TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4802-3p
miRNA Sequence: UACAUGGAUGGAAACCUUCAAGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1132447 1069 761 --11295 1716
NM_000052chrX73460 2909 2160 1293 1204 386 56 ----1862
NM_000067chr81459 ----1430
NM_000084chrX76862 6114 5098 4303 1641 928 206 --12103 --
NM_000110chr151116 1103 1052 813 169 --136 --
NM_000189chr222370 518 --21460 298 11998
NM_000216chrX43554 2604 1606 119 13470 24074 3899 1269
NM_000217chr1275307 4425 3396 3385 1351 196 84 --15029 --
NM_000240chrX62226 2146 1823 1753 224 91 --12184 --
NM_000242chr1042552 2072 691 482 62515 2290 2030 1693 839 520 1801 12042
NM_000259chr1545900 5684 4821 458 45428 2544 2167 796 ----
NM_000297chr451789 1721 827 438 243 --11776 --
NM_000335chr331860 432 377 ----12211
NM_000337chr596051 5995 5896 5082 4842 4615 2384 2091 1013 ------
NM_000368chr944576 4497 4103 4039 --31162 957 109 13458
NM_000408chr263056 3018 2935 2899 1143 430 154 ----
NM_000430chr171160 --43751 3255 2340 1173 3524 438 106
NM_000441chr73679 402 24 22281 423 --12131
NM_000461chr374375 4331 3545 3429 3311 1279 940 14158 ----
NM_000489chrX33055 1108 1083 --12861 11306
NM_000555chrX57727 6367 5120 4843 271 15880 25564 966 --
NM_000618chr1266625 6214 5591 5492 2261 1743 36284 6270 836 ----
NM_000618chr1266625 6214 5591 5492 2261 1743 36284 6270 836 ----
NM_000633chr1865045 4759 3253 2026 1467 554 --24482 380 --
NM_000719chr1256327 6031 5098 4972 1242 11224 15470 11529
NM_000793chr1495106 4640 4291 4081 3851 3611 1944 475 227 2985 546 11097 --
NM_000806chr541944 624 433 231 11510 ----
NM_000809chr4158359 8343 7980 7782 7691 5646 5624 2700 2333 1971 1479 1396 1269 671 180 15987 12804 --
NM_000813chr585067 5041 4342 3849 2108 1859 1159 461 --25454 259 --
NM_000816chr5----2120 89 1531
NM_000826chr412539 --22530 2111 12229
NM_000827chr562237 1946 1641 1030 547 395 --21828 561 --
NM_000831chr176117 5711 4598 2323 2163 1748 868 11835 12340 --
NM_000872chr102359 279 21172 565 1445 11032
NM_000880chr81339 1937 --1277
NM_000891chr1762652 2451 1021 666 188 164 --1196 1925
NM_000926chr11108374 8270 7558 7371 7326 6687 5749 3301 2993 1075 28730 293 38662 7645 3672 18766
NM_000965chr351278 963 900 484 221 1938 11252 --
NM_001001396chr133242 346 58 --23975 2820 14302
NM_001001419chr554517 3742 1750 786 642 11120 33449 184 178 --
NM_001001420chr554517 3742 1750 786 642 11120 33449 184 178 --
NM_001001664chr263689 2868 1556 1314 1180 699 ------
NM_001001924chr861760 1637 817 776 732 446 11702 11717 12005
NM_001001925chr861760 1637 817 776 732 446 11702 11717 12005
NM_001001931chr861760 1637 817 776 732 446 11702 11717 12005
NM_001002860chr1433638 3533 1248 --24433 416 11714
NM_001003407chr1074747 4232 1340 1155 928 884 463 --1212 --
NM_001003408chr1074747 4232 1340 1155 928 884 463 --1212 --
NM_001003652chr1898730 8384 8089 7889 7648 5339 3268 1877 1398 --12200 11712
NM_001003674chr18106164 6008 5121 4858 4813 4778 2340 1789 1729 1306 --15823 15181
NM_001003675chr18106164 6008 5121 4858 4813 4778 2340 1789 1729 1306 --15823 15181
NM_001003688chr431103 444 427 ----1864
NM_001003698chr63664 560 60 ----1487
NM_001003699chr63664 560 60 ----1487
NM_001004065chr963329 2640 2632 2472 1586 1310 13675 32821 2503 638 --
NM_001004317chr684462 4303 3476 3244 2994 392 212 180 12856 1867 --
NM_001005210chr1192059 1870 1755 1634 843 611 346 88 25 ------
NM_001005473chr5116551 6197 5628 4876 4035 2571 1684 1252 566 293 23 11553 11636 --
NM_001007023chr1495106 4640 4291 4081 3851 3611 1944 475 227 2985 546 11097 --
NM_001008239chr1822630 1321 22878 1261 --13261
NM_001008392chr373357 2919 2702 2643 664 657 104 12575 ----
NM_001008408chr766029 5610 4746 2168 2005 316 --35396 4862 1291 --
NM_001008707chr1431449 1248 299 11352 1182 11785
NM_001009554chr434724 1437 615 13565 23477 238 13104
NM_001009554chr434724 1437 615 13565 23477 238 13104
NM_001009880chr2263816 3381 1857 1660 1632 1153 --54881 3953 1769 1618 355 --
NM_001009899chr375783 5149 5088 4287 2544 1528 150 24531 303 14447 --
NM_001009993chr234409 1502 651 1865 --12787
NM_001010891chr5106602 5733 5280 2699 2124 2010 1216 921 738 130 26840 977 ----
NM_001010971chr12839 738 ----162
NM_001011666chr735354 1885 438 --12459 11055
NM_001012393chr1134578 3735 3542 14718 34948 4673 492 --
NM_001012418chr653979 3960 3145 1317 1143 24250 4177 22633 1581 1676
NM_001012756chr1923049 2534 11126 2835 829 13302
NM_001012977chrX21305 353 ----1555
NM_001013031chr1012396 23247 1171 1779 11052
NM_001013620chr12147881 7705 7684 6521 6269 5950 5612 3024 1799 1644 1472 1197 1178 1128 13270 38499 6491 891 --
NM_001014797chr1076950 6639 6527 6329 5572 5322 1644 27093 359 13287 1304
NM_001015880chr101315 11526 --21692 256
NM_001018065chr9145913 5869 5789 5702 5527 5274 4716 4592 2414 1926 1850 1627 87 62 --25457 737 --
NM_001018066chr9145913 5869 5789 5702 5527 5274 4716 4592 2414 1926 1850 1627 87 62 --25457 737 --
NM_001018090chr1521805 767 --21008 168 1876
NM_001018091chr1521915 877 --21118 278 1986
NM_001018102chr1521805 767 --21008 168 1876
NM_001024647chr1277480 6529 6383 6371 5511 2251 162 --34916 1216 661 --
NM_001024847chr372443 2146 857 820 308 186 26 12372 1543 --
