX31748 1346 730 ------
NM_006379chr772189 2155 2006 1997 1670 743 158 11440 ----
NM_006380chr1773138 3027 2862 1620 795 289 229 24087 974 34023 3268 1128 --
NM_006386chr2242103 634 501 224 145 11655 1665
NM_006387chr1921069 113 ------
NM_006389chr1131357 1207 50 ------
NM_006390chr1231142 674 141 2482 42 ----
NM_006393chr10114197 4068 3799 2793 1527 1269 901 639 361 183 75 24235 1757 11241 11714
NM_006400chr121108 ------
NM_006401chr93381 339 333 1447 ----
NM_006403chr641772 1385 1370 371 1129 ----
NM_006410chr111492 ------
NM_006416chr63703 694 41 ------
NM_006421chr81921 ------
NM_006424chr451558 632 561 181 69 --11662 --
NM_006430chr2----1409 --
NM_006431chr121174 ------
NM_006434chr1073131 2831 2606 759 277 253 240 ------
NM_006439chr41377 1576 ----
NM_006447chr212242 94 ------
NM_006449chr241587 810 715 374 22168 688 1231 12135
NM_006451chr541037 848 836 728 1413 1321 --
NM_006457chr494064 3932 3026 2990 2651 1174 721 560 205 12924 33735 3484 1051 13125
NM_006459chr1041589 1428 1289 533 11495 ----
NM_006460chr1741487 1322 449 278 1350 ----
NM_006464chr2114534 3899 3300 3149 3048 1802 1520 1423 733 508 235 --34188 977 573 11448
NM_006466chr203664 245 29 --1425 --
NM_006467chr562072 1837 1815 1598 1535 918 3768 756 417 1147 11907
NM_006469chr141118 232 209 157 ----11435
NM_006471chr18----2122 42 --
NM_006472chr131199 68 34 1803 2913 268 --
NM_006482chr12123786 3413 3152 3087 2854 2721 1253 1118 1019 959 204 158 23345 1295 13281 --
NM_006489chr1451792 1700 1298 218 72 12040 150 1274
NM_006494chr191134 ------
NM_006496chr182031 1875 1532 1441 1415 1400 359 241 ------
NM_006497chr172805 527 --1812 --
NM_006502chr64916 763 345 132 ------
NM_006504chr1082941 2730 2648 2471 1009 752 440 402 1531 22187 1087 --
NM_006510chr63981 863 248 ------
NM_006517chrX62069 1966 1575 775 277 72 ------
NM_006519chr62326 109 1320 ----
NM_006520chrX31274 554 435 ------
NM_006527chr41147 1643 ----
NM_006529chr411557 11627 31531 667 331 --
NM_006534chr2052910 2482 1302 1043 316 21265 721 43421 2859 2711 2629 --
NM_006536chr12376 192 ------
NM_006538chr2123988 3335 1661 1323 1292 1238 1216 1153 906 737 656 39 11173 13892 14130
NM_006539chr162147 102 ------
NM_006540chr8143 --11587 --
NM_006544chr14215805 5754 5603 5399 5371 4925 4913 4194 3942 3830 2139 1718 1464 1314 1137 1088 768 537 364 349 116 55317 4936 4816 1796 1532 24876 4524 11638
NM_006546chr17196656 6650 6320 6207 6094 5833 5749 5683 5616 5553 5167 4554 4056 2640 2393 456 429 248 133 11465 25110 4758 --
NM_006547chr762108 1983 1948 1647 845 552 2630 176 ----
NM_006548chr331384 1160 265 ------
NM_006549chr1282859 2708 2654 2438 2431 2018 860 262 11057 ----
NM_006557chr971656 1556 1443 1286 1211 392 299 11727 11564 --
NM_006558chr8--1329 1139 --
NM_006559chr12944 914 --21140 1093 --
NM_006561chr10135837 5199 5186 4401 4178 4148 4076 2470 1674 997 577 529 459 133 85405 3940 2116 1657 1648 1568 1334 608 1565
NM_006565chr1631163 1097 840 1110 ----
NM_006566chr183355 158 123 --1982 --
NM_006571chr8130 1111 ----
NM_006572chr1763382 3137 2925 2331 1005 140 --1307 --
NM_006574chr32296 96 ------
NM_006575chr1431132 1019 422 2359 134 ----
NM_006577chr251225 1013 339 246 123 ----1301
NM_006591chr1141648 655 305 70 ------
NM_006593chr24749 660 311 244 1110 ----
NM_006595chr1181857 1736 1676 1284 808 639 605 493 --21802 206 --
NM_006599chr16208086 7912 7481 6589 6579 5378 5146 5126 5118 5061 2501 2082 1949 1432 1217 1181 1149 1038 867 370 107422 7265 7135 6774 6348 6049 6033 5820 886 79 37993 5447 1581 22531 947
NM_006601chr1221062 936 --1129 1120
NM_006602chr204340 272 212 155 --1573 1526
NM_006603chrX41287 1263 633 37 --11271 --
NM_006609chr242317 2029 1833 71 41898 1886 1875 272 --12564
NM_006614chr353691 808 679 347 157 22585 1450 ----
NM_006618chr161131 477 368 196 143 28 --1518 --
NM_006620chr6113919 2949 1764 1597 1464 1300 1176 846 813 323 253 13796 ----
NM_006621chr171977 1489 626 577 411 380 275 --11613 --
NM_006622chr5------1566
NM_006624chr1072089 1821 1553 426 272 251 121 --1100 --
NM_006625chr121141 848 21165 173 1395 --
NM_006625chr121141 848 21165 173 1395 --
NM_006625chr121141 848 21165 173 1395 --
NM_006626chr982616 2336 2133 2077 2058 601 551 512 2520 432 ----
NM_006628chr1574005 3608 3115 3043 1027 705 225 11646 43988 3981 717 69 --
NM_006636chr22878 284 3758 647 368 --1682
NM_006644chr133649 459 253 ------
NM_006646chr1343074 2761 2421 1001 22142 981 2739 432 --
NM_006648chr92118 25 ------
NM_006654chr12104769 4530 4193 4060 3558 3549 1067 972 839 70 44042 3704 1222 730 21772 1157 --
NM_006658chr74860 839 91 23 ------
NM_006662chr16178 ------
NM_006670chr61597 1532 181 --
NM_006675chr1243336 3156 1134 334 ------
NM_006681chr4162 ------
NM_006682chr7102712 2253 2242 1935 1928 793 767 497 388 362 32226 170 65 22460 2287 --
NM_006690chr2082030 1991 1753 1668 896 580 247 27 22329 1766 1712 --
NM_006694chr12297 267 ------
NM_006699chr192530 2501 2168 1994 1873 1026 738 604 448 1912 12349 2461 179
NM_006700chr12----1137 --
NM_006703chr62460 83 ------
NM_006706chr52538 154 ------
NM_006711chr163792 328 61 1770 ----
NM_006713chr53787 201 136 ------
NM_006717chr943257 2416 801 178 33214 2378 825 22283 302 --
NM_006721chr104833 287 277 223 --198 --
NM_006722chr31818 --1309 1461
NM_006726chr41293 --1978 --
NM_006727chr53204 88 60 1193 ----
NM_006729chrX135648 5547 5270 5142 4893 4120 3913 3798 3532 2228 1253 1063 55 34608 811 778 24448 513 2765 226
NM_006731chr9165768 5639 5207 5070 4511 3779 2141 1965 1915 1901 1840 1334 830 536 239 158 1887 44803 1771 1457 456 24869 1234
NM_006734chr67514 493 280 257 220 130 35 --143 --
NM_006735chr71294 ------
NM_006738chr1543425 3205 2978 1320 22951 640 13054 --
NM_006743chrX--1369 1877 --
NM_006745chr411092 --11017 1168
NM_006746chrX71507 1138 1025 249 180 165 73 11388 ----
NM_006750chr16187741 7473 7048 6924 6859 6306 5769 2965 2946 2583 2573 2426 1575 920 677 602 564 327 16806 1834 --
NM_006751chr24830 359 300 83 ------
NM_006754chr721121 238 ------
NM_006755chr111163 ------
NM_006756chr851490 1456 1354 1329 384 21228 1199 11128 11507
NM_006759chr21294 187 ----
NM_006761chr17------1621
NM_006763chr131780 1729 1583 22143 1956 ----
NM_006766chr892670 2529 2216 2209 967 472 403 302 181 52692 1745 1664 1087 221 12723 --
NM_006769chr11677 ------
NM_006772chr621716 160 --1448 --
NM_006775chr642980 2086 999 932 43017 2914 2353 993 12227 --
NM_006777chrX22686 2510 22615 373 22896 1180 1670
NM_006783chr132282 237 ------
NM_006788chr1821796 1658 11490 ----
NM_006790chr5162 ------
NM_006791chr152412 46 1493 ----
NM_006800chrX2596 214 ------
NM_006803chr841383 839 427 37 ----1269
NM_006805chr56547 494 448 398 224 129 ------
NM_006806chr21--2332 174 ----
NM_006807chr175994 482 383 242 69 11139 ----
NM_006808chr91188 ------
NM_006814chr2092627 2389 2371 2129 1900 893 438 345 268 --21995 405 --
NM_006815chr1241015 536 528 424 1361 185 --
NM_006822chr171555 1275 ----
NM_006823chr831171 256 237 ------
NM_006826chr231022 838 70 21303 1012 11082 --
