TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4799-5p
miRNA Sequence: AUCUAAAUGCAGCAUGCCAGUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000112chr564993 4648 4484 1498 1340 310 45324 5195 1639 694 65542 4674 4190 3537 1136 325 24315 1002
NM_000163chr532128 503 243 22187 1965 1558 21456 820
NM_000448chr1122686 1111 1682 42851 1277 851 836 1723
NM_000555chrX77214 6891 5888 2456 2193 2183 755 32910 2361 1094 --27423 728
NM_000618chr12116037 5463 4862 4283 2421 1620 1031 843 716 634 526 2173 81 ----
NM_000618chr12116037 5463 4862 4283 2421 1620 1031 843 716 634 526 2173 81 ----
NM_000633chr1894489 4200 4064 3721 3352 3280 1853 1401 814 54777 1754 1678 964 296 13960 13317
NM_000813chr5104118 3901 3552 1865 1779 1233 582 343 270 155 14882 1642 1303
NM_000899chr1283391 2970 2961 2824 1241 1117 984 550 13579 24152 1582 23476 278
NM_000959chr143868 3297 2605 749 23086 2649 13264 23785 3759
NM_001001419chr594776 4242 3804 3691 1763 1702 800 249 53 34222 3964 1848 13643 --
NM_001001420chr594776 4242 3804 3691 1763 1702 800 249 53 34222 3964 1848 13643 --
NM_001001481chr843116 2869 2730 837 3954 789 284 21181 515 12412
NM_001001668chr1973733 3524 3458 1392 867 377 256 13495 34042 3855 3267 --
NM_001001890chr2183664 3461 1630 1177 1033 659 534 342 --11316 13190
NM_001003652chr1877733 5903 5383 1719 1650 1318 1109 37085 6076 3125 13207 1516
NM_001003712chr1263451 3418 3162 2545 915 45 11291 --23631 3574
NM_001003760chr652541 1379 1234 1064 775 1426 --32307 1448 1051
NM_001004317chr683832 3760 3578 3439 2861 1173 730 578 14375 14275 23981 3406
NM_001005473chr552415 1994 1116 749 678 56505 6116 4678 1642 1284 25225 4604 --
NM_001007278chr1395206 4488 3416 2091 1803 1657 1377 172 72 44687 4315 3649 899 24365 4210 --
NM_001008408chr795449 4479 4445 4114 2421 1851 1200 897 511 --14179 16410
NM_001009899chr385636 5259 5053 4774 889 862 703 565 36452 5714 4789 15134 --
NM_001010846chr164463 3844 3182 1646 1553 535 23505 1660 11707 14354
NM_001010891chr596407 4508 4228 4186 2459 2366 1494 731 585 32208 473 453 25606 1388 16138
NM_001011513chr474056 3638 3610 3301 2524 163 74 23051 308 33974 3838 2581 --
NM_001011537chr341751 827 647 355 22321 1846 12335 31784 1656 883
NM_001011666chr776221 5770 4212 2509 2257 1991 891 25872 76 15637 34637 4359 4051
NM_001012418chr654209 3081 2810 1403 536 23270 452 1411 22992 24
NM_001014380chr1385882 5172 4805 4261 3986 2059 1458 462 65109 3707 1799 496 297 84 25406 4865 1314
NM_001014797chr1097954 7378 6788 6770 5139 3274 2919 2251 1225 67541 7397 6127 5876 3070 312 --15380
NM_001015877chrX52582 726 550 345 326 32731 1096 946 12952 12281
NM_001018067chr1195152 5058 4844 4669 4482 4392 4251 3851 3471 3462 1830 1761 1670 1576 1514 1204 952 901 658 65219 4977 3640 1621 1440 1094 34988 4659 3531 2384 211
NM_001018068chr1195152 5058 4844 4669 4482 4392 4251 3851 3471 3462 1830 1761 1670 1576 1514 1204 952 901 658 65219 4977 3640 1621 1440 1094 34988 4659 3531 2384 211
NM_001018069chr1195152 5058 4844 4669 4482 4392 4251 3851 3471 3462 1830 1761 1670 1576 1514 1204 952 901 658 65219 4977 3640 1621 1440 1094 34988 4659 3531 2384 211
NM_001024647chr1286891 6714 5639 2633 1639 1123 949 923 11974 1321 37231 2070 1938
NM_001024948chr182999 2750 2523 1198 948 791 784 488 12824 ----
NM_001025077chr1065453 5164 5143 1925 1519 591 47616 4619 2213 672 44725 2878 2377 698 15096
