TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4799-3p
miRNA Sequence: ACUGGCAUGCUGCAUUUAUAUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr832537 2312 176 1446 ----
NM_000042chr17130 ------
NM_000051chr11103338 3116 2912 2579 2514 1242 1095 911 879 481 1776 ----
NM_000052chrX73463 3066 2892 2464 2151 1341 23 ------
NM_000055chr31446 ----1116
NM_000084chrX106506 6111 5717 2780 2655 2453 2432 2105 1710 920 ----12564
NM_000089chr72687 255 1529 ----
NM_000092chr254178 1418 579 274 81 24332 3429 ----
NM_000109chrX51930 1726 1074 775 642 ------
NM_000110chr14911 267 171 38 ------
NM_000125chr644105 3055 2625 1483 --14010 --
NM_000129chr611066 11456 ----
NM_000138chr155885 876 834 424 296 --11702 --
NM_000161chr1431671 1407 44 1264 ----
NM_000163chr532270 932 915 1235 11662 --
NM_000165chr611123 --11565 --
NM_000167chrX41597 1359 1154 184 ------
NM_000176chr543915 3584 3062 1292 13326 --23791 1252
NM_000189chr2167 3919 426 82 ----
NM_000194chrX1547 --1154 --
NM_000210chr242276 1992 1643 626 11846 1809 --
NM_000214chr201570 1313 1529 --
NM_000217chr1225166 86 --25246 4649 --
NM_000245chr72764 555 ----11594
NM_000248chr342866 2642 2196 1972 ------
NM_000252chrX21290 511 ------
NM_000259chr1555903 4761 4741 1476 860 22325 1360 23919 461 --
NM_000266chrX2341 333 ------
NM_000267chr1733013 2846 2128 1144 12659 11182
NM_000274chr101513 ------
NM_000280chr112979 666 ------
NM_000286chr17150 ------
NM_000296chr162640 256 ----1760
NM_000297chr431793 1641 1475 --21519 105 --
NM_000304chr1711045 ------
NM_000314chr1073150 3018 2070 1242 1170 783 599 2685 100 ----
NM_000328chrX1167 ------
NM_000330chrX32218 2170 27 11688 ----
NM_000332chr687211 6582 6551 2794 1040 757 335 195 ------
NM_000337chr5136409 6391 6200 5395 5373 5340 2532 2387 1608 1169 1113 1038 68 12098 14123 14911
NM_000349chr841300 1248 391 346 --2977 319 --
NM_000351chrX22888 387 ------
NM_000353chr161117 1218 ----
NM_000354chrX1187 1252 ----
NM_000362chr2253226 2567 1448 1087 243 ----22365 250
NM_000368chr974832 4736 4716 4106 3229 1934 1147 11734 1960 --
NM_000371chr181100 ------
NM_000399chr10------1372
NM_000408chr253246 2901 2875 789 160 23390 2967 ----
NM_000430chr1753048 2814 2752 1464 1241 ------
NM_000439chr542246 2207 528 452 22031 670 ----
NM_000450chr1--11142 --21835 112
NM_000451chrX22050 416 --11331 --
NM_000452chr1311979 11702 11861 --
NM_000454chr21153 2268 235 ----
NM_000461chr364258 4025 3409 3402 3283 3266 14469 1730 11329
NM_000462chr1521624 714 ------
NM_000474chr72123 48 ------
NM_000489chrX52615 2469 839 185 116 ------
NM_000503chr821270 130 21655 1453 ----
NM_000508chr43843 784 352 143 ----
NM_000525chr1141517 1261 667 152 ------
NM_000531chrX1363 ------
NM_000533chrX1740 1226 --1512
NM_000555chrX87879 6877 6715 6563 6497 6469 1490 265 ------
NM_000601chr72175 83 ------
NM_000609chr1062459 2386 2265 1258 413 89 --11095 --
NM_000615chr1132646 2240 615 ----11889
NM_000617chr1222242 1858 ------
NM_000618chr1241498 1305 1210 35 15020 14885 16218
NM_000618chr1241498 1305 1210 35 15020 14885 16218
NM_000621chr132910 166 ------
NM_000627chr21653 ------
NM_000663chr1663050 3020 2741 760 402 385 11095 ----
NM_000681chr1031208 440 187 --11335 --
NM_000693chr1511607 11402 ----
NM_000719chr1275323 4598 4402 4248 2550 2409 1639 16540 ----
NM_000720chr31139 ------
NM_000721chr152514 2423 2263 1696 889 1879 2917 564 --
NM_000724chr1021674 658 11489 ----
NM_000726chr241124 966 130 54 1577 ----
NM_000782chr203878 203 117 11267 ----
NM_000806chr52610 381 ----1235
NM_000807chr41652 ------
NM_000809chr4107594 7303 7038 6626 6035 1746 1381 1216 820 415 --26323 963 1745
NM_000813chr575032 4801 3896 2257 1554 431 335 ----14459
NM_000814chr1563738 3455 3284 1656 1086 492 ------
NM_000826chr432000 709 22 11910 1149 12543
NM_000827chr562240 1990 1743 1716 1638 71 12223 ----
NM_000829chr1141669 759 679 413 ------
NM_000831chr1105436 5218 4938 4914 4798 2325 2165 892 226 150 --25372 4920 --
NM_000834chr123255 227 68 ------
NM_000838chr652618 2396 1082 954 655 --1414 --
NM_000840chr7--1162 ----
NM_000868chrX21948 524 1586 ----
NM_000875chr15106144 6134 5826 5448 4907 4659 4339 2304 2069 1209 26654 5073 ----
NM_000891chr1783354 3174 2880 2594 1331 1252 1214 999 21314 568 ----
NM_000899chr1253867 3564 1537 1017 505 --21190 561 --
NM_000901chr422157 325 ----1141
NM_000910chr451927 1844 1773 1371 1235 ------
NM_000914chr61401 ------
NM_000926chr11139226 8958 8550 8288 7474 7453 6518 3295 2959 2842 2010 1949 1109 16262 16249 --
NM_000933chr2041262 601 527 511 1457 ----
NM_000944chr421765 604 1515 1281 --
NM_000949chr52837 285 ------
NM_000950chrX33647 3358 190 --22246 1109 --
NM_000959chr142706 849 674 228 3910 330 136 ----
NM_000962chr943081 2829 911 458 3852 343 245 --1281
NM_000963chr152044 2006 1846 777 164 ------
NM_000977chr161116 ----1370
NM_000990chr1151546 1209 840 470 31 --1823 --
NM_001001331chr372486 2459 1891 1007 972 868 729 ------
NM_001001342chr101410 21442 1086 ----
NM_001001344chrX42028 1894 1670 531 1986 11974 --
NM_001001394chr21537 ------
NM_001001396chr1104349 4028 4015 4000 3865 3055 1118 1061 651 197 ------
NM_001001419chr564436 4421 3184 1149 714 645 13199 11364 13833
NM_001001420chr564436 4421 3184 1149 714 645 13199 11364 13833
NM_001001433chr201351 ------
NM_001001481chr872860 2604 2161 900 354 240 231 ------
NM_001001484chr1011729 ------
NM_001001549chr722653 132 ----1727
NM_001001550chr722653 132 ----1727
NM_001001555chr722653 132 ----1727
NM_001001557chr852203 1769 1755 530 190 ------
NM_001001664chr222828 410 13851 11183 --
NM_001001669chr532299 2217 2188 22081 1853 ----
NM_001001740chr1182 ------
NM_001001740chr1182 ------
NM_001001924chr82483 433 --21514 735 11583
NM_001001925chr82483 433 --21514 735 11583
NM_001001931chr82483 433 --21514 735 11583
NM_001001936chr10132 ------
NM_001001974chr1042364 2222 2131 373 1447 ----
NM_001001995chrX61795 1402 611 412 322 287 11609 1753 --
NM_001002243chr2--1608 ----
NM_001002265chr103842 729 303 ------
NM_001002266chr103842 729 303 ------
NM_001002295chr103776 434 354 --11028 --
NM_001002762chr1072707 2600 2281 2188 1974 1164 664 21807 880 ----
NM_001002860chr1444398 3237 578 163 --191 --
NM_001003398chr12128 ------
NM_001003674chr18106670 5783 5492 4574 4424 2319 2098 1348 1303 510 26453 5540 24831 4369 26193 4817
NM_001003675chr18106670 5783 5492 4574 4424 2319 2098 1348 1303 510 26453 5540 24831 4369 26193 4817
NM_001003698chr62682 168 ----11336
NM_001003699chr62682 168 ----11336
NM_001003712chr1284047 3773 3708 3059 2530 1448 377 217 12992 ----
NM_001003792chr31380 ------
NM_001003793chr31380 ------
NM_001003794chr373014 2728 1134 1128 896 775 690 --12568 --
NM_001003800chr952713 2628 2334 1014 79 13519 1415 --
NM_001003810chr41551 ------
NM_001004065chr933418 3099 640 ------
NM_001004329chr1211485 1578 166 --
NM_001004360chr24710 183 113 91 ------
NM_001005266chr154573 552 538 136 ------
NM_001005267chr154573 552 538 136 ------
NM_001005268chr154573 552 538 136 ------
NM_001005269chr154573 552 538 136 ------
NM_001005335chr192131 59 ------
NM_001005386chr21316 ------
NM_001005463chr1062427 2064 2037 774 689 126 1724 ----
NM_001005473chr585648 5622 5233 4378 4260 4178 1805 693 ------
NM_001005609chrX23509 2930 32834 1497 301 ----
NM_001005739chr23620 566 182 ------
NM_001005743chr142924 402 1479 ----
NM_001005744chr142924 402 1479 ----
NM_001005745chr142924 402 1479 ----
NM_001005746chr241124 966 130 54 1577 ----
NM_001005747chr241124 966 130 54 1577 ----
NM_001006115chr362805 2412 2336 2159 1104 480 ----12141
NM_001006118chrY1211 ------
NM_001006120chrY1211 ------
NM_001006600chr511694 ------
NM_001006612chrX--1438 ----
NM_001006613chrX--1438 ----
NM_001006614chrX--1438 ----
NM_001006618chr9------188
NM_001006938chrX3562 170 125 ------
NM_001006943chr11229 ------
NM_001007024chr1744251 3699 625 486 23499 401 13807 --
NM_001007025chr1744251 3699 625 486 23499 401 13807 --
NM_001007156chr1531525 103 33 --11714 --
NM_001007237chr142645 721 493 275 22213 117 --12494
NM_001007243chr841300 1248 391 346 --2977 319 --
NM_001007246chr212697 497 1767 --1343
NM_001007277chr1171094 1067 942 859 435 387 203 ------
NM_001007526chrY1211 ------
NM_001007565chr3135 --1302 --
NM_001008220chr563833 826 779 744 321 279 13173 ----
NM_001008239chr1832794 1085 325 --22377 1158 --
NM_001008392chr343508 2968 2629 666 --13261 --
NM_001008401chr1941476 586 446 175 ----1301
NM_001008405chr7----11323 11233
NM_001008408chr796237 5473 3958 3879 1708 1635 1293 581 67 --15884 --
NM_001008495chr81902 ----11452
NM_001008541chr1042165 1905 652 314 ------
NM_001008541chr1042165 1905 652 314 ------
NM_001008563chr93299 265 223 1310 --11358
NM_001008564chr1332273 1793 1705 12040 11496 --
NM_001008738chr522965 2243 ----1162
NM_001008897chr61482 ------
NM_001009555chr411741 ------
NM_001009571chr741624 1133 476 163 ------
NM_001009899chr395785 4833 4685 4449 2123 1591 1476 1016 662 1175 22206 439 1154
NM_001009944chr162640 256 ----1760
NM_001009993chr254412 3386 3345 775 527 ------
NM_001010861chr152146 1122 654 425 137 ----1949
NM_001010888chrX43777 3653 3071 229 ------
NM_001010891chr5136918 6599 5805 5463 4831 4646 4543 4440 2646 2043 1567 208 133 26342 4898 22034 817 --
NM_001010897chr13------1153
NM_001010927chr61498 ------
NM_001010932chr72175 83 ------
NM_001010984chr122105 480 22183 1666 11812 --
NM_001010989chr16--1443 ----
NM_001010990chr16--1443 ----
NM_001011513chr452876 2647 2549 1568 500 --1899 --
NM_001011658chrX51489 398 291 171 30 ------
NM_001011666chr735883 4917 382 ------
NM_001011713chr144627 573 233 120 11169 ----
NM_001011885chr15------11675
NM_001012267chr931857 563 191 ------
NM_001012393chr1194998 4786 4714 4327 3313 3256 1690 1333 591 14900 11375 --
NM_001012398chr1631123 281 118 2194 40 ----
NM_001012420chr1552925 2785 2174 1831 514 ------
NM_001012423chr1552925 2785 2174 1831 514 ------
NM_001012514chr211001 ------
NM_001012516chr211001 ------
NM_001012614chr41123 ------
NM_001012751chr1011412 ----1362
NM_001012755chrX74487 3851 1760 1536 1234 719 582 23420 3307 11069 --
NM_001012761chr531948 1711 812 ----12712
NM_001013399chr6----1966 --
NM_001013415chr42576 364 ------
NM_001013615chr13951 822 811 1984 ----
NM_001013625chr1------130
NM_001013659chr1964929 4564 3888 1652 1014 995 --14808 --
NM_001013693chr152590 2168 2082 1928 535 22335 525 12482 --
NM_001013693chr152590 2168 2082 1928 535 22335 525 12482 --
NM_001013699chr12----1171 --
NM_001013839chr1721976 887 ------
NM_001013843chr15--1107 ----
NM_001014286chr13193 1110 ----
NM_001014797chr1067458 7293 7217 2083 2003 1020 1250 25664 5470 12760
NM_001014809chr4166 1639 ----
NM_001014812chr15------1194
NM_001015508chr82657 264 ------
NM_001015877chrX52764 1918 535 510 403 11059 ----
NM_001015882chr92139 25 ------
NM_001015887chr331804 1197 246 1358 ----
NM_001017395chr313113 12705 23436 1458 --
NM_001017396chr222182 474 1228 1670 --
NM_001017420chr831358 900 392 ------
NM_001017440chr777488 6296 5462 2960 2824 841 52 12590 45991 2878 2865 1359 11020
NM_001018008chr151575 ----1505
NM_001018037chr941396 1353 1234 121 1513 ----
NM_001018053chr151941 1756 1682 792 574 --2459 66 --
NM_001018065chr9125573 5459 5198 4920 4879 4368 4295 2358 1701 1683 855 219 15011 ----
NM_001018066chr9125573 5459 5198 4920 4879 4368 4295 2358 1701 1683 855 219 15011 ----
NM_001018067chr123423 606 ------
NM_001018068chr123423 606 ------
NM_001018069chr123423 606 ------
NM_001018074chr543915 3584 3062 1292 13326 --23791 1252
NM_001018075chr543915 3584 3062 1292 13326 --23791 1252
NM_001018076chr543915 3584 3062 1292 13326 --23791 1252
NM_001018077chr543915 3584 3062 1292 13326 --23791 1252
NM_001018089chr1543766 2557 1560 361 ------
NM_001018090chr1572699 2452 1971 1138 1010 934 35 181 ----
NM_001018091chr1562809 2562 2081 1120 1044 145 1191 ----
NM_001018100chr151828 1313 ----
NM_001018102chr1572699 2452 1971 1138 1010 934 35 181 ----
NM_001023567chr1552317 2177 1852 705 517 ------
NM_001024094chr543915 3584 3062 1292 13326 --23791 1252
NM_001024218chr14----1261 --
NM_001024380chr852125 2060 1611 1536 783 12166 ----
NM_001024381chr852125 2060 1611 1536 783 12166 ----
NM_001024401chr1642340 1065 953 920 12668 11780 --
NM_001024649chr542833 2556 1908 315 11961 1809 --
NM_001024847chr312395 12213 11655 --
NM_001024912chr1941369 689 670 555 11216 ----
NM_001024947chr52979 240 ------
NM_001025076chr1095626 5430 5154 4988 2178 2127 1088 993 658 --15516 --
NM_001025077chr1096984 6788 6512 6346 2446 2351 2016 1136 235 --16874 --
NM_001025079chr333772 3021 1603 ----12966
NM_001025100chr1863010 2876 1376 761 711 414 12437 22777 1119 --
NM_001025105chr521523 321 21148 595 11485 --
NM_001025203chr21--131 ----
NM_001025204chr21--131 ----
NM_001025252chr853234 3210 2595 2388 1295 22807 34 21124 340 12252
NM_001025253chr853234 3210 2595 2388 1295 22807 34 21124 340 12252
NM_001025266chr374091 3813 3790 3506 1728 1035 480 ------
NM_001025580chrX43556 1679 1350 1314 ----12696
NM_001025596chr111525 ------
NM_001025616chr441872 1284 526 190 1723 ----
NM_001025780chr91611 --1100 --
NM_001029858chr641110 1023 708 477 22922 377 ----
NM_001029863chr673000 2993 2394 2015 1286 1239 637 ----12726
NM_001029875chr5--1563 ----
NM_001029884chr642590 2320 563 548 ------
NM_001030055chr1454055 3603 3160 3014 1772 ------
NM_001031679chr1223122 912 1576 13030 --
NM_001031700chr431549 247 239 ------
NM_001031804chr1684103 3530 3030 1523 837 746 305 74 ------
NM_001032280chr62576 186 ------
NM_001032282chr821171 903 ------
NM_001032288chr201489 11594 ----
NM_001032296chr1352889 2820 2504 881 446 --12074 --
NM_001032394chr622624 2321 --12214 1105
NM_001032395chr622491 2188 --12081 --
NM_001033025chr12496 62 --21470 1272 --
NM_001033047chr422526 758 ------
NM_001033057chr322102 786 ------
NM_001033087chr2053237 2522 1283 1053 816 12043 21198 1156 --
NM_001033117chr364420 4381 4274 3028 1289 531 11112 ----
NM_001033507chr141603 1582 1266 592 ------
NM_001033557chr231404 1040 936 ----1955
NM_001033566chr171671 174 ----
NM_001033568chr171671 174 ----
NM_001033925chr1012086 11545 ----
NM_001034850chr511488 1250 11183 --
NM_001035chr131210 1083 105 ------
NM_001035260chr1021551 1327 ------
NM_001037131chr21488 ------
NM_001037164chr721408 107 1778 ----
NM_001037172chr32949 35 ----1261
NM_001037290chr112817 638 ------
NM_001037317chr152146 1122 654 425 137 ----1949
NM_001037339chr111525 --21657 50 --
NM_001037340chr111525 --21657 50 --
NM_001037341chr111525 --21657 50 --
NM_001037341chr111525 --21657 50 --
NM_001037954chr1143479 2903 612 110 12291 ----
NM_001038493chr221483 556 --11242 --
NM_001038702chr582433 2324 2099 2080 2008 1780 1041 231 199 --1488