NM_006827chr1473356 3308 3107 3070 1220 1214 352 1608 23205 1320 --
NM_006828chr62476 21 ------
NM_006831chr111337 1406 ----
NM_006832chr143711 436 423 21075 105 ----
NM_006838chr123430 302 115 --1410 --
NM_006851chr1272704 2265 2248 2104 837 402 289 22119 1010 1643 --
NM_006852chr1732760 2413 1954 12804 --12136
NM_006854chr712020 21549 622 ----
NM_006856chr1251088 1018 797 729 417 ------
NM_006861chr1221562 1517 --12057 --
NM_006874chr451247 897 849 440 104 1396 1880 --
NM_006875chrX1266 ------
NM_006885chr1683862 3388 3330 2631 1447 1426 1131 522 13773 41090 1063 847 732 --
NM_006888chr1462835 2581 1337 1259 1102 273 --11192 --
NM_006897chr121654 ------
NM_006902chr162749 2487 2360 2215 377 31 --11343 --
NM_006906chr114994 746 327 96 ------
NM_006908chr731290 1231 52 11078 1159 --
NM_006910chr161381 ------
NM_006912chr161699 1594 963 764 615 95 --1898 --
NM_006914chr961446 1349 1090 1076 386 345 1333 ----
NM_006915chrX72248 2058 642 548 461 368 73 1181 --1226
NM_006916chr261371 1106 1025 948 497 188 ------
NM_006918chr11145562 5296 4954 4931 4883 4811 4576 4178 3677 3549 1423 988 978 862 34348 1294 641 45484 3807 2281 1928 --
NM_006920chr272077 1974 1923 1541 1525 1515 386 41445 1321 1293 332 ----
NM_006922chr232018 2002 1646 --2837 579 --
NM_006924chr1784240 3855 2882 1371 973 902 573 74 33296 598 432 44415 3933 706 672 --
NM_006931chr1272093 1866 1742 1488 433 260 107 ------
NM_006937chr171197 ------
NM_006939chr1421046 92 11011 --1840
NM_006940chr1251851 1282 766 753 494 1108 11356 1578
NM_006947chr441716 698 597 342 21791 1133 --1396
NM_006948chr2121601 54 --12485 --
NM_006950chrX6726 598 248 236 68 61 ------
NM_006951chr103780 639 266 ------
NM_006956chr772390 2216 2173 2005 934 689 582 ------
NM_006962chrX41079 1003 804 415 166 ----
NM_006965chr1811040 ----1426
NM_006980chr72741 130 --1225 --
NM_006981chr932497 2251 290 13016 ----
NM_006990chr142544 2464 1776 382 --1193 --
NM_006991chr331006 176 37 1723 ----
NM_006993chr102278 260 ------
NM_006997chr10197 ------
NM_006999chr531920 608 444 11883 ----
NM_007005chr94216 156 149 46 11302 ----
NM_007006chr1693056 2844 2614 2192 1151 308 224 206 35 23174 550 ----
NM_007007chr12134720 4201 4087 3300 3073 3042 1716 1690 1575 1549 1347 529 388 14448 1180 24677 1245
NM_007010chr1731663 1432 565 ------
NM_007011chr15226820 6550 6244 6231 6011 5993 5417 5073 5036 4996 4958 4918 4879 4832 1994 1843 1478 1211 586 575 466 386 36803 1953 1542 24270 2451 --
NM_007013chr82791 740 --1890 1174
NM_007017chr53875 699 631 1856 ----
NM_007019chr201173 ------
NM_007023chr271018 978 894 758 346 251 62 ------
NM_007026chr172212 197 ------
NM_007033chr121698 796 11640 ----
NM_007034chr141003 978 743 362 1872 ----
NM_007035chr123722 607 590 --1117 --
NM_007038chr2185516 2206 2052 2011 1890 1129 685 350 23863 417 44867 2062 905 623 --
NM_007039chr1481889 1860 1676 1648 856 625 275 79 ------
NM_007040chr191185 --1446 --
NM_007045chr61548 1158 157 --
NM_007052chrX3626 545 32 189 ----
NM_007064chr311242 1644 ----
NM_007067chr1751381 1126 591 538 505 ------
NM_007073chr6134240 4155 3473 3457 3372 3273 2716 2630 1043 392 322 167 69 54176 3298 2854 1179 891 23713 3691 13044
NM_007078chr1072697 2561 2471 2309 1971 1068 924 --13057 --
NM_007084chr1341550 1403 1181 1018 11300 ----
NM_007087chr16--140 ----
NM_007106chr1322452 179 --42419 1719 1063 301 --
NM_007107chr321664 913 22283 1542 ----
NM_007114chr373170 2813 2696 2569 1233 981 241 31141 1004 275 --13212
NM_007115chr23478 359 332 ------
NM_007118chr52624 195 1872 ----
NM_007124chr64691 672 446 398 31780 1427 759 --1392
NM_007129chr132887 421 ------
NM_007137chrX84534 4032 3904 2061 787 614 501 136 --35049 4670 442 --
NM_007144chr1721324 264 --285 53 --
NM_007145chr1931236 1146 239 11347 ----
NM_007146chr1762405 1808 1154 863 303 136 2523 352 --1200
NM_007150chrX11714 1232 11375 --
NM_007153chr1994473 4040 3328 3198 3172 1438 1376 1092 988 ------
NM_007157chrX82648 2374 2252 2221 1972 704 437 37 1550 ----
NM_007158chr121181 360 --1300 1190
NM_007159chr331647 1530 366 11415 2493 80 --
NM_007166chr1181592 1575 1535 1437 1403 1397 1046 966 ------
NM_007170chr11925 ------
NM_007172chr2262955 1329 1120 1049 620 523 23220 2748 22289 2186 --
NM_007173chr1151762 1535 771 497 232 1901 22316 689 --
NM_007174chr1262159 2145 921 778 496 244 --22123 826 1367
NM_007175chr873390 3351 3282 2835 2316 1220 610 --23561 3358 --
NM_007185chr12885 216 11003 ----
NM_007190chr1091159 1107 1043 954 928 897 840 93 25 --1733 --
NM_007191chr121445 1678 ----
NM_007192chr143761 137 111 ------
NM_007195chr1853535 1136 765 352 232 ----1223
NM_007197chr123926 745 353 ------
NM_007198chr821522 1277 1371 ----
NM_007200chr1543425 3205 2978 1320 22951 640 13054 --
NM_007202chr172718 284 1640 ----
NM_007203chr973911 3345 904 771 553 449 371 21578 77 33080 2565 483 13726
NM_007207chr11791 2357 142 ----
NM_007212chr142231 799 276 78 2870 558 1289 22166 1500
NM_007214chr63997 900 475 11310 11325 --
NM_007217chr3--1320 ----
NM_007218chr82973 248 ------
NM_007219chr204972 644 188 109 ------
NM_007222chr831338 1148 264 --11134 --
NM_007231chrX82405 2095 2045 943 759 540 469 287 22411 886 ----
NM_007235chr123512 437 25 ------
NM_007236chr1541648 515 460 433 12347 ----
NM_007240chr1--1187 ----
NM_007245chr161914 ------
NM_007246chr43839 686 91 31031 676 105 ----
NM_007249chr13309425 9388 8436 8129 7949 7769 7618 7151 6948 6875 5792 3695 3636 3484 3474 3455 3087 2906 2890 2669 2593 2554 2202 1820 1413 1125 810 319 300 274 46933 6505 5702 1107 17277 --
NM_007259chr1----2522 206 --
NM_007269chr11167 ------
NM_007270chr731267 1253 1066 1422 --11452
NM_007276chr71182 11094 ----
NM_007279chr192647 632 ------
NM_007280chr151414 ------
NM_007285chr16----163 --
NM_007294chr171260 ------
NM_007295chr171260 ------
NM_007296chr171260 ------
NM_007297chr171260 ------
NM_007298chr171260 ------
NM_007299chr171260 ------
NM_007300chr171260 ------
NM_007302chr171260 ------
NM_007303chr171260 ------
NM_007304chr171260 ------
NM_007305chr171260 ------
NM_007308chr43682 519 289 1601 1499 --
NM_007313chr941904 599 412 363 11558 ----
NM_007331chr492499 2288 1984 1859 723 610 513 191 41 32695 2316 1748 11946 12013
NM_007332chr851346 1066 582 293 101 ------
NM_007345chr1831770 1476 504 12111 12029 --
NM_007347chr1562060 1983 962 813 653 267 13169 --1717
NM_007350chr12173474 3413 3334 2993 1775 1679 1653 1443 1388 1277 1011 995 555 510 492 178 77 --1373 --
NM_007358chr111816 11320 ----
NM_007359chr1761717 1254 609 396 322 228 ------
NM_007361chr142557 133 ------
NM_007362chr381466 1285 1277 1083 1075 974 475 303 --190 --
NM_007363chrX2982 749 21082 770 ----
NM_007373chr1051506 1203 1150 322 152 --11539 --
NM_007375chr142283 2195 2160 151 12454 1691 --
NM_009585chr32644 205 1866 197 --
NM_009585chr32644 205 1866 197 --
NM_012069chrX2514 237 32325 1813 1764 12714 --
NM_012073chr54437 381 152 34 ------
NM_012074chr1421052 818 ------
NM_012081chr573481 2702 2639 1268 943 698 134 12998 33392 2988 914 1149
NM_012082chr81923 2724 364 1186 --