NM_001025252chr883239 2987 2828 2603 926 852 668 109 1514 12533 32161 2143 221
NM_001025253chr883239 2987 2828 2603 926 852 668 109 1514 12533 32161 2143 221
NM_001025266chr3104370 4161 3671 3350 3195 3103 1917 1318 1100 1054 54905 4530 3377 3295 3094 1967 --
NM_001025580chrX61229 1160 866 781 432 209 11523 13893 1928
NM_001030055chr14124526 4457 4251 4231 3657 3484 2875 1346 1079 852 816 418 --34769 2960 33 --
NM_001037334chr1852000 1896 957 191 77 32189 723 662 11943 1118
NM_001039547chr3128034 7795 7778 7165 6405 6236 3233 3181 2519 1425 1314 1253 36259 3029 2965 47806 5301 1270 847 37927 6786 1570
NM_001039577chr124238 3895 34013 3438 3176 23649 1526 43209 1736 793 745
NM_001039585chr154125 3554 2862 1006 176 23343 2906 13521 24042 4016
NM_001039590chrX84022 3827 3493 3148 2872 972 653 543 11342 13916 23518 3261
NM_001039591chrX84022 3827 3493 3148 2872 972 653 543 11342 13916 23518 3261
NM_001039618chr11155754 5103 4558 4437 4165 3611 1566 1327 1017 725 691 619 421 222 139 32363 2334 398 23849 3698 --
NM_001040152chr785147 4640 4536 4192 4186 3654 3341 1234 --14825 24687 875
NM_001040157chr462506 2497 1064 693 611 124 22420 221 1114 12296
NM_001040284chr1645210 3805 1883 1534 11626 13864 15536
NM_001040429chr13113127 2959 2880 2785 2728 2508 2467 2393 2193 1129 769 13591 --13030
NM_001042355chr1695351 5326 4537 1535 1093 914 854 694 437 25076 296 14085 --
NM_001042361chr1061165 1028 572 310 198 27 11044 --21017 372
NM_001042364chr1061165 1028 572 310 198 27 11044 --21017 372
NM_001042365chr1061165 1028 572 310 198 27 11044 --21017 372
NM_001042387chr1061165 1028 572 310 198 27 11044 --21017 372
NM_001042393chr1061165 1028 572 310 198 27 11044 --21017 372
NM_001042396chr1061165 1028 572 310 198 27 11044 --21017 372
NM_001042397chr1061165 1028 572 310 198 27 11044 --21017 372
NM_001042412chr1695351 5326 4537 1535 1093 914 854 694 437 25076 296 14085 --
NM_001042533chr323175 962 22219 319 11037 32691 2489 285
NM_001042555chr1264611 4506 4435 4248 1628 962 ----21410 1005
NM_001042599chr2137318 6050 5932 5454 3055 2791 2729 2644 2175 1878 1130 439 21 --25671 1771 17302
NM_001046chr552802 2719 1044 923 479 --2905 820 1843
NM_001099678chr3126193 6160 5666 5145 4549 4460 4327 2380 397 333 228 187 23964 1591 --16389
NM_001106chr398196 7097 6808 5941 1852 1735 797 623 184 59607 9538 8811 667 76 ----
NM_001167chrX76471 6394 4570 2667 2509 2290 476 32606 903 498 --1736
NM_001173chr14124526 4457 4251 4231 3657 3484 2875 1346 1079 852 816 418 --34769 2960 33 --
NM_001204chr2127740 6574 6294 6268 6212 5871 2838 2299 1653 343 219 165 12146 16566 --
NM_001259chr7135880 5843 5052 4797 4355 1789 1722 1666 1472 1012 847 728 388 42415 1715 978 808 ----
NM_001364chr1173741 3437 1557 1175 1010 503 324 24197 1001 14269 143
NM_001412chrX33506 2873 1196 13584 43695 3289 3024 55 12462
NM_001609chr1044192 4147 1294 1012 --13165 2792 615
NM_001616chr273178 3053 2745 2394 901 499 289 43170 2920 2227 1089 11329 11412
NM_001650chr1823573 299 13094 14152 34064 3943 3522
NM_001695chr8123993 3895 3803 3189 1712 1682 1467 1068 968 763 691 390 11101 ----
NM_001754chr2183664 3461 1630 1177 1033 659 534 342 --11316 13190
NM_001806chr1952683 2176 2068 827 24 32988 2130 904 22323 496 1661
NM_001858chr6124890 4505 3799 3760 3472 3341 3291 1900 1669 1441 810 582 11491 14978 --
NM_001941chr1853824 3237 2750 1110 508 21487 412 23134 1080 12883
