TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4804-3p
miRNA Sequence: UGCUUAACCUUGCCCUCGAAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr113696 654 103 186 ----
NM_000052chrX43238 3190 2639 1019 23426 2489 ----
NM_000091chr2--12654 ----
NM_000093chr9--1581 1614 --
NM_000112chr585535 4950 4378 4343 3762 2114 1176 805 23512 1353 14445 14776
NM_000138chr151585 ------
NM_000254chr132700 1886 724 32803 2032 1103 11998 --
NM_000321chr1331811 1475 1119 ----11205
NM_000329chr12892 661 1830 --1159
NM_000332chr696853 6835 6749 6038 5501 4739 4551 969 878 25869 1118 ----
NM_000393chr222086 141 ------
NM_000408chr22830 447 22132 212 12582 --
NM_000484chr211361 ------
NM_000531chrX1321 ------
NM_000555chrX44835 2497 2214 1473 11273 16215 --
NM_000582chr41369 ------
NM_000596chr7--142 ----
NM_000801chr20--1318 ----
NM_000813chr544046 3857 1547 394 32035 602 541 --13696
NM_000901chr4133 1859 ----
NM_000965chr3--11150 2860 316 --
NM_001001396chr194294 3551 3478 2812 1480 1114 1030 669 469 --23897 3809 --
NM_001001557chr832063 1844 1388 --1600 11997
NM_001001890chr2183905 3733 3533 2640 2619 1150 637 582 12883 ----
NM_001002926chr732445 1109 638 12340 1349 188
NM_001003652chr1876209 5603 3418 3281 3208 2567 2484 28223 2682 --12699
NM_001003712chr1221066 812 21555 746 22622 213 --
NM_001003792chr32785 430 11045 ----
NM_001003793chr32785 430 11045 ----
NM_001004051chrX1238 ------
NM_001004313chr1722130 1560 11431 --12069
NM_001004317chr664499 3666 3220 1408 1111 1097 32895 1536 169 ----
NM_001004419chr1244593 4309 4116 3177 21641 993 ----
NM_001005375chrY61781 751 518 383 337 140 ------
NM_001005463chr101800 ----22468 739
NM_001005476chr2----1482 --
NM_001005849chr17--1515 ----
NM_001006636chr21644 ------
NM_001007098chr1190 ------
NM_001007278chr1383481 2084 1852 1761 1662 1603 1387 546 13758 1977 --
NM_001008239chr181553 --12809 --
NM_001008405chr731222 291 85 21580 695 ----
NM_001008540chr22493 50 ------
NM_001008925chr452940 1418 1347 596 501 42907 1394 971 107 ----
NM_001010888chrX43456 1111 205 127 11183 24328 1320 --
NM_001010891chr5106475 4970 4911 4268 1415 1332 1292 1162 1104 688 25608 1983 12399 --
NM_001010895chr931679 1553 539 11346 --12045
NM_001010971chr1------1893
NM_001011515chr41425 ------
NM_001011516chr41425 ------
NM_001011666chr786279 5925 5718 5570 4538 1155 632 442 12561 16437 11277
NM_001012410chr31349 ------
NM_001012420chr1542949 2287 2165 143 ------
NM_001012423chr1542949 2287 2165 143 ------
NM_001012755chrX33924 559 273 1337 --23222 157
NM_001013406chr711089 ----11463
NM_001013620chr1288338 7055 3145 3139 2372 2088 1244 166 16212 ----
NM_001013699chr121108 --1376 --
NM_001014336chr121244 195 ----
NM_001014380chr13105725 4630 4527 4508 4295 1563 1184 592 438 159 35231 5174 1346 12100 12051
NM_001015053chr17------11565
NM_001015877chrX22322 337 ------
NM_001017969chr9--1587 ----
NM_001018054chr111339 ------
NM_001018067chr194641 4434 4270 3852 3838 3634 3520 3429 1216 --14585 --