NM_001039348chr211047 ------
NM_001039349chr211047 ------
NM_001039538chr233451 3026 2365 11019 32708 699 564 11044
NM_001039585chr162963 1106 931 485 159 136 31167 587 393 ----
NM_001039590chrX32615 939 219 --1455 --
NM_001039591chrX32615 939 219 --1455 --
NM_001039618chr1132339 240 59 11619 25502 3959 --
NM_001039762chr1042070 1477 901 198 11527 ----
NM_001039802chr1--21006 217 ----
NM_001039840chrX85978 5443 4752 4274 2218 1698 1307 596 36042 5803 4252 ----
NM_001039937chr1344112 3318 965 729 13811 ----
NM_001040020chr711456 ------
NM_001040100chr331187 1025 189 1417 ----
NM_001040142chr232261 1630 97 ------
NM_001040143chr232261 1630 97 ------
NM_001040152chr755010 4475 3720 1958 951 24927 447 14137 --
NM_001040159chr4--1464 ----
NM_001040214chr662240 741 733 677 489 329 --21805 23 11916
NM_001040284chr1655856 4553 1739 1716 251 ------
NM_001040402chr433158 611 527 1455 21113 1037 --
NM_001040429chr1373363 2943 2704 2627 2447 1400 660 ------
NM_001040441chr154340 3701 3640 1481 1440 ------
NM_001040450chr1512415 1925 1825 --
NM_001040453chr1512415 1925 1825 --
NM_001040653chr362617 2181 2132 972 867 329 12312 ----
NM_001040655chr1541655 1256 483 206 ------
NM_001040656chr1541655 1256 483 206 ------
NM_001040657chr1541655 1256 483 206 ------
NM_001040658chr1541655 1256 483 206 ------
NM_001040659chr1541655 1256 483 206 ------
NM_001040660chr1541655 1256 483 206 ------
NM_001040665chr793697 3137 3054 1860 1182 931 846 173 46 ------
NM_001040876chr42728 183 --1393 --
NM_001042355chr1664501 1970 1247 948 730 92 --11139 --
NM_001042357chr1021554 1368 2599 205 ----
NM_001042358chr1021554 1368 2599 205 ----
NM_001042360chr1021554 1368 2599 205 ----
NM_001042363chr1021554 1368 2599 205 ----
NM_001042368chr94653 641 260 92 ----1832
NM_001042383chr322720 910 23416 232 22882 823 --
NM_001042389chr1021554 1368 2599 205 ----
NM_001042390chr1021554 1368 2599 205 ----
NM_001042392chr1021554 1368 2599 205 ----
NM_001042395chr1021554 1368 2599 205 ----
NM_001042406chr62373 75 11014 11137 --
NM_001042412chr1664501 1970 1247 948 730 92 --11139 --
NM_001042413chr953742 3274 1487 993 542 1960 32911 597 96 --
NM_001042424chr453199 2899 1162 673 278 ------
NM_001042425chr62576 186 ------
NM_001042476chr1611976 ----12052
NM_001042481chr1452474 2297 1013 650 86 145 1858 --
NM_001042492chr1733013 2846 2128 1144 12659 11182
NM_001042494chr1573509 3408 2654 1233 1085 633 65 ----1315
NM_001042495chr1573509 3408 2654 1233 1085 633 65 ----1315
NM_001042496chr1573509 3408 2654 1233 1085 633 65 ----1315
NM_001042497chr1573509 3408 2654 1233 1085 633 65 ----1315
NM_001042498chrX21091 759 1767 11077 --
NM_001042537chrX2374 115 ------
NM_001042555chr1284322 4179 3671 1768 1458 1356 825 664 ------
NM_001042599chr287460 6403 6126 5897 1299 1223 843 400 17844 13084 --
NM_001042603chr1234513 3620 3532 1591 ----
NM_001042604chr374012 3980 3723 1085 594 493 215 ------
NM_001042669chr441872 1284 526 190 1723 ----
NM_001042749chrX21362 768 1665 ----
NM_001042750chrX21362 768 1665 ----
NM_001042751chrX21362 768 1665 ----
NM_001043318chr1422563 1122 13547 ----
NM_001044385chr223837 1256 1851 ----
NM_001046chr572672 2618 2366 1168 918 879 392 --12561 --
NM_001048183chr143449 3080 1479 203 13382 ----
NM_001076chr41185 ------
NM_001076chr41185 ------
NM_001083620chr431998 708 22 11908 1149 12541
NM_001092chr1772377 1669 988 613 415 283 160 12148 ----
NM_001106chr398827 8566 8393 6593 3860 2885 2496 1326 1247 --28420 2934 --
NM_001113490chrX33382 2355 1184 --22553 1306 --
NM_001121chr1041908 1556 1384 326 ------
NM_001123chr104591 529 231 220 ------
NM_001146chr821471 57 ------
NM_001148chr411730 --11845 --
NM_001149chr1031028 440 41 --170 --
NM_001167chrX86325 4457 4256 2000 1276 1210 1017 633 --15260 --
NM_001173chr1454055 3603 3160 3014 1772 ------
NM_001174chrX72334 2270 2064 1702 913 716 213 1299 ----
NM_001198chr61930 12353 ----
NM_001204chr287600 5184 2967 2587 1357 1232 762 99 26703 2264 --12379
NM_001206chr932916 2480 1080 --11949 --
NM_001218chr1521665 849 1349 32267 2247 122 --
NM_001237chr42970 243 --1236 --
NM_001237chr42970 243 --1236 --
NM_001241chr222391 1738 1680 ----
NM_001241chr222391 1738 1680 ----
NM_001259chr7106321 6039 4739 4430 4289 2241 2113 643 377 318 1988 ----
NM_001265chr13--166 1721 1737
NM_001270chr511051 ------
NM_001271chr1583166 3034 2952 2755 2322 1048 747 354 --1805 --
NM_001284chr51396 ------
NM_001286chr132832 1151 929 --1432 --
NM_001304chr1723525 3003 12988 13264 --
NM_001313chr4166 1639 ----
NM_001315chr622258 886 ----12272
NM_001328chr41123 ------
NM_001331chr116810 686 557 292 108 100 ------
NM_001343chr51656 --11070 --
NM_001356chrX32074 1912 1781 --22431 984 --
NM_001357chr1154 ------
NM_001364chr1184755 4702 4025 3726 3575 3036 368 236 ------
NM_001385chr81273 ------
NM_001386chr822169 2156 ------
NM_001391chr181354 ----11153
NM_001394chr83665 634 262 ------
NM_001396chr211603 ------
NM_001399chrX23509 2930 32834 1497 301 ----
NM_001415chrX1261 ------
NM_001416chr172326 126 ------
NM_001417chr1241230 513 277 262 ------
NM_001423chr1231613 725 712 ------
NM_001426chr21486 ------
NM_001427chr71228 ------
NM_001431chr63149 106 79 ----11170
NM_001432chr473702 2633 2615 1524 1472 1388 632 ------
NM_001438chr132409 1313 1166 --1616 11471
NM_001439chr12496 62 --21470 1272 --
NM_001460chr163051 2477 2467 831 227 46 ------
NM_001463chr22606 528 ------
NM_001482chr152657 185 ------
NM_001490chr973098 2825 1073 869 556 364 75 1137 ----
NM_001491chr621762 705 --12205 1683
NM_001497chr972608 2365 2225 1969 1876 1699 839 11048 ----
NM_001498chr611199 ------
NM_001530chr144803 758 440 333 ------
NM_001533chr192131 59 ------
NM_001541chr111148 ------
NM_001542chr142645 721 493 275 22213 117 --12494
NM_001543chr584648 4411 3815 1856 1815 1409 855 769 23665 970 14479 --
NM_001546chr611136 ------
NM_001565chr4193 ------
NM_001570chr331431 392 93 ------
NM_001584chr111242 ----1137
NM_001604chr112979 666 ------
NM_001614chr171444 --187 --
NM_001614chr171444 --187 --
NM_001616chr243507 1175 720 473 21185 343 --12752
NM_001635chr7------1113
NM_001650chr1863039 2684 1629 1429 436 120 ------
NM_001656chr541973 1853 675 559 ------
NM_001663chr1412125 1270 1711 --
NM_001664chr31366 ------
NM_001678chr1711538 11803 11421 --
NM_001681chr122665 658 ------
NM_001682chr1211880 1177 12697 --
NM_001683chr372486 2459 1891 1007 972 868 729 ------
NM_001684chr1104066 3745 3732 3717 3582 2772 1532 835 778 368 ------
NM_001701chr91500 ----1354
NM_001706chr31283 --1256 --
NM_001709chr1122334 493 ------
NM_001730chr1331244 1169 394 ------
NM_001730chr1331244 1169 394 ------
NM_001731chr124678 242 167 102 ------
NM_001742chr741690 1376 1326 252 ------
NM_001746chr542833 2556 1908 315 11961 1809 --
NM_001755chr161372 --1671 --
NM_001759chr1275315 5025 4172 3961 3630 3617 654 ------
NM_001769chr12--2303 136 ----
NM_001777chr333772 3021 1603 ----12966
NM_001791chr1--21006 217 ----
NM_001792chr1811174 ------
NM_001830chrX33667 1626 1031 13432 2547 417 --
NM_001842chr91530 ------
NM_001845chr1331328 315 24 ------
NM_001855chr9--1220 ----
NM_001859chr912725 ------
NM_001875chr21163 ------
NM_001892chr521523 321 21148 595 11485 --
NM_001895chr2011029 ----1944
NM_001920chr124688 492 289 51 ------
NM_001924chr12507 115 ------
NM_001938chr111610 --11365 --
NM_001942chr1831923 1322 163 1416 ----
NM_001949chr642986 2251 2157 2079 12739 13099 --
NM_001962chr51491 --1500 1115
NM_001969chr141110 1407 13344 --
NM_001980chr1212039 ------
NM_001987chr1284081 3888 3750 3710 3187 2989 1427 235 --1862 --
NM_001992chr532204 245 226 --21431 822 1834
NM_001993chr1132 ------
NM_001995chr411081 ----1155
NM_002006chr475689 5607 4929 3700 3613 2151 392 ------
NM_002009chr1511873 1448 ----
NM_002015chr1373379 2880 2199 2144 966 269 241 --1653 --
NM_002024chrX3445 422 132 ------
NM_002025chrX67865 6978 2399 841 603 586 18965 27642 6745 --
NM_002026chr21947 ------
NM_002040chr2152991 2842 2601 2406 876 1779 --1687
NM_002051chr103776 434 354 --11028 --
NM_002054chr22119 43 ------
NM_002063chrX21037 1012 ------
NM_002074chr12609 22 1333 ----
NM_002092chr495003 4132 3987 3964 3909 3277 1759 1561 106 ----1801
NM_002094chr16----1151 --
NM_002114chr61154 ------
NM_002129chr41407 ------
NM_002138chr41551 ------
NM_002140chr9----11230 --
NM_002148chr2--1149 ----
NM_002158chr263664 3412 3089 1380 1313 1163 ----1324
NM_002166chr22695 572 ------
NM_002187chr55851 472 305 240 166 11070 ----
NM_002202chr52932 240 ------
NM_002211chr1031017 436 222 --2397 180 --
NM_002214chr762224 1755 1608 1579 762 698 11100 21454 109 --
NM_002228chr11923 ------
NM_002232chr121219 1131 ------
NM_002239chr21822 ------
NM_002245chr11103 ----127
NM_002249chr11395 ------
NM_002253chr421431 1287 ------
NM_002264chr3104978 4826 4766 4012 3741 3600 3079 1448 1242 654 133 ----
NM_002267chr1321538 269 11714 1328 --
NM_002270chr521213 675 ----14076
NM_002271chr1331788 1617 520 11847 12190 --
NM_002286chr12159 ------
NM_002310chr554503 1647 1072 988 52 ------
NM_002336chr1253633 3570 644 566 214 21651 1509 13718 --
NM_002349chr241653 1132 172 73 ------
NM_002351chrX41431 659 287 51 ------
NM_002372chr51189 ------
NM_002374chr233451 3026 2365 11019 32708 699 564 11044
NM_002375chr352276 1894 1865 890 87 --1131 --
NM_002383chr162844 614 1197 ----
NM_002384chr18----1149 --
NM_002397chr551880 1725 1701 1686 1651 11571 12227 --
NM_002398chr23549 497 240 --2247 55 --
NM_002399chr1511266 --2250 55 --
NM_002401chr1752082 993 585 548 25 1211 ----
NM_002449chr51965 ------
NM_002482chr11746 ------
NM_002486chr942474 2074 1889 22 ------
NM_002504chr93767 344 60 1152 ----
NM_002524chr12795 439 126 ----
NM_002537chr152748 366 --11080 --
NM_002539chr2181 ------
NM_002545chr1194998 4786 4714 4327 3313 3256 1690 1333 591 14900 11375 --
NM_002546chr8--1205 ----
NM_002572chr111363 ------
NM_002578chrX1459 ------
NM_002581chr945446 4628 740 507 ----15625
NM_002583chr12----167 --
NM_002589chr4196 ------
NM_002590chr131221 ------
NM_002600chr111525 --21657 50 --
NM_002605chr1531155 323 173 ----11081
NM_002613chr1683573 3562 1569 1198 1166 708 92 34 1795 13659 --
NM_002618chr2--1130 1404 --
NM_002623chr201237 ------
NM_002628chr361209 964 320 244 114 65 ------
NM_002641chrX62012 1853 1630 1559 700 118 --2726 716 --
NM_002645chr1152637 2597 2389 592 245 --1306 --
NM_002651chr11234 ------
NM_002660chr2031156 782 55 ----1141
NM_002706chr22687 219 ----1238
NM_002709chr221158 108 ----13464
NM_002736chr751850 1455 795 410 83 --1610 --
NM_002737chr1765207 4826 2121 1633 846 831 35585 5108 4031 ----
NM_002740chr342720 2531 1812 209 ----12012
NM_002742chr14--1100 ----
NM_002745chr2244475 3064 1485 1421 11188 24092 1058 --
NM_002750chr10159 ------
NM_002752chr53527 389 26 ------
NM_002753chr43731 629 622 ------
NM_002760chrY75033 4587 4417 3784 2304 1608 1169 15787 --11668
NM_002786chr111111 ------
NM_002806chr14194 ------
NM_002811chr16--169 ----
NM_002815chr17----170 --
NM_002822chr121474 1484 ----
NM_002828chr181273 ------
NM_002829chr91481 1411 ----
NM_002833chr1541361 1212 462 279 11221 ----
NM_002834chr1284035 3808 2754 1636 1493 1387 1348 909 1566 13359 --
NM_002837chr1263980 3519 3308 1138 1010 86 --1761 --
NM_002838chr11813 1173 ----
NM_002843chr1123472 354 11100 ----
NM_002844chr641376 1144 290 221 ----11226
NM_002845chr18--1534 ----
NM_002849chr123854 428 335 ------
NM_002852chr32503 221 1256 159 --
NM_002865chr81108 ------
NM_002886chr354336 1465 1077 715 590 24733 735 ----
NM_002890chr51281 --1170 --
NM_002893chrX140 ------
NM_002895chr201939 ------
NM_002904chr61142 ------
NM_002906chr111125 ------
NM_002912chr61139 ------
NM_002940chr42728 183 --1393 --
NM_002955chr62682 168 ----11336
NM_002968chr161320 ------
NM_002973chr121144 ------
NM_002977chr252759 1263 668 599 83 ------
NM_002993chr42707 673 ------
NM_002994chr42734 264 ------
NM_002998chr842216 2196 2130 338 1570 ----
NM_003011chr941512 1441 1255 339 ------
NM_003012chr832933 883 104 21033 756 ----
NM_003028chr943803 3500 3082 2662 154 ----
NM_003032chr352717 2694 1770 350 124 ------
NM_003039chr1135 ----1503
NM_003043chr351622 1476 1242 638 388 23142 826 12651 --
NM_003051chr11569 ------
NM_003069chrX4736 217 209 130 ------
NM_003071chr321957 1352 ------
NM_003072chr191428 --1413 --
NM_003074chr331876 382 317 1706 ----
NM_003081chr2041162 854 399 144 ------
NM_003099chr1575761 5160 5019 3999 1089 1031 352 26165 2435 12380 --
NM_003108chr236000 4523 1956 --26908 5301 --
NM_003112chr723105 2297 ------
NM_003115chr11359 ------
NM_003118chr552058 1613 1498 798 704 ------
NM_003128chr232683 1772 1082 --1618 --
NM_003137chr642242 2170 1496 399 ------
NM_003144chr621830 88 --11984 --
NM_003149chr341578 1552 417 244 --11301 --
NM_003155chr852774 2656 2565 2405 485 ------
NM_003161chr1742466 2279 2210 109 ------
NM_003162chr21337 ------
NM_003164chr111567 ------
NM_003170chr172471 414 --1184 --
NM_003178chr331975 1502 149 --11430 --
NM_003179chrX----11307 --
NM_003199chr1874573 1859 1808 1688 1401 1075 837 14069 ----
NM_003203chr242350 531 330 23 ------
NM_003217chr1261798 1704 1562 1501 708 498 ------
NM_003220chr62576 186 ------
NM_003221chr653854 2663 1204 832 729 22753 1114 ----
NM_003223chr161108 ------
NM_003242chr312395 12213 11655 --
NM_003243chr141275 1229 1030 914 --1303 --
NM_003246chr1511802 ----1377
NM_003247chr661560 1331 1235 273 145 41 ------
NM_003257chr151181 ------
NM_003262chr375220 4950 4556 4006 3687 1507 904 13914 23725 1327 --
NM_003281chr194885 4217 3448 1775 1727 1345 708 539 320 11704 14762 --
NM_003286chr201285 ------
NM_003290chr191112 ------
NM_003292chr17903 827 797 774 614 608 108 ------
NM_003295chr131173 ------
NM_003298chr364572 2009 1771 1323 728 510 --15968 25446 304
NM_003304chr3------11264
NM_003309chr61229 11793 ----
NM_003319chr23914 741 193 ----1732
NM_003338chr1021267 466 --1365 --
NM_003340chr421434 564 ------
NM_003342chr1772970 2732 2555 2371 2277 2140 187 21180 585 1154 1444
NM_003347chr2262096 1975 1811 1800 760 99 --1673 --
NM_003349chr201489 11594 ----
NM_003371chr94639 550 207 174 2802 484 ----
NM_003372chrX3969 624 283 ----1301
NM_003373chr1031682 724 662 ----11796
NM_003380chr10--1219 ----
NM_003385chr23839 414 178 ------
NM_003390chr112382 102 --1172 1950
NM_003392chr383964 3374 3196 960 733 585 531 367 ------
NM_003404chr2021263 201 ------
NM_003405chr222723 714 ----1752
NM_003406chr821845 1463 ------
NM_003409chr1841443 1415 1339 952 11179 174 --
NM_003410chrX1655 22165 428 22228 226 --
NM_003411chrY41651 1623 618 465 ------
NM_003412chr352532 2028 1158 1069 280 ------
NM_003430chr1931494 1368 559 --11262 --
NM_003442chr111588 ------
NM_003452chr91369 --1846 --
NM_003454chr16--1163 --1565