NM_002006chr444566 3885 699 104 3878 305 55 --24407 1477
NM_002025chrX67416 6854 6761 3068 2975 711 16617 43423 3338 3152 1371 12200
NM_002182chr332207 2136 851 1184 32435 762 132 22649 1715
NM_002247chr1061764 1732 1719 1523 850 750 --11725 --
NM_002264chr364661 4525 3481 1581 443 256 13561 --34938 1634 792
NM_002310chr566432 4588 4342 4298 2268 561 16450 46399 6367 4702 1613 25515 1692
NM_002336chr12104933 4126 4086 3942 3825 3353 1853 1515 1268 56 34016 3987 687 13774 14431
NM_002577chr3103454 3285 3231 2977 2931 1564 1340 1090 949 200 22838 663 --1919
NM_002655chr884872 4005 3332 1835 1248 1034 386 315 41655 1611 1092 171 13429 --
NM_002745chr22104341 4273 3750 3637 3244 2767 1215 992 844 131 1663 --11504
NM_002834chr1243864 3133 1557 431 33803 2726 1513 1106 1113
NM_002886chr3105053 4966 4830 4347 3866 3510 2079 1293 1187 925 --35094 3815 1656 25046 2015
NM_002977chr262990 1230 1136 948 692 476 13212 --22401 400
NM_003199chr1885502 5466 5421 4011 3695 3651 3572 670 34102 1231 348 15306 --
NM_003298chr365881 5812 5374 5183 1957 1910 35613 5562 229 --25574 258
NM_003411chrY61696 1542 1509 1496 1458 737 1636 11474 21533 1334
NM_003463chr662451 2436 2206 841 169 153 --21083 190 1338
NM_003566chr1283246 2786 1195 981 279 217 92 86 2249 138 --21314 785
NM_003574chr1874886 2252 2195 1873 1427 1294 1063 43855 1906 1398 1270 1394 --
NM_003583chr12123881 3347 3258 3186 2683 2454 1481 1261 1156 995 839 252 ----1751
NM_003590chr263897 3236 1532 1138 829 626 23846 1091 --22877 301
NM_003617chr184589 4159 4024 3654 3378 1542 1339 165 34924 3665 1019 --24379 810
NM_003672chr13603 462 253 1538 1415 21481 669
NM_003913chr684219 3932 3214 3177 3044 2852 1718 156 --13848 13144
NM_003994chr1283391 2970 2961 2824 1241 1117 984 550 13579 24152 1582 23476 278
NM_004028chr1823573 299 13094 14152 34064 3943 3522
NM_004124chr14113544 3432 3306 2983 2893 2837 2418 1209 856 476 431 --13384 --
NM_004171chr1198577 7055 6976 3771 2823 2292 1953 1788 876 58478 7646 3124 2566 2310 27159 3601 19236
NM_004232chr1882822 2611 2590 2485 1501 1274 216 142 23853 2624 --32952 744 528
NM_004458chrX32602 2504 1643 11946 12510 21826 878
NM_004464chr454280 3608 2809 1252 628 --1828 22862 264
NM_004726chrX64796 4717 4463 3767 1771 1414 35735 1473 861 25640 523 15072
NM_004745chr857066 6531 2075 1735 1310 35142 5132 2120 --25338 1856
NM_004904chr776221 5770 4212 2509 2257 1991 891 25872 76 15637 34637 4359 4051
NM_004949chr1851991 776 769 476 156 --2327 165 1179
NM_004956chr784037 3551 1437 1021 745 679 551 256 24242 820 33954 3182 1520 --
NM_004985chr1284368 3855 3742 3727 3122 2869 1122 953 53820 3112 2891 1792 1547 34056 4046 3217 13545
NM_004999chr683024 1759 1698 1255 1019 896 794 178 53444 3408 3389 1201 497 24128 3826 11133
NM_005065chr1454899 4526 3730 1758 1609 44132 1907 694 509 14432 25385 75
NM_005079chr883239 2987 2828 2603 926 852 668 109 1514 12533 32161 2143 221
NM_005151chr1852000 1896 957 191 77 32189 723 662 11943 1118
NM_005156chr965118 3668 3621 3478 3322 1344 1964 23875 1486 1661
NM_005188chr1177419 6545 5910 2441 1714 1611 27 88238 7229 5883 2206 1773 1073 594 467 15600 --
NM_005235chr2137318 6050 5932 5454 3055 2791 2729 2644 2175 1878 1130 439 21 --25671 1771 17302
NM_005256chr113229 96 69 2691 616 --2325 269
NM_005665chr154446 4315 3962 3291 3116 43993 3624 285 69 23535 1500 13168