NM_001018068chr194641 4434 4270 3852 3838 3634 3520 3429 1216 --14585 --
NM_001018069chr194641 4434 4270 3852 3838 3634 3520 3429 1216 --14585 --
NM_001020658chr11619 ------
NM_001020658chr11619 ------
NM_001020825chr51207 ------
NM_001023567chr151143 ------
NM_001024218chr141654 ------
NM_001024649chr53800 605 390 11031 22278 990 --
NM_001024807chr191240 ------
NM_001024956chr1165473 5291 5166 2165 1556 1135 31936 825 25 --22237 1599
NM_001025076chr1076179 4468 4080 2275 1582 803 498 15528 ----
NM_001025077chr1087537 5826 5438 5115 4750 2940 2161 1856 16886 ----
NM_001025079chr364072 3987 3646 3363 3283 3118 2527 70 1161 --
NM_001025580chrX53577 2992 1011 892 188 31033 1000 602 ----
NM_001029863chr631113 863 730 1253 --1722
NM_001030055chr1494579 4480 4451 4331 3578 3463 3195 2961 1165 --11491 1474
NM_001031689chr9--1107 ----
NM_001031803chr171272 ------
NM_001031812chr532146 1443 339 21833 1623 12229 --
NM_001032288chr202537 530 ------
NM_001032730chr13609 575 32 1708 ----
NM_001033045chr254405 3463 3433 2955 1415 12880 1848 --
NM_001033049chr211330 ------
NM_001033503chr51412 ------
NM_001035260chr1021152 141 --1316 --
NM_001037163chr7170 ------
NM_001037164chr73595 518 423 11946 ----
NM_001039538chr252621 2571 623 613 521 33308 2631 39 ----
NM_001039618chr1145166 4375 4317 3895 11705 --1720
NM_001039762chr10155 --12372 --
NM_001040058chr41369 ------
NM_001040060chr41369 ------
NM_001040152chr764669 4324 3741 1877 1294 1235 24660 4609 25156 3791 --
NM_001040202chr472487 2271 1766 956 633 621 397 --11627 138
NM_001040440chr51143 ------
NM_001041chr3151 ------
NM_001042355chr1644897 3634 936 265 12013 1270 --
NM_001042412chr1644897 3634 936 265 12013 1270 --
NM_001042453chrX31138 279 242 2494 263 ----
NM_001042481chr1412013 21982 172 ----
NM_001042548chr22703 650 1802 ----
NM_001042599chr287682 6745 5718 5683 5569 5418 2772 1091 46823 1180 798 757 --17553
NM_001042604chr354339 4308 946 136 21 34404 1943 194 13906 --
NM_001044385chr273821 3276 3099 2857 1390 1040 975 ----11020
NM_001044722chr532146 1443 339 21833 1623 12229 --
NM_001044723chr532146 1443 339 21833 1623 12229 --
NM_001046chr562881 2312 1156 1045 945 486 --12739 --
NM_001099678chr376091 4684 4572 4465 4059 1917 103 22094 1316 14451 --
NM_001100108chr1107565 6323 2685 2478 2362 2039 1890 1484 1116 207 57202 5203 2410 1657 971 ----
NM_001106chr398985 8476 8385 8089 7798 6869 2607 941 253 28280 6810 59343 8186 7052 2824 2734 16527
NM_001124chr111460 ------
NM_001135chr15----1325 --
NM_001148chr411427 ------
NM_001167chrX85928 5401 4419 2135 1814 1398 1346 1217 2932 75 34576 1432 647 25120 2518
NM_001173chr1494579 4480 4451 4331 3578 3463 3195 2961 1165 --11491 1474
NM_001201chr453225 2585 978 472 413 11489 11581 13452
NM_001204chr2127621 6567 5885 5694 5487 5362 5333 4780 4690 1686 1015 202 47101 6179 1279 997 14822 15453
NM_001259chr755833 1862 1796 1182 22 25284 4348 ----
NM_001270chr51316 ------
NM_001284chr51118 ------
NM_001290chr4--1696 ----
NM_001329chr1031613 644 415 --21190 241 --