NM_003458chr363565 3544 3411 1570 1211 747 ----1460
NM_003463chr682858 2826 2597 2557 2147 1209 351 217 ----1310
NM_003478chr1143224 2993 2244 898 12606 ----
NM_003483chr1232144 837 812 ------
NM_003489chr2123377 184 ----12170
NM_003507chr211700 21833 661 ----
NM_003558chr92454 153 ------
NM_003562chr171298 ------
NM_003564chr11115 ------
NM_003566chr1262980 2920 2350 1207 815 240 ------
NM_003567chr1------1328
NM_003574chr1884443 3902 3670 2280 2112 1723 1633 424 11519 1232 --
NM_003576chr1352889 2820 2504 881 446 --12074 --
NM_003583chr1243102 2834 2498 1029 ------
NM_003586chr161627 ------
NM_003590chr223709 3297 11208 12587 33198 2643 862
NM_003603chr421911 36 11673 ----
NM_003607chr144317 3486 2756 482 13899 ----
NM_003613chr153701 280 154 1673 ----
NM_003615chr353496 2760 1582 88 63 --1728 --
NM_003626chr11--11167 ----
NM_003631chr102159 62 1951 2383 374 --
NM_003632chr171315 ------
NM_003633chr541800 1575 868 283 ------
NM_003635chr102435 214 ------
NM_003644chr17125704 5547 5521 5007 4355 4243 1881 779 724 455 428 70 11573 24513 1388 --
NM_003651chr121201 ------
NM_003663chr352763 2408 665 393 226 ------
NM_003671chr953257 3162 1255 1106 789 12405 ----
NM_003688chrX178 ------
NM_003702chr81269 ------
NM_003705chr21739 --1613 1624
NM_003713chr111655 1212 --1380
NM_003718chr71471 ------
NM_003722chr362729 1910 1026 587 528 43 --12174 --
NM_003744chr142924 402 1479 ----
NM_003749chr1332006 964 31 --1380 140
NM_003759chr473118 2649 1309 1170 969 184 34 --11392 --
NM_003762chr121218 273 ----11155
NM_003763chr201351 ------
NM_003794chr32970 292 ------
NM_003797chr11171 ------
NM_003798chr9--1194 ----
NM_003800chr632414 1699 977 --32387 948 805 --
NM_003806chr121255 ------
NM_003812chr22238 207 ------
NM_003822chr153136 2915 2671 978 971 --23126 2581 --
NM_003825chr1531520 1217 243 ------
NM_003829chr92953 306 ------
NM_003831chr1841537 1191 189 45 21358 147 ----
NM_003850chr132685 271 ------
NM_003872chr263005 2697 2497 1920 574 91 --11903 --
NM_003873chr1041804 655 559 400 11849 1885 --
NM_003877chr122724 327 ------
NM_003887chr262157 2052 1801 1736 458 119 169 ----
NM_003891chr131271 ------
NM_003899chr1362619 2579 2538 2464 1898 1686 ----1404
NM_003909chr872952 2906 2733 2412 2236 175 42 ------
NM_003913chr664145 4109 4096 3239 1493 951 13303 ----
NM_003916chrX2454 103 ------
NM_003924chr41348 ------
NM_003930chr742378 1725 492 332 ------
NM_003932chr2221817 1496 ------
NM_003934chr9--1932 ----
NM_003941chr732384 1922 468 11703 --1332
NM_003943chr41127 ------
NM_003947chr311350 ------
NM_003949chr1752016 1810 1634 1474 135 1524 ----
NM_003968chr34621 587 74 55 ------
NM_003972chr10132 ----1503
NM_003980chr621266 1036 ------
NM_003983chr1641536 1227 1101 442 --33876 3645 319 --
NM_003994chr1253867 3564 1537 1017 505 --21190 561 --
NM_004006chrX51930 1726 1074 775 642 ------
NM_004007chrX51930 1726 1074 775 642 ------
NM_004009chrX51930 1726 1074 775 642 ------
NM_004010chrX51930 1726 1074 775 642 ------
NM_004011chrX51930 1726 1074 775 642 ------
NM_004012chrX51930 1726 1074 775 642 ------
NM_004013chrX51930 1726 1074 775 642 ------
NM_004014chrX51930 1726 1074 775 642 ------
NM_004015chrX51930 1726 1074 775 642 ------
NM_004016chrX61844 1640 996 988 689 556 ------
NM_004017chrX51930 1726 1074 775 642 ------
NM_004018chrX61844 1640 996 988 689 556 ------
NM_004020chrX51930 1726 1074 775 642 ------
NM_004021chrX61844 1640 996 988 689 556 ------
NM_004022chrX61844 1640 996 988 689 556 ------
NM_004023chrX61844 1640 996 988 689 556 ------
NM_004024chr121324 1025 11548 ----
NM_004028chr1863039 2684 1629 1429 436 120 ------
NM_004050chr1412292 ------
NM_004061chr53617 496 191 ------
NM_004073chr1137 1246 ----
NM_004086chr143814 620 120 ------
NM_004093chr1322530 376 --1686 --
NM_004094chr1472769 2439 2422 2100 1875 871 339 13032 22536 171 --
NM_004098chr1021278 1272 ------
NM_004105chr211047 ------
NM_004109chr1142112 924 639 201 1421 ----
NM_004111chr111139 --1216 --
NM_004114chrX2210 98 ------
NM_004124chr1483520 3236 2919 2714 2383 1031 842 696 --13363 11117
NM_004130chr31597 2437 100 ----
NM_004133chr852692 2241 1647 870 856 ------
NM_004162chr311248 11214 ----
NM_004170chr941802 1529 490 482 1706 ----
NM_004171chr11119461 7588 6767 6367 3659 3577 3092 2850 2089 1048 285 17526 23669 2548 --
NM_004172chr531670 1608 676 ------
NM_004185chr11187 ------
NM_004225chr821233 552 21474 1021 ----
NM_004229chrX51940 879 676 297 249 ------
NM_004232chr1843676 3183 2967 159 --13231 --
NM_004236chr151471 ------
NM_004241chr104675 316 165 106 ----1267
NM_004242chr6186 ------
NM_004263chr231824 1457 1304 11151 ----
NM_004274chr1433067 2554 2140 --22081 1215 --
NM_004279chr742162 2069 713 503 11505 ----
NM_004285chr166423 5898 4975 4718 4581 1055 35748 4215 2482 11874 --
NM_004293chr932755 654 269 23694 1011 --1642
NM_004296chr1443851 3079 1055 537 --13668 --
NM_004302chr1281833 994 799 596 513 502 363 250 ------
NM_004319chr141066 743 226 204 32169 691 29 ----
NM_004321chr293466 3302 3212 3085 3042 896 492 197 157 22671 96 33250 2983 139 --
NM_004329chr10------11279
NM_004331chr862695 2059 327 308 300 277 ------
NM_004338chr18106670 5783 5492 4574 4424 2319 2098 1348 1303 510 26453 5540 24831 4369 26193 4817
NM_004342chr71773 1750 ----
NM_004349chr81397 ------
NM_004354chr41724 ------
NM_004356chr111531 ------
NM_004360chr1611899 ------
NM_004370chr641617 728 335 202 ----1497
NM_004380chr1622490 700 ------
NM_004385chr52610 507 ------
NM_004392chr1321789 1024 ------
NM_004397chr1121647 467 13603 --1922
NM_004407chr41112 --1330 1903
NM_004430chr862715 2625 2210 2027 741 53 ------
NM_004432chr942021 1606 1497 161 12080 ----
NM_004433chr121459 148 --11447 1500
NM_004437chr133414 1186 388 --1522 --
NM_004438chr263236 2628 1320 1210 693 191 1321 --12420
NM_004447chr12------184
NM_004449chr215579 417 290 208 199 11138 ----
NM_004457chr231212 598 240 ----11380
NM_004459chr1731678 442 332 1784 ----
NM_004491chr1963887 3753 1121 786 369 175 ----23836 1497
NM_004500chr1431819 1443 519 11805 ----
NM_004504chr222094 632 1830 1800 --
NM_004513chr1552522 2382 1060 985 265 23542 3354 ----
NM_004523chr1011447 --11526 --
NM_004530chr1621099 765 ------
NM_004537chr1231488 471 294 --1625 --
NM_004560chr92823 344 ------
NM_004575chr411643 ------
NM_004578chr11265 1848 ----
NM_004586chrX33914 2128 438 1731 --15171
NM_004593chr31348 ------
NM_004598chr553176 3005 2335 505 346 ------
NM_004602chr2031394 1384 512 ----1423
NM_004607chr51153 ------
NM_004612chr994397 4350 3844 3788 3596 3151 1572 797 652 33925 3265 3035 13463 --
NM_004635chr31775 ----11186
NM_004654chrY2443 163 ----1901
NM_004660chrY62168 1999 1843 1713 798 251 ------
NM_004661chr541019 982 326 199 ----1494
NM_004663chr151197 ------
NM_004685chr1352585 2512 2199 619 463 ------
NM_004690chr6--1583 ----
NM_004709chrX21782 1474 ----1404
NM_004713chr142518 226 1775 ----
NM_004717chr751304 1077 1067 628 138 21443 1252 ----
NM_004719chr1251820 1769 1143 1008 384 ------
NM_004726chrX64985 4824 633 575 554 213 1807 11293 --
NM_004730chr521970 198 ------
NM_004736chr11430 ------
NM_004738chr2052585 1626 895 292 270 ------
NM_004744chr473961 3925 3784 1187 1104 940 718 23597 2878 --13294
NM_004745chr876570 6485 6432 5937 5026 4784 2757 35057 2558 1255 ----
NM_004748chr1532877 1673 1049 --11380 --
NM_004760chr772173 1694 948 869 692 635 335 --1998 --
NM_004763chr261052 782 726 446 390 334 ------
NM_004774chr1721089 1045 1230 22797 1258 --
NM_004775chr181837 1709 ----
NM_004776chr2083209 2804 2762 2559 2505 2487 803 753 13063 12225 --
NM_004779chr511265 ------
NM_004788chr1142574 2439 794 408 ----12549
NM_004808chr1033214 2859 1250 ------
NM_004815chr154872 4491 3625 1578 621 11762 44602 4456 3609 3083 --
NM_004845chrX43532 3482 995 858 1433 23559 1463 --
NM_004849chr631531 314 59 ----1149
NM_004855chr15------1187
NM_004857chr1424016 321 --11389 --
NM_004859chr1773098 2652 2213 2196 2169 1929 474 --1633 --
NM_004866chr531561 1526 221 --14782 11514
NM_004869chr1831574 1526 1364 ----1273
NM_004871chr1744251 3699 625 486 23499 401 13807 --
NM_004872chr11324 ------
NM_004879chr117972 945 820 737 313 265 81 ------
NM_004884chr1511194 ------
NM_004887chr531084 1059 778 ----11097
NM_004896chr1021466 1242 ------
NM_004898chr462680 2307 1928 1905 772 424 12200 1402 --
NM_004899chr21133 ------
NM_004904chr735883 4917 382 ------
NM_004922chr10------162
NM_004929chr821103 26 ------
NM_004939chr21129 ------
NM_004949chr182837 297 11705 ----
NM_004956chr774565 3725 3246 1253 1100 807 732 23860 3840 ----
NM_004965chr211270 ------
NM_004966chr102905 355 ------
NM_004969chr103585 507 132 --1601 --
NM_004985chr1264213 2756 1730 1270 778 185 1860 --12923
NM_004992chrX98127 8092 5980 5726 3030 2297 1646 1387 405 16231 28022 1679 --
NM_004992chrX98127 8092 5980 5726 3030 2297 1646 1387 405 16231 28022 1679 --
NM_004999chr61664 2686 281 11094 --
NM_005016chr12----1320 --
NM_005025chr31196 ------
NM_005032chrX2908 212 --1412 --
NM_005045chr71941 ------
NM_005054chr211663 1277 11555 --
NM_005056chr1234757 3864 3776 1835 ----
NM_005058chrY1211 ------
NM_005063chr10103374 3256 2698 1299 1190 731 720 181 94 83 1487 ----
NM_005065chr1455123 2083 1002 358 216 21470 1340 35191 4894 1418 24740 4646
NM_005067chr31380 ------
NM_005079chr853234 3210 2595 2388 1295 22807 34 21124 340 12252
NM_005095chr111416 ------
NM_005097chr10--1125 ----
NM_005103chr111233 ------
NM_005109chr362332 2326 2067 647 392 300 21684 777 12492 --
NM_005116chr2084014 3601 3423 3149 2992 1748 1301 807 --13204 --
NM_005121chr1753744 3159 2960 1543 1444 --23595 1381 --
NM_005130chr4138 ------
NM_005135chr1573509 3408 2654 1233 1085 633 65 ----1315
NM_005155chr61543 --172 --
NM_005156chr935394 4527 3595 13832 --1733
NM_005164chr1232125 584 468 ------
NM_005180chr103482 82 62 ------
NM_005188chr11138221 6777 6728 6238 5851 5466 5225 2513 2425 2404 2384 1091 968 15815 16604 11651
NM_005190chr6----1966 --
NM_005191chr311452 --1414 1489
NM_005197chr1475104 2379 2020 1976 691 561 347 23984 318 154 12396
NM_005201chr361098 892 448 309 246 113 --150 --
NM_005202chr12536 222 ----12057
NM_005207chr2283283 3159 2654 2617 2561 1181 1088 1028 11383 ----
NM_005215chr183716 482 251 1268 ----
NM_005229chrX1213 ------
NM_005235chr287460 6403 6126 5897 1299 1223 843 400 17844 13084 --
NM_005238chr1143060 834 675 592 --11431 12469
NM_005242chr531418 1312 137 1459 ----
NM_005254chr15--1488 ----
NM_005259chr241362 1063 560 107 ------
NM_005261chr82875 789 ------
NM_005276chr1271479 1429 1350 509 447 363 198 1212 ----
NM_005276chr1271479 1429 1350 509 447 363 198 1212 ----
NM_005296chrX3792 668 57 --1404 --
NM_005311chr722653 132 ----1727
NM_005324chr1721318 667 --11496 --
NM_005338chr753973 2759 1586 595 564 33068 2823 1055 126 --
NM_005339chr443784 3560 364 277 ------
NM_005342chrX52626 2221 2196 713 160 ------
NM_005359chr1844928 4003 467 199 1286 --16389
NM_005384chr9299 40 ------
NM_005387chr111645 ------
NM_005400chr233036 2633 618 ----12308
NM_005402chr741812 1615 1348 1315 ------
NM_005406chr1831016 306 40 ------
NM_005410chr51159 ------
NM_005429chr41100 ------
NM_005436chr1013895 22732 155 12824 --
NM_005445chr101255 ------
NM_005455chr12628 205 ----1551
NM_005458chr931749 677 511 12392 ----
NM_005465chr121675 1280 ------
NM_005467chr111107 ------
NM_005475chr1282298 2066 1111 805 788 660 243 130 1535 12247 --
NM_005493chr61695 ------
NM_005497chr1756049 5991 1759 1130 482 --22383 1511 --
NM_005502chr953219 3009 611 504 434 1491 ----
NM_005504chr1285430 2492 1378 1299 1105 647 556 50 14784 --1159
NM_005517chr14974 469 443 177 ----11228
NM_005537chr132995 757 ------
NM_005539chr1051083 926 444 391 333 1120 121 --
NM_005542chr71369 --11619 --
NM_005546chr522396 538 ------
NM_005570chr18--11051 --11103
NM_005578chr323823 2036 ----24422 740
NM_005587chr15------1751
NM_005596chr966457 6373 6003 5305 5097 1219 ------
NM_005604chr622308 1979 ------
NM_005610chr13851 294 130 ------
NM_005614chr7--2868 796 ----
NM_005619chr192330 123 ------
NM_005629chrX11365 ------
NM_005638chrX41429 1264 573 102 ------
NM_005639chr121290 ------
NM_005644chr1----1384 --
NM_005649chr51509 1186 ----
NM_005650chr2211147 21130 992 1162 --
NM_005655chr821171 903 ------
NM_005664chr15----1221 --
NM_005665chr114737 --13227 --
NM_005667chr21130 ------
NM_005668chr554090 1083 403 318 215 --13621 --
NM_005717chr13842 403 72 --21325 1192 --
NM_005722chr21316 ------
NM_005725chr132406 867 50 ------
NM_005730chr1273472 3079 2697 2367 1218 445 157 --12678 1174
NM_005738chr721408 107 1778 ----
NM_005746chr71721 --12688 1758
NM_005759chr274706 4687 4053 3185 1514 1496 251 ------
NM_005777chr3--185 ----
NM_005779chr553220 3069 2992 2770 707 31421 916 257 23105 2400 23228 2461
NM_005780chr131115 ------
NM_005786chr181902 21149 493 ----
NM_005789chr1731974 1623 394 --11783 --
NM_005792chr163489 407 371 ------
NM_005802chr93704 555 230 ------
NM_005808chr343508 2968 2629 666 --13261 --
NM_005813chr222603 956 22341 2250 1838 --
NM_005828chr1764577 4245 3193 1707 1697 292 --13559 --
NM_005832chr3--1355 ----
NM_005839chr13771 602 113 ------
NM_005840chrX106440 5519 5065 2243 2069 1018 744 729 223 134 12646 ----
NM_005843chr241686 776 562 469 ------
NM_005857chr121094 141 ------
NM_005859chr531318 1293 1151 ------
NM_005862chr31195 ------
NM_005868chr722411 2177 1278 ----
NM_005880chr1611378 11427 ----
NM_005898chr1132493 1197 156 ------
NM_005899chr1721369 1196 ------
NM_005903chr564436 4421 3184 1149 714 645 13199 11364 13833
NM_005904chr1831403 548 332 ------
NM_005907chr641692 1514 1419 598 ------
NM_005909chr554117 2954 576 297 125 ------
NM_005911chr23534 435 423 --11496 --
NM_005933chr1172883 2770 2680 2373 748 594 451 ------
NM_005935chr455200 4946 4267 3538 758 --13897 --
NM_005941chr863459 3106 2820 1151 905 593 ------
NM_005955chr154949 4723 1550 785 256 ------
NM_005962chr1042165 1905 652 314 ------
NM_005962chr1042165 1905 652 314 ------
NM_005964chr172992 514 --11016 --
NM_005966chr221734 1512 ----1437
NM_005977chr131273 1225 ----
NM_005986chr1321841 825 --12535 --
NM_005990chr561899 862 777 648 136 107 --12367 --
NM_005996chr1241389 1344 1228 1027 1157 ----
NM_006003chr19144 ------
NM_006007chr964386 4231 3363 1453 1437 290 --14196 --
NM_006011chr1563164 1020 942 477 394 43 12691 ----
NM_006016chr661912 1771 632 538 395 279 ------
NM_006036chr282331 2236 2112 2047 1014 867 497 345 --1691 --
NM_006038chr2032129 1946 612 ------
NM_006040chr162270 100 ----1315
NM_006047chr2053479 3310 2822 693 371 --1343 --
NM_006048chr131014 862 276 128 ----
NM_006064chrX1146 ------
NM_006070chr3135 --1302 --
NM_006080chr722882 312 ------
NM_006086chr16--1286 ----