NM_005746chr752777 2248 814 217 152 ----22626 2119
NM_005748chr1283450 3129 3009 2531 798 724 705 286 1850 12619 11200
NM_005759chr244020 3324 3279 1791 1972 --34767 3817 3230
NM_005798chr1395206 4488 3416 2091 1803 1657 1377 172 72 44687 4315 3649 899 24365 4210 --
NM_005901chr1877733 5903 5383 1719 1650 1318 1109 37085 6076 3125 13207 1516
NM_005903chr594776 4242 3804 3691 1763 1702 800 249 53 34222 3964 1848 13643 --
NM_005935chr4105097 4822 4728 4243 3290 1820 1254 1177 500 261 55161 3829 3364 3243 1472 ----
NM_006016chr651440 776 460 369 355 --22246 1546 --
NM_006060chr754329 3707 3603 198 119 --1886 23093 1144
NM_006106chr1173369 2143 1339 1121 989 390 292 31371 1347 605 22881 2363 11044
NM_006212chr1104951 4791 4443 3801 3536 1975 1603 1553 1485 1379 53852 1664 1022 890 243 44908 4213 3490 847 --
NM_006252chr197108 6759 6586 6418 5745 5714 2784 1704 75 47024 2802 2287 2203 15839 --
NM_006267chr241220 664 424 408 11553 1343 21473 1263
NM_006306chrX95850 5771 4007 2378 2192 1808 1649 1564 783 21297 409 1123 23787 3734
NM_006352chr172035 1885 1706 1686 464 187 163 21678 138 11843 --
NM_006380chr1753690 3140 2887 780 767 23740 3384 23633 820 --
NM_006393chr1044536 3972 3724 3021 43643 1717 1168 366 11001 24306 3635
NM_006457chr474056 3638 3610 3301 2524 163 74 23051 308 33974 3838 2581 --
NM_006482chr12123881 3347 3258 3186 2683 2454 1481 1261 1156 995 839 252 ----1751
NM_006544chr14135498 5164 4169 4110 2380 2053 1839 1599 1472 887 704 482 181 65480 4539 1641 1554 1535 1349 45606 4341 4292 1001 21170 368
NM_006572chr1743011 2436 575 526 --63534 3359 3106 2707 2508 1029 12563
NM_006599chr16117975 7054 6568 5916 5424 3201 2902 1920 1622 893 693 56358 6052 6036 2987 1956 --25893 1977
NM_006620chr641022 673 482 109 1852 34596 1467 716 1566
NM_006654chr1264611 4506 4435 4248 1628 962 ----21410 1005
NM_006729chrX54741 3555 2244 1948 1794 1517 44398 2101 859 473 1559
NM_006895chr241966 1441 411 115 2699 503 1777 22036 162
NM_006924chr1793794 3680 3011 2749 1411 1081 1074 399 220 44012 3411 3349 435 12922 12784
NM_007006chr1663079 2625 2447 2372 1012 858 22914 897 22662 661 33366 2573 2429
NM_007173chr1151953 1779 536 365 262 31719 1584 53 2940 542 1501
NM_007195chr1843538 1489 1180 480 --33589 3072 829 23493 3211
NM_007249chr13119010 8904 8623 7861 6467 6157 2578 2529 2386 1226 1109 59429 5796 3699 2472 1875 27808 385 13608
NM_012081chr563232 3000 2665 410 326 244 12760 12486 1479
NM_012214chr246262 5881 5738 4832 36093 1812 564 14777 26018 5565
NM_012249chr283352 2999 2918 2451 2222 1259 821 730 --12847 13210
NM_012262chr1115090 5029 4828 4112 3968 3945 3847 3313 1991 1804 762 14056 1985 --
NM_012287chr364168 3436 3319 1825 1795 666 44251 3383 1589 194 1261 13097
NM_012431chr763267 3192 3164 2860 2218 1291 2832 308 11395 145
NM_012464chr422515 2381 2754 545 2642 364 22681 2448
NM_013943chr162401 2134 685 513 461 272 33268 735 446 22836 242 22920 812
NM_014155chr11117513 7208 7033 6055 4885 2798 2170 2091 1613 1203 285 56296 3028 1923 736 306 15535 36370 5939 4766
NM_014267chr113793 686 651 --1617 2702 582
NM_014331chr456972 6806 6386 4980 170 36786 6247 2599 35701 1975 520 --
NM_014393chr82344 275 12135 1712 21493 126
NM_014423chr5145470 5099 5086 5064 4399 4216 3693 3581 3492 2057 1903 1555 672 390 --25532 5235 14709
NM_014721chr687062 7000 6360 6140 4972 2407 2150 1519 25649 5543 37460 7174 5057 46566 2333 512 22