NM_001356chrX41984 1966 663 602 32294 1995 770 ----
NM_001378chr2--150 ----
NM_001402chr632055 200 87 12001 1600 --
NM_001412chrX41490 1100 358 181 22386 495 1193 --
NM_001419chr1944342 4174 3752 204 21663 910 13974 --
NM_001430chr221692 548 --1743 --
NM_001432chr443660 3246 3054 98 22628 728 ----
NM_001438chr143297 2700 1377 904 22873 765 ----
NM_001482chr151782 ------
NM_001498chr6----11121 1906
NM_001546chr62303 297 21344 939 ----
NM_001650chr1843116 2800 1028 1002 22925 232 1305 --
NM_001684chr194011 3268 3195 1546 1197 831 747 386 186 --23614 3526 --
NM_001701chr921117 630 ------
NM_001731chr121157 ------
NM_001742chr711520 ------
NM_001746chr53800 605 390 11031 22278 990 --
NM_001754chr2183905 3733 3533 2640 2619 1150 637 582 12883 ----
NM_001755chr1632241 2140 1837 2247 176 ----
NM_001777chr364072 3987 3646 3363 3283 3118 2527 70 1161 --
NM_001799chr5--179 ----
NM_001827chr91217 ------
NM_001854chr111195 21306 980 ----
NM_001858chr654779 4354 3331 1921 1053 33962 3575 3244 25060 4018 --
NM_001935chr2--1163 ----
NM_001938chr141588 1476 687 140 41775 1758 1668 1347 ----
NM_001949chr652875 2661 2612 1274 568 42458 2388 913 836 12024 --
NM_001951chr81518 ------
NM_001977chr41532 ------
NM_001993chr11916 --1847 --
NM_002006chr495382 5201 4685 4666 4133 3865 3565 1982 700 24366 656 ----
NM_002009chr1562571 2136 956 923 798 50 12201 ----
NM_002017chr1121344 1084 --21351 279 --
NM_002025chrX98103 6010 3507 3310 2252 2058 1753 869 297 1713 28614 1904 --
NM_002026chr23919 390 106 1354 ----
NM_002039chr42781 159 ------
NM_002054chr2----170 --
NM_002063chrX--11173 ----
NM_002069chr7--1464 ----
NM_002092chr475027 4958 4833 3582 3488 3158 1700 --14498 --
NM_002126chr1733167 1629 1153 43993 3242 2567 847 14127 --
NM_002146chr171175 ------
NM_002147chr171634 ------
NM_002154chr52188 47 ------
NM_002190chr62414 259 21257 442 ----
NM_002203chr523800 697 13020 ----
NM_002229chr19--1476 ----
NM_002267chr1332318 2186 840 ------
NM_002270chr5125148 4596 4419 4400 4247 4110 3863 3639 2043 1448 1127 187 --21896 1647 --
NM_002293chr112249 12439 --1908
NM_002310chr5126013 5809 5328 5189 5148 4795 4179 4025 2321 2185 1427 107 --2994 132 --
NM_002336chr1284826 4360 3954 3745 1597 794 402 61 13211 11361 13510
NM_002374chr252621 2571 623 613 521 33308 2631 39 ----
NM_002399chr1521362 1060 --11433 --
NM_002408chr14--1342 ----
NM_002445chr811258 1559 ----
NM_002520chr5--1212 ----
NM_002526chr631683 1211 1165 21460 369 1237 --
NM_002538chr5--134 1484 --
NM_002544chr17--199 ----
NM_002568chr8--1368 ----
NM_002578chrX1353 ------
NM_002595chr1221364 530 ------
NM_002627chr10162 ------
NM_002645chr1142769 2278 2037 506 12474 1805 --
NM_002655chr853495 1386 1310 669 130 11588 1191 --
NM_002687chr141323 ------
NM_002701chr6192 ------
NM_002738chr1611028 ------
NM_002740chr342527 2306 2039 638 1977 --12701
NM_002748chr152844 74 1858 ----
NM_002752chr5--1443 ----
NM_002755chr151696 ------
NM_002758chr172502 404 ------
NM_002763chr1--1476 ----
NM_002834chr1243686 3374 1117 546 1443 11308 --
