TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4796-5p
miRNA Sequence: UGUCUAUACUCUGUCACUUUAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1143451 1009 745 607 1944 33513 3183 1387 23067 2487
NM_000052chrX63262 3144 2596 1360 520 87 --13455 13168
NM_000084chrX115071 4834 4764 4685 4376 2768 2448 2158 2008 1607 713 36882 1195 773 16050 25460 1269
NM_000217chr12105022 4875 4832 4073 1684 1587 966 492 114 97 35014 518 507 23256 1308 --
NM_000259chr15116407 6383 5405 5173 4167 4053 2346 1786 557 371 179 15957 24617 595 --
NM_000332chr645284 4979 2710 2525 ----21028 651
NM_000337chr586569 6486 6024 5284 4576 4169 2250 566 21528 490 --16550
NM_000618chr1275216 4523 4210 4143 1223 826 248 14974 36304 4540 328 24030 2528
NM_000618chr1275216 4523 4210 4143 1223 826 248 14974 36304 4540 328 24030 2528
NM_000809chr4109118 8620 7617 6795 6548 1984 1652 1191 1079 995 --17973 13489
NM_000814chr1564048 3160 1438 904 870 232 24186 662 --1274
NM_000945chr211586 ----2479 341
NM_001003679chr161939 1700 446 198 172 59 1370 --1513
NM_001003712chr1283538 3521 2940 1335 856 833 658 130 22636 477 33944 2984 2856 --
NM_001004065chr973403 3336 3120 1602 1196 858 83 12540 33530 2550 126 --
NM_001004317chr654490 3611 1270 283 63 --1335 2407 293
NM_001004419chr1294269 4228 3768 3514 3373 3335 2842 1312 1279 2607 601 14452 --
NM_001005473chr576568 5906 5055 4361 2560 1313 661 ----25965 2095
NM_001008539chr854752 4299 3337 2127 938 ----24378 4356
NM_001008925chr493522 3484 2754 2392 1008 722 354 225 77 12195 ----
NM_001009899chr366286 4535 1346 1312 716 357 ----36507 6131 392
NM_001010922chr173393 2823 1514 1368 1224 1216 1194 ----14012
NM_001012968chrX51129 1012 724 475 279 --21922 1802 11792
NM_001013620chr12117990 7939 7742 6470 6368 5496 2513 2485 2113 1484 32 31807 1165 558 12964 --
NM_001030055chr1473375 1409 1270 933 863 452 326 ----11877
NM_001039091chrX2876 447 ----21276 425
NM_001039547chr3136939 6732 6274 5917 5193 5084 4943 3225 1794 1625 1388 1338 1185 26243 4971 13010 13113
NM_001039840chrX75413 4734 4335 4114 693 651 60 ----21794 250
NM_001040284chr1654076 655 521 509 328 25522 1682 24216 2007 --
NM_001040402chr442116 2083 1280 686 --12949 1599
NM_001040665chr764948 3429 3245 1641 1440 893 ----21703 312
NM_001040712chr953408 2610 2475 687 659 1963 --1939
NM_001042506chrX1543 ----21428 1414
NM_001042555chr1244551 1916 704 160 13283 3787 391 100 12966
NM_001042604chr394872 4733 4475 3924 3593 3572 1377 1272 969 23314 1900 --14546
NM_001099678chr345508 1769 1687 1187 24410 1464 24613 2270 16319
NM_001106chr3109255 9111 7937 7706 7059 6381 6120 3044 987 718 17615 18016 13599
NM_001173chr1473375 1409 1270 933 863 452 326 ----11877
NM_001201chr453975 3703 3118 1091 150 13286 156 21177 228
NM_001204chr2117595 7449 5901 5840 5409 2656 1545 1052 986 972 142 27301 6465 25805 525 15794
NM_001219chr752234 1865 1578 551 220 ----2758 326
NM_001546chr63546 453 419 21265 587 --1513
NM_001918chr1149312 8932 8451 7862 7514 7486 5743 3607 2357 1517 1230 1203 807 215 12934 16367 --
NM_002006chr445343 4139 1767 1713 14374 34048 1698 1147 13588
NM_002015chr1362707 2688 2631 1221 616 227 1791 12681 11069
NM_002270chr595666 5211 5166 4639 4532 3541 2208 2100 1342 11069 14361 --