NM_012083chr1041187 422 316 295 --1110 --
NM_012084chrX1579 ------
NM_012089chr131400 1385 292 --1428 --
NM_012090chr111164 --2826 35 --
NM_012093chr131249 1217 255 ------
NM_012095chr1073426 3058 3032 2385 546 511 220 22466 1301 ----
NM_012096chr363680 3409 2482 1283 583 398 53600 1372 793 683 136 --11039
NM_012097chr251776 599 298 230 140 12253 --1593
NM_012099chr1921265 185 ------
NM_012100chr25746 693 667 542 307 ------
NM_012102chr152622 1882 1867 913 814 --22171 881 --
NM_012104chr1153350 2531 1246 842 57 13027 33363 3337 2677 --
NM_012104chr1153350 2531 1246 842 57 13027 33363 3337 2677 --
NM_012108chr42506 66 1428 ----
NM_012110chr41265 ------
NM_012120chr672131 2040 1937 931 885 520 233 12546 1424 --
NM_012129chr762259 1820 1690 629 533 87 22432 1868 ----
NM_012134chr151601 1404 1261 650 178 ------
NM_012137chr132186 2130 481 22789 2734 11170 --
NM_012141chr13184115 3987 3976 3559 3050 2721 2569 1598 1392 1091 743 635 495 371 218 173 85 23 31381 795 152 ----
NM_012153chr1172457 2070 1695 975 892 738 132 1718 22046 90 --
NM_012156chr2083143 2560 2432 705 619 584 483 453 --33120 2883 557 --
NM_012158chr1361861 1786 1749 1208 449 182 31795 1199 384 11445 --
NM_012161chr481105 1089 791 432 245 191 124 27 2767 62 1925 --
NM_012164chr9167487 7392 7064 6382 6238 6091 6034 5552 5406 4819 4788 2575 2514 1209 1039 269 36815 5417 2199 15664 22904 1826
NM_012176chr52232 34 ------
NM_012180chr41679 --1148 --
NM_012183chr11427 ------
NM_012193chr11134464 4414 4090 3542 3472 3433 1747 1247 1186 833 819 54 31 2735 263 --22085 409
NM_012197chr931174 651 517 ------
NM_012199chr1114338 4050 3994 3680 3235 1815 1130 1119 1059 1004 650 24428 403 ----
NM_012207chr102236 189 ------
NM_012210chr951469 1008 419 356 179 --11123 1297
NM_012214chr2266089 5974 5825 5760 5611 5501 5341 4366 4327 2566 2537 1973 1967 1871 1428 1294 1236 650 611 509 361 349 215 137 83 24 55298 4765 964 747 334 23958 593 --
NM_012215chr1071915 1706 1606 1273 765 601 155 ------
NM_012223chr241328 1204 1095 986 11110 121 --
NM_012229chr1041025 969 585 287 11396 ----
NM_012234chr363707 3471 2890 2339 2317 195 12654 33129 952 266 13700
NM_012238chr1071543 1477 1469 621 519 426 344 11279 11318 --
NM_012247chr106977 963 866 703 258 59 1366 ----
NM_012248chr162220 190 ------
NM_012249chr273379 3068 3013 2875 2278 1275 35 53086 2916 2533 681 219 1865 --
NM_012250chr1131143 987 866 21326 279 ----
NM_012252chr785255 4498 3952 3739 3419 2150 533 237 35313 4057 633 ----
NM_012257chr7187 2861 205 ----
NM_012259chr651405 1356 948 251 45 1520 ----
NM_012262chr1144543 4107 3757 3178 2082 1449 1373 1261 880 868 459 379 346 194 33553 1802 1714 24365 4283 --
NM_012264chr223763 637 146 12102 ----
NM_012264chr223763 637 146 12102 ----
NM_012266chr921082 294 --1905 --
NM_012281chr742167 1766 798 364 --11734 --
NM_012286chrX148 1244 125 --
NM_012287chr3124395 4217 4040 3894 3652 3520 3315 3128 3071 1162 981 92 23722 614 54266 4163 3607 1433 890 --
NM_012288chr6145738 5672 5431 5275 4782 4712 4629 4457 4327 2014 1837 1393 1091 154 11168 15065 12123
NM_012290chr211685 1676 11514 --
NM_012294chr793823 3590 3010 1396 921 614 533 395 38 --11218 --
NM_012296chr1173785 3739 3633 3413 3038 3026 266 --1639 --
NM_012297chr452342 2013 1974 1648 333 2665 588 22044 1923 --
NM_012300chr52460 376 11619 11944 --
NM_012302chr11789 --1360 1313
NM_012307chr183835 787 254 ------
NM_012308chr1182609 2560 2219 2038 1831 1752 1644 754 ------
NM_012309chr1184513 4174 3626 3366 3305 1771 1507 295 34330 3105 3015 34249 4075 980 13982
NM_012316chr1114987 4961 4807 4781 4648 4287 4008 3536 2239 2072 581 --12084 --
NM_012322chr73423 340 290 --2145 75 --
NM_012323chr2251415 1389 1255 563 92 11170 ----
NM_012325chr2021126 141 --11603 21641 1588
NM_012326chr21818 ------
NM_012327chr1831261 628 251 ----11316
NM_012328chr721160 946 1106 ----
NM_012329chr1721192 389 --1434 --
NM_012330chr1091756 1335 1175 631 524 485 289 228 127 11216 21245 693 --
NM_012333chr121237 567 --1514 --
NM_012334chr564402 3561 3527 3387 3256 950 34510 731 624 13417 --
NM_012342chr101440 173 ----
NM_012343chr51718 2422 280 ----
NM_012345chr1311292 21849 1318 31449 1365 394 11629
NM_012347chr692985 2929 2660 2277 2230 1832 1201 1169 27 22552 426 ----
NM_012382chr5144147 3400 3369 3211 1731 1674 1358 918 899 830 757 742 569 484 1278 24259 3306 11308
NM_012383chr91446 ------
NM_012388chr1563016 3005 2503 1151 1018 428 22309 722 ----
NM_012394chr1242 21 ------
NM_012397chr1851720 1674 1324 601 102 21754 1496 11580 --
NM_012398chr1932367 2097 38 --12700 --
NM_012402chr1131164 246 93 ------
NM_012417chr171628 ------
NM_012419chr64638 444 241 24 --1149 --
NM_012426chr16----1313 --
NM_012428chr152862 380 1175 1313 --
NM_012430chr32739 527 ------
NM_012433chr22239 37 ------
NM_012443chr104861 801 776 259 1151 ----
NM_012446chr5--1410 ----
NM_012449chr7122 ------
NM_012454chr62454 125 139 1230 --
NM_012463chr1261783 1465 1288 1279 494 65 ------
NM_012464chr482417 2161 1932 1896 1042 1021 577 514 12876 --1625
NM_012465chr1043217 2187 621 469 ----12859
NM_012471chrX51950 1896 1770 1524 181 --3393 338 158 --
NM_012475chr11249 ------
NM_012479chr74917 643 410 158 --11837 --
NM_012481chr174775 585 569 197 --1118 --
NM_013229chr1222664 1810 12808 ----
NM_013230chrY51754 1391 1339 1170 583 ------
NM_013231chr1474351 3618 3530 3379 2758 1594 861 23652 1278 31452 1406 340 --
NM_013233chr251371 1131 267 107 83 1429 ----
NM_013235chr5--2868 644 ----
NM_013243chr151465 ------
NM_013246chr112802 310 --149 --
NM_013248chr201242 ------
NM_013254chr122603 88 1571 ----
NM_013255chr7148876 8385 7816 7215 7146 7037 5564 5459 2212 1964 1432 484 445 228 67181 2738 2543 2127 1923 268 28780 7100 11477
NM_013257chr871980 1810 1784 1511 765 631 105 ----12005
NM_013261chr463545 3021 1454 1432 853 417 ----23582 107
NM_013262chr661406 1325 1264 1136 1127 411 11242 21348 457 --
NM_013263chr16139 ------
NM_013269chr1274540 4392 4372 4213 3348 3209 2833 1603 --161
NM_013272chr152390 48 --1256 --
NM_013277chr123911 898 201 --195 --
NM_013280chr112854 570 ------
NM_013281chr2041240 1108 413 289 --2596 407 --
NM_013282chr1941307 1007 442 173 ------
NM_013283chr52210 58 196 ----
NM_013286chr363741 2931 2770 2308 491 480 23823 3077 33634 822 84 --
NM_013293chr73204 137 30 ----1170
NM_013302chr16103860 3481 1578 1349 1301 859 608 463 139 102 --34708 3122 589 --
NM_013309chr1582661 2597 2249 1717 837 714 640 350 21923 587 --1364
NM_013322chr741732 1252 1090 692 ------
NM_013336chr33717 402 153 ------
NM_013341chr2112838 2828 2620 2530 2311 2191 2165 1950 1068 946 783 ----12903
NM_013351chr171729 ------
NM_013354chr8--1433 --1122
NM_013357chr82766 717 1638 ----
NM_013368chr192462 127 ------
NM_013372chr1532582 587 560 ------
NM_013374chr382795 2669 2632 2251 1006 843 552 303 22915 656 ----
NM_013381chr1282446 2070 1826 1798 878 620 568 57 21592 649 ----
NM_013386chr181516 1414 1343 1279 1152 603 141 106 21313 229 21498 1174 1612
NM_013390chr941384 573 299 254 169 1101 --
NM_013392chr2----1438 --