NM_006095chr463251 1648 931 892 334 306 1265 13199 1988
NM_006106chr1132266 380 304 ------
NM_006108chr1132343 2237 236 ----1145
NM_006135chr131274 454 100 ------
NM_006136chr711062 ------
NM_006139chr282855 2767 2415 2407 1056 801 223 125 --1779 --
NM_006141chr1662021 1897 1802 958 518 90 12478 --1191
NM_006145chr1921164 369 ------
NM_006153chr31420 ------
NM_006154chr1521175 350 11975 --11967
NM_006158chr851831 1426 1138 605 223 ------
NM_006164chr21166 ------
NM_006166chr1242580 2500 2384 909 22531 298 ----
NM_006167chr841901 795 632 416 ------
NM_006186chr211098 ------
NM_006194chr142962 445 ------
NM_006196chr21314 ------
NM_006203chr573660 1735 420 187 105 72 65 11325 14053 --
NM_006206chr42685 188 --1467 --
NM_006211chr81222 ------
NM_006226chr211303 --1141 --
NM_006242chr2021440 329 21849 1339 ----
NM_006246chr1411204 ------
NM_006252chr185634 5469 5099 2823 2633 2156 953 135 --35653 5110 2665 --
NM_006256chr132276 414 80 --11799 --
NM_006258chr1031516 524 62 1537 21586 998 --
NM_006265chr811522 ------
NM_006266chr94653 641 260 92 ----1832
NM_006282chr2054574 3933 3751 1284 170 13625 12873 23632 1092
NM_006283chr854904 4774 4725 4408 3831 14086 ----
NM_006298chr642796 2340 717 603 32867 2123 113 --11347
NM_006306chrX64789 4743 2184 963 692 592 ----14668
NM_006312chr12133 ------
NM_006320chr411076 ------
NM_006322chr131909 151 ----
NM_006323chr4--160 ----
NM_006330chr831525 1120 126 ------
NM_006357chr23447 368 163 ------
NM_006359chrX2374 115 ------
NM_006366chr62505 352 1880 ----
NM_006371chr354326 3511 1075 359 149 24523 4498 ----
NM_006372chr6--1409 ----
NM_006375chrX51664 1513 717 270 112 --11362 --
NM_006379chr72377 191 ------
NM_006380chr1774267 4199 4043 3431 3186 3135 929 1581 ----
NM_006386chr222672 180 --12161 --
NM_006391chr111310 ------
NM_006393chr1094147 3936 3650 3211 1811 1293 1036 774 732 --21394 684 --
NM_006420chr2083401 2382 2267 2111 1045 489 286 51 ------
NM_006421chr81234 ------
NM_006451chr53903 288 81 ------
NM_006454chr493081 3001 2866 2427 2387 464 158 107 51 32971 655 571 ----
NM_006457chr452876 2647 2549 1568 500 --1899 --
NM_006459chr1071994 1839 1486 1459 1450 778 264 ------
NM_006460chr1731355 559 483 ------
NM_006464chr284648 4388 4379 3501 2997 1124 1091 554 --11130 14104
NM_006482chr1243102 2834 2498 1029 ------
NM_006496chr121481 181 ------
NM_006504chr1012503 11985 12865 --
NM_006517chrX32125 1864 1556 ------
NM_006520chrX147 193 1223 --
NM_006526chr20----140 --
NM_006532chr1911720 ------
NM_006534chr2063429 3053 2855 699 332 145 ------
NM_006539chr161213 ----1486
NM_006540chr81105 1119 --1311
NM_006544chr1464081 1386 924 600 275 30 24658 307 ----
NM_006546chr17106484 6429 5927 5852 5057 5019 4904 4265 1484 570 1227 14536 1712
NM_006547chr7137 ----1340
NM_006548chr321437 699 1208 11701 --
NM_006549chr1262724 2483 2348 2277 2015 295 --12067 --
NM_006558chr8----1376 --
NM_006559chr121204 1162 ------
NM_006560chr111525 ------
NM_006561chr1095626 5430 5154 4988 2178 2127 1088 993 658 --15516 --
NM_006580chr32495 122 ------
NM_006599chr1676119 5738 5443 5024 3093 2942 2929 15189 12250 --
NM_006601chr1221011 723 ------
NM_006603chrX21362 768 1665 ----
NM_006609chr232526 2409 2066 --11045 --
NM_006614chr333009 655 177 ------
NM_006621chr131645 1329 322 11471 ----
NM_006624chr1011399 ----11661
NM_006628chr1584213 4115 3717 1796 1641 1504 796 713 ------
NM_006629chr1862867 2526 1995 995 951 43 12146 1614 1959
NM_006633chr51738 ------
NM_006646chr1332691 782 183 --12095 1390
NM_006650chr563833 826 779 744 321 279 13173 ----
NM_006654chr1284322 4179 3671 1768 1458 1356 825 664 ------
NM_006675chr123784 446 173 32611 1101 1091 22511 896 --
NM_006681chr4136 ------
NM_006682chr752764 2400 907 371 131 12366 ----
NM_006690chr2052319 1477 1441 585 216 --1291 --
NM_006704chr131341 ------
NM_006708chr611232 11252 11017 --
NM_006717chr942936 2847 2816 125 12393 22587 1291 --
NM_006721chr104591 529 231 220 ------
NM_006722chr342866 2642 2196 1972 ------
NM_006729chrX34093 3621 410 14213 1824 --
NM_006731chr984864 4552 3865 1992 1731 1443 631 183 11783 1196 --
NM_006734chr611236 ------
NM_006750chr16117423 7360 6400 6269 6099 5973 5075 2865 1531 1414 439 11279 ----
NM_006751chr21356 --1151 --
NM_006756chr821410 1250 ------
NM_006758chr21--131 ----
NM_006766chr832593 1768 976 ------
NM_006775chr652698 2223 2164 2101 619 ------
NM_006777chrX82780 2680 2578 2476 1992 1905 1170 513 12229 11958 1480
NM_006788chr1831619 706 235 11435 ----
NM_006790chr51434 ------
NM_006802chr12889 335 1205 ----
NM_006807chr1711345 ------
NM_006815chr1241300 931 516 69 ------
NM_006823chr821400 1369 ----1341
NM_006827chr1443048 2930 603 283 1121 ----
NM_006836chr12--1475 ----
NM_006838chr1241522 738 240 206 ------
NM_006839chr2138 ------
NM_006854chr731988 699 557 ------
NM_006874chr41780 ------
NM_006875chrX159 ------
NM_006877chr61347 ------
NM_006885chr1642975 2960 2929 2750 13464 1175 --
NM_006888chr142656 134 --1851 --
NM_006908chr721338 120 11213 ----
NM_006910chr161378 ------
NM_006914chr931225 1073 88 ------
NM_006915chrX3928 748 104 ------
NM_006920chr262035 2025 2014 506 163 96 ------
NM_006922chr242354 894 420 94 1511 ----
NM_006924chr171197 --11103 --
NM_006938chr1811043 --171 --
NM_006939chr142741 121 ------
NM_006940chr1251711 1701 1512 720 374 11609 1251 --
NM_006948chr2131690 794 341 --1454 --
NM_006951chr102759 280 ------
NM_006981chr921844 302 ------
NM_006996chr111222 ----11233
NM_007005chr931440 1116 444 11126 ----
NM_007010chr1731842 1437 422 ------
NM_007011chr1575977 5780 5131 4507 2724 1657 382 ------
NM_007013chr8----1750 --
NM_007017chr51216 ------
NM_007023chr26966 705 686 257 68 59 ------
NM_007026chr171188 ------
NM_007030chr5104232 3851 3641 3362 1745 1120 1076 822 638 30 --14259 --
NM_007034chr12755 683 1304 ----
NM_007039chr1442102 1703 1661 1603 ------
NM_007042chr352028 1912 1855 307 190 --1421 --
NM_007050chr2055578 5479 2871 1053 942 46929 6849 4990 26 47948 6687 1625 1325 --
NM_007067chr1711272 ------
NM_007069chr11122 161 ----
NM_007073chr664152 3663 3345 3108 1224 1040 21343 1328 13425 --
NM_007125chrY21308 132 ------
NM_007146chr17--12262 --1273
NM_007150chrX3672 246 184 --1438 --
NM_007159chr321564 1221 --21573 1305 --
NM_007172chr2252911 2764 2592 1135 741 13264 ----
NM_007174chr122331 194 --12236 --
NM_007187chr132261 94 ------
NM_007203chr933418 3099 640 ------
NM_007212chr141989 1843 1566 1412 ------
NM_007238chr2084702 3886 3824 3678 1939 1365 1161 353 24645 3333 14846 --
NM_007249chr1388282 7353 6442 3542 3520 2655 2051 1347 21701 313 23561 2254 --
NM_007282chr32960 787 ------
NM_007283chr373014 2728 1134 1128 896 775 690 --12568 --
NM_007345chr1821910 104 11740 11688 1374
NM_007347chr1532863 2643 337 22817 997 12982 --
NM_007350chr1253251 1598 1560 1385 523 --14489 --
NM_007358chr1--1781 ----
NM_007371chr91266 --1631 --
NM_007373chr1021738 1422 --1245 --
NM_012081chr583683 3545 2422 1378 1156 991 958 652 --12710 --
NM_012104chr1123010 2805 13618 ----
NM_012104chr1123010 2805 13618 ----
NM_012111chr141201 ------
NM_012129chr741759 562 515 151 ------
NM_012137chr172842 2240 1986 636 324 97 26 --12711 --
NM_012141chr1344112 3318 965 729 13811 ----
NM_012155chr19127 ------
NM_012164chr966788 5006 1109 205 147 39 11534 12852 --
NM_012177chr61577 ------
NM_012188chr51868 --167 137
NM_012193chr1125208 1611 --21356 48 --
NM_012197chr91204 --21515 481 --
NM_012207chr1021124 895 11104 ----
NM_012214chr286373 6164 5959 5369 5319 2454 1603 589 35148 4796 4693 11919 --
NM_012215chr1021877 458 ------
NM_012223chr211201 1399 1386 --
NM_012234chr373548 3539 3384 2436 854 345 123 ------
NM_012238chr1021107 59 11442 ----
NM_012243chr1--2705 589 --1326
NM_012249chr273565 3474 2729 1403 765 623 60 ------
NM_012250chr1111300 21391 1161 1446 --
NM_012255chr20151 ------
NM_012262chr164415 3829 3383 2109 1038 172 13508 15104 --
NM_012281chr731580 894 252 11674 11954 1486
NM_012294chr773734 2638 713 599 310 198 61 11351 1165 --
NM_012297chr4----12544 --
NM_012301chr72660 343 ------
NM_012309chr1184656 3905 1768 1351 1033 749 300 76 21921 1781 11527 --
NM_012316chr155172 4849 2164 1935 1149 --14482 --
NM_012326chr22855 109 --1536 --
NM_012327chr1841084 1066 548 423 ------
NM_012328chr731315 189 60 ------
NM_012338chr74461 399 224 169 ------
NM_012383chr92421 173 170 ----
NM_012395chr713396 ------
NM_012399chr2241960 1370 457 32 11722 ----
NM_012402chr112908 350 --11107 --
NM_012405chr172397 1430 994 776 197 130 107 33201 2413 1528 1937 --
NM_012416chr93811 353 335 --21074 305 --
NM_012421chr1----1147 --
NM_012425chr1062111 897 784 440 352 168 ------
NM_012454chr61498 ------
NM_012463chr1221856 239 1390 --173
NM_012471chrX61504 697 668 551 389 334 ------
NM_012479chr74881 654 538 35 21090 291 12241 --
NM_013231chr1443838 2986 953 291 1358 21236 1071 --
NM_013232chr5150 ------
NM_013250chr1121509 917 1111 ----
NM_013255chr786668 6427 6308 6157 2369 1645 1538 1305 --16060 --
NM_013262chr61499 1593 1295 --
NM_013269chr1211582 ------
NM_013281chr2011070 ------
NM_013286chr373318 2799 2534 1501 1451 1173 295 11267 1773 --
NM_013293chr71143 ------
NM_013336chr331485 802 698 2233 147 ----
NM_013352chr61364 ------
NM_013357chr83840 773 574 ------
NM_013372chr1532549 2427 1229 2818 216 1519 --
NM_013374chr352865 2441 2042 1081 423 12885 --13156
NM_013390chr911472 ------
NM_013437chr851360 1309 1198 1105 525 ------
NM_013449chr1222655 1020 12025 ----
NM_013937chr61465 ------
NM_013960chr83297 58 32 ------
NM_013995chrX1793 --21871 939 --
NM_014000chr1031682 724 662 ----11796
NM_014011chr2--1132 ----
NM_014016chr331728 1564 629 ------
NM_014021chr163141 3012 2812 2425 1288 1080 13293 1572 --
NM_014023chr1031140 795 35 22055 1871 1670 --
NM_014028chr623026 2763 ------
NM_014034chr61501 11372 ----
NM_014048chr1645158 4453 1293 1079 1696 --11495
NM_014056chr352259 1979 1447 674 235 ----1355
NM_014071chr201511 ------
NM_014089chr1332273 1793 1705 12040 11496 --
NM_014109chr81173 1211 11123 --
NM_014112chr865221 4973 4933 4518 4509 2086 11429 24494 4027 1938
NM_014141chr775104 4800 4313 3702 1720 1579 551 --1579 24638 2128
NM_014154chr31317 ------
NM_014155chr1187370 6906 6753 6531 5518 5481 4938 1862 22038 190 ----
NM_014159chr32144 91 --1453 --
NM_014160chr311419 ------
NM_014223chr12719 256 ------
NM_014233chr1721939 1485 ------
NM_014241chr102355 145 ------
NM_014253chrX52220 1670 975 576 439 ------
NM_014313chr1184 --21380 1055 --
NM_014316chr1611976 ----12052
NM_014319chr1221593 1310 ------
NM_014331chr477703 7616 6467 6439 2519 1324 1210 ----37573 6546 683
NM_014332chrX1386 ------
NM_014342chr1131405 1045 999 --1447 --
NM_014350chr52990 417 1133 ----
NM_014382chr331375 1201 464 1570 11171 --
NM_014393chr83451 103 87 ------
NM_014395chr411421 ------
NM_014411chr741941 1926 1803 203 21567 1334 ----
NM_014415chr331682 1209 681 ------
NM_014421chr41254 ----1385
NM_014423chr545608 5114 4733 1908 --24514 165 --
NM_014435chr42674 651 ------
NM_014445chr342214 903 830 676 ------
NM_014505chr122454 333 ------
NM_014548chr1521213 1060 ------
NM_014563chrX51489 398 291 171 30 ------
NM_014572chr1341692 1665 1140 468 ------
NM_014573chr1741788 741 153 142 ------
NM_014574chr142473 158 ------
NM_014584chr1431644 1541 380 --11590 --
NM_014586chr2144419 3963 667 68 11548 ----
NM_014588chr202136 118 ------
NM_014600chr231535 612 315 ------
NM_014602chr31361 ------
NM_014607chr23808 374 192 2399 222 ----
NM_014612chr92397 199 ------
NM_014614chr241455 1292 1210 1076 ------
NM_014615chr1673408 2693 2681 2284 2259 493 116 --13199 --
NM_014620chr121146 ------
NM_014632chr11143 ------
NM_014634chr2242915 2890 2504 755 --12995 13610
NM_014635chr221641 696 1241 11527 --
NM_014636chr963987 3048 2953 1033 773 185 ----1897
NM_014647chr1631728 1396 770 ------
NM_014660chr72456 172 1339 ----
NM_014666chr5175 ------
NM_014667chr322129 920 ----1532
NM_014682chr81423 ------
NM_014685chr16--1443 ----
NM_014701chr1542998 2223 1270 1028 ------
NM_014702chr672708 2486 1376 839 673 371 199 12497 ----
NM_014707chr722030 1802 --1524 --
NM_014711chr1641791 1516 1329 285 21973 579 ----
NM_014715chr112922 800 ------
NM_014720chr1041526 1360 1257 46 ------
NM_014721chr696525 6347 6280 6225 5237 4988 4967 2395 614 25103 632 46266 5140 4940 1686 --
NM_014729chr821608 761 ------
NM_014730chr1265088 4942 1842 1004 639 377 ------
NM_014730chr1265088 4942 1842 1004 639 377 ------
NM_014732chr1685201 1859 1706 1679 1242 263 205 44 35868 5536 1605 14435 11823
NM_014733chr552154 2121 327 288 74 --22234 399 --
NM_014735chrX31885 1595 1392 1219 --11783
NM_014746chr244220 3940 160 128 21026 366 14206 --
NM_014747chr165726 5222 4297 3518 2201 844 --24682 4289 --
NM_014755chr223948 1049 ------
NM_014758chr1131869 1797 623 1335 ----
NM_014762chr152505 1979 1967 1722 608 11661 22262 2026 --
NM_014770chr1211183 ------
NM_014772chr1842816 858 562 460 13316 --11441
NM_014779chr341129 201 170 56 ------
NM_014781chr8--11157 ----
NM_014787chr152741 2490 2311 1873 1068 ------
NM_014795chr21900 ------
NM_014798chr1741756 1369 600 115 11377 ----
NM_014802chr122390 326 --1751 --
NM_014819chr541847 547 118 102 ------
NM_014820chr331960 1627 528 ----11440
NM_014826chr144317 3486 2756 482 13899 ----
NM_014827chr13448 331 209 ------
NM_014828chr1442482 2458 1861 386 --12043 --
NM_014830chr1283385 3131 2411 1339 1229 1115 688 663 11105 ----
NM_014835chr2032213 1530 787 1543 ----
NM_014840chr12112879 2823 2723 2325 2152 1284 697 614 512 202 186 1904 ----
NM_014847chr1--1447 ----
NM_014850chr364420 4381 4274 3028 1289 531 11112 ----
NM_014864chr154009 3582 3486 1551 281 ------
NM_014869chr32579 450 11206 ----
NM_014872chr922090 1955 22051 41 12350 --
NM_014877chr17107102 6973 6541 5785 5514 5362 2573 1900 1035 655 22988 143 26328 2776 11879
NM_014888chr711456 ------
NM_014893chrY72279 2267 888 843 573 261 105 ------
NM_014901chr562223 2051 1796 436 309 134 ------
NM_014903chr124586 438 168 82 11593 ----
NM_014904chr1013517 ------
NM_014905chr2----1263 --
NM_014906chr1773277 3184 3178 3082 989 788 273 --1849 --
NM_014910chr191747 2792 74 1320 --
NM_014912chr1023353 3305 11252 ----
NM_014913chr181299 ------
NM_014914chr21488 ------
NM_014923chr1361921 1847 1765 1557 1463 415 ------
NM_014932chr341755 1700 569 512 ----1387
NM_014945chr51133 --11844 --
NM_014946chr231207 516 466 22420 791 ----
NM_014947chr13433 272 211 23113 297 ----
NM_014950chr141312 11525 1622 --
NM_014961chr41106 ------
NM_014962chr2052172 2156 1166 741 96 11137 ----
NM_014969chr11869 ------
NM_014974chr1011235 31678 566 480 11132 11450
NM_014982chr1432013 1544 850 13801 23442 735 --
NM_014988chr42657 421 ----1832
NM_014989chr61547 ----11849