NM_002336chr1234701 3781 1437 1429 13183 24606 989
NM_002397chr551660 1508 844 412 240 2343 300 1425 12012
NM_002655chr885325 4136 3672 1723 1394 1011 816 260 --23565 1483 15077
NM_002737chr17126526 5610 5443 2479 2131 1517 1478 1461 1157 975 240 113 36034 5681 2355 16190 --
NM_002760chrY115313 4233 4201 4053 3790 1398 1040 537 465 331 324 14437 1423 11769
NM_002765chrX2876 447 ----21276 425
NM_002834chr1243967 348 269 34 ----23268 252
NM_002839chr953408 2610 2475 687 659 1963 --1939
NM_003034chr1277871 7793 7146 5555 3107 2457 1859 12864 17167 27364 1135
NM_003046chr854752 4299 3337 2127 938 ----24378 4356
NM_003199chr1895331 5275 4435 4093 3951 1544 1364 967 773 15282 21961 618 13780
NM_003298chr396140 5934 5654 5583 5540 5211 5019 4878 4110 --11250 1390
NM_003338chr1041538 1306 630 564 --31719 1398 438 1761
NM_003342chr1762850 2771 2764 2756 2522 794 --12823 --
NM_003392chr364150 3792 3239 2761 271 51 13844 --13454
NM_003468chr254341 2707 2661 753 657 --11364 24018 3453
NM_003574chr18105710 5267 5258 4867 4231 3697 2300 1454 1283 1088 --1130 25439 4077
NM_003590chr293583 3466 2991 2702 1580 1472 783 208 50 13645 11316 1813
NM_003615chr383887 3504 3298 1175 1006 760 552 498 ----22594 32
NM_003692chr95957 871 857 641 279 ----1627
NM_003884chr341658 277 210 204 11648 1503 11745
NM_003913chr674234 4185 4141 4057 3419 2933 1707 23398 2973 2800 204 --
NM_003921chr151602 1503 1457 467 310 11829 --21780 507
NM_004133chr872452 1905 1749 839 480 474 228 ----1513
NM_004171chr11209070 8831 7115 6995 6650 6520 6434 6143 5924 3454 3161 2745 2401 2267 1632 1581 1570 1556 1138 758 18175 68118 7038 6946 3105 2936 1666 12367
NM_004232chr1883617 2985 2872 2754 2647 2470 970 805 23374 2657 ----
NM_004440chr621980 1752 --2295 145 11345
NM_004586chrX94576 4187 3596 3320 2123 2067 1166 369 328 33774 1034 377 ----
NM_004744chr4123846 3620 3402 3331 2922 1569 900 889 811 761 609 58 12953 13709 --
NM_004815chr1114944 4785 4176 3500 3327 3179 1605 1405 1174 1054 100 24768 3556 13923 --
NM_004999chr684520 4123 3821 3466 2989 2972 2864 2783 23575 1773 23032 978 1478
NM_005188chr11107577 7571 7240 5646 3288 3215 2998 2018 840 300 11112 36882 6199 5871 1788
NM_005359chr18104866 2517 2100 1791 1742 1656 1570 1542 1493 1208 11475 16263 15443
NM_005504chr1276451 6221 5062 2413 2311 766 85 16565 2840 683 36133 4108 1842
NM_005596chr9115869 5774 5592 5009 4804 4699 1901 1192 779 382 239 24436 2028 --13971
NM_005668chr584498 3433 3348 3070 1679 1415 1103 1017 23998 3950 --13975
NM_005725chr122118 726 ----22215 2194
NM_005746chr742361 838 611 584 ----21046 115
NM_005840chrX117510 7457 6598 5820 4749 2861 2536 1699 1520 713 61 25292 1129 55107 2834 2812 1938 1290 --
NM_005909chr534191 1398 1025 33898 933 556 23085 734 11035
NM_005966chr2101936 1804 1777 1594 960 854 513 368 328 258 --11715 --
NM_006095chr474302 3402 3370 3215 3036 2778 1495 23827 134 --1159
NM_006252chr187447 7134 6985 5724 2608 2533 2102 182 1224 --22505 1848
NM_006256chr142154 1964 1756 907 --22609 2345 12628
NM_006380chr1794239 4215 4118 2903 1589 1077 738 635 472 1862 --13873
NM_006544chr14115511 5004 4965 4649 4319 4086 1042 996 868 713 246 --11329 1638
NM_006599chr1686630 6506 6390 5968 5945 5028 2032 126 17357 --16971