NM_001024948chr163527 2460 1143 311 123 26 --12546 --
NM_001024956chr1154702 3603 1836 1641 357 25529 548 --14297
NM_001025076chr1076016 1813 1399 1326 704 266 55 23856 1381 45965 5622 4047 929 --
NM_001025077chr1077374 2757 2684 2062 1624 1413 1040 25214 2739 57323 6980 5405 2287 148 --
NM_001025266chr384613 3913 3810 3504 3062 1780 1408 610 ----1228
NM_001025356chr1242880 804 712 383 22084 131 1471 --
NM_001029875chr552306 2088 385 110 102 --12279 --
NM_001029884chr632477 2021 683 --1234 22244 242
NM_001030007chr1663333 3288 1500 1239 810 346 11476 ----
NM_001030055chr1453561 2974 876 782 177 11894 186 --
NM_001031679chr1253540 3287 2670 2203 328 12281 --1165
NM_001031695chr2265372 1765 884 303 167 44 23927 856 45352 4218 1485 290 --
NM_001031700chr422244 242 ----21641 911
NM_001031732chr433544 2934 622 13570 23395 2904 12859
NM_001032280chr631314 433 257 --1574 11066
NM_001033045chr264202 3991 3700 1665 1580 887 34384 2965 759 ----
NM_001033551chr17113972 2922 2692 1417 1333 1192 741 563 249 132 117 --13159 --
NM_001033578chr82500 469 --1151 12037
NM_001035260chr1031563 1491 1457 --21057 395 31515 1448 267
NM_001037954chr1173429 3419 2580 2209 868 595 232 12260 --1704
NM_001039569chr253255 759 709 368 171 32705 2147 2110 22563 294 --
NM_001039590chrX33287 3103 3042 --33144 475 452 --
NM_001039591chrX33287 3103 3042 --33144 475 452 --
NM_001039840chrX65876 4840 4755 4749 4346 2125 12069 16094 13792
NM_001040152chr784962 3333 2031 1884 1751 1698 1161 553 ------
NM_001040284chr1665895 4551 1320 1203 1119 1001 1816 12104 --
NM_001040429chr1353360 3173 1179 658 379 13565 11447 --
NM_001040450chr153914 446 236 --1202 12476
NM_001040453chr153914 446 236 --1202 12476
NM_001040665chr754928 3766 3703 3134 176 ------
NM_001040712chr932325 991 50 12833 11436 1929
NM_001042357chr1021551 631 --1458 11236
NM_001042358chr1021551 631 --1458 11236
NM_001042360chr1021551 631 --1458 11236
NM_001042363chr1021551 631 --1458 11236
NM_001042389chr1021551 631 --1458 11236
NM_001042390chr1021551 631 --1458 11236
NM_001042392chr1021551 631 --1458 11236
NM_001042395chr1021551 631 --1458 11236
NM_001042413chr953723 3272 2991 989 219 --22689 474 --
NM_001042425chr631314 433 257 --1574 11066
NM_001042481chr1452657 2273 969 950 653 --22379 731 --
NM_001042494chr1522484 56 13604 23118 3098 12916
NM_001042495chr1522484 56 13604 23118 3098 12916
NM_001042496chr1522484 56 13604 23118 3098 12916
NM_001042497chr1522484 56 13604 23118 3098 12916
NM_001042506chrX1353 --21445 1341 1555
NM_001042555chr1274762 4717 4320 3606 1335 1190 590 --31820 316 130 --
NM_001042599chr276741 6170 2085 2043 1988 1379 840 14844 37500 6109 6093 --
NM_001042604chr374870 3544 3137 1503 1162 821 154 --24857 68 11300
NM_001042683chr621741 22 ----11462
NM_001044385chr243584 3483 3217 1395 23300 481 22832 1477 1685
NM_001083620chr412537 --22528 2109 12227
NM_001099678chr376126 2331 1659 1641 1506 1042 183 56069 4358 4285 2568 1048 21863 1762 12314
NM_001100108chr157959 6549 5993 1931 1159 26786 2670 --12976
NM_001106chr3129308 7372 6349 3888 3463 3327 3110 2930 2330 2274 2165 1382 --13202 19507
NM_001113490chrX53049 2397 2277 841 162 22920 510 --12818
NM_001128chr1663333 3288 1500 1239 810 346 11476 ----
NM_001148chr422158 462 1518 11493 1545
NM_001167chrX76607 5678 5003 2542 2053 1104 447 1676 21381 1342 --
NM_001173chr1453561 2974 876 782 177 11894 186 --
NM_001204chr267640 7593 6315 5790 1856 632 --56288 3112 930 923 416 1914
NM_001310chr12--12759 1406 2363 354
NM_001412chrX53667 1273 731 532 241 23354 1302 13464 --
NM_001420chr1933173 2130 273 --22990 947 12173
NM_001438chr133445 918 735 1880 134 --
NM_001453chr62474 421 ----11280
NM_001530chr14--1784 --21075 993
NM_001621chr752958 1164 950 799 447 ------
NM_001621chr752958 1164 950 799 447 ------
NM_001659chr1262190 1714 949 258 116 86 --1595 12146
NM_001684chr122959 63 --23692 1637 14019
NM_001759chr1244449 4122 3649 1903 24914 4176 45039 3841 688 360 --
NM_001858chr665055 4710 3198 1908 1585 1197 14299 13853 --
NM_001859chr923396 1575 --13501 1313
NM_001918chr177523 7372 7100 5857 5632 3261 2755 23590 1012 36851 1334 597 --
NM_001955chr62992 735 ----11029
NM_001977chr411231 11380 --11651
NM_001995chr451094 952 573 201 189 --21459 69 --
NM_002025chrX148908 8334 8197 8070 6311 6187 5624 3435 2553 1833 1672 1510 1235 996 --39065 7691 6218 23228 1553
NM_002033chr1154085 3015 2721 1108 125 --1982 13212
NM_002040chr2132660 2097 683 --22716 2561 --
NM_002111chr4103519 3001 2595 2419 1510 1083 611 463 262 153 1619 --12830
NM_002182chr352730 2513 2454 1727 228 ----1642
NM_002223chr121173 1732 --11504
NM_002270chr545694 5422 2119 970 --11672 --
NM_002310chr5106201 5094 4772 4473 4209 1570 1191 903 684 363 21381 257 34718 4113 152 --
NM_002313chr1074747 4232 1340 1155 928 884 463 --1212 --
NM_002356chr672665 2213 2090 1813 1079 686 359 1534 ----
NM_002387chr534699 1863 434 24464 76 14647 24286 4081
NM_002397chr562089 2038 1461 876 309 100 --11793 --
NM_002399chr1531304 316 247 --21227 1213 1532
NM_002480chr1231253 1220 926 1591 3532 515 233 --
NM_002545chr1134578 3735 3542 14718 34948 4673 492 --
NM_002613chr1664426 4193 3517 2107 285 241 14712 35170 918 254 11993
NM_002655chr844472 4260 4100 1346 15019 24619 3975 --