NM_014991chr452979 2891 2711 1139 632 ----11105
NM_014992chr141637 1794 ----
NM_014996chr3------153
NM_014997chr772797 2754 2438 1927 901 668 347 12944 ----
NM_015002chr1222258 233 ------
NM_015008chr313113 12705 23436 1458 --
NM_015020chr1653745 3736 3711 2726 1181 161 --11044
NM_015026chr1274801 4239 3919 3738 3633 1201 259 ------
NM_015027chr1652003 1720 1699 773 79 1476 ----
NM_015032chr1342879 2223 485 406 --12822 --
NM_015035chr2096247 5991 5813 5504 4474 4334 1494 410 91 11559 25593 618 --
NM_015039chr163363 3088 2979 2752 1549 47 14336 ----
NM_015040chr253284 3178 2641 315 109 --12585 --
NM_015049chr2----12633 13103
NM_015051chr953258 1229 1034 1017 203 32678 1091 292 ----
NM_015052chr72879 220 11343 ----
NM_015059chr1593724 3665 3526 3151 2808 1519 1471 1101 182 33999 2647 2513 11255 --
NM_015062chr10191 ------
NM_015068chr743862 3327 2572 810 13779 12989 --
NM_015074chr173615 3107 1873 1812 1488 978 775 --11066 --
NM_015076chr644011 1468 656 97 ------
NM_015090chr166072 4535 2420 1751 630 204 14248 22260 2146 15999
NM_015092chr1633424 1752 325 13089 24384 3793 --
NM_015093chr63466 330 177 --1143 11599
NM_015097chr32545 308 --12248 1465
NM_015115chr433158 611 527 1455 21113 1037 --
NM_015130chr42352 273 ------
NM_015132chr721339 456 1320 ----
NM_015136chr31135 ------
NM_015144chr1643910 2628 2434 1358 33202 2655 204 ----
NM_015156chr1463493 2952 2936 2592 929 549 1524 21102 1007 --
NM_015180chr141713 --1267 --
NM_015185chrX32914 2675 2419 --1650 --
NM_015191chr1152161 1768 1722 1106 935 1698 ----
NM_015197chr1433410 3348 168 --12517 --
NM_015199chr342936 2503 474 269 ----1230
NM_015200chr422579 1598 ------
NM_015219chr1721976 887 ------
NM_015236chr41577 ------
NM_015247chr1664501 1970 1247 948 730 92 --11139 --
NM_015250chr94636 473 263 129 11821 ----
NM_015254chr82642 58 12409 22090 262 --
NM_015267chr1262089 1526 717 588 190 128 --11538 --
NM_015271chr432887 1600 754 --1905 199
NM_015272chr161528 ------
NM_015275chr1232075 1796 60 ----1770
NM_015277chr1831881 489 253 11365 ----
NM_015278chr633444 2426 274 ------
NM_015286chr1542496 908 346 47 11817 12017 --
NM_015288chr583507 3460 3060 1373 754 719 663 234 13213 12565 --
NM_015291chr153229 2830 2649 1387 242 ----12331
NM_015299chr1443648 3088 1326 34 23858 268 1449 --
NM_015310chr877989 7826 7630 7500 7217 2552 2073 ------
NM_015313chr1164056 3559 3251 1602 1168 627 14067 ----
NM_015315chr523302 2700 ----12568
NM_015317chr221885 1876 --12029 --
NM_015321chr1991767 1321 1293 1270 1199 1167 741 332 117 13285 13222 --
NM_015326chr122847 1826 --12736 --
NM_015332chr753553 3317 1369 1352 1017 11026 ----
NM_015335chr1222614 152 ------
NM_015336chr1252669 2576 2132 1840 105 --11884 11955
NM_015355chr1761812 1691 671 436 272 204 ------
NM_015365chrX43556 1679 1350 1314 ----12696
NM_015375chr153768 3065 1529 929 585 14069 ----
NM_015381chr2231906 523 398 --11627 --
NM_015382chr142593 94 ------
NM_015384chr5----129 --
NM_015393chr473793 3698 3677 3574 3487 3296 2728 ----23718 2860
NM_015394chr1242465 2193 422 336 ----1262
NM_015397chr921710 1369 11856 1704 --
NM_015423chr1141656 1276 305 251 11204 21444 1324 --
NM_015436chr423239 242 ------
NM_015446chr121495 521 ------
NM_015455chr553560 2682 1455 1408 162 1204 ----
NM_015458chr841180 292 276 234 ------
NM_015460chr351876 1388 674 366 22 ------
NM_015483chr71901 ------
NM_015497chr1521148 63 2874 155 ----
NM_015503chr161663 ------
NM_015508chr321075 211 2995 138 ----
NM_015530chr24880 691 255 164 ----1201
NM_015532chr1572699 2452 1971 1138 1010 934 35 181 ----
NM_015542chr101812 ------
NM_015557chr172484 2365 1224 726 202 151 59 1904 ----
NM_015559chr181919 --1951 --
NM_015564chr533131 2255 493 12836 13295 --
NM_015565chr211711 ------
NM_015569chr163210 1615 1583 514 449 166 ----1649
NM_015571chr622003 787 11707 21963 1882 1129
NM_015576chr332121 344 226 --11203 --
NM_015578chr191543 ------
NM_015640chr123423 606 ------
NM_015652chr10------1139
NM_015678chr13------11693
NM_015702chr2--169 ----
NM_015713chr812873 1781 12935 --
NM_015844chr18----1149 --
NM_015846chr18----1149 --
NM_015847chr18----1149 --
NM_015850chr841660 1633 494 230 12372 ----
NM_015852chr743178 3051 2944 806 ------
NM_015859chr14------1109
NM_015879chr1898235 8141 5782 5527 3344 3213 2249 2066 551 48432 8389 8289 2801 37005 3236 1497 12970
NM_015892chr1042128 2118 395 41 ----1896
NM_015902chr82959 205 ------
NM_015905chr72569 64 ------
NM_015906chr144256 3929 3074 528 --2892 503 13713
NM_015907chr4--1355 1316 --
NM_015912chr842112 883 489 308 ------
NM_015941chr81129 ------
NM_015980chr531591 1260 1042 ------
NM_015981chr552696 2098 1158 232 108 33006 2612 2527 11106 --
NM_015995chr1584951 4836 3927 3385 1926 1894 1768 801 34087 3847 1634 1736 11160
NM_016018chr861781 1000 789 713 234 127 ------
NM_016019chr71275 ------
NM_016021chr652085 1881 1046 605 473 ------
NM_016023chr841983 1670 1409 84 ----22064 156
NM_016025chr161484 ------
NM_016037chr13362 254 121 ----11160
NM_016045chr2021140 491 11268 ----
NM_016061chr26579 560 509 432 337 220 ------
NM_016066chr1235 24 ------
NM_016071chr7189 ------
NM_016076chr121272 711 1396 --11016
NM_016078chr171775 ------
NM_016081chr441408 854 473 384 ------
NM_016083chr643085 1395 1129 311 --11446 --
NM_016090chr112815 341 --1723 --
NM_016098chr62107 45 ------
NM_016107chr511267 ------
NM_016118chr761032 787 472 455 448 43 ------
NM_016125chr17138 ------
NM_016127chr82478 262 --1205 --
NM_016131chr221573 886 --1930 --
NM_016132chr1522844 2545 12641 12396 --
NM_016133chr251416 1353 336 308 95 ------
NM_016169chr103684 150 127 12616 33165 3041 2230 --
NM_016201chr361758 925 731 345 338 56 ------
NM_016205chr4--1946 1351 --
NM_016206chr3139004 8997 7088 6350 5722 1641 1529 1435 1307 1120 965 952 325 12368 1694 --
NM_016217chr673524 2989 2416 1313 830 571 132 ------
NM_016224chr641559 786 594 28 1393 --1438
NM_016248chr1331542 746 661 1332 ----
NM_016252chr22689 59 ------
NM_016255chr653335 3140 2708 2251 159 ------
NM_016258chr11283 ------
NM_016260chr232202 2070 999 11460 37148 4854 2288 --
NM_016269chr4--1167 21053 289 --
NM_016271chr1862130 1907 1859 1811 946 41 ------
NM_016277chr641476 1296 1239 254 1471 ----
NM_016287chr11161 11873 1387 --
NM_016289chr232272 1555 1498 12008 ----
NM_016300chr32332 197 ------
NM_016303chrX--1438 ----
NM_016308chr12814 659 11684 ----
NM_016312chr122467 98 ------
NM_016315chr24529 410 404 54 11543 ----
NM_016322chr932056 1260 266 12467 13037 --
NM_016351chr72403 124 ------
NM_016374chr121612 1349 11359 ----
NM_016374chr121612 1349 11359 ----
NM_016395chr153681 403 29 ----1296
NM_016396chr1523053 1165 ------
NM_016418chr2273727 3445 2553 1055 731 565 455 13456 11256 --
NM_016424chr1751745 1346 752 486 328 --1714 --
NM_016448chr141819 1601 629 384 11752 21326 750 11867
NM_016463chr5140 ------
NM_016470chr202407 345 ------
NM_016475chr142111 21 ------
NM_016507chr1753048 2930 2304 2009 1146 187 ----
NM_016516chr23620 566 182 ------
NM_016530chr1584068 3734 3710 3521 3067 1624 1398 143 ------
NM_016531chr493681 2947 1522 1493 1139 773 388 321 246 21389 399 --1352
NM_016556chr171256 ----142
NM_016569chr1241389 1344 1228 1027 1157 ----
NM_016570chr12------1421
NM_016598chr321474 1192 11330 ----
NM_016603chr531922 135 95 --1848 --
NM_016607chrX31123 527 94 1476 ----
NM_016620chr121425 1109 ------
NM_016621chr1194048 3323 3268 1413 1152 257 247 228 145 21654 1397 ----
NM_016626chr1821364 442 ------
NM_016640chr52302 123 ------
NM_016653chr221235 269 ----1956
NM_016654chr15--1488 ----
NM_016656chrX1146 ------
NM_016824chr1041908 1556 1384 326 ------
NM_016830chr121551 ------
NM_016950chr4--1464 ----
NM_017415chr544173 3782 3272 763 1645 ----
NM_017420chr1433845 2381 1217 ----13270
NM_017452chr2031394 1384 512 ----1423
NM_017453chr2031394 1384 512 ----1423
NM_017454chr2031394 1384 512 ----1423
NM_017519chr61378 ------
NM_017540chr552753 1077 731 636 453 12084 ----
NM_017544chrX162 ----1394
NM_017550chr19169 ------
NM_017553chr1531213 1188 58 ------
NM_017569chr131130 1147 ----
NM_017580chr1022154 1556 ----1888
NM_017582chr141217 1171 335 246 --11343 11450
NM_017593chr41189 ------
NM_017594chr953340 1005 343 254 200 ------
NM_017610chr1531968 1928 1463 ----1147
NM_017628chr454956 4268 4191 2086 740 ----24227 4045
NM_017629chr12713 319 ------
NM_017633chr643657 3430 3095 2716 13885 --13070
NM_017635chr1131118 493 424 1468 ----
NM_017637chr968516 7088 3703 2846 2282 961 23057 1589 27974 27 --
NM_017641chr121448 ------
NM_017644chr364789 4168 3986 3810 3248 93 --14253 --
NM_017645chr942791 2722 766 51 ------
NM_017650chr795855 5099 4762 4696 4118 4030 1086 971 612 11716 ----
NM_017651chr621553 415 ------
NM_017657chr2--1608 ----
NM_017658chr1463910 3903 1765 1633 727 539 11179 ----
NM_017662chr941690 1410 610 44 --11276 --
NM_017667chr71506 --1519 --
NM_017691chr151395 ------
NM_017709chr183557 3352 3125 1522 574 557 275 210 ------
NM_017714chr20------1626
NM_017716chr111294 ------
NM_017719chr312119 1177 12059 --
NM_017736chr1641214 1060 364 282 11226 ----
NM_017737chr12409 81 1392 ----
NM_017745chrX1476 ------
NM_017752chrX41788 444 308 55 ------
NM_017753chr93701 694 79 ----1212
NM_017754chr674979 4589 3430 3203 1755 1659 26 --24867 799 1109
NM_017787chr1042779 2189 998 499 11906 ----
NM_017790chr91161 --2491 479 --
NM_017799chr1441437 1430 1297 1261 --11343 --
NM_017801chr331819 709 156 ----12607
NM_017811chr932382 887 871 ------
NM_017813chr855045 4957 1834 1314 990 11794 ----
NM_017845chr4--1544 ----
NM_017848chrX23984 3551 23893 310 ----
NM_017902chr1034728 1339 28 25044 1321 25298 5007 --
NM_017905chr131567 ------
NM_017913chr91165 ------
NM_017919chr955227 1471 695 376 28 21743 1005 35456 3712 225 --
NM_017922chr141157 ------
NM_017933chr221424 1082 --1300 --
NM_017944chr1162987 2798 2598 2268 893 74 ------
NM_017954chr741624 1133 476 163 ------
NM_017958chr243045 2461 985 131 --1343 --
NM_018000chr242126 513 441 410 ------
NM_018028chr1911036 ------
NM_018030chr1831106 1041 818 ------
NM_018036chr1454035 4004 3675 3088 2748 --33900 3711 1623 --
NM_018046chr521313 101 1739 ----
NM_018051chr7--1309 ----
NM_018061chr141561 1422 1381 422 --11555 --
NM_018084chr213146 1943 23204 2722 1527
NM_018086chr211348 ------
NM_018092chr1651526 1453 552 370 256 ------
NM_018094chrX2360 145 ------
NM_018121chr1053076 2375 1174 121 97 1646 12306 1702
NM_018126chr4163 ------
NM_018155chr323213 1301 ------
NM_018157chr1243279 2985 2137 774 --22102 592 --
NM_018169chr122425 87 ------
NM_018178chr12605 540 150 ----
NM_018182chr1732078 1562 249 --11383 --
NM_018195chr1162129 1724 1503 386 116 69 ------
NM_018200chr1562531 2260 2236 2224 1993 666 11918 ----
NM_018207chr141657 1309 1174 647 1357 --11127
NM_018227chr442907 2579 894 241 ------
NM_018230chr12472 213 ------
NM_018243chr434062 3603 328 --13009 11259
NM_018247chr643140 2407 2137 92 ------
NM_018254chr131890 854 740 --11925 --
NM_018257chr2032398 1949 609 1662 --21915 1861
NM_018270chr204909 180 111 77 ----1778
NM_018299chr872860 2604 2161 900 354 240 231 ------
NM_018302chr451920 792 728 148 91 ------
NM_018307chr171671 174 ----
NM_018313chr332401 1702 767 ------
NM_018315chr42576 364 ------
NM_018318chr122881 269 ----1383
NM_018325chr9----1167 --
NM_018339chr921656 1513 --1333 --
NM_018342chr431714 1358 1125 ------
NM_018351chr1284398 4386 3882 3044 1834 1511 1017 821 ------
NM_018361chr842547 1075 782 493 ----11593
NM_018362chr1153946 3823 3316 1194 80 --13632 --
NM_018364chr142654 1137 720 140 --12858 13484
NM_018368chr61200 ------
NM_018369chr5--128 1186 --
NM_018373chr1496339 6219 5564 5075 4927 4003 2380 1586 339 --24031 1749 --
NM_018374chr765185 4788 4192 3895 1072 773 14774 ----
NM_018383chr231755 1363 172 1351 11656 --
NM_018388chrX51136 1118 1029 312 140 ------
NM_018398chr3150 ------
NM_018403chr363747 3582 3126 794 703 674 12725 ----
NM_018409chr4135 ------
NM_018429chr532859 2212 2065 12144 ----
NM_018439chr1852660 1629 727 498 309 ----12272
NM_018440chr8108540 7379 6528 5697 5645 3096 2864 2424 2242 282 21114 214 17359 --
NM_018445chr15----1141 --
NM_018447chr3127 ------
NM_018469chr1731527 139 94 21349 1032 1448 --
NM_018490chr1121564 1496 ------
NM_018527chr131165 ------
NM_018553chr1741802 1656 1341 633 ------
NM_018566chr164989 4658 4636 3169 1420 1085 11709 ----
NM_018569chr431392 1338 1051 11016 ----
NM_018590chr1021702 1121 ------
NM_018638chr1234555 756 172 --43759 3708 491 247 --
NM_018682chr7----1747 --
NM_018695chr511694 ------
NM_018698chrX3429 152 130 --21485 330 --
NM_018703chr161378 ------
NM_018710chr81189 1544 ----
NM_018712chr1141567 1544 1200 413 ------
NM_018718chr752263 1912 1729 1591 934 11934 ----
NM_018719chr72882 252 --21262 1060 11019
NM_018834chr51345 ------
NM_018844chr72250 119 --11565 11475
NM_018847chr921537 1331 ----1334
NM_018890chr721338 120 11213 ----
NM_018945chr673359 3315 3263 3152 1380 825 636 ------
NM_018951chr71237 ------
NM_018968chr21127 ------
NM_018970chr752553 660 504 312 195 ----1737
NM_018976chr1221978 547 --22426 41 --
NM_018993chr2021162 519 ------
NM_018999chr1064684 4132 3808 3537 1300 909 21552 1095 ----
NM_019000chr511488 1250 11183 --
NM_019001chr374012 3980 3723 1085 594 493 215 ------
NM_019004chr741766 706 682 609 11511 151 --
NM_019006chr151107 ------
NM_019022chr1812777 12231 ----
NM_019027chr432512 1657 1053 ------
NM_019036chr62373 75 11014 11137 --
NM_019044chr2124368 4281 3558 3410 3066 3018 2865 1488 1350 901 605 26 13959 ----
NM_019060chr11300 ------
NM_019072chr573639 3515 1698 1367 1146 750 246 12982 31391 1064 468 --
NM_019084chr1072316 2092 1988 1639 820 523 195 1995 ----
NM_019106chr2242422 2184 2102 707 23423 946 11096 --
NM_019117chrX63463 3443 2233 791 607 280 1637 ----
NM_019556chrX1320 ------
NM_019558chr21119 ------
NM_019590chr101117 ------
NM_019593chr2072602 2315 838 818 477 191 160 ------
NM_019610chr131473 1379 430 ------
NM_019857chrX11611 11765 11669 --
NM_019891chr13911 823 416 --11241 --
NM_019903chr1041908 1556 1384 326 ------
NM_020066chr11305 ------
NM_020122chr285820 4297 4094 1989 1929 1110 1040 1013 ------
NM_020123chr1041381 1369 1352 371 ------
NM_020130chr83928 368 118 ------
NM_020131chr111268 11455 144 1466
NM_020133chr686412 5788 5650 5553 4422 2284 1151 1138 1387 26315 1208 14389
NM_020139chr461998 1484 1276 593 379 135 ------
NM_020141chr141856 1583 852 492 ------
NM_020144chr71804 ----12018
NM_020152chr213680 631 149 ------
NM_020154chr152250 216 ------
NM_020159chr421175 294 --31346 527 312 --
NM_020177chr533357 3274 2396 12508 33321 2777 1054 --
NM_020178chr17140 ------
NM_020193chr111404 ------
NM_020199chr52292 143 ------
NM_020210chr151984 ------