NM_014746chr233467 1717 471 1488 12845 21661 608
NM_014877chr17136804 6753 6312 5652 5566 3063 2330 2261 1892 1580 847 706 573 37637 1470 796 17814 --
NM_014904chr1043854 3041 2515 401 31137 802 544 --1553
NM_014906chr1782683 1566 1206 1119 974 744 694 436 1754 13018 13130
NM_014962chr2072773 1976 729 638 346 324 237 2716 681 --22339 481
NM_014982chr1484942 4357 4054 4009 3643 3569 2043 2024 13333 11325 11426
NM_015026chr1274331 3337 3209 3014 1760 1147 780 ----11166
NM_015068chr783999 3492 3388 3044 3038 2506 1151 86 11046 13677 13539
NM_015092chr1674016 3887 3230 3211 1851 1384 972 34612 4261 1229 --24202 347
NM_015200chr442304 2096 853 419 31796 958 523 21892 1687 2992 821
NM_015247chr1695351 5326 4537 1535 1093 914 854 694 437 25076 296 14085 --
NM_015313chr1164586 3142 1783 1761 825 425 23062 1863 142 11901
NM_015365chrX61229 1160 866 781 432 209 11523 13893 1928
NM_015455chr553160 3010 2737 2548 443 44112 3780 2717 1110 34017 1461 112 24044 510
NM_015458chr894711 4497 4319 3334 3282 1383 536 382 110 11909 14860 --
NM_015553chr634400 4051 3202 11959 11273 22041 1441
NM_015564chr52879 463 --1778 2868 337
NM_015605chr1061165 1028 572 310 198 27 11044 --21017 372
NM_015640chr1195152 5058 4844 4669 4482 4392 4251 3851 3471 3462 1830 1761 1670 1576 1514 1204 952 901 658 65219 4977 3640 1621 1440 1094 34988 4659 3531 2384 211
NM_015713chr873359 3213 2624 2292 1430 786 664 1803 12236 12748
NM_015879chr18146790 6605 5925 5589 3361 3170 2429 2041 2010 895 278 233 202 170 68309 8228 6692 5267 2820 1636 --25322 1011
NM_015886chr8115572 5246 4949 4827 4723 4635 4080 1929 1256 1092 951 33686 1498 1037 45597 4199 1967 1732 --
NM_015888chr143232 3031 2864 882 33164 2891 595 --23324 568
NM_016206chr376949 5598 3086 2926 2045 1686 426 47009 6499 5533 1258 36419 2336 1269 16982
NM_016217chr6133643 3618 3388 3236 2538 2331 1386 1353 824 779 645 386 224 32591 1053 406 11445 32285 686 296
NM_016255chr652878 2646 2443 453 212 22686 2204 22517 648 192
NM_016260chr2107059 6907 6164 6116 5965 2810 2672 2219 1624 1190 46994 6599 6024 4942 57540 7277 6689 2420 2282 --
NM_016275chr342386 2023 862 496 2896 191 22654 1737 12206
NM_016530chr15123786 3575 3552 3301 3120 2922 1381 1292 1115 999 948 446 23051 1130 22990 860 1696
NM_016575chr12115335 4604 4333 4169 4003 3901 2073 2036 1167 1114 524 33695 2150 90 --14370
NM_017447chr2194322 3121 2984 1588 1408 1066 604 437 201 34259 3171 1305 1846 14093
NM_017599chr1272036 1519 1494 737 591 365 55 42073 652 522 189 --11526
NM_017628chr495047 3855 3801 3646 3632 3217 1942 211 194 15076 --1467
NM_017643chr1752498 995 950 321 261 33009 2210 434 32114 1142 614 12071
NM_017644chr3104664 4310 3857 1956 1912 1891 1776 1278 628 124 21680 307 34967 1491 412 13297
NM_017831chr1813409 21183 511 23493 531 24587 974
NM_018017chr1052858 2752 2174 618 486 32307 2247 1857 22467 2074 1715
NM_018299chr843116 2869 2730 837 3954 789 284 21181 515 12412
NM_018313chr331841 1753 594 22266 2122 1587 12170
NM_018374chr774830 4355 4030 3224 2011 1964 1017 54909 4886 4685 3521 3189 --11108
NM_018440chr8118388 8127 8102 6878 6816 6759 6654 6134 1805 1638 730 33081 2991 529 47761 7116 2690 910 --
NM_018638chr1285590 4259 3887 2104 1678 1044 940 104 1545 --24963 518
NM_018999chr1084861 3856 3700 3489 3016 1484 1060 200 23286 91 13814 13006
NM_019072chr574271 4071 4042 2920 1051 495 169 13587 --1775