NM_002709chr253120 2981 2698 2225 1126 ----1258
NM_002734chr1732238 214 44 11896 --11874
NM_002740chr352389 2230 2008 207 33 12757 ----
NM_002837chr1263242 3197 834 367 273 70 2658 109 14250 --
NM_002839chr932325 991 50 12833 11436 1929
NM_002941chr311309 --21548 1084 11575
NM_002955chr63664 560 60 ----1487
NM_002977chr283375 3303 2809 2303 2295 1284 1081 80 43220 1104 348 284 --12456
NM_002994chr431931 635 181 ----1590
NM_003010chr176644 607 402 250 137 106 --11877 --
NM_003034chr1277723 7079 6866 3069 2655 1759 88 --22515 55 15600
NM_003048chr241947 935 925 135 12084 1834 189
NM_003108chr234746 1616 678 17128 15774 25942 5407
NM_003112chr732423 2356 293 32813 2449 1088 ----
NM_003220chr631314 433 257 --1574 11066
NM_003242chr372443 2146 857 820 308 186 26 12372 1543 --
NM_003253chr2141902 1294 576 450 1146 41836 600 532 478 1495
NM_003262chr345073 4608 3241 1505 23345 821 25218 54 35053 3819 916
NM_003330chr1261667 463 386 271 247 53 1516 --11793
NM_003342chr1723204 2402 --13251 21057 303
NM_003372chrX2949 789 ----1906
NM_003392chr363967 3472 2972 2958 2867 435 --21217 1053 --
NM_003406chr82143 64 31533 777 484 1320 1743
NM_003453chr131628 2293 141 --1178
NM_003468chr273246 3069 2942 1592 1096 520 93 13753 13737 --
NM_003483chr1242936 2837 2434 1088 ----11982
NM_003489chr2123195 1155 --13370 12862
NM_003566chr1232832 519 237 13293 11205 11015
NM_003583chr1283835 2837 2496 763 421 408 342 298 --1357 --
NM_003617chr134953 1579 1269 33259 1364 855 23049 570 14015
NM_003626chr115881 553 465 293 166 ----1260
NM_003644chr1786319 5992 5423 5371 4940 4320 1780 1385 14728 26306 2481 --
NM_003663chr343148 1126 528 101 1327 1780 --
NM_003714chr542438 1907 1900 56 --21101 616 12281
NM_003716chr32246 142 2892 323 1196 2957 316
NM_003743chr231707 1530 453 ----12135
NM_003759chr483976 3822 3576 2852 2793 1168 1133 1082 ------
NM_003822chr163123 3050 2187 1031 706 427 --22977 2615 --
NM_003873chr1032396 1807 192 --42338 965 739 378 --
NM_003895chr2131447 1391 154 --11747 11986
NM_003916chrX31128 959 135 11074 272 66 11432
NM_003948chr43618 394 95 12473 --1785
NM_003966chr5107253 6167 5989 5140 2887 1578 882 756 357 70 11092 46097 2235 1839 1698 --
NM_004133chr852695 2650 1738 919 868 1176 ----
NM_004171chr1159062 8570 8413 3831 3555 --66614 6006 3115 2771 422 110 17101
NM_004232chr181403 --1348 11071
NM_004261chr12363 156 --1790 1827
NM_004272chr511430 21721 1697 --2694 237
NM_004274chr1431980 1034 607 12769 1909 1433
NM_004293chr963428 2752 2471 847 753 209 ----1745
NM_004338chr18106164 6008 5121 4858 4813 4778 2340 1789 1729 1306 --15823 15181
NM_004392chr1342579 2401 2336 2220 --21884 26 12437
NM_004412chr1095942 5067 4955 3976 2367 1362 967 807 579 --35698 4356 155 11844
NM_004434chr1431449 1248 299 11352 1182 11785
NM_004459chr1741995 625 556 323 1573 ----
NM_004464chr474228 3130 1485 1091 997 954 712 --24176 4072 --
NM_004501chr143083 2975 952 831 11489 --1423
NM_004505chr1721771 662 --12016 11275
NM_004586chrX45386 4507 3840 1954 23918 1818 21023 341 --
NM_004612chr943760 899 561 181 --33250 1891 703 --
NM_004670chr101315 11526 --21692 256
NM_004685chr1311201 --11090 12777
NM_004725chr1041248 1095 443 28 ----11354
NM_004726chrX45767 5527 2028 1603 --34948 3963 1789 1740
NM_004738chr2092228 2121 2052 1976 1835 1802 855 739 76 --1470 1670
NM_004741chr1021522 1403 1551 --21490 1060
NM_004744chr453637 3542 3120 2802 2680 33704 3058 1194 --1516
NM_004745chr885487 4573 2659 2513 2319 1814 1394 1235 11504 12584 --
NM_004748chr1533986 3915 1562 --14086 1429
NM_004776chr2073298 2996 2860 2833 2768 2720 2266 1631 12583 --
NM_004808chr1062856 2280 1334 1241 1214 319 1347 --1422
NM_004815chr153977 3928 3840 3080 1554 --21427 1279 --
NM_004841chr111106 1235 11049 1207
NM_004842chr631778 138 23 --1473 1537
NM_004863chr1474982 4034 3980 3667 1810 1506 1052 --24597 3250 --
NM_004896chr1041478 1406 1372 588 --2972 310 31430 1363 182
NM_004902chr201577 ----1239
NM_004904chr735354 1885 438 --12459 11055
NM_004947chr35875 453 299 237 160 1171 12399 --
NM_004956chr784499 3707 3111 2801 1141 378 324 153 1942 ----
NM_004985chr1243092 1711 490 113 11638 24179 1589 13062
NM_004992chrX87895 7195 6109 5951 2358 2168 1675 348 16937 21972 997 --
NM_004992chrX87895 7195 6109 5951 2358 2168 1675 348 16937 21972 997 --
NM_005044chrX64304 4139 3201 1776 1694 170 ----12820
NM_005068chr6--1411 11328 1271
NM_005116chr2094144 3426 3414 3302 3248 1746 1554 1351 859 --1954 --
NM_005121chr1763854 3493 3107 3080 2636 310 ------
NM_005126chr342096 2004 1955 1663 1622 1466 --
NM_005135chr1522484 56 13604 23118 3098 12916
NM_005160chr2246043 4466 1408 1221 14781 45479 4819 1028 401 --
NM_005164chr1252571 2301 2043 2020 267 22254 290 ----
NM_005180chr1031226 480 59 --11418 1473
NM_005188chr11148323 6900 6736 6705 6372 6241 5643 2917 2451 2390 2244 923 566 366 --35591 2538 1647 --
NM_005197chr1485618 5473 5186 4871 3758 2023 1641 676 --35685 4365 1957 15999
NM_005235chr276741 6170 2085 2043 1988 1379 840 14844 37500 6109 6093 --
NM_005359chr1845836 1488 470 415 11080 35393 2412 972 --
NM_005436chr1053971 3657 3380 642 378 --21401 604 1232
NM_005497chr1766101 5994 4894 1818 1322 638 24687 3791 25028 1243 --