NM_013396chr2131075 353 287 31142 954 200 ----
NM_013400chr741051 852 398 195 1664 ----
NM_013410chr131310 976 491 ------
NM_013433chr1982024 1973 1588 1358 1327 473 291 174 ------
NM_013436chr2134 --1742 --
NM_013437chr851432 1298 991 317 50 21314 922 ----
NM_013438chr941602 423 218 82 1133 ----
NM_013444chrX61085 1026 441 168 97 91 1144 ----
NM_013446chr761440 1188 1045 1035 1012 324 11373 ----
NM_013448chr142768 254 ------
NM_013449chr1252990 2559 2245 1151 319 --21127 67 --
NM_013450chr231055 390 382 1792 2923 154 --
NM_013937chr631012 383 283 11174 ----
NM_013943chr172978 2916 2131 2109 1118 618 52 2726 270 --12264
NM_013951chr242394 1736 848 561 21920 1637 ----
NM_013952chr242471 1813 925 638 21997 1714 ----
NM_013953chr242471 1813 925 638 21997 1714 ----
NM_013981chr5--1154 ----
NM_013982chr5--1154 ----
NM_013983chr5--1154 ----
NM_013992chr242471 1813 925 638 21997 1714 ----
NM_013993chr64756 740 594 587 ------
NM_013994chr64756 740 594 587 ------
NM_013995chrX42530 1934 1037 818 1292 2763 492 --
NM_013996chr7--1529 ----
NM_013996chr7--1529 ----
NM_013997chr7--1529 ----
NM_013997chr7--1529 ----
NM_013998chr7--1529 ----
NM_013998chr7--1529 ----
NM_013999chr1711516 ------
NM_014000chr1021692 182 11789 ----
NM_014007chr92456 86 --1329 --
NM_014011chr231880 532 227 12495 139 12060
NM_014016chr331548 1356 433 1674 174 --
NM_014021chr1103234 2950 2705 2449 2317 1341 1310 1089 728 306 ------
NM_014023chr1072066 1841 1055 969 798 595 190 1733 185 --
NM_014028chr683029 2869 2424 2244 2113 842 527 169 --22060 131 1799
NM_014031chr51303 ------
NM_014034chr631549 1257 975 1430 ----
NM_014038chr7167 --2359 43 --
NM_014039chr114522 276 256 139 11094 21310 268 --
NM_014048chr1695323 5299 5166 4743 4681 4323 4132 3589 3231 44965 1146 625 372 23819 856 --
NM_014057chr9111574 1567 1454 1387 1359 1119 996 645 537 257 110 --21492 1296 --
NM_014079chr311066 --157 --
NM_014089chr1341801 1727 702 545 12147 ----
NM_014106chr1562755 2073 1891 315 254 74 42995 2519 2212 234 ----
NM_014109chr861236 1177 776 484 342 53 ------
NM_014110chr12750 301 --1288 --
NM_014112chr8135006 4898 4790 3807 2205 2197 2191 1834 1795 877 734 407 227 1797 12019 1756
NM_014117chr16102198 2179 1772 1689 920 762 745 646 371 44 21736 914 22079 451 --
NM_014139chr34788 677 322 195 1160 1120 --
NM_014142chr10----125 --
NM_014153chr161494 ------
NM_014154chr371444 1427 1254 1121 1099 1058 208 11037 ----
NM_014155chr11157204 6790 6589 5968 4986 2972 2360 2328 2258 2085 1849 1418 799 413 139 47083 6318 4883 2993 36339 5177 4709 16233
NM_014157chr1673758 3308 3167 1380 1340 1236 851 11488 ----
NM_014171chr24652 264 138 42 ----1304
NM_014175chr82139 114 ------
NM_014181chr292855 2798 2685 2641 2557 2521 2218 1926 125 --22585 763 --
NM_014182chr121261 --1759 --
NM_014189chr441408 1249 1066 465 ------
NM_014190chr451760 1601 1418 1186 1180 ------
NM_014191chr121979 2388 357 ----
NM_014211chr521711 453 ------
NM_014217chr181853 1781 1610 1225 583 396 175 80 --1208 --
NM_014220chr3164 --1118 --
NM_014223chr11294 1770 1206 --
NM_014232chr172630 549 ------
NM_014232chr172630 549 ------
NM_014233chr1731984 1885 282 --1114 --
NM_014240chr383735 3709 3507 2872 1147 841 738 219 ----11544
NM_014243chr431606 1504 149 31785 378 113 11847 --
NM_014245chr32317 162 ------
NM_014246chr223903 471 443 ------
NM_014250chr2222145 404 --1175 --
NM_014253chrX52451 2292 1878 1851 1591 --1276 --
NM_014258chr203727 626 480 126 ----
NM_014263chr1061365 1256 1144 980 523 81 --170 --
NM_014264chr43593 488 178 1503 ----
NM_014267chr112921 161 1877 1185 --
NM_014268chr1861448 1380 1260 560 390 247 --21442 164 --
NM_014271chrX3737 255 210 ------
NM_014278chr4--1343 1105 --
NM_014280chr13707 593 80 --1121 --
NM_014282chr93891 187 134 --21231 1127 --
NM_014283chr131228 1189 200 1227 ----
NM_014289chrX31382 1367 1127 ------
NM_014293chr2262614 1481 1455 1073 797 129 13599 33534 2773 41 --
NM_014294chr861485 1359 1241 1234 270 137 --11267 1579
NM_014299chr1921929 429 12141 178 --
NM_014300chr151327 ------
NM_014309chr22105096 4666 4610 3812 1230 1174 1037 584 225 140 --22021 1317 --
NM_014313chr12481 422 --188 --
NM_014316chr161764 ------
NM_014317chr10170 1106 ----
NM_014319chr122763 272 21739 1210 --1661
NM_014322chr12330 222 1973 149 --
NM_014323chr222389 112 ------
NM_014325chr123632 121 106 1893 32267 462 285 --
NM_014331chr4186970 6829 6609 6173 5881 3066 2817 2792 2522 2472 1870 1725 1381 1190 1039 728 563 69 57356 6769 6236 1053 870 17794 17784
NM_014332chrX1324 ------
NM_014333chr1172746 2536 2519 2242 1783 1748 465 11975 22770 400 --
NM_014335chr1531099 520 32 --11115 --
NM_014342chr1151197 1093 421 288 92 ------
NM_014344chr112799 636 1778 ----
NM_014345chr66850 825 775 704 356 22 --1280 --
NM_014350chr551032 993 777 404 378 --1765 --
NM_014361chr112443 347 ------
NM_014363chr1331280 1184 437 41221 1140 1055 269 ----
NM_014368chr932068 396 273 ----1735
NM_014372chr131843 1578 1329 22045 449 140 --
NM_014374chr741051 852 398 195 1664 ----
NM_014381chr1451210 941 848 481 269 22027 764 11147 12085
NM_014382chr321521 531 11713 11126 --
NM_014388chr1215808 5623 5328 4866 4799 4691 4619 4345 3897 1690 1653 1481 1401 1174 1153 831 777 765 723 265 61 23786 878 24971 3827 12385
NM_014391chr102289 44 1740 ----
NM_014392chr43428 331 33 190 1222 --
NM_014393chr842181 248 170 106 --1225 --
NM_014394chr1021145 215 ----1306
NM_014395chr411528 11375 11968 --
NM_014399chr74775 278 74 47 ------
NM_014405chr1712389 ------
NM_014411chr761954 1944 1557 1475 1417 603 11589 ----
NM_014415chr33361 338 145 21396 350 ----
NM_014423chr565317 5248 3639 2266 617 413 44214 3522 1541 1389 --14788
NM_014445chr332141 934 260 31798 915 428 ----
NM_014447chr421612 437 1152 11306 --
NM_014452chr621076 858 21014 342 2481 303 --
NM_014454chr611024 ----1897
NM_014456chr1041601 1493 1467 677 31859 1345 129 11298 --
NM_014458chr131117 1100 304 21030 545 ----
NM_014469chr111777 --1145 --
NM_014472chr10------1730
NM_014487chr42705 95 1674 1617 --
NM_014489chr111259 1860 ----
NM_014491chr71294 ------
NM_014494chr1641918 735 698 118 11780 3716 362 125 --
NM_014502chr11----1315 --
NM_014504chr731467 186 112 1491 --1551
NM_014505chr121336 ------
NM_014515chr123798 689 155 ------
NM_014516chr192241 219 ------
NM_014517chr351932 1475 1229 1201 766 21501 748 1738 11342
NM_014521chr251523 1417 1192 449 254 --11152 --
NM_014547chr151127 2713 667 1195 --
NM_014547chr151127 2713 667 1195 --
NM_014548chr151154 1606 1279 185
NM_014554chr1252096 1992 1500 801 259 --1786 --
NM_014562chr22730 170 --1160 --
NM_014570chr22----1112 --
NM_014572chr1361723 1196 1171 193 168 126 --1288 1482
NM_014573chr1711538 --21354 175 --
NM_014574chr1421552 978 11580 ----
NM_014575chr32465 183 1199 ----
NM_014577chr227921 817 788 717 635 333 251 1855 ----
NM_014584chr1441326 1102 638 156 2211 103 ----
NM_014586chr2164425 4031 3269 1845 277 270 13768 --14190
NM_014587chr1631357 1290 299 --21375 1366 --
NM_014588chr205786 760 540 139 57 2710 218 ----
NM_014591chr1021313 1223 ------