NM_020240chr582433 2324 2099 2080 2008 1780 1041 231 199 --1488
NM_020336chr2053811 2407 1115 1097 586 12957 32880 2494 1361 --
NM_020337chr422043 341 --11239 1693
NM_020338chr1022724 1312 23690 870 ----
NM_020341chr201490 ------
NM_020342chr222133 1610 12091 ----
NM_020346chr1111542 ------
NM_020347chr331829 1714 1662 ------
NM_020348chr1062464 1903 451 353 304 146 ----1237
NM_020362chr12191 36 1851 --1774
NM_020403chr1331767 1500 43 ------
NM_020405chr1753863 1621 1197 574 393 12836 11650 --
NM_020432chr732108 1492 351 --22072 487 --
NM_020443chr1117003 6532 6204 4665 4592 2685 2459 1840 1160 1030 1002 ----16897
NM_020455chr622624 2321 --12214 1105
NM_020473chrX62012 1853 1630 1559 700 118 --2726 716 --
NM_020475chr832474 2249 113 1383 ----
NM_020476chr832474 2249 113 1383 ----
NM_020477chr832474 2249 113 1383 ----
NM_020478chr832537 2312 176 1446 ----
NM_020480chr832474 2249 113 1383 ----
NM_020526chr111392 --153 11258
NM_020546chr532670 615 465 22195 1018 22623 531 --
NM_020640chr31452 ----1590
NM_020644chr112854 698 ------
NM_020647chr82797 571 --1752 --
NM_020651chr2----11606 --
NM_020653chr17--171 ----
NM_020673chr2087790 7738 7271 5242 3007 1745 1160 654 --15414 15888
NM_020686chr1663050 3020 2741 760 402 385 11095 ----
NM_020689chr20--11346 ----
NM_020697chr831375 1043 288 1268 ----
NM_020699chr174623 4174 3781 3620 1837 1175 344 11583 11984 --
NM_020717chrX33544 3105 1011 33327 3089 1844 ----
NM_020718chr1696270 2424 1460 1444 1394 1249 1130 951 634 --12404 --
NM_020732chr61378 ------
NM_020734chr1232816 876 162 --31049 816 233 --
NM_020739chr1532877 1673 1049 --11380 --
NM_020749chr82483 433 --21514 735 11583
NM_020750chr61110 1421 11509 11444
NM_020752chr1012497 12273 11795 --
NM_020754chr31903 1168 ----
NM_020762chr124983 704 373 211 ------
NM_020766chrX64200 3560 1560 572 528 312 1901 ----
NM_020768chr523114 500 --21222 585 --
NM_020769chrX2678 354 ------
NM_020771chr641142 1021 234 71 ------
NM_020772chr1798496 8216 7074 6221 3238 2740 1455 1318 601 15478 ----
NM_020774chr1885271 5206 4720 4641 2133 2115 1871 453 24331 1359 25219 1848 --
NM_020783chr1822386 331 2290 124 ----
NM_020791chr1731072 192 175 ----11058
NM_020794chr131499 210 113 --11447 --
NM_020796chr552901 1151 1094 638 620 12836 ----
NM_020801chr51873 22124 405 ----
NM_020806chr14----1261 --
NM_020809chr1152308 2084 1820 449 180 ------
NM_020810chr1453449 3318 2673 917 707 ------
NM_020813chr1952067 988 675 456 364 --1559 --
NM_020819chr6--1358 ----
NM_020830chr242961 2526 635 578 1413 12243 13233
NM_020841chr1284047 3773 3708 3059 2530 1448 377 217 12992 ----
NM_020850chr1643053 2588 2262 1001 22972 1221 ----
NM_020854chr1811541 ------
NM_020858chr153868 548 426 ----1805
NM_020861chr61862 ----1383
NM_020868chr24710 183 113 91 ------
NM_020872chr331598 519 367 ------
NM_020873chr33864 186 104 ------
NM_020890chr3--1470 ----
NM_020917chr1931450 1161 707 13473 13172 11565
NM_020918chr1042699 1183 771 86 1598 ----
NM_020919chr2----1318 --
NM_020921chr1463257 3133 1322 1222 1202 100 ------
NM_020926chrX126 ------
NM_020927chr1641526 1469 180 169 ------
NM_020935chr224078 169 --21280 973 14221
NM_020940chr1052844 2629 1170 943 311 ------
NM_020948chr133709 1390 804 1186 33287 1065 532 --
NM_020956chr1984073 3578 3449 3325 1496 1226 932 186 111902 1887 1863 1824 1809 1746 1731 1707 1668 1653 1629 ----
NM_020962chr151792 ------
NM_020967chr2011152 --1356 1931
NM_020975chr1041965 1322 690 205 ------
NM_020977chr411730 --11845 --
NM_020981chr21660 ------
NM_020987chr1031028 440 41 --170 --
NM_021007chr232261 1630 97 ------
NM_021033chr1333259 3078 147 12305 13436 --
NM_021038chr362655 747 669 589 336 27 ------
NM_021064chr621565 1102 1592 ----
NM_021069chr421911 36 11673 ----
NM_021072chr522430 1921 --11971 --
NM_021083chrX73612 3544 2797 2552 2478 1213 820 1476 ----
NM_021088chr222182 474 1228 1670 --
NM_021090chr2284756 3887 3600 3432 3124 3047 1779 284 ------
NM_021111chr91110 --11302 --
NM_021116chr768902 8301 6125 5496 2131 118 --17113 --
NM_021117chr1122042 1682 11818 12018 --
NM_021120chrX82635 2500 1158 1015 931 209 127 97 ------
NM_021137chr1732200 1487 523 ----11511
NM_021140chrX------11130
NM_021159chr431600 1454 499 ------
NM_021174chr82557 248 1594 --1527
NM_021190chr1146 ------
NM_021191chr1261651 774 497 426 301 276 11579 ----
NM_021200chr1111109 144 ----
NM_021202chr2043067 2637 2271 1999 22527 985 12497 --
NM_021205chr122887 2607 --11117 --
NM_021238chr1221735 1533 ------
NM_021240chr93676 604 186 ------
NM_021253chr631245 946 212 ------
NM_021255chr1434040 2819 262 ----13153
NM_021260chr141503 ------
NM_021572chr61428 --154 --
NM_021614chr5------1115
NM_021622chr1042364 2222 2131 373 1447 ----
NM_021629chr353870 3346 1953 372 52 --14928 --
NM_021637chrX31269 1074 160 --165 --
NM_021643chr211205 ------
NM_021644chr1021124 895 11104 ----
NM_021648chr662306 1864 622 567 257 178 11027 ----
NM_021722chr7183 ------
NM_021723chr72403 124 ------
NM_021813chr685807 5258 4952 3784 2138 1976 1584 332 ----22128 583
NM_021815chr242498 2064 2052 239 ----1227
NM_021911chr575032 4801 3896 2257 1554 431 335 ----14459
NM_021912chr1563738 3455 3284 1656 1086 492 ------
NM_021914chr1422374 546 12142 11594 --
NM_021931chr2051086 1061 716 445 281 ----1964
NM_021935chr33848 277 70 188 ----
NM_021949chrX52323 2189 1965 826 221 --12269 --
NM_021956chr651395 1254 1241 333 116 ------
NM_021961chr11117374 7362 6423 6330 6053 5170 4681 2808 1679 1460 1281 ------
NM_021962chr1772377 1669 988 613 415 283 160 12148 ----
NM_021963chrX1297 ------
NM_021964chr376354 6282 5672 4552 731 534 451 --14518 15228
NM_021967chr511319 ------
NM_021977chr673885 3757 3449 3181 2575 241 104 ------
NM_021988chr201489 11594 ----
NM_021998chrX31278 931 47 ------
NM_022037chr22941 838 ----1104
NM_022039chr101585 ------
NM_022041chr1632438 786 428 --21875 527 11818
NM_022048chr1555936 5061 3952 2148 1185 24265 1313 --13972
NM_022073chr1431612 1420 398 21143 202 ----
NM_022080chr2042340 1130 547 508 12252 ----
NM_022118chr13------131
NM_022121chr641057 882 235 128 ------
NM_022130chr521299 1017 11187 11060 --
NM_022138chr621545 1441 ------
NM_022144chrX157 ------
NM_022166chr1675262 4105 2320 2056 2027 1897 617 11020 1520 --
NM_022170chr731492 1209 1097 --1146 --
NM_022173chr22941 838 ----1104
NM_022334chr261052 782 726 446 390 334 ------
NM_022351chr863845 3497 2886 2719 760 219 13444 ----
NM_022367chr1--1713 ----
NM_022373chr71778 ------
NM_022442chr201489 11594 ----
NM_022457chr1182 ------
NM_022459chr1364925 3851 2343 1742 1326 1304 25260 4297 1386 --
NM_022461chr32516 225 11333 ----
NM_022465chr1222662 2065 --12084 --
NM_022474chr1472804 2480 2140 2025 1750 885 539 12553 ----
NM_022475chr42556 534 --1164 --
NM_022476chr1631123 281 118 2194 40 ----
NM_022491chr124993 946 831 183 --13448 13133
NM_022648chr254203 3332 2913 1373 29 1952 ----
NM_022650chr51281 --1170 --
NM_022658chr121444 1140 ----
NM_022726chr611485 ------
NM_022728chr71630 ------
NM_022735chr121559 1547 ----11814
NM_022745chr162966 2811 2788 2229 1118 918 ----1979
NM_022753chr162834 2806 2730 2020 965 509 ------
NM_022756chr121071 202 11473 ----
NM_022763chr353148 2917 2729 946 33 1453 1139 --
NM_022776chr311084 ------
NM_022782chr121123 ------
NM_022821chr11369 ------
NM_022824chr541953 1619 1560 1213 ------
NM_022826chr241056 747 413 371 ------
NM_022838chrX1328 ------
NM_022845chr161326 --1625 --
NM_022893chr222527 2206 12521 ----
NM_022898chr1464752 4067 3394 1783 1497 911 --13077 13131
NM_022901chr941930 1822 1788 658 ------
NM_022905chr1541655 1256 483 206 ------
NM_022912chr232619 2235 1120 1559 12593 --
NM_022918chr1121743 875 ------
NM_022978chr511319 ------
NM_023010chrX1828 1235 ----
NM_023011chr131834 ------
NM_023012chr12153 ------
NM_023016chr232375 2348 1121 ----12637
NM_023033chr121532 ------
NM_023037chr132943 856 ------
NM_023105chr841660 1633 494 230 12372 ----
NM_023106chr841660 1633 494 230 12372 ----
NM_023110chr841660 1633 494 230 12372 ----
NM_023111chr841660 1633 494 230 12372 ----
NM_023923chr143449 3080 1479 203 13382 ----
NM_024007chr532686 2160 601 --1498 --
NM_024017chr172521 199 ------
NM_024046chr32442 257 11159 ----
NM_024076chr1952419 2006 928 854 371 ------
NM_024345chr975757 5739 5431 4686 4115 3900 243 35288 4478 907 --16049
NM_024415chr51169 ------
NM_024421chr18--1437 --1983
NM_024423chr184537 336 219 55 1246 14192 --
NM_024494chr11187 ------
NM_024496chr14------1754
NM_024513chr343803 2812 2779 520 12824 1822 --
NM_024524chr342198 1078 854 534 182 ----
NM_024529chr12879 469 ------
NM_024539chrX2402 137 ------
NM_024551chr1222470 1832 --181 --
NM_024551chr1222470 1832 --181 --
NM_024561chr1331404 1389 876 ------
NM_024563chr551901 1266 747 628 124 --1223 --
NM_024567chr81592 --1114 --
NM_024574chr41328 --2421 378 --
NM_024581chr6188 ------
NM_024582chr411134 ------
NM_024611chr1543766 2557 1560 361 ------
NM_024617chr92793 574 ----1127
NM_024657chrX1613 ------
NM_024665chr353763 3319 2869 1582 706 ------
NM_024666chr1511409 --137 1592
NM_024674chr142910 2405 1220 659 12898 --1357
NM_024692chr241861 1716 1214 270 11480 ----
NM_024699chr83919 776 128 --1285 --
NM_024713chr1511160 --11115 --
NM_024721chr83855 731 219 --1330 --
NM_024744chr21151 22286 478 --1951
NM_024751chr441993 1528 1437 565 ------
NM_024755chr15--1107 ----
NM_024757chr91711 ------
NM_024759chr83599 179 150 ------
NM_024761chr955354 4685 432 394 189 13655 13981 --
NM_024887chr11438 ----21520 1313
NM_024900chr411785 1744 11541 --
NM_024900chr411785 1744 11541 --
NM_024911chr11150 ----173
NM_024915chr892823 2816 2683 2323 2316 2300 2194 826 311 ------
NM_024920chr41996 ----11391
NM_024930chr512351 12374 12117 --
NM_024941chr521203 541 ------
NM_024949chr454700 4684 3888 1284 270 34927 4624 4341 ----
NM_024989chr245555 5249 5236 2574 ----13206
NM_024993chr211436 --11361 1562
NM_025040chr1942117 1888 603 565 21652 1564 ----
NM_025054chr894110 4075 3812 3708 3018 2811 1054 895 389 ----11346
NM_025073chr1113247 3200 2886 1879 1438 1401 1320 1210 640 585 492 13176 ----
NM_025074chr433104 2139 1941 12203 12504 --
NM_025076chr22689 440 ------
NM_025133chr2190 ------
NM_025134chr164981 891 677 430 ------
NM_025138chr131953 11272 ----
NM_025147chr23995 242 22 1256 ----
NM_025160chr133186 1646 582 14066 13430 --
NM_025164chr1152048 1376 736 519 80 ----12167
NM_025180chr322720 910 23415 232 22882 823 --
NM_025222chr382900 2554 2490 2242 1963 1864 1023 512 ------
NM_025235chr1021754 221 11568 ----
NM_025238chr151544 ----11472
NM_025250chr7102459 2000 1141 741 577 464 228 103 52 33 1585 ----
NM_025263chr62571 454 ------
NM_030621chr1474143 3599 2613 1181 938 632 436 --1339 --
NM_030627chr544061 3474 1577 1344 --23859 972 --
NM_030640chr12------1225
NM_030647chr795808 5675 4150 4143 1956 1911 1757 258 158 --25065 1402 --
NM_030648chr4115048 4847 4624 1823 1582 1434 1353 1213 1094 904 298 ------
NM_030650chr233308 3296 2598 --23527 52 13568
NM_030664chr1011729 ------
NM_030670chr1212125 ------
NM_030671chr1212125 ------
NM_030752chr61482 ------
NM_030755chr1442655 2587 591 236 12633 ----
NM_030762chr1221938 1491 ------
NM_030763chrX2752 269 ------
NM_030791chr1431852 1762 526 --1705 --
NM_030799chr521513 240 ------
NM_030806chr1148676 8372 6600 6283 3402 3301 2628 2136 2041 1544 1400 1042 523 228 27614 6782 28399 2415 --
NM_030816chr152638 1029 948 187 21 ----23125 2964
NM_030820chr61403 ------
NM_030881chr222672 180 --12161 --
NM_030884chr352276 1894 1865 890 87 --1131 --
NM_030918chr175422 5055 3625 3318 1756 334 167 ------
NM_030920chr131513 722 701 ----11804
NM_030926chr211001 ------
NM_030934chr121433 1292 1655 ----
NM_030938chr171353 ------
NM_030939chr6--1477 ----
NM_030954chr8----1354 --
NM_030964chr533143 949 111 ------
NM_030979chr13----1187 --
NM_030981chr112799 179 1765 11152 --
NM_031262chr9----11173 --
NM_031263chr9----11230 --
NM_031267chr71471 ------
NM_031268chr1683573 3562 1569 1198 1166 708 92 34 1795 13659 --
NM_031291chr42635 115 ------
NM_031305chr441872 1284 526 190 1723 ----
NM_031314chr1431819 1443 519 11805 ----
NM_031365chr242455 2374 1063 38 ------
NM_031366chr242455 2374 1063 38 ------
NM_031369chr41551 ------
NM_031370chr41551 ------
NM_031371chr121612 1349 11359 ----
NM_031371chr121612 1349 11359 ----
NM_031372chr411580 ------
NM_031412chr1251238 1206 1197 1020 969 --1212 --
NM_031418chr113748 555 119 1482 168 --
NM_031427chr1442361 859 187 40 ------
NM_031435chr1253106 2586 1290 373 74 ------
NM_031442chrX13000 12045 ----
NM_031445chr252516 2457 2120 1254 792 --1121 --
NM_031461chr841749 441 320 121 ------
NM_031468chr777488 6296 5462 2960 2824 841 52 12590 45991 2878 2865 1359 11020
NM_031473chr122428 264 ------
NM_031483chr2033488 2635 2507 ----12890
NM_031845chr233451 3026 2365 11019 32708 699 564 11044
NM_031847chr233451 3026 2365 11019 32708 699 564 11044
NM_031858chr1721369 1196 ------
NM_031862chr1721369 1196 ------
NM_031916chr5127 ------
NM_031922chr62549 355 ------
NM_031938chr112817 638 ------
NM_031940chr852125 2060 1611 1536 783 12166 ----
NM_031989chr12----1320 --
NM_031992chr731492 1209 1097 --1146 --
NM_032012chr955022 4870 4254 4044 2090 13902 13679 --
NM_032015chr111231 ------
NM_032017chr141483 745 703 68 11909 12104 --
NM_032025chr351800 1568 489 204 103 ------
NM_032028chr5--1646 ----
NM_032042chr542039 702 568 237 ------
NM_032132chr11211 ------
NM_032145chr631837 773 658 ------
NM_032146chr31162 ------
NM_032149chr41152 ------
NM_032174chr121449 1431 ------
NM_032181chr22641 624 ------
NM_032182chr1021628 1570 1472 --11377
NM_032186chr121425 1109 ------
NM_032208chr223606 3282 1186 1134 13209
NM_032217chr4----1440 --
NM_032221chr2021988 429 ------
NM_032226chr91240 ----2852 617
NM_032228chr1133504 3311 2404 --1198 --
NM_032231chr15------170
NM_032236chr12900 162 ------
NM_032239chr421173 515 ------
NM_032246chr152992 211 ------
NM_032256chr123971 921 121 ------
NM_032315chr11257 ------
NM_032320chr11131 ----1639
NM_032321chr253058 304 261 125 39 12015 ----
NM_032338chr123272 232 25 ------
NM_032364chr12----131 --
NM_032373chr1074331 3766 2234 1091 913 188 147 14638 ----
NM_032410chr841078 383 216 111 ------
NM_032433chr1911550 11417 11354 --
NM_032434chr221542 1279 11443 ----
NM_032439chr1071580 1374 1337 639 456 282 109 ------
NM_032440chr1012172 ------
NM_032446chr553370 2850 2717 698 547 --13666 --
NM_032458chrX93094 2248 2191 2104 865 840 733 236 34 ------
NM_032491chr12--11059 ----
NM_032505chr322790 724 --12420 --
NM_032507chr61222 1236 ----
NM_032520chr161191 ------
NM_032521chr2043079 2960 2425 36 --23130 748 --
NM_032539chrX1658 ------
NM_032547chr4------1123
NM_032550chr10132 ------
NM_032557chr41670 ----2377 65
NM_032558chr911453 ------