NM_005502chr962846 2512 2225 258 203 63 12854 13258 --
NM_005517chr121224 124 --11424 1916
NM_005578chr343597 3304 909 295 2466 194 15040 --
NM_005596chr975094 4888 4458 4029 1043 777 396 11868 44179 1788 1410 1217 36127 4601 796
NM_005613chr172158 786 752 241 132 119 42 1700 1453 --
NM_005665chr184598 4543 3427 3183 1303 923 846 695 --21278 993 --
NM_005668chr543739 1174 857 131 11046 44220 3757 1081 998 13535
NM_005725chr131737 968 700 --1210 12031
NM_005748chr1242778 2556 98 83 11116 --12104
NM_005759chr254537 4504 4056 3354 3105 14780 1616 --
NM_005795chr242320 2100 1923 585 1982 1173 --
NM_005808chr373357 2919 2702 2643 664 657 104 12575 ----
NM_005828chr1764937 4482 3552 1836 1416 886 --3398 392 381 24640 4367
NM_005895chr12124090 3673 3522 3430 3391 3057 2767 1470 877 747 645 22 12564 23511 2624 --
NM_005898chr1132565 2146 2041 ----12204
NM_005900chr431103 444 427 ----1864
NM_005901chr1898730 8384 8089 7889 7648 5339 3268 1877 1398 --12200 11712
NM_005903chr554517 3742 1750 786 642 11120 33449 184 178 --
NM_005907chr651417 1368 596 398 259 --1453 --
NM_005935chr484906 4722 4187 4166 4101 1816 1361 1009 --24636 1908 15042
NM_005941chr853571 3437 895 738 190 11008 11609 13659
NM_006007chr954412 4193 3846 2788 286 24338 1485 21770 864 --
NM_006055chr242857 2762 2705 1140 12623 13184 1842
NM_006080chr772504 2384 1139 1082 467 159 91 1734 ----
NM_006089chrX41887 1530 643 432 --21430 527 --
NM_006095chr434429 4096 94 1809 --1148
NM_006166chr1272623 2583 2561 1796 376 337 179 11788 ----
NM_006203chr585457 4977 4226 1974 1220 1196 1015 640 --31317 949 185 --
NM_006206chr421167 1118 11043 22908 653 1442
NM_006251chr533107 1048 693 ----13306
NM_006287chr272486 2042 1891 1050 893 609 118 1341 22000 964 --
NM_006298chr633144 2963 2847 --11217 1639
NM_006393chr1074282 3963 3235 1354 663 649 246 23919 778 12965 --
NM_006403chr621339 1265 1273 21637 280 --
NM_006420chr20--23405 2707 --13419
NM_006421chr82436 204 ----21170 967
NM_006482chr1283835 2837 2496 763 421 408 342 298 --1357 --
NM_006504chr1062698 2556 2361 2088 356 60 --32583 1966 512 --
NM_006546chr1775129 4698 1881 1238 1033 980 707 26136 794 1780 --
NM_006561chr1076016 1813 1399 1326 704 266 55 23856 1381 45965 5622 4047 929 --
NM_006599chr1675332 2480 2445 1749 921 363 64 16123 48177 7509 6645 1494 16438
NM_006614chr363162 2413 2310 885 853 195 13632 --23697 3360
NM_006628chr1553633 3273 1502 1149 953 ----11055
NM_006654chr1274762 4717 4320 3606 1335 1190 590 --31820 316 130 --
NM_006720chr1074747 4232 1340 1155 928 884 463 --1212 --
NM_006827chr1451087 672 518 410 332 12819 23027 700 11188
NM_006832chr1461048 932 698 406 364 179 ------
NM_006852chr1742732 2317 2052 923 ----1302
NM_006885chr1653734 2915 2601 1536 171 --12701 --
NM_006914chr931104 588 68 --1409 11082
NM_006918chr1154702 3603 1836 1641 357 25529 548 --14297
NM_006922chr24910 423 389 91 12427 1892 --
NM_006947chr44692 574 466 347 --1603 --
NM_007006chr1642476 1396 1373 1322 13359 22702 2241 12341
NM_007007chr1284629 4543 1914 1187 1170 1136 112 46 11162 14186 --
NM_007038chr2156058 4698 4107 2311 982 --12232 --
NM_007050chr20127781 7065 6621 6480 5576 5477 5061 3078 2474 2273 1983 1508 27546 7275 18115 26756 5769
NM_007124chr651791 1687 557 227 94 ----1545
NM_007146chr1722441 1853 ----22824 1839
NM_007203chr963329 2640 2632 2472 1586 1310 13675 32821 2503 638 --
NM_007249chr13108510 7897 7464 7314 6550 6352 6165 3205 2900 256 --58664 8354 8186 8180 7485 --
NM_012096chr373757 3117 1011 920 368 77 49 1208 11316 --
NM_012164chr976564 5620 4906 2405 918 669 630 1894 45968 5960 1999 139 --
NM_012214chr286419 5090 3999 3987 2304 2189 1126 914 14580 26386 1849 --
NM_012234chr383683 3536 2466 2433 1121 970 602 526 1452 1658 22360 308
NM_012249chr21283 33199 2765 2363 23540 1238 --
NM_012252chr784363 2094 1821 1298 825 674 122 43 --14216 --
NM_012262chr143992 1603 778 476 11395 11553 --
NM_012281chr742250 2055 1951 607 --22090 601 --
NM_012288chr634356 3671 493 --15408 25610 4239
NM_012301chr71564 ----22103 1889
NM_012309chr1174795 4653 4529 4108 625 189 109 --13293 --
NM_012316chr145227 4307 2137 1985 21121 1048 25475 3544 14117
NM_013231chr1474341 3462 1576 1092 951 711 694 ------
NM_013257chr82500 469 --1151 12037
NM_013261chr453533 3380 3141 437 247 23499 893 ----
NM_013448chr14147 --1269 1734
NM_013943chr142970 2432 2418 1244 1669 131 --
NM_013989chr1495106 4640 4291 4081 3851 3611 1944 475 227 2985 546 11097 --
NM_014016chr32546 133 --11506 11697
NM_014021chr173405 2892 2851 2483 1149 684 568 23273 2359 ----
NM_014048chr1655148 4313 4256 3652 1701 ----34866 4795 3220
NM_014106chr1552764 1203 1009 896 281 ----12341
NM_014154chr321494 542 ----11027
NM_014155chr1157236 4615 1906 1702 836 --15077 --
NM_014309chr2265362 1755 874 293 157 34 23917 846 45342 4208 1475 280 --
NM_014331chr447405 6903 288 217 --26214 5943 1185
NM_014363chr13--11246 11029 1311
NM_014388chr185840 5631 4595 2410 2359 2114 158 55 --1674 --
NM_014398chr341768 1753 708 143 --11163 1459
NM_014423chr564682 1451 1410 1398 245 162 24488 4378 44634 4167 798 129 14393
NM_014445chr31156 --21833 134 1472
NM_014494chr1642264 1951 894 273 11724 1603 --
NM_014670chr261548 187 149 122 63 56 ----11237