NM_014600chr231526 410 310 1624 ----
NM_014602chr31344 ------
NM_014607chr221547 744 1407 1336 --
NM_014612chr951312 1296 1261 169 90 ------
NM_014613chr5112661 2343 2336 2300 2226 2171 1890 1178 778 407 236 33057 2177 2062 ----
NM_014614chr261189 1154 220 175 117 21 --11080 --
NM_014615chr1693323 3271 2639 2543 2530 2351 2298 1078 1072 32927 835 520 1863 --
NM_014618chr9----1399 --
NM_014620chr12--1504 1280 --
NM_014623chr6185 ----1146
NM_014629chr811161 11229 ----
NM_014630chr1593969 3268 2853 2838 2681 2456 1088 810 359 14010 --12511
NM_014635chr251678 1569 1308 302 275 11502 1426 --
NM_014636chr9114372 4007 3849 3751 3236 3088 2973 1725 1663 578 540 44347 4091 3004 1281 11142 23884 3053
NM_014637chr821211 569 1324 ----
NM_014659chr154800 444 338 184 ------
NM_014666chr53355 285 214 ------
NM_014667chr351919 1775 590 362 321 2988 741 ----
NM_014670chr271600 1425 1306 1271 1207 1182 587 1316 ----
NM_014671chr761523 1288 1261 574 489 179 11053 --1244
NM_014674chr3113748 3599 2931 2878 2713 1573 1083 968 844 522 333 ----12810
NM_014676chr121454 1446 1456 ----
NM_014679chr1161366 464 432 403 268 89 ------
NM_014682chr852233 1924 1883 354 302 --12119 --
NM_014683chr1731903 1365 769 11791 1840 --
NM_014685chr16--1514 --1421
NM_014686chr1972545 2282 2247 2080 1979 992 81 --1399 --
NM_014689chr22628 165 ------
NM_014690chr762696 2690 1114 1001 978 419 --12886 --
NM_014700chr1611379 ------
NM_014702chr6123303 3113 3098 3005 2854 2456 2148 1041 520 485 169 45 22789 2214 23391 2174 12444
NM_014705chr721867 279 52084 1714 1564 1309 87 21993 1362 --
NM_014707chr721875 1567 21936 652 --1614
NM_014711chr1672077 2032 2013 1808 1351 745 305 1437 2553 477 11521
NM_014712chr161610 ------
NM_014713chr22365 341 1200 ----
NM_014720chr1041480 1400 1284 1141 --11333 --
NM_014721chr6157457 7310 7024 6326 6283 5967 5346 5253 4927 2305 2057 1642 1561 1065 761 11659 36444 4692 2180 22894 2115
NM_014729chr852109 1892 736 553 128 ----191
NM_014730chr1254670 4227 1508 1236 724 --22111 1635 --
NM_014730chr1254670 4227 1508 1236 724 --22111 1635 --
NM_014731chr202194 23 ------
NM_014732chr1685718 4394 4299 3617 2260 2228 1809 1426 25182 2203 14314 15088
NM_014735chrX72138 2068 2018 781 706 375 119 --21348 1341 --
NM_014738chr1721110 59 ------
NM_014741chr1142185 862 805 724 --12116 --
NM_014743chr472676 2202 1252 985 949 835 374 11246 ----
NM_014746chr2144214 3747 3607 3142 3104 1657 1545 1478 1199 1169 1137 1058 1038 845 34077 3588 570 ----
NM_014750chr142190 25 ------
NM_014751chr831885 851 276 21608 230 ----
NM_014752chr1151939 1864 1575 772 551 3587 336 304 1656 --
NM_014755chr2114268 3771 3693 3364 3239 1465 1061 690 439 248 196 11703 22730 185 --
NM_014757chr562360 2178 1912 1616 1588 375 --178 --
NM_014758chr1162486 2456 653 151 140 129 --32344 1801 1682 1751
NM_014760chr321278 387 --11834 --
NM_014764chr123510 202 149 --1940 --
NM_014767chr1043595 3124 1328 1091 ------
NM_014772chr1841453 1413 678 387 12429 ----
NM_014774chr162044 930 878 779 362 115 2390 236 43146 2116 836 350 23266 181
NM_014779chr3--1260 41067 887 790 384 176
NM_014781chr87926 816 502 271 265 144 35 1162 ----
NM_014783chr1531237 318 136 --21542 337 --
NM_014790chr5--2418 365 ----
NM_014791chr93336 265 74 ------
NM_014795chr23879 479 312 4992 974 366 275 21273 508 --
NM_014800chr721045 223 ------
NM_014802chr121174 ------
NM_014803chr1062401 1933 622 458 89 83 2989 118 1851 1304
NM_014804chr174273 166 158 24 ------
NM_014810chr151000 857 459 377 324 33674 3363 1172 23538 536 --
NM_014812chr141715 788 778 195 --21996 755 --
NM_014819chr552470 2255 1919 1003 183 --2517 215 --
NM_014820chr331889 1766 1568 11386 31410 1403 451 --
NM_014822chr44680 529 453 106 ------
NM_014824chr1121499 197 ------
NM_014826chr194356 4124 3618 3490 3241 1571 944 863 59 44342 4061 2997 268 --13838
NM_014827chr131666 1520 202 2184 22 21193 194 --
NM_014828chr142652 207 ----1404
NM_014829chr582296 2283 2219 2187 2031 1970 1645 362 22212 351 2823 659 --
NM_014830chr1242759 1088 845 370 12748 22884 819 --
NM_014832chr1311370 21814 672 ----
NM_014835chr2062294 1976 1422 611 586 212 --12189 --
NM_014836chr1011846 1399 2136 58 --
NM_014838chr2252600 1080 801 736 628 22453 1089 22141 2076 1337
NM_014839chr151826 1598 753 725 420 ----1550
NM_014840chr1273405 2943 2686 2658 2487 1003 128 ------
NM_014841chr621247 512 1900 ----
NM_014844chr1454101 3719 3177 969 138 14216 ----
NM_014846chr83287 236 106 ------
NM_014848chr15102521 2510 2411 2265 2246 2126 2012 919 854 147 21010 766 1584 --
NM_014849chr11229 ----11179
NM_014850chr364549 3226 3171 1491 1267 1060 11162 --11472
NM_014857chr11243 --186 --
NM_014859chr1721336 359 --1267 --
NM_014860chr281994 1645 848 703 628 452 334 304 21980 165 1556 --
NM_014862chr1544074 3006 1130 410 13535 ----
NM_014864chr143249 2966 991 399 13210 --13104
NM_014871chr122580 96 --1606 --
NM_014872chr951970 1939 949 627 569 ------
NM_014873chr1134846 4626 4573 4538 4192 3748 3711 3387 3348 3299 1550 730 684 14495 1929 --
NM_014874chr141570 530 222 159 11782 1140 --
NM_014876chr2252120 1950 1911 1639 88 --21759 377 --
NM_014877chr17146882 6390 5498 5379 5082 4976 3022 3003 2886 2631 2405 1511 188 125 17228 37653 1479 1348 1936
NM_014883chr452373 2124 1558 207 131 11827 ----
NM_014888chr721431 35 2475 383 ----
NM_014890chr32263 103 2312 278 ----
NM_014891chr751650 1406 1272 1075 247 --1581 --
NM_014892chr6188 ------
NM_014893chrY62093 1942 1606 398 295 172 ----11540
NM_014895chr63697 310 259 1214 1563 --
NM_014897chr1763097 2836 2346 1158 1097 239 ------
NM_014899chr582539 2103 2073 1042 759 503 484 410 23041 2720 --1585
NM_014900chr271069 994 299 260 68 38 32 1732 --11050
NM_014901chr532202 2023 467 12008 ----
NM_014902chr2021502 1463 ------
NM_014903chr1242464 2250 1817 211 12235 22121 353 --
NM_014904chr1083945 3708 3639 3539 3447 3405 2827 1471 ------
NM_014905chr231537 816 30 11288 11842 --
NM_014906chr1774030 3240 3015 2955 2939 882 197 43742 3512 1610 751 23527 993 --
NM_014909chr1453938 3908 2897 1048 730 ------
NM_014912chr1083382 3076 2563 1157 978 776 517 229 13223 12601 11341
NM_014913chr1821474 1037 ------
NM_014917chr1--1821 ----
NM_014918chr1541583 1294 1189 442 1654 11595 11492
NM_014920chr6103721 2681 2653 2607 2374 1260 632 621 259 49 52970 2343 671 288 114 1766 --
NM_014923chr1342296 1943 739 125 41674 1439 170 36 1134 --
NM_014924chr1482959 2328 2105 1165 976 883 787 72 32599 1140 387 22236 922 12874
NM_014926chr321019 948 --1738 --
NM_014932chr341666 1522 1461 226 ------
NM_014933chr42378 308 --136 --
NM_014934chr1383091 3065 2679 1559 1342 1003 692 552 23991 1363 11516 --
NM_014936chr651111 917 620 138 94 ----11849
NM_014937chr1041267 868 267 233 --11284 --
NM_014938chr1272553 2527 2465 2410 1960 1858 818 --12434 --
NM_014942chr652438 1941 1739 1014 896 2859 523 ----
NM_014945chr531886 706 174 --11365 --
NM_014946chr253058 2979 1166 1071 954 133 1424 --
NM_014947chr142401 2065 1219 126 32305 825 104 12609 --
NM_014949chr12983 965 ------
NM_014950chr1431731 189 178 ------