NM_032562chr103396 61 47 ------
NM_032582chr171425 21390 22 ----
NM_032594chr142837 231 ------
NM_032603chr21176 --193 --
NM_032622chr4177 --1117 --
NM_032632chr14161 ----11352
NM_032638chr341536 434 149 97 ------
NM_032682chr362225 1422 1073 962 746 158 1908 ----
NM_032727chr1031408 1139 353 31332 1275 416 ----
NM_032782chr52847 181 ------
NM_032784chr6----199 --
NM_032828chr1994959 4747 4424 3321 3130 1918 1782 1606 1029 ------
NM_032837chr1752077 1975 1861 575 247 ------
NM_032859chr1353883 3728 3204 2959 1361 --31590 1422 250 --
NM_032867chr11------1440
NM_032876chr141653 1699 12063 --
NM_032885chr192108 53 ------
NM_032900chr1043549 1576 864 356 33071 2616 1211 ----
NM_032932chr1796078 6058 5985 5155 4949 4907 4670 4277 702 12137 ----
NM_032949chr131221 ------
NM_032961chr421385 290 ------
NM_032968chrX43770 3384 3112 3055 ------
NM_032969chrX43770 3384 3112 3055 ------
NM_032973chrY43762 3379 3107 3050 ------
NM_032978chr181354 ----11153
NM_032979chr181354 ----11153
NM_032981chr181354 ----11153
NM_032982chr752600 2575 2112 637 234 --12444 --
NM_032983chr753414 3389 2926 1048 819 --23258 501 --
NM_033020chr144256 3929 3074 528 --2892 503 13713
NM_033030chr221620 1374 ------
NM_033055chr1----1802 --
NM_033133chr1723694 3581 13220 --12501
NM_033138chr71773 1750 ----
NM_033139chr71773 1750 ----
NM_033140chr71773 1750 ----
NM_033157chr71773 1750 ----
NM_033181chr643085 1395 1129 311 --11446 --
NM_033211chr5--11719 ----
NM_033224chr777289 6741 5778 2859 2647 1570 1430 --1723 --
NM_033225chr873178 2430 2326 2031 1163 167 71 ------
NM_033226chr161170 ------
NM_033227chr52503 383 ------
NM_033228chr52543 423 ------
NM_033251chr161116 ----1370
NM_033274chr522966 714 11415 ----
NM_033290chrX53686 2557 2509 1320 537 11137 11300 --
NM_033305chr941396 1353 1234 121 1513 ----
NM_033326chr1172486 1853 1789 962 783 563 394 --11929 --
NM_033331chr953257 3162 1255 1106 789 12405 ----
NM_033360chr1264334 2877 1851 1391 899 306 1981 --13044
NM_033394chr241446 1275 195 128 ------
NM_033425chr1143479 2903 612 110 12291 ----
NM_033426chr1421079 141 12350 12034 12939
NM_033429chr1551113 1079 1048 674 499 21064 561 ----
NM_033495chrX2707 428 ------
NM_033505chr2126586 6536 6269 5503 5250 4952 4451 2708 2478 2351 2117 472 16508 14227 --
NM_033512chr8102833 2541 2257 1924 1036 770 728 647 530 420 1892 ----
NM_033542chr2051369 1355 668 532 273 ------
NM_033551chr523302 2700 ----12568
NM_033624chr1222258 233 ------
NM_033632chr42576 364 ------
NM_033642chrX2210 98 ------
NM_033656chr21105904 5799 4789 4359 4014 1891 1249 1034 769 201 --14394 --
NM_044472chr11546 ------
NM_052864chr421389 443 --11536 --
NM_052867chr1331090 492 273 ------
NM_052879chr122466 300 --13589 --
NM_052885chr1284946 4187 4108 4041 3623 3132 1499 1126 24953 845 14353 --
NM_052898chr821435 1240 ----11607
NM_052903chr151502 ------
NM_052904chr641114 503 233 189 ------
NM_052905chr221626 1443 ------
NM_052913chr63991 845 772 ------
NM_052932chr1141581 761 458 341 ------
NM_052934chr151701 1618 917 636 449 1440 ----
NM_052937chr81137 11789 ----
NM_052940chr11151 ------
NM_052954chr2161818 1585 1415 142 124 28 --1802 --
NM_053002chr361039 1033 856 830 267 129 ----1442
NM_053024chr351531 1286 566 436 387 ------
NM_053025chr341724 1477 1463 556 ------
NM_053026chr341724 1477 1463 556 ------
NM_053027chr341724 1477 1463 556 ------
NM_053028chr341724 1477 1463 556 ------
NM_053031chr341724 1477 1463 556 ------
NM_053032chr341724 1477 1463 556 ------
NM_053035chr7189 ------
NM_053043chr796237 5473 3958 3879 1708 1635 1293 581 67 --15884 --
NM_053056chr1152667 2528 2072 1229 1192 ------
NM_053279chr822088 2033 160 1187 1426
NM_057089chr7188 --1138 --
NM_057158chr83665 634 262 ------
NM_057749chr811162 ------
NM_058170chr111597 --11033 --
NM_058172chr421798 1289 ----1516
NM_058237chr144905 872 814 789 ------
NM_058241chr222291 1638 1580 ----
NM_058241chr222291 1638 1580 ----
NM_078469chr10--1535 1874 11389
NM_078471chr171138 ----1243
NM_078473chr852125 2060 1611 1536 783 12166 ----
NM_078487chr943088 2818 2515 982 --11183 --
NM_080546chr942299 1511 604 536 ------
NM_080591chr943081 2829 911 458 3852 343 245 --1281
NM_080597chr1831106 1041 818 ------
NM_080599chr101812 ------
NM_080632chrX1828 1235 ----
NM_080645chr641617 728 335 202 ----1497
NM_080676chr2053237 2522 1283 1053 816 12043 21198 1156 --
NM_080759chr1321789 1024 ------
NM_080760chr1321789 1024 ------
NM_080867chr1453709 3597 3109 426 71 24880 3917 21784 1435 --
NM_080872chr854074 3033 2965 2577 901 1408 12634 1440
NM_080921chr11813 1173 ----
NM_080927chr332962 1291 1210 13279 ----
NM_130385chr1153181 3027 2331 909 766 ------
NM_130435chr1012503 11985 12865 --
NM_130436chr211603 ------
NM_130438chr2111180 ------
NM_130439chr1042165 1905 652 314 ------
NM_130439chr1042165 1905 652 314 ------
NM_130469chr141803 ------
NM_130798chr1531520 1217 243 ------
NM_130809chr563142 2713 969 423 319 160 ------
NM_130811chr2041162 854 399 144 ------
NM_130838chr1521624 714 ------
NM_130839chr1521624 714 ------
NM_130846chr123854 428 335 ------
NM_130901chr151115 ------
NM_133170chr2055578 5479 2871 1053 942 46929 6849 4990 26 47948 6687 1625 1325 --
NM_133264chr173974 776 251 --11254 --
NM_133265chrX33382 2355 1184 --22553 1306 --
NM_133328chr191659 ------
NM_133330chr453199 2899 1162 673 278 ------
NM_133331chr453199 2899 1162 673 278 ------
NM_133334chr455971 4667 4314 2034 453 12191 25362 1806 --
NM_133335chr453199 2899 1162 673 278 ------
NM_133372chr522965 2243 ----1162
NM_133378chr23914 741 193 ----1732
NM_133432chr23914 741 193 ----1732
NM_133437chr23914 741 193 ----1732
NM_133478chr252448 2347 2160 608 112 11924 ----
NM_133486chrX2341 169 ------
NM_133496chr173414 3370 1425 1048 823 628 509 ------
NM_133503chr124688 492 289 51 ------
NM_133504chr124688 492 289 51 ------
NM_133505chr124688 492 289 51 ------
NM_133506chr124688 492 289 51 ------
NM_133507chr123866 670 229 ------
NM_133509chr14--11141 ----
NM_133634chr2151365 664 623 535 439 11577 ----
NM_133646chr255396 3720 2208 1932 1621 --33941 3855 3745 15216
NM_133647chr1573509 3408 2654 1233 1085 633 65 ----1315
NM_134428chr91261 ------
NM_138270chrX52615 2469 839 185 116 ------
NM_138286chr1973629 3333 2732 1636 1529 1256 811 1395 ----
NM_138292chr11103338 3116 2912 2579 2514 1242 1095 911 879 481 1776 ----
NM_138316chr10--1983 ----
NM_138423chr15--11415 ----
NM_138426chr7--12366 ----
NM_138444chr1354844 3819 3160 1447 1143 14613 1960 --
NM_138459chr642826 2550 926 302 ------
NM_138473chr1265019 3505 1995 1760 1327 229 ------
NM_138569chr6--170 ----
NM_138576chr1464752 4067 3394 1783 1497 911 --13077 13131
NM_138638chr1422374 546 12142 11594 --
NM_138694chr643570 2461 906 702 1503 22905 226 --
NM_138713chr1676119 5738 5443 5024 3093 2942 2929 15189 12250 --
NM_138714chr1676119 5738 5443 5024 3093 2942 2929 15189 12250 --
NM_138717chr61543 --172 --
NM_138730chr61111 ------
NM_138731chr1453725 2920 1391 705 555 ------
NM_138771chr731491 1484 1350 ------
NM_138799chr242067 1602 580 180 --11360 --
NM_138927chr214998 123 54 34 ------
NM_138931chr31283 --1256 --
NM_138959chr186649 6225 4851 4280 1979 1048 859 709 11940 36676 6145 4618 169
NM_138966chr181477 ------
NM_138971chr1123010 2805 13618 ----
NM_138971chr1123010 2805 13618 ----
NM_138972chr1123010 2805 13618 ----
NM_138972chr1123010 2805 13618 ----
NM_138973chr1123010 2805 13618 ----
NM_138973chr1123010 2805 13618 ----
NM_138980chr43600 498 491 ------
NM_138981chr43731 629 622 ------
NM_138982chr43600 498 491 ------
NM_139012chr622258 886 ----12272
NM_139035chrX4736 217 209 130 ------
NM_139046chr10159 ------
NM_139048chr311120 ------
NM_139057chr1521083 654 12074 1637 1398
NM_139068chr53658 520 157 ------
NM_139069chr53658 520 157 ------
NM_139070chr53527 389 26 ------
NM_139131chr111645 ------
NM_139168chr51644 --1375 --
NM_139207chr1232162 1580 186 ------
NM_139283chr1282439 1884 1621 1579 950 365 283 197 ----11776
NM_139316chr7------1113
NM_139321chr2053224 2580 1270 1119 606 12716 23504 1245 --
NM_139323chr2021263 201 ------
NM_144498chr2032213 1530 787 1543 ----
NM_144570chr1663008 2647 2540 2444 2347 2293 --1724 --
NM_144571chr4146535 6516 6107 5505 5172 5131 4599 2777 1874 1767 1677 1161 890 861 ----16890
NM_144578chr14104217 3893 3841 2185 1598 1587 1578 1231 1131 531 1545 11901 --
NM_144590chr1052799 2325 691 513 99 22953 2435 ----
NM_144599chr1565403 5321 5125 2001 808 482 15165 25103 1608 --
NM_144607chr17--22566 2000 ----
NM_144625chr12396 119 1361 ----
NM_144632chr242166 1889 1823 1777 1418 ----
NM_144633chr341229 966 939 477 ------
NM_144654chr91294 ------
NM_144664chr1161931 1005 941 820 377 239 ------
NM_144665chr11123 ------
NM_144690chr192507 370 --162 --
NM_144724chr52752 97 ------
NM_144726chr52961 203 ------
NM_144778chr1362245 856 650 474 112 25 1819 ----
NM_144949chr2--1132 ----
NM_144963chr822427 70 --1541 --
NM_144967chrX3760 162 62 127 ----
NM_144973chr1233780 345 230 ------
NM_144982chr121541 1229 1647 --
NM_145021chr103842 729 303 ------
NM_145037chr31268 ------
NM_145049chr52345 178 ----166
NM_145055chr1832794 1085 325 --22377 1158 --
NM_145175chr231438 1394 1102 ------
NM_145176chr622316 1380 136 ----
NM_145206chr1043263 2697 2580 266 13106 ----
NM_145263chr42664 106 ------
NM_145284chrX72262 1917 1853 957 903 556 125 ------
NM_145287chr181174 ------
NM_145307chr1073271 2940 1447 1231 1187 955 933 ----14673
NM_145649chr621762 705 --12205 1683
NM_145655chr621762 705 --12205 1683
NM_145690chr821845 1463 ------
NM_145728chr1542496 908 346 47 11817 12017 --
NM_145735chr1332861 2309 2211 1381 ----
NM_145800chrX21058 1030 ------
NM_145802chrX21007 979 ------
NM_145808chr753102 3043 1952 1115 87 ------
NM_145891chr1621704 568 11274 --1268
NM_145892chr1621704 568 11274 --1268
NM_145893chr1631826 690 27 11396 --1390
NM_145912chr2284553 4025 3853 1851 1768 1579 301 232 --14544 --
NM_147147chr664152 3663 3345 3108 1224 1040 21343 1328 13425 --
NM_147150chr933418 3099 640 ------
NM_147164chr91530 ------
NM_147175chrX1585 ------
NM_148170chr1175085 4566 4480 3485 1966 1743 409 25426 4226 14516 2890 646
NM_148571chr1752110 1542 740 662 437 ----1140
NM_148894chr41404 ------
NM_148955chr1575761 5160 5019 3999 1089 1031 352 26165 2435 12380 --
NM_148976chr111111 ------
NM_148977chr10--1983 ----
NM_148978chr10--1983 ----
NM_152230chr10178 ------
NM_152261chr1241946 1831 744 351 --142 12506
NM_152282chr32949 35 ----1261
NM_152298chr11746 ------
NM_152300chr1731842 1437 422 ------
NM_152330chr1452474 2297 1013 650 86 145 1858 --
NM_152352chr1852482 2384 1923 1235 824 ------
NM_152360chr19----1147 --
NM_152371chr131834 1402 108 --11777 1567
NM_152388chr223837 1256 1851 ----
NM_152400chr461902 1768 1717 772 273 148 ------
NM_152402chr41223 1510 ----
NM_152410chr6------1372
NM_152414chr821527 1175 ----11661
NM_152417chr81254 11247 1826 --
NM_152422chr941484 1477 699 222 1679 ----
NM_152424chrX64726 3315 3294 3233 1495 795 23361 2971 13076 --
NM_152437chr1242099 1712 158 44 11497 ----
NM_152446chr142911 390 ------
NM_152450chr1551869 1837 353 118 39 ------
NM_152451chr151828 1313 ----
NM_152455chr1542698 1095 1038 126 ------
NM_152470chr1823780 3663 ----13708
NM_152512chr222194 122 --1511 --
NM_152523chr21540 ------
NM_152538chr331804 1197 246 1358 ----
NM_152556chr731660 1580 209 ----12273
NM_152581chrX31106 969 577 1169 ----
NM_152588chr122730 216 1557 --1611
NM_152622chr522218 746 --22860 120 --
NM_152624chr545212 4599 2658 443 --17235 12469
NM_152629chr953742 3274 1487 993 542 1960 32911 597 96 --
NM_152630chrX21370 1021 21213 1132 ----
NM_152636chr1122623 1148 --12463 --
NM_152641chr1232910 951 650 12603 ----
NM_152653chr31507 ------
NM_152678chr342375 2316 2155 503 --1121 --
NM_152682chr421582 1487 --11572 --
NM_152695chrX41791 1441 517 492 21809 774 ----
NM_152704chr133814 196 35 ------
NM_152707chr101187 --2791 682 --
NM_152713chr111209 ------
NM_152716chr11------1162
NM_152724chr1062111 897 784 440 352 168 ------
NM_152733chr6105858 5683 4261 4135 2383 2333 1779 898 689 568 --26297 1689 --
NM_152734chr695277 5200 4905 4783 4728 4619 1275 995 240 14199 24448 608 21363 394
NM_152737chr612058 1281 ----
NM_152745chr71438 ------
NM_152754chr733383 2655 1019 13702 ----
NM_152756chr524307 3826 13946 ----
NM_152787chrX72661 2426 1030 885 864 741 370 ------
NM_152826chr1575761 5160 5019 3999 1089 1031 352 26165 2435 12380 --
NM_152835chr11473 22670 2363 ----
NM_152838chr2053479 3310 2822 693 371 --1343 --
NM_152924chr1575977 5780 5131 4507 2724 1657 382 ------
NM_152945chr21190 ------
NM_152989chr1251711 1701 1512 720 374 11609 1251 --
NM_152991chr113601 88 55 --1502 --
NM_152994chr22620 231 ------
NM_152996chr141854 1412 156 72 --11473 --
NM_152999chr793697 3137 3054 1860 1182 931 846 173 46 ------
NM_153020chr631360 1098 120 ------
NM_153035chr11305 1108 1334 --
NM_153050chr2284756 3887 3600 3432 3124 3047 1779 284 ------
NM_153051chr2284756 3887 3600 3432 3124 3047 1779 284 ------
NM_153181chr181477 ------
NM_153184chr311579 --11921 --
NM_153188chr521213 675 ----14076
NM_153234chr532280 2135 1770 ------
NM_153235chr662376 1789 1724 937 623 95 ------
NM_153261chr162650 354 11181 ----
NM_153262chr123060 1186 ------
NM_153273chr362805 2412 2336 2159 1104 480 ----12141
NM_153321chr1711045 ------
NM_153322chr1711045 ------
NM_153332chr821160 328 ------
NM_153341chr11307 ------
NM_153365chr472263 1753 717 608 312 75 60 12634 ----
NM_153377chr12------1294
NM_153453chr6--1392 ----
NM_153456chr1386357 5725 5360 4715 4404 4188 4029 399 25907 609 ----
NM_153499chr1262822 2581 2446 2375 2113 393 --12165 --
NM_153500chr1262822 2581 2446 2375 2113 393 --12165 --
NM_153607chr53946 776 313 1500 22902 84 --
NM_153616chr153868 548 426 ----1805
NM_153617chr153868 548 426 ----1805
NM_153618chr153868 548 426 ----1805
NM_153633chr121146 ------
NM_153634chr1221601 24 ------
NM_153645chr2252911 2764 2592 1135 741 13264 ----
NM_153686chr411604 --140 1888
NM_153689chr22817 101 ------
NM_153715chr71237 ------
NM_153810chr1054437 3404 836 717 542 44129 1556 559 196 1414 14926
NM_170587chr81269 ------
NM_170665chr1294500 4493 4266 4176 3641 2851 1671 1396 327 ------
NM_170674chr1511266 --2250 55 --
NM_170675chr151942 ------
NM_170676chr151942 ------
NM_170677chr1511266 --2250 55 --
NM_170706chr163363 3088 2979 2752 1549 47 14336 ----
NM_170710chr453164 3125 2747 2431 2418 2371 91 ----
NM_170719chr131953 11272 ----
NM_170731chr1122334 493 ------
NM_170732chr1122334 493 ------
NM_170733chr1122334 493 ------
NM_170734chr1122334 493 ------
NM_170735chr1122334 493 ------
NM_170750chrX1836 ------
NM_170775chr5------1115
NM_170782chr11395 ------