NM_014686chr1942299 2161 2068 1947 --1782 22341 481
NM_014711chr1611316 21608 502 127 1616
NM_014721chr676345 2971 2617 2035 1716 1348 654 26936 4736 ----
NM_014897chr1762840 2371 2323 668 479 44 --1927 --
NM_014904chr1053093 2940 2904 1460 1256 --21423 1394 23373 492
NM_014912chr1033107 2315 539 --1617 12451
NM_014924chr1463127 2863 2213 2062 931 572 13048 --12778
NM_014936chr632247 983 727 ----12528
NM_014942chr642676 2489 993 568 --11652 1768
NM_014982chr1495226 5031 4976 2168 2122 882 731 382 107 ------
NM_014989chr6171 --12090 12056
NM_014990chr142475 133 --2941 250 11278
NM_014991chr432164 2156 1101 1417 --32692 2674 2527
NM_014997chr742917 2795 2148 864 1905 22825 345 --
NM_015025chr22471 425 22296 237 12137 1212
NM_015026chr1263971 3916 3897 1089 740 685 11742 ----
NM_015032chr131706 1233 --12409
NM_015044chr1692985 2609 2512 2417 1104 844 745 652 295 1991 --1370
NM_015071chr596386 6055 5836 4782 1877 1074 999 167 44 --25579 1237 --
NM_015074chr124140 981 --24810 4528 13624
NM_015076chr684410 4008 3798 3773 3637 3592 1338 420 --11146 1775
NM_015092chr1624136 1362 2871 582 34239 3160 1160 --
NM_015192chr2052962 2650 284 185 151 22615 1032 1178 11008
NM_015225chr982941 2843 2295 2133 1270 1104 834 40 12487 1707 1931
NM_015251chr1632099 838 499 --2257 21 1610
NM_015264chr2263816 3381 1857 1660 1632 1153 --54881 3953 1769 1618 355 --
NM_015265chr242106 1647 659 271 --11856 12602
NM_015271chr493807 3485 3148 2822 2708 1603 841 827 29 33973 1687 1122 14294 --
NM_015278chr683092 2933 2360 2330 1201 1007 970 846 23419 1071 1779 13452
NM_015310chr853300 2376 2071 1732 73 35939 2930 1921 22282 545 12153
NM_015329chr1932557 2015 1899 ----11919
NM_015436chr452425 800 304 89 76 11061 1566 --
NM_015455chr554094 1613 1214 739 286 --32560 2542 561 13515
NM_015484chr12804 109 --1967 2272 170
NM_015532chr1521805 767 --21008 168 1876
NM_015553chr654217 3645 1551 1011 999 --1544 13870
NM_015564chr51838 23343 403 --1516
NM_015569chr154125 3689 3097 1574 644 14553 --13289
NM_015571chr651935 1059 755 398 378 ----12077
NM_015576chr352938 2791 945 404 224 22094 822 --12114
NM_015691chrX102533 2518 945 804 791 563 491 432 251 50 1531 12633 --
NM_015879chr18127477 6993 6556 6164 5733 3331 2359 1915 1054 802 782 635 --37770 5969 273 --
NM_015886chr865098 4911 4551 4128 3560 2024 11490 ----
NM_015906chr134713 4046 774 23615 3215 23557 889 13386
NM_016009chr154524 3270 3084 513 194 11274 33814 1055 88 14290
NM_016061chr231653 277 239 1290 --1671
NM_016076chr153196 3078 2781 1012 402 --1347 --
NM_016078chr172773 444 1277 182 1918
NM_016083chr633931 1563 989 --13207 13526
NM_016152chr351278 963 900 484 221 1938 11252 --
NM_016205chr41534 1290 1418 1502
NM_016206chr379000 7585 7303 5719 3195 1002 690 28673 1533 25871 388 27953 7721
NM_016260chr266460 6170 5856 5654 2562 2341 25846 2388 21523 555 --
NM_016315chr2----291 29 11866
NM_016356chr652648 1922 1138 983 497 ----12741
NM_016377chr631778 138 23 --1473 1537
NM_016396chr1511162 ----22842 666
NM_016451chr112106 83 ----1231
NM_016507chr1722736 1011 ----13138
NM_016530chr1574071 4017 3861 3600 3277 1415 750 ------
NM_016531chr484189 3958 3790 3679 2684 1163 954 887 ----1332
NM_016544chr253352 2858 2722 2519 2497 --1115 11475
NM_016577chr384470 3782 3352 1818 1141 858 599 286 --11078 --
NM_016946chr183415 3305 2918 2876 2486 2291 178 160 --11126 --
NM_017415chr584552 4176 3959 3799 3687 3118 3067 630 --1342 --
NM_017420chr1462925 2774 1372 1215 415 51 23060 2674 1982 --
NM_017447chr2143928 1373 1299 503 23322 1140 22917 759 --
NM_017563chr375232 4802 2380 1954 1850 777 748 --1468 14720
NM_017637chr9108740 8287 8041 7970 7306 3655 3546 3491 2371 2243 --48631 7278 2048 2025 --
NM_017641chr121879 1939 --1377
NM_017644chr333272 2076 2066 14758 22048 272 --
NM_017658chr1434002 1119 724 11799 12957 --
NM_017742chr1821518 114 ----11212
NM_017754chr663883 1606 1346 459 332 246 11057 23201 423 --
NM_017769chr1453001 1292 898 773 762 12929 12118 --
NM_017813chr855854 5262 3851 3728 531 --45158 4953 2141 1325 11300
NM_017919chr965606 5295 5265 5077 4968 174 23693 793 11563 --
NM_017938chrX22161 1828 ----11843
NM_017987chr1021525 1509 21915 220 --11993
NM_018027chr1082867 2305 2205 2054 1286 1015 690 544 1821 ----
NM_018046chr5199 1599 --1361
NM_018098chr331132 835 366 11139 --1193
NM_018112chr94954 762 683 198 ----177
NM_018126chr411205 21545 305 --1558
NM_018184chr351332 819 487 245 133 11942 ----
NM_018195chr1171930 1851 1512 1325 865 789 559 21872 390 ----
NM_018227chr473182 2621 2598 2577 2211 718 419 12409 12905 --
NM_018243chr464044 3466 1616 930 431 67 1757 ----
NM_018247chr642601 2500 2467 623 11003 2488 294 1532
NM_018364chr143302 2789 940 690 ----13788
NM_018374chr723619 2082 14640 11830 15135
NM_018429chr552857 2785 2576 2200 950 22810 469 12592 --
NM_018440chr8168417 8177 7653 7429 7393 7375 7276 7191 6995 5301 2422 2324 2240 1977 1921 812 ----17232
NM_018482chr84709 456 259 38 ----159
NM_018566chr113184 14588 13473 1838
NM_018638chr1265532 4993 4582 4071 4007 276 11420 55392 5061 1037 1019 992 25500 659
NM_018662chr133364 2676 38 14236 2252 144 11761
NM_018834chr521013 415 --1146 1873
NM_018948chr12896 546 --1128 11186
NM_018976chr1232629 2284 1784 --11128 12375