NM_014953chr13113539 2854 2812 1472 1439 865 369 333 234 136 100 31285 948 113 13830 --
NM_014959chr1982179 1350 1298 1128 1097 834 824 184 33284 1119 511 32921 2328 1227 --
NM_014961chr452061 1871 784 777 503 --2858 285 --
NM_014962chr2062749 2427 2383 1943 1045 880 32358 2271 1067 21080 183 --
NM_014964chr1722117 1965 1761 ----
NM_014969chr141135 815 481 446 11042 ----
NM_014974chr1031224 253 106 ------
NM_014982chr14145445 4587 4327 4006 3831 3556 3360 1993 1942 1499 1350 707 238 96 11862 24641 4511 11765
NM_014988chr472229 2086 2009 1927 1742 1114 34 1381 ----
NM_014989chr662084 2010 1609 1439 1263 759 1680 31594 1380 39 --
NM_014990chr1441354 1164 887 367 ------
NM_014991chr4112853 2796 2282 2127 1132 664 539 514 323 294 238 ------
NM_014992chr141284 ------
NM_014994chr1542303 1617 337 195 ------
NM_014996chr341081 977 743 356 1422 ----
NM_014997chr732935 1027 175 12738 22705 1080 --
NM_014999chr1261387 1266 1247 1024 615 197 31563 1461 1071 ----
NM_015000chr1272871 2750 2479 2163 2106 2083 971 --12199 --
NM_015002chr1231600 1424 840 12080 21803 814 22168 802
NM_015008chr393649 3508 2657 2362 1364 715 575 548 219 12921 ----
NM_015009chr33584 311 247 ------
NM_015011chr1321099 449 ------
NM_015015chr191320 ------
NM_015017chr161090 1027 937 811 122 38 ------
NM_015020chr1653495 2395 1128 881 622 22778 1494 ----
NM_015023chr111669 --11853 --
NM_015024chr841242 1147 352 339 ------
NM_015025chr252653 762 505 462 197 32604 1931 1018 2863 445 --
NM_015026chr12214706 4699 4538 4461 4242 4132 4096 3978 3782 3768 3317 3094 3079 3068 2924 1712 1215 1059 620 330 134 13820 34751 4436 3062 --
NM_015027chr1631802 627 576 1251 ----
NM_015032chr1362931 2809 2512 2160 475 137 32436 2084 663 --1797
NM_015035chr2086422 6162 6155 5462 5301 5045 4299 849 ----11277
NM_015039chr174299 4207 3426 1696 898 674 110 13792 13265 14231
NM_015040chr273440 2909 2672 1241 1104 390 179 22902 2302 13328 --
NM_015042chr1564292 3714 3301 3082 2801 614 12811 24273 4241 --
NM_015044chr1692592 2370 2345 2291 2261 1223 1004 494 49 --1531 --
NM_015045chr1062125 1966 1816 1623 661 267 12020 12280 --
NM_015046chr962432 2258 2210 1876 646 598 11811 1362 11850
NM_015049chr273090 2625 2469 2262 2234 760 690 22591 2020 --13009
NM_015050chr621021 365 ------
NM_015051chr922833 567 22755 1160 --1241
NM_015052chr731084 353 26 --2503 433 --
NM_015057chr131702 --1101 --
NM_015059chr1543828 1091 573 318 ------
NM_015060chr7----1219 --
NM_015061chr94731 591 572 220 --1914 --
NM_015063chr1931168 1124 409 ------
NM_015064chr1253666 3344 2725 920 489 12486 128 --
NM_015068chr783333 2722 1583 1278 598 288 241 198 13490 ----
NM_015069chr16165 --1425 --
NM_015071chr5176554 6138 6127 6031 5878 5686 5379 4911 2020 1846 1664 1443 866 807 782 298 75 46247 5593 4941 2303 --15985
NM_015072chr141387 ------
NM_015073chr1921848 607 ------
NM_015074chr1114805 4577 4543 4346 4011 1975 1019 442 348 138 116 1475 ----
NM_015076chr674303 4197 3627 1819 1646 1551 100 1538 ----
NM_015087chr1352481 2325 2263 1901 857 --32283 994 573 --
NM_015090chr164164 4134 2199 1573 920 373 --130 --
NM_015091chr141171 1633 ----
NM_015092chr16164425 4408 4343 4256 4116 3551 3269 3205 1871 1837 1548 1310 1177 965 719 666 33512 1849 1226 34632 3412 2851 --
NM_015093chr631625 1216 449 ------
NM_015097chr342254 840 391 285 21878 1851 1433 --
NM_015100chr131561 560 232 ----11744
NM_015102chr12166 102 ------
NM_015103chr33820 719 290 --1757 --
NM_015107chrX82271 1549 759 662 630 598 460 398 --31514 734 182 --
NM_015110chr962295 2074 1871 1734 1544 369 21827 824 ----
NM_015115chr432444 2210 1974 22010 389 11137 12814
NM_015116chr1351739 1639 1391 484 203 ------
NM_015120chr22280 69 ------
NM_015124chr2222449 828 ------
NM_015125chr193485 422 97 ------
NM_015129chrX71681 391 327 241 205 136 33 ------
NM_015130chr421126 913 11059 --1487
NM_015132chr781891 1538 1527 1394 1312 462 280 31 ----11251
NM_015135chr71183 ----160
NM_015137chr852396 1803 881 385 184 42510 1816 626 265 ----
NM_015138chr1562660 1958 1849 1050 633 150 11835 12312 12867
NM_015141chr382468 1918 1803 1076 753 597 544 386 32397 2070 1930 22011 502 --
NM_015143chr431328 258 94 2424 52 ----
NM_015144chr1673976 3950 3406 3241 2562 1596 120 --23793 255 --
NM_015149chr131749 1418 385 --2655 600 12086
NM_015151chr2151029 790 656 387 331 --1966 --
NM_015153chr62618 612 ------
NM_015155chr1072952 2861 2739 2630 2393 1045 747 32827 2082 1211 ----
NM_015156chr14113996 2990 2799 2791 2554 1428 1311 1292 498 415 191 13196 1398 --
NM_015161chr1621437 467 1954 21541 1507 1974
NM_015163chr1431667 259 205 11680 ----
NM_015170chr822308 594 ------
NM_015172chr111574 --1278 --
NM_015176chr151698 1102 695 383 198 11274 21628 402 --
NM_015185chrX41106 926 809 526 --1298 --
NM_015186chr94433 132 105 83 1456 ----
NM_015191chr1121799 1100 --1912 --
NM_015192chr20132992 2947 2774 2760 2325 2303 2287 2065 2007 1023 911 638 495 32677 2263 2171 11999 --
NM_015198chr731082 400 103 11173 ----
NM_015199chr392939 2574 2532 2450 1886 978 968 664 68 11866 22873 478 --
NM_015200chr431601 1032 106 2780 718 1558 1417
NM_015203chr1124 ------
NM_015206chr1553800 2877 2817 1146 217 23074 2895 2992 325 --
NM_015208chr1853838 3386 1514 1437 1125 32826 1344 150 ----
NM_015215chr152516 2444 819 328 205 1801 22721 2250 --
NM_015216chr52349 83 --11533 --
NM_015225chr972260 1072 925 658 289 256 187 --52116 2095 2005 1199 99 --
NM_015231chr114951 892 319 32 1979 ----
NM_015233chr1332036 1870 404 ------
NM_015234chr62914 309 ------
NM_015236chr4----21439 1254 --
NM_015245chr652637 953 905 665 139 --12119 --
NM_015247chr16145419 5183 4963 4847 4172 3841 3597 3481 1423 1329 1315 983 395 191 13960 45202 1995 1356 660 24981 4181
NM_015252chr25904 870 778 343 98 135 --2133 122
NM_015254chr853216 2761 2538 2488 1052 11083 --11039
NM_015256chr52581 256 ------
NM_015264chr2294540 4046 3555 3270 3226 3002 1788 1720 907 --21293 518 --
NM_015265chr271970 1960 1749 1009 969 556 540 22367 258 ----
NM_015267chr1221772 1584 --31915 1825 203 --
NM_015269chr11461 ------
NM_015270chr1222077 1776 ------
NM_015271chr483290 2977 1613 1485 520 487 457 24 13576 23028 1330 --
NM_015272chr1671783 1761 567 389 301 292 160 --1333 1540
NM_015275chr1222120 735 21326 617 1180 --
NM_015277chr186588 499 469 448 367 53 ----1538
NM_015278chr653213 2854 2437 559 356 12550 --11221
NM_015282chr242967 398 351 333 12725 ----
NM_015284chr162072 1987 1322 1315 417 410 ------
NM_015285chr1852518 1925 1794 366 142 11846 ----
NM_015288chr583510 3411 2617 1290 1258 722 431 73 --13387 --
NM_015291chr183389 2976 2607 2416 2353 2343 1147 1141 --11125 --
NM_015294chr1731149 1127 720 ------
NM_015296chr131868 21104 944 ----
NM_015299chr1473768 3752 3558 3442 2799 1075 726 11394 1137 --
NM_015308chr112766 152 1799 ----
NM_015310chr8247595 7220 7168 6978 6810 6639 6194 6120 6046 5989 5973 5922 5808 5751 3260 3139 3098 3082 2616 1828 1498 1207 701 665 28101 3048 ----
NM_015313chr11104802 4679 4493 4217 3767 3549 3378 3045 892 251 44652 4471 3649 377 23401 1678 --