NM_020122chr242245 2064 1971 1738 35933 1293 1186 12102 25425 1306
NM_020159chr41618 21306 305 11403 21371 1112
NM_020199chr55497 487 445 256 179 21105 132 --1518
NM_020245chr644240 541 352 174 43959 2018 1522 44 14654 21606 238
NM_020390chr364629 3582 1881 1572 1509 58 13494 34007 3621 3044 11299
NM_020466chr654275 3670 1572 812 111 44915 3831 1988 336 --24473 57
NM_020673chr2085726 5055 4899 4797 3051 2620 1457 1309 ----11707
NM_020718chr16125796 5760 4802 4526 2601 2587 2567 2434 1797 1765 1225 327 26427 5966 11790 151
NM_020772chr1798186 7753 7613 6144 5491 5298 2972 1954 1538 57738 7278 7112 6060 2496 --16869
NM_020774chr1885946 5530 4466 4204 2487 1641 1261 926 24733 1192 1907 11665
NM_020782chr1264650 4086 3486 1893 1641 502 24833 545 1367 1780
NM_020792chr32757 207 42798 950 339 58 32180 780 774 --
NM_020801chr562556 2345 2091 2075 935 922 21652 159 --1950
NM_020841chr1263451 3418 3162 2545 915 45 11291 --23631 3574
NM_020844chr8137228 6498 6186 5561 5461 5272 4678 2860 2793 2660 1984 1468 138 34840 2184 1207 11381 17178
NM_020918chr1043302 1403 700 647 13378 --2805 605
NM_020921chr1493315 2885 2528 2462 2386 1281 1078 796 712 12727 1415 1623
NM_021083chrX62891 2830 2713 2466 2454 665 53500 2289 867 833 690 23421 616 22355 1287
NM_021191chr1252489 2282 2187 888 579 --1132 22420 2148
NM_021645chr1332031 1734 781 1170 22290 2278 11631
NM_021911chr5104118 3901 3552 1865 1779 1233 582 343 270 155 14882 1642 1303
NM_021964chr3116203 5537 4303 4191 4166 2519 2383 2122 982 939 233 54451 2222 1472 1064 39 25828 2246 --
NM_021998chrX51155 1057 1044 356 302 1403 --21394 33
NM_022133chr83736 702 477 21762 551 129 147
NM_022456chr1286891 6714 5639 2633 1639 1123 949 923 11974 1321 37231 2070 1938
NM_022459chr13135797 5402 5186 4888 4693 2329 1819 1259 972 225 114 107 97 24726 351 23888 27 --
NM_022828chr531601 239 117 41767 1429 393 131 --11638
NM_022977chrX32602 2504 1643 11946 12510 21826 878
NM_023929chr862839 2791 2424 2374 841 286 --261 37 1773
NM_024345chr995950 5426 5070 4659 4523 1931 1860 1322 386 45965 2176 1251 84 35973 5854 63 --
NM_024646chr144017 3430 1494 1161 33955 3721 227 23313 1543 21406 61
NM_024665chr33492 328 262 34157 3192 3110 --24012 254
NM_024744chr272597 2486 2190 2034 1832 1768 1020 ----1846
NM_024761chr954915 4878 1372 975 444 34971 4162 22 13611 15318
NM_024854chr1241428 1295 290 283 --1301 --
NM_024947chr3119286 8917 8651 6804 6011 1804 1593 1240 609 506 447 26220 2748 29346 655 27113 6283
NM_024989chr2118219 6760 6317 3123 3101 3000 2105 796 324 99 41 25198 2032 22048 2001 13147
NM_025073chr164644 4345 3834 1734 1630 405 34298 3503 378 11181 1136
NM_025160chr174088 3538 2729 1732 1570 491 69 43334 1082 396 374 --1730
NM_030621chr1432600 1307 284 31280 712 185 33916 1250 1237 13195
NM_030647chr756177 5753 5729 185 34 --32305 1272 430 21122 399
NM_030674chr12105663 4841 4616 4515 4412 3944 2099 1048 884 733 1416 55270 5168 2276 1909 203 12181
NM_030755chr1452253 898 518 486 350 22746 1991 13040 1602
NM_030791chr1471752 1732 1250 1172 642 246 178 1627 11559 21158 227
NM_030806chr1138967 8199 8147 7699 7283 7242 7019 5959 2346 1809 1648 1468 502 27785 960 23058 1150 18453
NM_030817chr1253142 3058 2689 2670 1483 32995 2869 2730 13293 11521
NM_031427chr1465226 4841 4024 1934 880 356 35045 3882 217 25178 633 15937
NM_032012chr954800 4500 3379 1998 1161 21765 1459 25032 3473 21883 846