NM_002835chr7127 ------
NM_002890chr5----11006 --
NM_002893chrX1270 ------
NM_002906chr1112357 ------
NM_002942chr31937 1185 1954 --
NM_002973chr121514 ------
NM_002982chr171143 1123 ----
NM_002998chr841476 898 879 564 11892 ----
NM_003022chrX21072 333 124 ----
NM_003034chr12127662 6877 6369 3199 2695 2093 1959 1643 1040 1010 318 45 17334 21427 569 25021 3045
NM_003042chr321915 861 21450 491 ----
NM_003063chr11----1445 --
NM_003071chr32626 43 11653 --1655
NM_003072chr19----1325 --
NM_003079chr172838 178 ------
NM_003099chr1545036 4645 4508 425 76045 4815 4758 2028 2006 743 218 ----
NM_003106chr311064 ------
NM_003135chr51346 ------
NM_003136chr141269 ------
NM_003199chr1843846 3652 3466 1457 ----11680
NM_003216chr2222991 2762 ------
NM_003243chr1--1992 ----
NM_003246chr1511577 ------
NM_003270chrX1930 ------
NM_003300chr14------1402
NM_003349chr202537 530 ------
NM_003350chr82649 643 193 ----
NM_003375chr10--1141 1395 --
NM_003385chr2--1649 ----
NM_003467chr22493 50 ------
NM_003472chr621319 292 ----1106
NM_003473chr10--1808 ----
NM_003478chr1143335 3261 2793 829 22265 646 12426 1533
NM_003487chr171106 ------
NM_003566chr1212454 22796 1267 ----
NM_003574chr18115732 5627 4588 4542 2197 1967 1941 1859 1428 923 754 13946 --13560
NM_003590chr253739 3627 3181 664 178 33877 1103 538 ----
NM_003592chr71478 ------
NM_003618chr221117 159 ------
NM_003628chr2----1482 --
NM_003701chr131716 ------
NM_003704chr4------1651
NM_003722chr342646 1102 273 192 22576 849 ----
NM_003758chr15--11184 --11246
NM_003758chr15--11184 --11246
NM_003795chr61597 ------
NM_003812chr2185 ------
NM_003829chr91133 ------
NM_003858chr141649 ------
NM_003872chr2--1616 ----
NM_003934chr9--1432 ----
NM_003941chr741744 1603 782 420 21841 1645 ----
NM_003948chr472641 2586 1954 1685 596 334 316 ------
NM_004028chr1843116 2800 1028 1002 22925 232 1305 --
NM_004052chr101621 ------
NM_004060chr53868 430 89 ------
NM_004071chr2169 ------
NM_004075chr12166 --1567 --
NM_004080chr711338 ----11075
NM_004081chrY61781 751 518 383 337 140 ------
NM_004086chr14--3801 135 115 1708 --
NM_004098chr10----11092 --
NM_004124chr1463499 3090 2811 2653 462 217 ----13561
NM_004136chr1543193 1100 971 498 23103 473 --13209
NM_004171chr1159504 2790 2322 2272 1910 37609 1817 572 ----
NM_004272chr551656 1499 1386 786 67 ----11488
NM_004279chr721869 668 1340 31718 1600 1576 11535
NM_004281chr10282 57 ------
NM_004293chr963497 3286 2790 368 249 190 21307 303 ----
NM_004329chr101249 ------
NM_004370chr611899 --11677 11670
NM_004384chr532146 1443 339 21833 1623 12229 --
NM_004397chr1123524 425 22837 1457 13793 --
NM_004458chrX62652 2377 2113 2010 677 69 21645 405 ----
NM_004469chrX1502 ------
NM_004480chr141320 ------
NM_004482chr21652 1678 ----
NM_004520chr5196 ------
NM_004524chr171244 ------
NM_004583chr172216 209 ------
NM_004586chrX34585 4335 3949 13744 --1391
NM_004631chr111339 ------
NM_004657chr21430 ------
NM_004660chrY41665 1448 659 604 21920 739 11894 --
NM_004681chrY1183 ------