NM_015315chr543216 2598 2517 153 ------
NM_015316chr142200 49 1116 1256 --
NM_015317chr2122786 2526 2490 2225 2193 2068 2038 1976 1842 1050 779 140 --12582 12237
NM_015321chr1954302 3985 3437 940 405 ------
NM_015323chr62339 37 21148 396 ----
NM_015326chr153001 2781 2133 904 894 32018 481 445 1888 --
NM_015327chr111343 ------
NM_015328chr793048 2776 2712 2605 2426 2381 1946 1226 925 ----1628
NM_015329chr1942219 2102 1830 528 --11068 --
NM_015331chr13580 214 40 ------
NM_015335chr1262660 2650 2458 1645 880 595 --11830 12607
NM_015336chr1272594 2398 2027 2012 1988 191 151 11791 31844 1696 830 --
NM_015344chr841978 732 326 135 ------
NM_015345chr652768 2631 1075 981 88 ------
NM_015346chr1441730 1542 345 142 21666 360 ----
NM_015347chr1272781 2750 2538 2272 2174 1903 690 42347 1155 1078 404 --11922
NM_015349chr682918 2896 2623 2404 2006 1229 1042 285 1928 21914 426 11901
NM_015355chr175767 699 374 192 158 2224 46 1356 --
NM_015358chr2111126 ------
NM_015360chr51180 ------
NM_015361chr22737 647 --1698 --
NM_015365chrX93943 3880 3609 3077 3047 2988 2609 1273 561 34172 1490 825 23857 3002 31126 747 100
NM_015381chr2241716 1566 1352 461 --1825 1739
NM_015382chr142702 264 1227 ----
NM_015385chr1073131 2831 2606 759 277 253 240 ------
NM_015387chr231857 361 154 164 --1745
NM_015393chr463653 3314 2425 1119 1089 347 12846 1298 --
NM_015396chr331052 265 170 --1305 --
NM_015397chr921342 775 11797 11440 --
NM_015409chr1242694 1860 728 316 2144 62 ----
NM_015415chr12224 214 ------
NM_015429chr361106 419 368 350 315 226 1189 --1860
NM_015431chr1123239 3158 2753 2607 2587 2280 1429 1240 841 621 238 94 1730 ----
NM_015435chr871336 1191 570 553 495 129 73 ------
NM_015436chr442225 1047 914 34 12649 33384 3243 2118 --
NM_015443chr17----21112 137 --
NM_015446chr161569 1507 1336 525 435 340 ------
NM_015449chr13523 232 192 ----1569
NM_015455chr583384 3169 3049 1458 1379 1314 1106 34 33413 1400 395 1655 12714
NM_015457chr112300 105 ----11117
NM_015458chr8154688 4217 3940 3517 3470 3376 1756 1616 1475 1347 1322 486 279 211 78 35099 1257 242 1518 1297
NM_015463chr23782 274 265 --149 --
NM_015464chr72920 96 ------
NM_015466chr31208 ------
NM_015472chr32209 97 ------
NM_015472chr32209 97 ------
NM_015475chr22422 21 ------
NM_015477chr153964 933 367 ------
NM_015483chr72135 48 --1745 --
NM_015484chr13792 311 184 --1239 --
NM_015488chr211621 11399 1564 --
NM_015497chr152463 313 --11152 --
NM_015503chr161612 ------
NM_015508chr331041 184 112 --1125 --
NM_015509chr1241373 1352 1221 88 --21395 1147 --
NM_015511chr2021127 66 ------
NM_015516chr1141286 1203 474 278 11169 1927 --
NM_015520chr352106 1775 1059 922 319 1832 ----
NM_015523chr111250 ------
NM_015525chr611185 127 ----
NM_015528chr171172 ------
NM_015530chr22790 625 --1925 --
NM_015534chr111032 ------
NM_015535chr273958 2853 2739 2695 1617 411 134 1231 ----
NM_015542chr1021126 286 ------
NM_015548chr631006 709 360 1940 ----
NM_015550chr783513 3484 3340 2631 2417 1425 1146 107 22302 545 13407 --
NM_015553chr6135165 4033 3708 3564 3401 3249 1367 1235 1113 988 730 407 74 1647 ----
NM_015554chr1572474 2451 2436 2265 2114 935 245 183 --12927
NM_015564chr593577 3387 2714 2705 2543 2497 2250 2228 1154 --22892 2581 --
NM_015565chr2142114 1584 605 103 21964 1405 ----
NM_015567chr134931 853 305 215 ------
NM_015569chr1174724 4703 4595 4529 4464 4331 3826 3680 3449 3169 3092 1810 1623 1112 870 843 259 --13810 --
NM_015570chr751441 1318 669 460 153 --1229 --
NM_015571chr6102365 2257 2056 1922 1778 1746 903 822 687 223 --129 --
NM_015575chr293575 3062 2722 2329 2237 1260 927 360 84 --33225 840 174 13635
NM_015576chr3132954 2604 2498 2464 2264 2156 1895 1088 656 361 317 200 171 --1297 --
NM_015577chr531844 1684 1533 11280 ----
NM_015578chr1951737 1449 795 176 148 32034 1463 697 11284 --
NM_015584chr1731349 1156 341 1543 ----
NM_015602chr161821 1183 1169 1128 440 54 11254 ----
NM_015605chr1081480 992 601 591 512 467 263 56 ------
NM_015609chr172501 914 590 451 433 321 313 12969 ----
NM_015610chr752511 2293 775 289 179 --42279 1774 536 337 --
NM_015626chr171135 ------
NM_015630chr22370 336 2844 782 ----
NM_015635chr932090 768 261 31846 863 125 ----
NM_015640chr1205167 4842 4721 4656 4162 3721 2072 1571 1435 1308 1119 1015 950 807 735 719 577 554 354 274 24323 1618 --1760
NM_015641chr761298 1169 991 939 300 257 --1145 --
NM_015642chr32112 106 ------
NM_015646chr1241286 519 339 174 1323 11163 --
NM_015652chr10--1540 ----
NM_015657chr24807 713 305 47 194 ----
NM_015660chr72268 226 ------
NM_015678chr1371370 1196 680 657 464 428 377 ----1158
NM_015686chrX31849 991 498 --12290 --
NM_015691chrX62788 1961 1147 427 358 115 --22386 1847 --
NM_015695chr641902 1835 466 26 --11434 --
NM_015714chr11368 --2361 294 --
NM_015716chr173487 478 294 1501 ----
NM_015726chr131248 570 99 ----11212
NM_015831chr71322 ------
NM_015833chr2152194 1973 1808 433 352 11529 ----
NM_015840chr192502 2385 1805 800 701 449 332 297 157 1645 ----
NM_015841chr192502 2385 1805 800 701 449 332 297 157 1645 ----
NM_015845chr182782 204 ------
NM_015859chr141171 ------
NM_015866chr111183 11519 11047 11022
NM_015869chr31171 ------
NM_015872chr121480 323 --11715 --
NM_015874chr41420 ------
NM_015878chr862221 1746 1606 1426 1361 699 ------
NM_015879chr18228637 8532 7986 7301 6982 6901 6491 6342 6243 6231 6209 3324 2807 2497 2125 1870 1417 1349 1178 572 305 111 58014 7082 2863 2373 2153 37448 2842 2585 18240
NM_015885chr112615 357 1153 ----
NM_015886chr8145063 5048 4695 4398 4377 4092 2170 1806 1738 1687 1510 1425 1279 676 1688 14532 15570
NM_015888chr1113126 2364 2326 2164 2116 2097 1097 1081 1061 826 804 ------
NM_015891chr652080 1796 768 173 34 11419 11436 --
NM_015902chr86928 850 799 668 632 63 --1888 --
NM_015905chr71157 ------
NM_015906chr193904 3092 3031 1875 1409 1325 965 547 372 44356 3833 1939 1854 11503 1496
NM_015907chr41258 ------
NM_015912chr831746 714 85 --12116 --
NM_015916chr10138 ------
NM_015938chr32424 370 1895 ----
NM_015948chr61111 --1373 --
NM_015975chrX61333 1242 673 566 456 267 1723 1498 1375
NM_015976chr1------1327
NM_015981chr551045 781 775 623 128 ------
NM_015982chr17------1373
NM_015986chr1751422 1389 1286 1007 136 11061 ----
NM_015990chr441116 1034 389 80 ------
NM_015994chr147718 698 454 258 233 178 151 149 ----
NM_015995chr1585572 5293 4052 3978 1908 1183 950 811 --14599 --
NM_015999chr12268 177 --1147 --
NM_016002chr11740 1638 ----
NM_016003chr752511 2293 775 289 179 --42279 1774 536 337 --
NM_016004chr20----1197 --
NM_016009chr184587 4233 3768 3551 3391 1461 1451 779 24889 3166 1259 --
NM_016021chr662941 2718 624 608 378 297 32569 2422 1979 32761 2156 635 12318
NM_016022chr111045 ------
NM_016023chr852103 1992 875 822 369 21920 1662 1849 --
NM_016025chr161549 21791 1360 --11235
NM_016032chrX51217 913 873 563 150 ------
NM_016038chr74587 422 252 107 ------
NM_016039chr14131 ------
NM_016040chr192367 2354 2311 1052 754 647 620 258 153 ------
NM_016041chr17192 1129 1382 --
NM_016045chr2051697 1413 1184 669 433 ------