NM_032047chr311718 2651 340 --21641 214
NM_032116chr1385882 5172 4805 4261 3986 2059 1458 462 65109 3707 1799 496 297 84 25406 4865 1314
NM_032288chr341751 827 647 355 22321 1846 12335 31784 1656 883
NM_032373chr1075602 4229 3706 2282 2087 1455 962 25329 1244 --1468
NM_032446chr593678 3620 3111 2831 2773 2583 1267 1172 120 42676 657 625 230 32532 2504 1060 --
NM_032458chrX72912 2145 1056 880 675 656 110 33061 2174 1276 13282 12611
NM_032663chr12------31333 1286 445
NM_032778chr323175 962 22219 319 11037 32691 2489 285
NM_032859chr1332473 1462 1227 21132 69 33364 2706 1263 32520 1599 744
NM_032873chr1174307 1759 1624 717 231 112 36 --43820 3046 1240 1193 13301
NM_033143chr464611 3939 3140 1583 959 328 --11159 23193 595
NM_033224chr767611 7381 6498 4876 2744 482 --26275 391 26368 5645
NM_033285chr834229 3704 1754 --1134 43621 850 745 599
NM_033360chr1284489 3976 3863 3848 3243 2990 1243 1074 43941 3233 3012 1668 34177 4167 3338 13666
NM_033430chr463670 1361 1199 1065 166 96 23574 385 22837 1459 1771
NM_033437chr463670 1361 1199 1065 166 96 23574 385 22837 1459 1771
NM_033505chr295775 5422 2602 1586 1313 1218 748 568 161 14466 14343 1390
NM_033656chr2185145 4816 4444 3873 2211 2068 1682 1323 15578 34776 4251 2101 25961 888
NM_052811chr1395206 4488 3416 2091 1803 1657 1377 172 72 44687 4315 3649 899 24365 4210 --
NM_052832chr872730 2214 2020 1139 815 235 89 ----1364
NM_052879chr1293571 2654 2645 2512 1180 636 327 138 76 23172 1264 13381 21409 1040
NM_052885chr12104859 4534 4318 4291 4262 4087 3463 1773 570 23 13421 11602 14598
NM_053042chr472083 2056 936 499 454 293 52 73031 2973 2557 2459 2095 1993 1957 --12780
NM_053043chr795449 4479 4445 4114 2421 1851 1200 897 511 --14179 16410
NM_080872chr853526 3422 2783 465 234 --1254 32866 534 527
NM_133493chr694409 3253 3051 3042 2915 2892 1523 1292 259 33239 298 249 11243 --
NM_138459chr622906 1060 21046 290 --32961 1451 1388
NM_138468chr286302 6145 5895 5778 5649 4347 1979 137 44302 1151 481 343 3596 271 76 11728
NM_138713chr16117975 7054 6568 5916 5424 3201 2902 1920 1622 893 693 56358 6052 6036 2987 1956 --25893 1977
NM_138714chr16117975 7054 6568 5916 5424 3201 2902 1920 1622 893 693 56358 6052 6036 2987 1956 --25893 1977
NM_138959chr175816 5590 4578 4206 4143 1638 867 --15843 36344 5698 161
NM_144571chr4126917 6391 5460 4913 4378 2140 1211 1070 1052 650 471 170 25123 805 25711 5294 12784
NM_144578chr14105290 4948 4052 2149 2016 1548 1038 716 510 230 35416 1714 954 11416 --
NM_144664chr1152456 2175 2125 1797 43 ----3846 491 406
NM_144973chr1234641 870 184 33595 3527 589 24416 64 25088 121
NM_145259chr276393 5074 4800 2729 1990 1745 427 36872 5340 837 12147 36855 4662 2131
NM_152275chr282403 1568 1504 897 652 547 368 69 32123 831 567 11471 --
NM_152407chr583135 2917 2603 2434 2155 794 399 111 1248 2448 439 12483
NM_152409chr543298 2249 554 253 131 23383 3275 22711 1248
NM_152622chr532876 2344 874 --11004 22796 2566
NM_152624chr556736 6465 6083 5987 2271 56951 5844 2763 1673 906 12803 27036 5795
NM_152754chr742989 2355 699 582 43409 3378 2940 277 22532 541 23443 2859
NM_152756chr574068 3867 3716 2771 900 863 386 23307 2942 14091 23429 1207
NM_152787chrX53838 2997 2843 1044 504 32935 2796 1440 --21155 916
NM_152836chr83736 702 477 21762 551 129 147
NM_152837chr83736 702 477 21762 551 129 147