NM_006628chr15104611 3165 3109 1636 1222 1081 922 885 637 159 ----13710
NM_006654chr1244551 1916 704 160 13283 3787 391 100 12966
NM_006750chr1687647 6749 6723 5645 5160 2934 2221 1050 35284 5034 1173 17981 --
NM_006766chr862367 2141 2130 1880 109 81 1322 1677 11672
NM_006924chr1784123 4023 3673 3288 2951 952 931 25 1203 13643 1367
NM_007038chr21125594 5573 4530 4318 4254 3706 2402 1841 1748 777 665 205 33720 2443 1224 ----
NM_007195chr1863679 3486 2911 2859 998 655 2708 94 23573 867 1450
NM_007203chr973403 3336 3120 1602 1196 858 83 12540 33530 2550 126 --
NM_007249chr13179395 8767 8741 7702 7329 7286 6558 6509 6452 6171 3731 3406 3128 3104 2459 2375 748 16002 --26992 6704
NM_007347chr1573026 2894 2726 2612 1042 723 277 23157 51 --1598
NM_012156chr2032844 398 166 1868 --2176 160
NM_012193chr1185332 4937 4743 4506 4438 3795 3463 767 --23366 1395 12150
NM_012214chr276054 5221 4867 4706 4272 443 114 --4838 627 392 378 --
NM_012262chr155172 4031 2028 1645 1413 35114 4539 1973 1891 13464
NM_012287chr354415 3490 3358 1147 647 13328 --21673 240
NM_012333chr151533 1256 1231 1204 93 ----21272 410
NM_012334chr573758 3609 3535 3316 1812 1259 1029 ----23912 1867
NM_013255chr7168899 8852 8824 8197 8155 8067 7489 6571 5653 3116 2416 2235 1452 1370 1156 1097 --18704 --
NM_013269chr1294196 4155 3695 3441 3300 3262 2769 1239 1206 2534 528 14379 --
NM_013447chr1953245 1009 515 283 141 11149 23147 225 33528 3480 3389
NM_013943chr1103240 2945 2884 2644 2246 1130 1038 671 604 79 32425 2307 138 1329 --
NM_014021chr193174 2931 2924 2670 2537 2291 770 394 288 1501 1243 --
NM_014155chr1177580 6848 3016 2317 1939 1431 1162 34894 2471 1983 11683 11388
NM_014243chr441737 706 604 399 --21565 98 1736
NM_014421chr432036 1310 167 11324 21640 127 11511
NM_014423chr5115651 5462 5005 3851 3442 1866 1714 1453 1355 1118 1061 ----23970 409
NM_014707chr731397 240 124 --1593 21526 156
NM_014810chr153652 3213 2504 993 134 2471 422 22810 1323 1360
NM_014828chr1462487 2247 1945 1927 1612 162 12106 12313 1830
NM_014892chr6--159 --2418 168
NM_014904chr10113665 3552 3505 2601 2462 1432 695 661 392 337 291 --12995 1514
NM_014982chr1494738 3470 3416 1851 1675 1311 768 510 439 ----13903
NM_014989chr621737 1511 11801 11661 21769 1605
NM_015032chr1362321 2203 2066 1160 386 199 12910 --2890 237
NM_015076chr674334 3775 3557 3010 1101 703 689 ----14134
NM_015087chr1362046 2038 1037 637 567 406 32083 978 64 --12130
NM_015115chr442116 2083 1280 686 --12949 1599
NM_015137chr882401 2315 2267 1845 959 694 394 195 2548 510 11821 --
NM_015310chr8118227 8211 6913 6054 5941 5526 2333 2325 2159 1368 894 ----18187
NM_015381chr2241691 1669 478 214 ----21961 1783
NM_015878chr841644 768 627 559 22193 1441 1639 1870
NM_015886chr895146 4749 3656 1636 1452 1414 417 372 66 ----24927 1905
NM_015906chr184777 3741 3249 3180 2945 1639 1261 905 23944 169 --24435 1513
NM_015912chr862258 2197 2064 1795 476 186 ----22356 1581
NM_016953chr286018 5406 2026 1152 1018 925 736 376 21947 1731 12074 16063
NM_017563chr384577 4218 4185 2417 2348 1639 507 206 25436 4434 --25603 5216
NM_017629chr151459 1344 471 307 209 41646 1479 654 200 ----
NM_017637chr9118839 7709 6745 6685 5814 3707 3518 2721 2693 2220 949 37261 3730 1428 ----