NM_171825chr552696 2098 1158 232 108 33006 2612 2527 11106 --
NM_171998chrX22072 730 --1238 --
NM_171999chr181684 ------
NM_172016chr631245 946 212 ------
NM_172020chr741834 1449 665 63 ------
NM_172058chr821270 130 21655 1453 ----
NM_172059chr821270 130 21655 1453 ----
NM_172060chr821270 130 21655 1453 ----
NM_172070chr221791 1717 ------
NM_172071chr167476 7302 5815 4686 1229 931 --1481 12419
NM_172127chr441662 350 59 43 ------
NM_172128chr421618 306 ------
NM_172164chr11746 ------
NM_172193chr1431343 378 141 ------
NM_172216chr1262724 2483 2348 2277 2015 295 --12067 --
NM_172217chr1552522 2382 1060 985 265 23542 3354 ----
NM_172226chr1262822 2581 2446 2375 2113 393 --12165 --
NM_172240chr1231133 433 321 ------
NM_172315chr1511266 --2250 55 --
NM_172316chr1511266 --2250 55 --
NM_172373chr1321280 1192 ------
NM_172375chr143841 461 311 --1871 --
NM_173039chr11--1236 ----
NM_173054chr71941 ------
NM_173075chr421773 1435 ------
NM_173079chr1741855 1454 217 55 ------
NM_173156chr111422 1650 ----
NM_173171chr211098 ------
NM_173173chr211098 ------
NM_173198chr921844 302 ------
NM_173200chr921844 302 ------
NM_173214chr1676119 5738 5443 5024 3093 2942 2929 15189 12250 --
NM_173216chr352717 2694 1770 350 124 ------
NM_173217chr352717 2694 1770 350 124 ------
NM_173355chr22379 110 ------
NM_173454chr1531155 323 173 ----11081
NM_173468chr465696 3932 3855 1669 1314 173 25876 2141 --15951
NM_173470chrX32499 2359 521 2653 639 ----
NM_173471chr321032 140 --1852 2729 188
NM_173495chrX12324 ------
NM_173511chr283286 2744 2448 2418 1335 1096 893 707 ------
NM_173514chr51583 ------
NM_173517chr72320 178 ------
NM_173519chr842048 1754 632 619 --1791 --
NM_173552chr352103 899 767 714 397 --11716 --
NM_173554chr10127 ------
NM_173564chr75736 562 184 162 110 1666 1839 --
NM_173576chr1052310 2062 1777 1761 318 ------
NM_173582chr1145460 4968 2414 1982 --26097 1304 --
NM_173591chr121896 ------
NM_173602chr1233078 3067 308 ------
NM_173609chr154573 552 538 136 ------
NM_173614chr161313 ------
NM_173632chr1943370 3169 2197 977 22637 1054 --1570
NM_173642chr1129165 7110 6360 6035 5758 5680 3267 2922 1942 1894 1878 1343 13353 ----
NM_173666chr531162 1026 23 ------
NM_173694chrX22536 1579 ------
NM_173797chr531344 1265 328 ------
NM_173808chr123865 318 11013 ----
NM_173809chr101410 21442 1086 ----
NM_173822chr212083 --11336 --
NM_173829chr595134 4986 4782 4739 4711 1945 1767 1332 795 15495 25513 5458 --
NM_173848chr84813 767 194 22 ------
NM_173851chr863795 3463 2514 1017 462 108 31519 1220 883 ----
NM_174911chr863980 3433 3149 3080 1340 960 ------
NM_174938chr9----141 --
NM_175056chr331923 213 139 --188 --
NM_175610chr151181 ------
NM_175630chr22775 168 1280 ----
NM_175634chr81397 ------
NM_175635chr81397 ------
NM_175636chr81397 ------
NM_175736chr1286018 5259 1917 1483 657 490 437 152 27460 2893 22619 529 11272
NM_175768chr681599 1458 1445 537 320 184 92 58 ------
NM_175854chr1362726 2683 2286 2266 754 544 --12179 --
NM_175859chrX11611 11765 11669 --
NM_175861chr1245784 4788 4356 370 ------
NM_175863chr61378 ------
NM_175873chr541368 1324 930 401 ------
NM_175876chr131988 1077 236 11768 1215 --
NM_175907chr1842788 2600 2395 886 ----1308
NM_176787chr1841084 1066 548 423 ------
NM_176792chr1031327 1314 1287 1297 ----
NM_176863chr1731974 1623 394 --11783 --
NM_177398chr141603 1582 1266 592 ------
NM_177399chr141603 1582 1266 592 ------
NM_177414chr111655 1212 --1380
NM_177424chr11643 2420 65 ----
NM_177438chr1474143 3599 2613 1181 938 632 436 --1339 --
NM_177538chr2148893 8815 8677 8504 7988 7623 6929 6245 5937 5586 2560 2297 2088 262 13141 ----
NM_177559chr2011029 ----1944
NM_177560chr2011029 ----1944
NM_177947chrX31123 527 94 1476 ----
NM_177948chrX31123 527 94 1476 ----
NM_177966chr311948 ------
NM_177969chr22687 219 ----1238
NM_177974chr15--11415 ----
NM_177976chr31162 ------
NM_177977chr1752016 1810 1634 1474 135 1524 ----
NM_177990chr201490 ------
NM_177995chr941484 1477 699 222 1679 ----
NM_178010chr1251711 1701 1512 720 374 11609 1251 --
NM_178151chrX87879 6877 6715 6563 6497 6469 1490 265 ------
NM_178152chrX87879 6877 6715 6563 6497 6469 1490 265 ------
NM_178153chrX87879 6877 6715 6563 6497 6469 1490 265 ------
NM_178171chr171700 ------
NM_178313chr231464 1371 749 ------
NM_178441chr141503 ------
NM_178454chr1------1617
NM_178496chr3168 ------
NM_178505chr1033263 2678 906 1379 23230 723 --
NM_178539chr122427 194 ------
NM_178565chr821183 635 ----1276
NM_178566chr921510 1433 --11780 --
NM_178585chr452979 2891 2711 1139 632 ----11105
NM_178812chr8--11439 --11583
NM_180989chr13--12127 ----
NM_181054chr143949 904 479 ------
NM_181077chr1552310 2170 1850 705 517 ------
NM_181265chr453164 3125 2747 2431 2418 2371 91 ----
NM_181351chr1132646 2240 615 ----11889
NM_181354chr841498 1460 1321 96 ------
NM_181358chr11587 --23940 1116 --
NM_181361chr3--1355 ----
NM_181443chr2052172 2156 1166 741 96 11137 ----
NM_181453chr221641 696 1241 11527 --
NM_181458chr211199 ------
NM_181481chr18106670 5783 5492 4574 4424 2319 2098 1348 1303 510 26453 5540 24831 4369 26193 4817
NM_181482chr18106670 5783 5492 4574 4424 2319 2098 1348 1303 510 26453 5540 24831 4369 26193 4817
NM_181483chr18106670 5783 5492 4574 4424 2319 2098 1348 1303 510 26453 5540 24831 4369 26193 4817
NM_181489chr3146455 5666 5604 5338 5316 4973 4249 4169 2568 2559 1456 1287 533 173 46373 5053 723 50 26292 2297 --
NM_181492chr2211085 21068 930 1100 --
NM_181504chr554048 3598 2729 1508 1418 1616 2969 573 --
NM_181521chr1652374 2101 1781 1701 1277 177 1482 --
NM_181523chr554048 3598 2729 1508 1418 1616 2969 573 --
NM_181524chr554048 3598 2729 1508 1418 1616 2969 573 --
NM_181575chr21123 ------
NM_181659chr2063429 3053 2855 699 332 145 ------
NM_181659chr2063429 3053 2855 699 332 145 ------
NM_181670chr122536 410 ----1595
NM_181702chr82875 789 ------
NM_181704chr2111059 1329 1365 --
NM_181714chr631964 789 88 ------
NM_181782chr642116 1933 1675 1546 11884 ----
NM_181789chr1522439 2052 ----12701
NM_181807chr11----1141 131
NM_181828chr2273727 3445 2553 1055 731 565 455 13456 11256 --
NM_181829chr2273727 3445 2553 1055 731 565 455 13456 11256 --
NM_181830chr2273727 3445 2553 1055 731 565 455 13456 11256 --
NM_181836chr542110 1803 928 598 ----1558
NM_181839chr821400 1369 ----1341
NM_181846chr1932930 2211 1963 12348 12974 --
NM_181886chr421434 564 ------
NM_181887chr421434 564 ------
NM_181888chr421434 564 ------
NM_181889chr421434 564 ------
NM_181890chr421434 564 ------
NM_181891chr421434 564 ------
NM_181892chr431481 52 42 ------
NM_181893chr421434 564 ------
NM_182314chrX51664 1513 717 270 112 --11362 --
NM_182484chr2111059 1329 1365 --
NM_182485chr422878 628 13057 ----
NM_182487chr974377 3933 3254 1082 1052 831 197 --11661 --
NM_182488chr131732 --1766 --
NM_182641chr1731678 442 332 1784 ----
NM_182645chr6--1392 ----
NM_182646chr422878 628 13057 ----
NM_182678chr23447 368 163 ------
NM_182691chr71284 ------
NM_182692chr71284 ------
NM_182756chr24609 406 174 46 ------
NM_182758chr1553759 3487 3303 1423 58 22933 2873 1294 --
NM_182763chr122702 815 12138 1402 --
NM_182765chr103594 378 369 --1867 --
NM_182767chr1241737 1442 737 239 11974 1145 --
NM_182789chr53903 288 81 ------
NM_182797chr2041282 621 547 531 1477 ----
NM_182811chr2031156 782 55 ----1141
NM_182898chr735883 4917 382 ------
NM_182899chr735883 4917 382 ------
NM_182907chr61930 12353 ----
NM_182910chr141713 --1267 --
NM_182913chr141713 --1267 --
NM_182914chr141713 --1267 --
NM_182918chr215579 417 290 208 199 11138 ----
NM_182931chr7----1747 --
NM_182972chr152716 2649 2399 1098 504 12805 1744 --
NM_183004chr141110 1407 13344 --
NM_183043chr131273 1225 ----
NM_183044chr131273 1225 ----
NM_183057chr8--1221 ----
NM_183227chr641476 1296 1239 254 1471 ----
NM_183323chr53903 288 81 ------
NM_183381chr32960 787 ------
NM_183383chr32960 787 ------
NM_183384chr32960 787 ------
NM_183397chr2084926 4110 4048 3902 3189 1589 1385 577 24869 3557 15070 --
NM_194071chr773604 3528 2044 1926 762 404 300 --13843 --
NM_194247chr244256 3411 1613 55 13760 24280 1686 --
NM_194278chr1422563 1122 13547 ----
NM_194282chr432061 1232 1090 ----1554
NM_194285chr1162983 2637 2536 1257 539 459 --1250 11284
NM_194286chr12145646 5331 4635 4560 1216 1177 1101 1026 986 937 923 623 179 45 14915 11803 14550
NM_194292chr12573 64 ------
NM_194301chr14--1752 ----
NM_194313chr931252 491 78 --1127 --
NM_194314chr164541 4468 1358 990 906 43 15301 13477 13843
NM_194317chr272702 2665 2217 2106 1839 1827 214 12461 ----
NM_194356chr1222162 38 ------
NM_194434chr1884443 3902 3670 2280 2112 1723 1633 424 11519 1232 --
NM_194449chr181966 ------
NM_194463chrX2402 137 ------
NM_197941chr522805 2576 ----1227
NM_197962chr1235 24 ------
NM_197970chr221620 1374 ------
NM_197977chr91369 --1846 --
NM_198081chr652827 2596 2071 1093 925 ------
NM_198086chr141653 1699 12063 --
NM_198087chr16--1163 --1565
NM_198088chr16--1163 --1565
NM_198128chr1862130 1907 1859 1811 946 41 ------
NM_198148chr102815 762 ----1949
NM_198158chr342866 2642 2196 1972 ------
NM_198159chr342866 2642 2196 1972 ------
NM_198177chr342866 2642 2196 1972 ------
NM_198178chr342866 2642 2196 1972 ------
NM_198181chr1532690 2554 715 --11919 --
NM_198195chr34621 587 74 55 ------
NM_198215chr102526 238 ------
NM_198217chr132995 757 ------
NM_198218chr132995 757 ------
NM_198219chr132995 757 ------
NM_198261chr12153 ------
NM_198262chr12153 ------
NM_198268chr11587 --23940 1116 --
NM_198269chr11587 --23940 1116 --
NM_198270chrX52508 2141 1189 1109 605 --11395 --
NM_198275chr11--178 ----
NM_198281chr453201 3047 905 180 63 12376 ----
NM_198321chr552753 1077 731 636 453 12084 ----
NM_198335chr112799 377 --1107 --
NM_198336chr71281 --11531 --
NM_198391chr2011070 ------
NM_198392chr652337 2145 2007 157 141 --2929 288 --
NM_198400chr1521175 350 11975 --11967
NM_198404chr131785 ------
NM_198467chr71398 ------
NM_198490chr363395 2668 1182 904 761 210 13282 ----
NM_198513chr851839 1690 1474 1399 451 1559 ----
NM_198521chr121147 ------
NM_198569chr622491 2188 --12081 --
NM_198581chr2105949 5284 4987 1808 962 759 582 448 421 121 --1294 --
NM_198597chr10------162
NM_198700chr111525 ------
NM_198715chr1156157 5492 5383 4679 4375 4179 3920 1868 1816 1542 1428 1396 765 162 87 ------
NM_198793chr333768 3017 1599 ----12962
NM_198829chr721338 120 11213 ----
NM_198859chr371933 1742 1137 919 842 820 127 15074 34112 933 603 --
NM_198889chr4----1440 --
NM_198900chr1286018 5259 1917 1483 657 490 437 152 27460 2893 22619 529 11272
NM_198904chr531801 1736 147 ------
NM_198925chr151984 ------
NM_198990chr763268 3175 2620 1307 845 233 --11108 --
NM_198991chr181224 ------
NM_198995chr181205 ------
NM_199133chr53821 287 188 ------
NM_199138chr133814 196 35 ------
NM_199144chr201489 11594 ----
NM_199168chr1031486 1002 164 --11322 --
NM_199188chr122466 300 --13589 --
NM_199189chr51345 ------
NM_199190chr122466 300 --13589 --
NM_199191chr2155 ------
NM_199194chr2155 ------
NM_199203chr201489 11594 ----
NM_199205chr82557 248 1594 --1527
NM_199245chr1212595 ------
NM_199320chr432588 2544 2381 152 12128 --
NM_199320chr432588 2544 2381 152 12128 --
NM_199324chr473188 2446 1406 1020 858 803 195 11089 13267 --
NM_199421chr1453709 3597 3109 426 71 24880 3917 21784 1435 --
NM_199436chr231207 516 466 22420 791 ----
NM_199462chr153768 3065 1529 929 585 14069 ----
NM_199464chr132624 127 ------
NM_199478chrX1740 1226 --1512
NM_201266chr263005 2697 2497 1920 574 91 --11903 --
NM_201269chr121425 1109 ------
NM_201279chr263005 2697 2497 1920 574 91 --11903 --
NM_201432chr17125704 5547 5521 5007 4355 4243 1881 779 724 455 428 70 11573 24513 1388 --
NM_201433chr17125704 5547 5521 5007 4355 4243 1881 779 724 455 428 70 11573 24513 1388 --
NM_201437chr821410 1250 ------
NM_201568chr111422 1650 ----
NM_201569chr111422 1650 ----
NM_201570chr1021674 658 11489 ----
NM_201571chr1021674 658 11489 ----
NM_201572chr1021674 658 11489 ----
NM_201590chr1021674 658 11489 ----
NM_201593chr1021674 658 11489 ----
NM_201595chr14------1109
NM_201596chr1021674 658 11489 ----
NM_201597chr1021674 658 11489 ----
NM_201613chr121896 ------
NM_201999chr41780 ------
NM_203282chr1931627 1500 1395 1426 ----
NM_203301chr14--1331 --11606
NM_203318chr171138 ----1243
NM_203327chr2084014 3601 3423 3149 2992 1748 1301 807 --13204 --
NM_203342chr133414 1186 388 --1522 --
NM_203343chr133414 1186 388 --1522 --
NM_203349chr1542129 2010 309 248 --1577 --
NM_203350chr12523 100 ----1446
NM_203351chr1752082 993 585 548 25 1211 ----
NM_203372chr231212 598 240 ----11380
NM_203390chr831762 1387 280 ------
NM_203391chrX41597 1359 1154 184 ------
NM_203394chr1232556 2181 652 ------
NM_203406chr542554 2545 1859 764 1742 ----
NM_203437chr2--1608 ----
NM_203458chr153150 3002 1545 1007 873 ------
NM_203459chr122212 681 ------
NM_203463chr264088 3658 3552 3168 1515 1466 --11355 --
NM_203487chr1331767 1500 43 ------
NM_203488chr14------1327
NM_203504chr4----12544 --
NM_203505chr4----12544 --
NM_205860chr153136 2915 2671 978 971 --23126 2581 --
NM_205861chr11438 ----21520 1313
NM_206594chr132409 1313 1166 --1616 11471
NM_206595chr132409 1313 1166 --1616 11471
NM_206853chr622513 1338 14073 --13789
NM_206854chr633774 1093 1084 15334 --15050
NM_206855chr634739 2058 2049 16299 1939 16015
NM_206876chr221158 108 ----13464
NM_206900chr192330 123 ------
NM_206901chr192330 123 ------
NM_206909chr877989 7826 7630 7500 7217 2552 2073 ------
NM_206921chr6127 --139 --
NM_206925chr1521665 849 1349 32267 2247 122 --
NM_206943chr21653 ------
NM_207113chr73251 133 113 --133 --
NM_207292chr362655 747 669 589 336 27 ------
NM_207293chr362655 747 669 589 336 27 ------
NM_207294chr362655 747 669 589 336 27 ------
NM_207295chr362655 747 669 589 336 27 ------
NM_207296chr362655 747 669 589 336 27 ------
NM_207297chr362680 772 694 614 361 52 ------
NM_207299chr93701 694 79 ----1212
NM_207303chr1052829 1605 1568 1507 679 1933 14097 --
NM_207304chr1342132 743 537 361 1706 ----
NM_207337chr121950 --127 --
NM_207371chr1031016 347 302 --21485 642 --
NM_207372chr1022457 704 --12468 --
NM_207380chr1543388 3100 1061 92 --32688 2539 2268 --
NM_207406chr4146568 6530 5967 5855 5437 5031 4630 4433 4211 1753 1331 1189 952 787 34412 1589 1202 --16016
NM_207422chrX21313 267 ------
NM_207577chr1192931 2288 2060 2047 1812 1145 980 534 441 22034 1161 11929 --
NM_212460chr721408 107 1778 ----
NM_212474chr21947 ------
NM_212475chr21947 ------
NM_212476chr21947 ------
NM_212478chr21947 ------
NM_212482chr21947 ------
NM_212558chr974073 3998 3726 3631 3600 1721 1260 --11053 --
NM_213594chr12--11059 ----
NM_213606chr1062717 2084 2009 860 670 478 ------
NM_213609chr31792 ------
NM_213619chr81129 ------
NM_213620chr81129 ------
NM_213654chr31317 ------