NM_018999chr1044682 1599 1225 986 ----23181 1279
NM_019001chr374870 3544 3137 1503 1162 821 154 --24857 68 11300
NM_019045chrX2901 678 ----1651
NM_019050chr41583 32018 806 441 12251 12113
NM_019072chr533226 1691 237 --13388 11032
NM_019114chr942574 2343 2112 122 --1743 1211
NM_019600chr152532 185 ----1167
NM_019859chr102390 310 21203 596 1476 11063
NM_019860chr103438 358 43 21251 644 1524 11111
NM_020116chr421792 1200 ----11751
NM_020122chr2105867 5761 5683 5002 4694 4543 4125 3840 1366 1139 12158 21527 766 11449
NM_020152chr213683 677 602 ----1962
NM_020310chr1732729 2086 424 ----12771
NM_020336chr2073397 3267 2916 2519 1251 1080 444 13363 11555 --
NM_020338chr1053737 2990 2861 2721 1056 13206 13646 22869 2855
NM_020440chr162790 2675 2319 1173 1163 1066 ------
NM_020443chr176892 6376 5431 4752 2435 2210 1048 --26591 1384 --
NM_020673chr20147793 7626 6551 6165 5235 4962 2928 2284 2090 1989 1856 1797 646 113 ------
NM_020699chr145424 4668 4632 3653 ----13503
NM_020718chr1655288 2383 1246 1013 637 15038 11827 15011
NM_020727chr2163937 3559 1271 775 409 289 21301 556 --22588 2530
NM_020739chr1533986 3915 1562 --14086 1429
NM_020748chr1721628 1378 ----12074
NM_020749chr861760 1637 817 776 732 446 11702 11717 12005
NM_020766chrX43567 842 611 224 1780 21155 310 --
NM_020772chr1788556 7150 5604 1655 1126 1053 776 54 26487 2031 11073 36076 5382 1450
NM_020774chr1856229 2180 1868 1823 830 --36007 2206 1631 21706 222
NM_020805chr1831432 743 177 1526 2376 272 --
NM_020859chr483905 3452 3292 3081 3036 1176 1074 508 11446 1797 12553
NM_020917chr1963336 2590 1176 1158 567 74 23429 2755 ----
NM_020918chr1032982 624 152 11302 --12741
NM_020921chr1453310 3199 2905 1405 974 1839 23520 339 --
NM_020935chr243286 3017 655 166 --24030 557 --
NM_020940chr1032692 1934 674 12479 1692 --
NM_020977chr422158 462 1518 11493 1545
NM_021083chrX72970 2706 1460 1328 1032 639 234 ------
NM_021097chr282530 2457 2215 995 946 563 189 91 --33080 2816 1047 --
NM_021116chr798727 6760 5730 2692 2101 2085 1663 1138 273 13458 15630 13471
NM_021222chr121373 1141 21117 900 --21260 393
NM_021229chr123225 184 162 --1488 139
NM_021255chr1443412 3298 2597 850 13975 14038 --
NM_021647chr434724 1437 615 13565 23477 238 13104
NM_021648chr652729 2565 1887 254 199 1439 1658 --
NM_021905chr631793 1635 435 --41950 1818 1669 156 32033 1853 1829
NM_021911chr585067 5041 4342 3849 2108 1859 1159 461 --25454 259 --
NM_021954chr1353217 2464 1428 1127 977 13611 1162 22416 536
NM_022041chr1652586 1975 1863 680 350 21851 298 ----
NM_022080chr2062825 2773 2581 2343 294 212 --1831 1637
NM_022154chr42367 259 1309 --11265
NM_022456chr1277480 6529 6383 6371 5511 2251 162 --34916 1216 661 --
NM_022474chr1442603 2076 1910 449 12484 21994 352 --
NM_022726chr611373 --1123 21325 312
NM_022763chr373055 2763 2679 2556 2223 909 417 --12915 --
NM_023016chr262751 2668 2483 1085 1003 994 --12695 --
NM_024345chr9105861 5560 4994 4792 4623 4118 4017 638 196 129 --14347 --
NM_024638chr392289 2231 2131 2108 2096 1943 1576 1552 902 ------
NM_024646chr154023 3696 607 149 97 --21506 1035 --
NM_024665chr384557 4504 4142 2866 1529 1418 1136 704 172 --13021
NM_024674chr162402 2283 1971 1216 569 389 1108 12960 12819
NM_024740chr1134044 3128 1515 --22696 755 12595
NM_024744chr222655 946 ----12517
NM_024921chrX31540 1437 420 21889 213 ----
NM_024947chr378487 8250 7837 7499 6093 1922 1630 --39524 3319 1952 39270 6789 3462
NM_024989chr287739 5473 2532 2376 2120 1884 563 228 11352 --27255 204
NM_025134chr1652542 834 762 755 675 ----1926
NM_025146chr352494 2447 2303 1792 186 ------
NM_025160chr153274 1332 580 518 220 --23427 2765 --
NM_025208chr1132478 623 598 --2276 270 --
NM_025235chr1051991 1925 1577 896 571 11859 21906 793 --
NM_030621chr1453597 3424 3324 1410 682 --22586 422 12884
NM_030625chr1052243 995 452 358 75 1770 1352 --
NM_030647chr795589 4568 4129 2316 2055 1695 1450 974 799 11890 34449 2434 623 --
NM_030648chr475398 5168 4495 4103 3784 1219 50 --15214 15109
NM_030674chr1295445 4921 3677 1938 1706 1556 1506 1345 989 --42235 960 288 176 --
NM_030751chr102236 71 ----11827
NM_030751chr102236 71 ----11827
NM_030791chr1421849 583 --1575 1237
NM_030918chr163722 2027 1784 1321 151 22 --3981 871 194 --
NM_030920chr131963 613 576 --11425 173
NM_031268chr1664426 4193 3517 2107 285 241 14712 35170 918 254 11993
NM_031427chr1485852 5021 4242 2349 2335 2286 2064 754 11161 15504 13689
NM_031442chrX43174 3076 2988 2593 --23205 1013 --
NM_031445chr253282 3207 3080 515 256 1739 22635 1207 --
NM_031844chr143083 2975 952 831 11489 --1423
NM_032025chr341973 618 421 202 21732 305 ----
NM_032102chr1133042 1167 68 --2520 178 --
NM_032121chrX72422 2292 2210 2027 944 630 519 12497 11879 --
NM_032208chr263205 2859 2708 852 725 675 --12778 --
NM_032281chr1933173 2130 273 --22990 947 12173
NM_032373chr1085903 5813 5148 3802 3671 1860 1054 814 11614 1159 2843 623
NM_032435chr161913 1725 951 173 111 81 1935 ----
NM_032440chr1022961 2382 --42715 2480 1097 185 --
NM_032446chr542972 2763 747 423 --21157 87 --
NM_032458chrX63339 2494 2454 1207 1127 337 --1999 --
NM_032505chr322515 807 22654 602 1741 11910
NM_032727chr102655 350 --21486 1402 1535
NM_032832chr63603 488 201 ----11716