NM_153182chr323175 962 22219 319 11037 32691 2489 285
NM_153262chr163189 3082 2576 2049 962 293 22691 204 --12535
NM_153371chr1322237 43 21913 89 22284 963 21783 1559
NM_172071chr1147427 7164 7032 6673 6403 6395 6030 5776 5126 2758 2542 2209 1273 287 44717 2962 2457 2437 12392 25618 581
NM_173214chr16117975 7054 6568 5916 5424 3201 2902 1920 1622 893 693 56358 6052 6036 2987 1956 --25893 1977
NM_173468chr485453 5435 4694 3808 2440 2337 1093 902 31460 1407 1050 --35132 4431 4350
NM_173470chrX1326 51822 1107 987 368 357 12472 1963
NM_173582chr1165961 5774 2329 1993 1584 532 23868 550 --12269
NM_173642chr1118932 8531 8506 8253 6290 6201 3374 3365 2066 1490 539 39227 8553 5775 --26576 3554
NM_173829chr584311 4183 4005 2382 1743 1662 1654 133 22325 764 --35779 4251 846
NM_174900chr421276 124 ----2232 207
NM_175623chr1286891 6714 5639 2633 1639 1123 949 923 11974 1321 37231 2070 1938
NM_176814chr761110 966 517 420 276 31 11039 --1997
NM_177438chr1432600 1307 284 31280 712 185 33916 1250 1237 13195
NM_177553chr113229 96 69 2691 616 --2325 269
NM_178151chrX77214 6891 5888 2456 2193 2183 755 32910 2361 1094 --27423 728
NM_178152chrX77214 6891 5888 2456 2193 2183 755 32910 2361 1094 --27423 728
NM_178153chrX77214 6891 5888 2456 2193 2183 755 32910 2361 1094 --27423 728
NM_181443chr2072773 1976 729 638 346 324 237 2716 681 --22339 481
NM_182485chr453432 3345 3139 2794 946 32906 1254 722 --12388
NM_182503chr6105597 5300 5128 4634 3952 2024 1900 1724 847 363 55605 4373 3870 257 170 --1559
NM_182515chr1986105 5901 5616 5526 5042 2407 2266 2210 16495 25597 5477 25441 1282
NM_182646chr453432 3345 3139 2794 946 32906 1254 722 --12388
NM_182898chr776221 5770 4212 2509 2257 1991 891 25872 76 15637 34637 4359 4051
NM_182899chr776221 5770 4212 2509 2257 1991 891 25872 76 15637 34637 4359 4051
NM_194291chr862796 1070 967 780 189 117 22977 1985 12332 22577 75
NM_194314chr1125326 4945 4050 3609 2144 2072 2003 1695 575 557 232 30 24779 2228 35016 4448 173 --
NM_194434chr1874886 2252 2195 1873 1427 1294 1063 43855 1906 1398 1270 1394 --
NM_198270chrX53382 2317 979 915 170 11061 22843 813 1431
NM_198273chr542481 2463 1113 493 42826 2200 686 243 21159 95 22237 815
NM_198468chr684359 3464 3126 3100 1168 979 872 690 24551 4111 33701 3597 644 --
NM_198506chr461083 1009 258 225 81 70 41287 1094 976 591 ----
NM_198581chr277332 4740 2347 1938 981 352 318 47309 6116 5933 2366 12440 --
NM_199188chr1293571 2654 2645 2512 1180 636 327 138 76 23172 1264 13381 21409 1040
NM_199190chr1293571 2654 2645 2512 1180 636 327 138 76 23172 1264 13381 21409 1040
NM_203406chr552437 2122 2003 1785 1114 22663 1169 --12715
NM_203459chr162433 2383 1770 1719 540 163 22375 493 1790 1969
NM_205768chr172035 1885 1706 1686 464 187 163 21678 138 11843 --
NM_206853chr6124084 3363 3257 3200 2770 1275 1258 1176 1091 834 474 158 13140 ----
NM_206854chr6105345 4624 4518 4461 4031 3265 2095 1735 1419 1236 54401 3667 3582 3433 167 --13687
NM_206855chr6126310 5589 5483 5426 4996 4230 2384 2201 727 540 275 63 55366 4632 4547 4398 1132 --14652
NM_207303chr1043374 1448 1417 974 64137 3416 2624 2593 1296 1126 23762 2986 --
NM_207406chr495805 5122 4681 1829 1702 1462 1450 1232 153 86396 5830 5412 4337 4239 1166 1002 195 26072 4117 11725
NM_213589chr264304 3886 3760 1968 1874 976 --14597 2755 376
NM_213590chr1395206 4488 3416 2091 1803 1657 1377 172 72 44687 4315 3649 899 24365 4210 --