NM_004694chr172845 183 1653 ----
NM_004704chr3124 ------
NM_004725chr1041465 547 179 21 11149 ----
NM_004726chrX55246 4797 4246 3529 900 54010 2269 1773 1213 247 13701 --
NM_004730chr521955 860 ------
NM_004731chr121428 21799 342 --11898
NM_004736chr12831 804 ----11983
NM_004745chr896645 5872 5265 5242 4957 2248 1807 1772 865 ----14805
NM_004748chr1552701 1413 693 286 214 34238 4020 180 ----
NM_004770chr8--1162 ----
NM_004788chr1131014 539 168 22332 766 --11087
NM_004792chr2144 ------
NM_004800chr13--1213 ----
NM_004801chr211091 ------
NM_004831chr191690 ------
NM_004836chr25936 761 744 172 143 ------
NM_004857chr1464435 3930 1414 611 407 151 54336 3536 3126 2942 307 34658 3977 3153 --
NM_004863chr14105166 4346 4265 4160 4053 3501 1823 1393 1085 540 ------
NM_004896chr1021067 56 --1231 --
NM_004904chr786279 5925 5718 5570 4538 1155 632 442 12561 16437 11277
NM_004912chr711089 ----11463
NM_004949chr182849 609 11851 12074 --
NM_004966chr10--2274 265 ----
NM_005023chr531279 1116 150 31354 524 446 ----
NM_005045chr72751 384 1305 ----
NM_005065chr1465355 4937 4100 3856 664 472 11760 ----
NM_005095chr1--11524 ----
NM_005102chr22703 650 1802 ----
NM_005113chr141132 ------
NM_005121chr1753562 2910 2469 860 67 22647 1065 ----
NM_005126chr332124 2068 1515 21843 1465 --11746
NM_005166chr191240 ------
NM_005168chr21213 ------
NM_005188chr1168204 8024 3236 2290 1972 353 17721 --26218 2992
NM_005230chr122253 210 ------
NM_005235chr287682 6745 5718 5683 5569 5418 2772 1091 46823 1180 798 757 --17553
NM_005238chr1143241 2623 929 622 1221 1914 --
NM_005295chr7--1100 ----
NM_005339chr433115 3050 1434 32969 780 501 ----
NM_005378chr21345 ------
NM_005386chr201794 ------
NM_005399chr153968 3586 2929 2817 1351 --23188 1229 --
NM_005415chr2----1733 --
NM_005474chr17------11565
NM_005524chr31109 ------
NM_005530chr1571457 1403 1135 1123 1117 298 219 ------
NM_005539chr10--1211 ----
NM_005578chr375164 5149 1817 1494 1347 560 397 --1544 --
NM_005584chr13155 ------
NM_005587chr151731 ------
NM_005623chr171168 ------
NM_005626chr11415 ------
NM_005665chr153787 3769 3155 2993 948 34414 3457 1364 11802 --
NM_005668chr533699 3122 1055 44363 3614 615 432 13402 --
NM_005738chr73595 518 423 11946 ----
NM_005744chr15--1154 ----
NM_005746chr732463 2368 1008 12640 12714 --
NM_005754chr51114 ------
NM_005798chr1383481 2084 1852 1761 1662 1603 1387 546 13758 1977 --
NM_005801chr17127 ------
NM_005822chr622297 1881 1193 ----
NM_005826chr11444 199 ----
NM_005828chr1754527 1659 1536 1286 305 --34674 4501 1673 --
NM_005840chrX97183 6648 6626 6138 5336 5215 2772 1476 107 12333 24929 2258 --
NM_005843chr211648 1291 ----
NM_005857chr1--1105 ----
NM_005862chr321059 994 ------
NM_005880chr1611014 ------
NM_005885chr51103 ------
NM_005898chr1143145 2987 672 227 23024 2724 --12874
NM_005901chr1876209 5603 3418 3281 3208 2567 2484 28223 2682 --12699
NM_005907chr651470 1261 1117 380 112 1236 ----
NM_005923chr62564 490 ------
NM_005930chr142803 74 157 1859 --
NM_005966chr241484 542 478 348 1926 1245 --