NM_017644chr354568 3531 3154 2084 381 21817 1704 25007 4024 11942
NM_017658chr1474423 4132 3668 3615 3361 3290 1772 1426 --1310
NM_017769chr1442761 2538 359 277 ----32073 766 233
NM_018036chr1464372 3847 2759 1783 1063 197 13735 --13581
NM_018098chr331025 380 27 2890 388 11121 139
NM_018257chr2052579 2367 2244 1018 935 11721 11823 12275
NM_018374chr755015 3389 1846 855 383 --24643 1211 1967
NM_018440chr898067 7804 3259 2619 2402 1881 1725 519 322 26809 220 --12291
NM_018638chr1294839 2260 2061 1966 1315 1282 920 508 160 23685 1308 ----
NM_019001chr394872 4733 4475 3924 3593 3572 1377 1272 969 23314 1900 --14546
NM_020390chr354367 3600 3564 3499 205 13632 --14848
NM_020466chr664932 4467 3996 1908 971 194 2938 70 --23352 1694
NM_020673chr2097725 5579 4692 2687 1625 1061 507 272 137 16872 17570 26286 5385
NM_020718chr1646362 4676 4381 4326 35940 676 220 24583 257 14285
NM_020766chrX74626 4220 3875 1430 876 848 136 --1741 1430
NM_020774chr1896260 5901 5228 5107 3906 2105 1490 1215 58 1687 31684 1236 1048 --
NM_020782chr1294840 4669 3177 1833 1805 1232 1194 671 284 23607 789 ----
NM_020841chr1283538 3521 2940 1335 856 833 658 130 22636 477 33944 2984 2856 --
NM_020853chr1272793 2296 1998 1792 1051 926 85 ----22022 570
NM_021038chr353369 2053 1339 674 544 2907 842 2487 397 --
NM_021101chr322336 207 32496 331 49 --1296
NM_021813chr654937 4514 4249 1948 279 ----21048 660
NM_021912chr1564048 3160 1438 904 870 232 24186 662 --1274
NM_021961chr1187224 6662 5957 5695 5060 4804 1436 1234 27443 1063 35802 1319 915 125
NM_021964chr3105979 5964 5145 4496 1673 1110 822 711 489 210 36059 4241 2067 --15133
NM_022458chr7113007 2760 2662 2321 2058 579 482 398 240 196 74 --1811 1262
NM_022912chr232965 930 542 1884 --2600 345
NM_024511chr453259 3212 1249 1207 635 --2761 666 22920 2577
NM_024524chr33816 766 588 12204 --22799 2124
NM_024641chr653034 3002 2873 2551 853 1296 --22319 2053
NM_024665chr374532 3963 3443 1086 500 435 24 13138 --21465 1368
NM_024947chr3129599 9499 8717 8151 8005 7811 2693 2239 2199 1431 893 438 13182 29099 3706 38659 8327 2636
NM_024989chr2138111 8055 7756 7726 7002 6987 6942 6104 5161 5055 2790 1518 1273 25350 1006 47582 7363 2938 1293 25307 84
NM_025191chr112909 2321 65 --22474 1359
NM_030647chr796143 2027 1860 1593 1569 1266 1205 1184 865 11552 --35912 4108 1544
NM_030806chr1137676 7565 6912 6133 5930 5863 2867 2750 2363 2189 870 770 465 16334 11705 --
NM_031427chr1455614 4700 3838 2195 2073 21958 55 1297 14013
NM_031442chrX72788 2751 2595 2288 1970 1233 815 22587 218 12602 22623 2617
NM_031469chr642820 2717 2532 783 11623 22693 1516 13889
NM_032221chr2011737 ----22038 529
NM_032373chr10115815 5705 5140 4365 3785 2173 2138 1082 1015 988 455 ----1602
NM_032439chr1031446 607 598 --21153 307 21346 1245
NM_032859chr1373743 2938 2712 2429 1271 1245 729 1261 --12920
NM_033020chr184777 3741 3249 3180 2945 1639 1261 905 23944 169 --24435 1513
NM_033224chr7118033 7494 7209 5980 4984 2637 2546 1904 1575 928 325 17003 12382 --
NM_052832chr872827 2713 2180 1895 1052 963 936 21191 1185 1465 --
NM_053016chr9136577 6315 6262 6098 6025 5928 4841 2568 2301 1634 619 278 58 18026 ----
NM_053042chr442842 2196 506 94 11001 --23167 2788
NM_053053chr13741 306 118 1924 --2977 942