NM_032873chr1184450 3487 2900 1511 1462 1151 884 810 11783 13594 --
NM_032968chrX53848 3482 583 332 307 1105 ----
NM_032969chrX53848 3482 583 332 307 1105 ----
NM_032973chrY53840 3478 583 332 307 1105 ----
NM_032983chr743210 2442 2205 308 13007 33160 187 180 --
NM_033017chr761660 1643 1486 1149 651 376 --41708 1591 1550 84 --
NM_033020chr134713 4046 774 23615 3215 23557 889 13386
NM_033119chr162583 160 --1290 1916
NM_033135chr1132478 623 598 --2276 270 --
NM_033143chr484559 3461 2855 1816 1422 1328 1285 1043 --24507 4403 --
NM_033181chr633931 1563 989 --13207 13526
NM_033224chr776981 6793 5873 5831 2925 2796 496 32840 2714 2366 --11840
NM_033360chr1243213 1832 611 234 11759 24300 1710 13183
NM_033393chr452955 2755 2322 933 408 ----12857
NM_033425chr1173429 3419 2580 2209 868 595 232 12260 --1704
NM_033505chr296466 5718 4797 2425 1665 1175 870 291 203 --26157 4760 --
NM_052864chr421963 543 --11384 22099 752
NM_052885chr1254350 4268 4159 3711 881 13910 14333 1506
NM_052918chr1022595 77 33446 1370 190 1978 11251
NM_053016chr997118 6690 5940 2759 2710 889 698 580 395 ------
NM_053043chr766029 5610 4746 2168 2005 316 --35396 4862 1291 --
NM_053064chr142788 298 1424 12721 12204
NM_058191chr214874 798 727 192 ----1279
NM_080546chr941938 1758 1419 534 163 --11676
NM_080759chr1342579 2401 2336 2220 --21884 26 12437
NM_080760chr1342579 2401 2336 2220 --21884 26 12437
NM_130391chr932325 991 50 12833 11436 1929
NM_130392chr932325 991 50 12833 11436 1929
NM_130393chr932325 991 50 12833 11436 1929
NM_130435chr1062698 2556 2361 2088 356 60 --32583 1966 512 --
NM_130438chr214785 768 250 223 12637 12554 158
NM_133170chr20127781 7065 6621 6480 5576 5477 5061 3078 2474 2273 1983 1508 27546 7275 18115 26756 5769
NM_133264chr1763746 3030 2929 1482 1250 161 12739 1276 --
NM_133265chrX53049 2397 2277 841 162 22920 510 --12818
NM_133334chr496266 5946 4952 4479 2409 2118 1776 983 713 ------
NM_133370chr433544 2934 622 13570 23395 2904 12859
NM_133468chr732592 772 741 11769 1707 1920
NM_133496chr164342 1336 972 874 540 147 1657 1329 --
NM_133631chr311309 --21548 1084 11575
NM_133647chr1522484 56 13604 23118 3098 12916
NM_138270chrX33055 1108 1083 --12861 11306
NM_138292chr1132447 1069 761 --11295 1716
NM_138316chr1041293 860 432 422 11204 ----
NM_138328chr17103074 2761 2480 1315 1006 995 892 794 458 306 --13212 --
NM_138333chr91396 12305 21685 159 12547
NM_138426chr73764 35 29 22305 2179 ----
NM_138444chr1384276 3022 1962 1917 1742 1455 390 267 23726 1702 ----
NM_138468chr275995 5804 4925 4877 4373 3834 209 14053 31800 1693 233 16287
NM_138554chr942552 2172 2069 121 32436 2392 1799 12384 --
NM_138633chr631778 138 23 --1473 1537
NM_138713chr1675332 2480 2445 1749 921 363 64 16123 48177 7509 6645 1494 16438
NM_138714chr1675332 2480 2445 1749 921 363 64 16123 48177 7509 6645 1494 16438
NM_139168chr541989 676 260 238 11798 11716 --
NM_139246chr952187 1878 819 787 305 ----1630
NM_144571chr456886 6121 4373 1434 888 16520 12627 --
NM_144578chr1474912 4658 4579 3440 1129 238 105 --14932 --
NM_144599chr1595136 4822 4680 3873 3603 1721 1318 1125 274 45469 4426 1714 1084 34006 3852 1657 --
NM_144632chr232164 1530 275 1534 22263 1821 --
NM_144664chr1142205 2158 1008 752 ----11778
NM_144778chr1342716 2077 663 472 11048 11675 --
NM_144973chr1225342 4473 15115 34593 2123 207 --
NM_145055chr1822630 1321 22878 1261 --13261
NM_145246chr1041217 896 60 43 11167 1830 --
NM_145259chr266042 5958 4808 2222 2195 561 26282 805 2442 197 --
NM_145305chrX11283 11003 --11242
NM_145690chr82143 64 31533 777 484 1320 1743
NM_145808chr742823 2368 2096 2081 --1653 13089
NM_147150chr963329 2640 2632 2472 1586 1310 13675 32821 2503 638 --
NM_147223chr231890 1713 636 ----12318
NM_147233chr231707 1530 453 ----12135
NM_148977chr1041293 860 432 422 11204 ----
NM_148978chr1041293 860 432 422 11204 ----
NM_152330chr1452657 2273 969 950 653 --22379 731 --
NM_152352chr1852253 2246 2064 980 895 12524 12120 --
NM_152387chr231007 915 217 ----1859
NM_152388chr243584 3483 3217 1395 23300 481 22832 1477 1685
NM_152409chr563518 2761 2648 1423 273 266 ------
NM_152424chrX114469 3999 3911 3851 3826 3497 3405 1808 1670 1440 175 --11452 --
NM_152519chr231739 1564 1533 3479 305 27 --11498
NM_152529chr264202 3991 3700 1665 1580 887 34384 2965 759 ----
NM_152622chr563212 2856 2721 2596 737 588 12380 --12447
NM_152629chr953723 3272 2991 989 219 --22689 474 --
NM_152641chr1272908 2583 2090 1977 949 758 647 12914 --12690
NM_152737chr682055 1788 1331 650 357 346 220 105 --1696 11981
NM_152774chr752528 2024 881 689 41 ------
NM_152787chrX43828 3405 1341 999 --23749 3397 --
NM_152793chr764850 4398 4382 2027 1756 222 25176 3278 14529 13469
NM_152999chr754928 3766 3703 3134 176 ------
NM_153188chr545694 5422 2119 970 --11672 --
NM_153207chr1253697 2812 2773 2590 229 11290 12858 13174
NM_153262chr132305 1094 140 ----22555 1204
NM_153362chr62809 677 ----2848 769
NM_153634chr1221040 349 11479 --11549
NM_153686chr452415 1627 958 825 656 ------
NM_170674chr1531304 316 247 --21227 1213 1532
NM_170675chr152980 364 --2903 889 1208
NM_170676chr152980 364 --2903 889 1208
NM_170677chr1531304 316 247 --21227 1213 1532
NM_170692chr111106 1235 11049 1207
NM_170709chr82500 469 --1151 12037