NM_005975chr20----1758 --
NM_005999chr151363 1217 1049 541 370 31458 1125 530 ----
NM_006007chr934298 1522 835 12769 12845 23413 1271
NM_006010chr3188 ------
NM_006048chr121171 202 ------
NM_006106chr1133394 2107 1263 ----12998
NM_006152chr12139 ------
NM_006167chr81437 1641 ----
NM_006197chr862173 671 447 399 374 186 11776 --12067
NM_006203chr543930 3827 1600 1009 34803 3649 38 11386 --
NM_006212chr165433 4063 3716 1816 1794 181 44577 2086 1921 1757 ----
NM_006251chr522538 1147 33332 2800 2320 12571 --
NM_006252chr176795 6063 5383 4589 1437 929 922 24678 1211 ----
NM_006256chr172146 2078 1101 1082 732 354 232 12372 ----
NM_006275chr2071994 866 688 577 387 261 235 2754 51 ----
NM_006282chr2064671 4557 1414 1202 514 276 24349 2915 --11822
NM_006343chr2------1143
NM_006380chr1741690 1676 1397 1058 44094 3692 3100 1616 13907 --
NM_006393chr1044221 3873 1763 23 24099 2843 13703 13907
NM_006409chr7--1237 ----
NM_006416chr6163 ------
NM_006475chr131667 ------
NM_006544chr1485682 5012 4906 4219 2274 1722 1437 720 34708 1292 531 13883 --
NM_006561chr1076179 4468 4080 2275 1582 803 498 15528 ----
NM_006599chr1656383 1543 1500 1244 832 48024 7934 6673 2184 --13177
NM_006620chr674603 4050 1768 1318 994 609 75 33924 3538 645 ----
NM_006644chr131151 ------
NM_006703chr6----1165 --
NM_006706chr51700 ------
NM_006750chr16137878 7860 7430 6547 5437 5262 5169 5003 2985 2433 1270 867 777 47747 6687 6430 5102 1828 16295
NM_006775chr6--11127 ----
NM_006826chr2--1295 11276 --
NM_006851chr121876 ------
NM_006885chr1652985 2839 1475 857 778 --14182 1722
NM_006915chrX42436 1892 140 33 22126 190 11662 --
NM_006918chr1165473 5291 5166 2165 1556 1135 31936 825 25 --22237 1599
NM_006924chr1753833 3604 1233 978 190 13374 24461 3131 --
NM_006937chr17--1515 ----
NM_006939chr141807 ------
NM_006948chr2122277 933 1335 1570 12037
NM_007005chr921422 1229 11576 ----
NM_007006chr1673345 3253 3202 3158 2646 955 358 ----11347
NM_007007chr1253320 3213 3112 981 615 23447 1375 ----
NM_007026chr17------1536
NM_007114chr332189 648 480 12760 ----
NM_007125chrY11078 ------
NM_007129chr1311012 ------
NM_007153chr1953320 3202 2869 1189 615 14494 ----
NM_007173chr1142396 2292 1575 290 1215 --1524
NM_007191chr122164 26 ------
NM_007208chr3------1202
NM_007246chr41108 ------
NM_007249chr13119301 8885 8814 7776 6282 3496 3431 3317 3219 2720 1173 39013 3092 1987 ----
NM_007347chr1522162 1172 --11023 --
NM_007375chr122644 1015 --32188 2020 1060 12124
NM_012095chr1042504 1393 859 174 32237 830 524 1916 13487
NM_012096chr342472 645 539 102 --13474 --
NM_012110chr41218 ------
NM_012155chr191221 ------
NM_012193chr1185085 3860 3428 1903 1839 1571 352 120 23878 903 21982 978 --
NM_012208chr51750 ------
NM_012214chr245139 4427 4370 541 13963 --159
NM_012234chr333518 3136 423 ----13379
NM_012250chr1121188 267 11267 ----
NM_012262chr154082 3252 1093 727 116 34945 3849 1761 14072 --
NM_012287chr333172 1572 262 24530 2891 --13206
NM_012297chr42830 341 --12208 12533
NM_012310chrX------1537