NM_080867chr1464305 4282 3079 1874 1353 920 45005 3976 1359 197 13515 --
NM_130391chr953408 2610 2475 687 659 1963 --1939
NM_130392chr953408 2610 2475 687 659 1963 --1939
NM_130393chr953408 2610 2475 687 659 1963 --1939
NM_133334chr4126199 5912 5906 5643 5370 4274 1565 1519 697 476 247 85 15697 15928 --
NM_138292chr1143451 1009 745 607 1944 33513 3183 1387 23067 2487
NM_138444chr1344293 3439 1535 717 ----24437 3309
NM_138713chr1686630 6506 6390 5968 5945 5028 2032 126 17357 --16971
NM_138714chr1686630 6506 6390 5968 5945 5028 2032 126 17357 --16971
NM_138731chr1473131 1540 1370 919 550 449 312 11144 1213 11065
NM_138959chr135927 5880 48 22529 1198 36200 2559 372 15663
NM_144571chr496948 6554 5951 5154 4621 2375 1557 1008 745 16745 142 --
NM_144664chr1161699 1631 874 710 662 597 11818 22516 868 --
NM_145259chr2147119 6706 6155 6004 5435 5083 4678 4598 4313 2692 2266 1840 1770 872 21955 1195 16840 --
NM_145307chr10104561 3642 3241 1614 1596 1429 440 135 88 68 33969 3820 3327 1531 --
NM_147150chr973403 3336 3120 1602 1196 858 83 12540 33530 2550 126 --
NM_148174chr841644 768 627 559 22193 1441 1639 1870
NM_152624chr5136861 5859 5747 5315 5089 5072 4808 4519 1932 1579 1367 855 802 16677 ----
NM_152756chr543920 3795 796 775 ----22904 26
NM_152793chr764334 4118 3597 3544 329 224 54568 3677 2066 1958 878 1717 --
NM_152919chr1953245 1009 515 283 141 11149 23147 225 33528 3480 3389
NM_152999chr764948 3429 3245 1641 1440 893 ----21703 312
NM_153188chr595666 5211 5166 4639 4532 3541 2208 2100 1342 11069 14361 --
NM_173214chr1686630 6506 6390 5968 5945 5028 2032 126 17357 --16971
NM_173468chr4135853 5558 5298 4939 4796 4152 2118 2020 1930 1226 784 759 582 21862 420 11586 --
NM_173582chr11135600 5093 4728 3890 3882 3823 2256 2192 2131 2106 1203 1160 40 12115 25879 4217 --
NM_173642chr198519 7603 3196 2482 2006 1553 831 814 579 --1678 11136
NM_173829chr555265 2047 1308 769 533 ----21406 119
NM_175861chr12105711 5132 4802 4681 4409 4110 1097 981 692 515 ------
NM_177996chr2032844 398 166 1868 --2176 160
NM_178505chr1032997 2359 278 ----23009 1451
NM_182485chr453423 3402 2816 2645 610 ----23564 1081
NM_182515chr1986507 6206 6002 4968 4441 2379 1467 1195 ----11184
NM_182646chr453423 3402 2816 2645 610 ----23564 1081
NM_194291chr822801 130 ----2545 99
NM_194434chr18105710 5267 5258 4867 4231 3697 2300 1454 1283 1088 --1130 25439 4077
NM_198484chr3106430 6399 4747 4539 4121 2260 2073 1578 711 705 12346 16411 --
NM_198841chr92953 308 3964 380 360 1895 1372
NM_198992chr1221090 933 --1915 11365
NM_199421chr1464305 4282 3079 1874 1353 920 45005 3976 1359 197 13515 --
NM_206855chr696147 5545 5539 4310 1820 1720 922 782 575 12357 ----
NM_206909chr8118227 8211 6913 6054 5941 5526 2333 2325 2159 1368 894 ----18187
NM_207292chr353369 2053 1339 674 544 2907 842 2487 397 --
NM_207293chr353369 2053 1339 674 544 2907 842 2487 397 --
NM_207294chr353369 2053 1339 674 544 2907 842 2487 397 --
NM_207295chr353369 2053 1339 674 544 2907 842 2487 397 --
NM_207296chr353369 2053 1339 674 544 2907 842 2487 397 --
NM_207297chr363394 2078 1364 699 569 26 2932 867 2512 422 --
NM_212558chr974191 4117 4041 3666 3211 1299 816 62947 2923 2891 2832 1236 160 ----
NM_213589chr295612 5157 4311 3968 3485 1843 1101 447 215 12169 14645 25384 1002