NM_170710chr453122 2858 2429 930 52 ------
NM_172071chr177340 6237 2811 1639 1232 1167 955 ----12747
NM_172315chr1531304 316 247 --21227 1213 1532
NM_172316chr1531304 316 247 --21227 1213 1532
NM_173082chr621478 622 ----11199
NM_173214chr1675332 2480 2445 1749 921 363 64 16123 48177 7509 6645 1494 16438
NM_173500chr15------2487 80
NM_173576chr10----21970 1930 11509
NM_173582chr1134987 3971 2412 25995 4696 --26035 5876
NM_173602chr1253656 3563 3419 825 780 1983 1738 11355
NM_173632chr1953118 2559 1231 696 565 --22096 468 --
NM_175623chr1277480 6529 6383 6371 5511 2251 162 --34916 1216 661 --
NM_175624chr1277575 6624 6478 6466 5606 2346 257 --35011 1311 756 --
NM_175625chr1277575 6624 6478 6466 5606 2346 257 --35011 1311 756 --
NM_175736chr1267318 5591 5267 2777 1154 112 27788 7677 17505 --
NM_175876chr11514 1440 11762 12732
NM_176081chr1095942 5067 4955 3976 2367 1362 967 807 579 --35698 4356 155 11844
NM_176083chr1095942 5067 4955 3976 2367 1362 967 807 579 --35698 4356 155 11844
NM_177438chr1453597 3424 3324 1410 682 --22586 422 12884
NM_177925chr1232312 633 52 ----12964
NM_178151chrX57727 6367 5120 4843 271 15880 25564 966 --
NM_178152chrX57727 6367 5120 4843 271 15880 25564 966 --
NM_178153chrX57727 6367 5120 4843 271 15880 25564 966 --
NM_178313chr231344 826 491 --21998 143 11417
NM_178454chr12664 553 --1540 1773
NM_178585chr432164 2156 1101 1417 --32692 2674 2527
NM_178812chr811602 11214 11032 11053
NM_178815chr1042556 2281 2227 225 ----22619 2298
NM_180989chr1352414 1719 1628 955 773 --21001 252 --
NM_181054chr14--1930 --21221 1139
NM_181265chr453122 2858 2429 930 52 ------
NM_181457chr231240 935 365 1978 --11334
NM_181458chr231373 1068 498 11111 --11467
NM_181459chr231139 834 264 1877 --11233
NM_181460chr231186 881 311 1924 --11280
NM_181481chr18106164 6008 5121 4858 4813 4778 2340 1789 1729 1306 --15823 15181
NM_181482chr18106164 6008 5121 4858 4813 4778 2340 1789 1729 1306 --15823 15181
NM_181483chr18106164 6008 5121 4858 4813 4778 2340 1789 1729 1306 --15823 15181
NM_181504chr544151 3009 2965 2833 13482 --1581
NM_181521chr1697167 6831 5835 4560 1937 1661 1040 840 478 12381 24846 86 --
NM_181523chr544151 3009 2965 2833 13482 --1581
NM_181524chr544151 3009 2965 2833 13482 --1581
NM_181705chr555503 4221 3754 1797 362 --35822 4535 146 15707
NM_181706chr1142259 953 822 275 ----11578
NM_181782chr642184 1914 1451 595 ----22230 174
NM_181783chr12152 11778 1789 11826
NM_182485chr433176 1487 1149 --21061 219 12300
NM_182501chr283241 3137 2720 2495 1309 1241 569 340 1388 ----
NM_182641chr1741995 625 556 323 1573 ----
NM_182646chr433176 1487 1149 --21061 219 12300
NM_182648chr14147 --1269 1734
NM_182729chr1261667 463 386 271 247 53 1516 --11793
NM_182742chr1261667 463 386 271 247 53 1516 --11793
NM_182743chr1261667 463 386 271 247 53 1516 --11793
NM_182762chr776262 6125 5621 2213 1529 577 189 --14988 --
NM_182765chr10--1918 175 12128
NM_182898chr735354 1885 438 --12459 11055
NM_182899chr735354 1885 438 --12459 11055
NM_182972chr112714 --22556 1747 1271
NM_183393chr32246 142 2892 323 1196 2957 316
NM_183394chr32246 142 2892 323 1196 2957 316
NM_184234chr201577 ----1239
NM_194071chr795236 4510 3601 3457 1049 860 442 185 99 25077 2181 ----
NM_194283chr563775 3667 3301 2816 1533 275 --13624 14086
NM_194285chr1152534 2410 584 486 448 --22981 2202 --
NM_194301chr141303 --2769 78 11106
NM_197968chr131628 2293 141 --1178
NM_198056chr331860 432 377 ----12211
NM_198484chr3115718 5564 4935 4866 4687 1846 1831 1648 1478 881 457 --12242 --
NM_198900chr1267318 5591 5267 2777 1154 112 27788 7677 17505 --
NM_198903chr5----2120 89 1531
NM_198904chr51377 11750 2120 89 32085 1588 531
NM_199000chr731936 1416 271 ----11466
NM_199168chr1041497 1147 319 222 1997 --1617
NM_199189chr521013 415 --1146 1873
NM_199355chr1631108 712 492 --1547 1699
NM_199461chr1053176 2539 1203 168 154 --11175 1698
NM_201432chr1786319 5992 5423 5371 4940 4320 1780 1385 14728 26306 2481 --
NM_201433chr1786319 5992 5423 5371 4940 4320 1780 1385 14728 26306 2481 --
NM_203327chr2094144 3426 3414 3302 3248 1746 1554 1351 859 --1954 --
NM_203341chr12436 229 --1863 1900
NM_203406chr532548 1942 85 --11078 1532
NM_203446chr2152257 2201 1917 964 374 --12557 12796
NM_203463chr244798 3959 3502 148 14770 34192 3722 561 --
NM_205860chr163123 3050 2187 1031 706 427 --22977 2615 --
NM_206594chr133445 918 735 1880 134 --
NM_206595chr133445 918 735 1880 134 --
NM_206853chr623192 3170 12751 14120 11390
NM_206854chr674453 4431 3706 3470 3367 3357 350 24012 3567 25381 823 --
NM_206855chr685418 5396 4671 4435 4332 4322 4105 1315 24977 4532 26346 1788 --
NM_206876chr253120 2981 2698 2225 1126 ----1258
NM_206907chr533107 1048 693 ----13306
NM_206909chr853300 2376 2071 1732 73 35939 2930 1921 22282 545 12153
NM_207170chr12804 109 --1967 2272 170
NM_207304chr1342603 1964 550 359 1935 ----
NM_207325chr1942063 1417 544 291 32020 621 81 ----
NM_207372chr1081931 1880 1752 805 505 309 226 156 ------
NM_207406chr466233 6155 4217 2160 1756 1058 14539 --16110
NM_212471chr1732238 214 44 11896 --11874
NM_212472chr1732238 214 44 11896 --11874
NM_212558chr943539 1710 682 653 1152 13552 23561 767
NM_213589chr242009 865 340 24 --21834 401 --
NM_213654chr321494 542 ----11027