NM_016057chr1241316 1176 501 298 ------
NM_016059chr62246 92 1160 1717 --
NM_016061chr251250 1143 1093 422 60 1390 ----
NM_016072chr1252444 1735 1712 1572 517 32219 972 470 ----
NM_016073chr151377 2735 181 ----
NM_016075chr1343212 2699 941 624 1298 --23180 3170
NM_016076chr173235 3163 2862 2067 999 804 168 ------
NM_016078chr172342 116 1830 ----
NM_016079chr252127 1927 1840 904 195 --32041 305 97 21727 54
NM_016081chr461863 1685 1464 825 762 107 --12182 --
NM_016083chr6173763 3666 3202 3056 2876 2790 2687 2617 2608 2402 1492 1411 1171 1019 749 557 138 12829 1393 --
NM_016087chr721597 404 ------
NM_016090chr112841 770 4431 262 253 39 ----
NM_016094chr34700 195 65 36 ------
NM_016096chr832045 305 132 11487 --11905
NM_016099chr861352 287 267 145 128 24 11325 1194 --
NM_016100chr20--1103 ----
NM_016103chr51363 ------
NM_016106chr14131 ------
NM_016107chr541271 896 427 45 --11365 --
NM_016122chr12187 165 ----
NM_016123chr1231234 1099 475 --154 --
NM_016124chr141381 1276 1056 185 ------
NM_016127chr82499 55 ------
NM_016129chr41377 ------
NM_016131chr272361 2158 1511 753 736 472 228 11694 179 --
NM_016132chr1582804 2407 2343 2237 1261 968 785 64 --42837 2148 1100 256 12253
NM_016133chr211373 11655 ----
NM_016141chr3121 --2225 157 --
NM_016144chr53232 191 130 1656 ----
NM_016147chr1121000 882 --21139 813 --
NM_016152chr341200 848 217 74 ------
NM_016162chr122863 661 ------
NM_016169chr1063232 2878 2569 2026 1084 998 ------
NM_016185chr171850 2319 114 ----
NM_016200chr72271 243 2282 150 ----
NM_016201chr351998 1676 611 590 69 ------
NM_016205chr411330 1967 ----
NM_016206chr3178947 8743 8416 8234 7806 6260 6159 6008 5889 5832 5493 2275 1975 1880 1836 294 194 25689 5634 39008 1645 1600 --
NM_016211chr42378 308 --136 --
NM_016213chr15------1180
NM_016217chr663561 3087 2632 1396 579 117 42970 1372 1336 48 ----
NM_016224chr682132 1745 1702 1689 1568 1517 1364 414 ------
NM_016226chr123387 345 93 ------
NM_016227chr131228 1189 200 1227 ----
NM_016230chr63490 341 78 ------
NM_016231chr1761688 1678 1584 1270 404 131 ------
NM_016248chr13153934 3861 3451 3441 3348 3198 2973 2957 2575 2433 1479 1438 511 176 143 43537 3265 3019 736 13717 --
NM_016252chr21929 ------
NM_016255chr693000 2848 2703 2681 2317 1165 309 277 257 22421 2304 21226 969 --
NM_016258chr13792 691 549 ------
NM_016260chr2157475 7039 5862 2459 2357 2083 2077 1873 1707 1420 1362 1023 748 300 266 45389 1622 949 724 22206 851 16905
NM_016262chr6269 24 ------
NM_016269chr421198 1168 1998 11084 --
NM_016270chr192421 353 ------
NM_016271chr1852277 1687 1494 905 337 52064 1650 343 265 120 ----
NM_016272chr2232233 2138 609 ------
NM_016275chr332586 931 301 32631 860 467 ----
NM_016277chr681488 1315 1224 1190 1160 624 612 430 --11066 11647
NM_016281chr1231124 1032 1000 11104 --188
NM_016282chr941714 1210 589 118 21330 657 ----
NM_016284chr163958 234 189 ------
NM_016287chr131628 1477 696 21821 207 11908 --
NM_016289chr222284 693 31451 707 129 11954 --
NM_016298chr351245 760 519 401 300 1771 12378 --
NM_016299chr10185 ------
NM_016303chrX190 ------
NM_016306chr31373 ------
NM_016308chr141940 1436 527 364 2502 344 ----
NM_016315chr241673 1368 326 210 41737 1634 475 72 ----
NM_016316chr22581 526 ------
NM_016322chr983168 3070 2485 1195 800 571 519 62 22973 1099 --1623
NM_016329chr32517 132 ------
NM_016333chr161480 ------
NM_016338chr551076 1050 1034 127 98 ------
NM_016340chr541263 1186 1107 954 --1237 --
NM_016351chr72632 584 --1165 --
NM_016352chr741183 1102 416 321 ------
NM_016356chr692563 2538 2486 2419 635 578 454 275 192 32477 2272 316 22868 2448 --
NM_016357chr1221245 887 2423 221 ----
NM_016374chr161395 1269 1080 396 153 24 11224 152 --
NM_016374chr161395 1269 1080 396 153 24 11224 152 --
NM_016376chr17124020 3833 3154 2782 1617 1447 1183 798 782 681 320 155 13393 ----
NM_016377chr651774 1310 1237 343 133 1593 --1374
NM_016396chr1532567 489 97 32433 1905 411 2655 399 --
NM_016410chr91412 ------
NM_016418chr2263737 2533 2423 1103 1072 93 13153 13716 --
NM_016422chr1142689 980 458 177 --1104 --
NM_016424chr1771931 1913 1774 1517 1474 188 55 --1467 --
NM_016436chr20102549 2318 2183 2125 1094 763 753 552 450 283 2993 985 1163 --
NM_016441chr252422 2257 1696 1677 671 --21899 182 --
NM_016442chr572287 2207 2144 1865 1795 889 568 1559 ----
NM_016448chr171806 1790 1621 1231 275 256 130 ------
NM_016456chr12125 77 ------
NM_016472chr1441529 512 378 114 ------
NM_016475chr1421173 1118 --11002 1321
NM_016480chr51322 ------
NM_016485chr651524 855 613 379 189 ------
NM_016486chr13481 421 198 1459 ----
NM_016487chr6173 ------
NM_016489chr71213 --1394 --
NM_016505chr12691 506 --1656 --
NM_016507chr1782950 2772 2159 924 620 591 572 147 --22420 662 --
NM_016513chr6103721 2681 2653 2607 2374 1260 632 621 259 49 52970 2343 671 288 114 1766 --
NM_016516chr23734 234 186 1335 1859 --
NM_016522chr1131395 451 164 1606 11327 11071
NM_016525chr92265 245 ------
NM_016529chr1321055 1020 ------
NM_016530chr1593569 2890 2844 2537 1352 857 715 352 291 33762 2605 654 --13180
NM_016531chr494125 3672 3583 3354 2611 790 725 223 82 34156 3462 98 ----
NM_016532chr173928 341 193 ------
NM_016536chr191224 ------
NM_016538chr175359 134 125 111 32 ------
NM_016542chrX21093 306 1168 ----
NM_016547chr11551 1733 ----
NM_016548chr991552 1519 1154 1068 640 618 487 195 145 ------
NM_016559chr351365 1344 1283 1155 1070 1987 ----
NM_016577chr354376 4364 3662 1375 324 1238 23905 1286 --
NM_016584chr121278 ------
NM_016587chr71182 11094 ----
NM_016588chr6----1287 --
NM_016591chr54909 460 422 292 ------
NM_016603chr532135 1731 116 11977 ----
NM_016604chr531258 1247 1204 --1952 --
NM_016605chr552301 2221 2202 2127 652 --12761 12356
NM_016607chrX51322 1314 306 187 51 --11202 --
NM_016612chr82664 84 ------
NM_016613chr462486 1989 1971 840 200 45 22782 807 21895 1792 --
NM_016618chr22203 182 --184 --
NM_016620chr1------11293
NM_016621chr1154264 3960 3216 3120 1462 24622 1040 13189 --
NM_016623chr83667 522 496 ------
NM_016626chr1811262 ----1370
NM_016628chr105756 729 665 584 68 --1613 --
NM_016631chr213669 348 220 ------
NM_016641chr1641487 1251 654 136 1368 ----
NM_016644chr52549 70 ------
NM_016651chr1421129 83 197 ----
NM_016653chr231254 452 250 ------
NM_016654chr1531181 505 31 2900 171 21343 1081 --
NM_016823chr1721090 848 ------
NM_016824chr1021271 368 1177 ----
NM_016834chr1753316 3217 2704 1638 133 13301 1977 --
NM_016835chr1753316 3217 2704 1638 133 13301 1977 --
NM_016841chr1753316 3217 2704 1638 133 13301 1977 --
NM_016936chr1621866 27 ------
NM_016937chrX1305 ------
NM_016950chr441486 1423 1271 1256 21210 601 ----
NM_016952chr1142487 1289 1119 751 --12714 --
NM_016953chr2126075 6010 5736 5636 5534 4926 4832 4748 1722 1204 313 225 --33837 1520 52 26113 5894
NM_016954chrX2592 494 ------
NM_017412chr831372 899 266 1285 ----
NM_017415chr5114230 3809 3785 3727 3055 2909 2823 1664 1172 973 565 21348 575 31747 1591 941 11016
NM_017420chr1493438 1181 913 807 510 406 204 83 76 23484 3459 --11249
NM_017423chr461902 1468 872 808 667 633 22090 1778