NM_012334chr564140 3479 979 577 506 186 ------
NM_012347chr64862 698 265 254 1275 ----
NM_012419chr6----1173 --
NM_012428chr151685 --1708 --
NM_012482chr1--2535 474 ----
NM_013227chr15----1325 --
NM_013255chr7148028 7797 7278 7026 6248 6021 5943 3013 2724 2559 1858 1402 548 203 68328 7971 1936 1609 1090 307 ----
NM_013269chr1244520 4236 4043 3104 21568 920 ----
NM_013293chr7----1592 --
NM_013374chr342203 2126 588 376 21264 354 12700 --
NM_013396chr2131468 583 357 ------
NM_013446chr7----11238 --
NM_014011chr242130 2081 902 760 1985 190 1593
NM_014112chr834243 4042 1854 --2580 244 11134
NM_014141chr734828 4159 1553 44856 561 258 90 11842 13626
NM_014155chr1177471 6431 5587 4901 4681 2175 808 15187 24929 2458 --
NM_014169chr14155 ------
NM_014267chr11--1731 ----
NM_014283chr151321 1208 612 599 446 11224 1974 --
NM_014294chr821308 393 ------
NM_014305chr13174 ------
NM_014319chr12--1268 21863 222 11447
NM_014342chr11--11497 --11061
NM_014363chr134444 418 325 72 ----1104
NM_014423chr534753 3751 323 25237 4455 14426 13900
NM_014435chr4--1663 ----
NM_014445chr352377 1851 1723 891 239 ----12245
NM_014456chr1031177 426 230 195 1393 1558
NM_014503chr121410 ------
NM_014584chr1421581 92 1146 1173 --
NM_014612chr9--1348 ----
NM_014660chr721008 732 1355 ----
NM_014666chr531142 917 839 ------
NM_014670chr2--1195 ----
NM_014676chr11619 ------
NM_014699chr161370 ------
NM_014702chr632168 1347 914 23456 2983 ----
NM_014709chr22421 29 ------
NM_014764chr121406 ------
NM_014765chr142699 2226 2118 1834 11697 --165
NM_014819chr582146 1890 1855 1827 625 349 199 188 11672 ----
NM_014839chr112125 2964 764 12327 12503
NM_014841chr611072 ------
NM_014864chr163797 3168 3082 1490 1157 588 12677 ----
NM_014869chr311460 ------
NM_014881chr10----132 --
NM_014892chr61107 ------
NM_014904chr1042952 2710 1495 1044 23918 2921 1579 --
NM_014924chr1452442 2200 740 390 82 22720 140 22612 891 --
NM_014977chr141225 ------
NM_014982chr1464218 3950 3689 1630 528 217 15066 --1143
NM_015032chr1332450 2394 380 22850 394 --12142
NM_015068chr763521 3176 2593 729 146 87 23512 3461 24008 2643 --
NM_015091chr141109 ------
NM_015092chr1674452 4017 3150 2931 1581 1279 848 13718 23779 31 --
NM_015093chr61664 ------
NM_015110chr921799 963 11670 1192 --
NM_015137chr81241 ----1280
NM_015144chr1663798 3570 1220 1100 843 32 23193 2777 188 --
NM_015156chr1422774 2558 --23752 3178 11352
NM_015170chr822063 361 ------
NM_015176chr131220 439 97 152 21395 356 --
NM_015192chr20--22738 433 1841 1857
NM_015198chr71240 ------
NM_015206chr15--13589 13394 --
NM_015208chr1853551 3502 2930 1106 280 23667 2802 ----
NM_015225chr932907 2668 771 --1228 1341
NM_015247chr1644897 3634 936 265 12013 1270 --
NM_015251chr1642326 2038 1494 795 1485 ----
NM_015272chr1622031 220 ------
NM_015278chr622263 798 2672 614 --11209
NM_015310chr868091 7538 6348 6113 5507 568 25214 476 --16806
NM_015314chr762361 2107 2094 555 508 58 ----1153
NM_015317chr232056 861 753 1968 3873 774 530 --
NM_015335chr1222043 2034 --1851 --
NM_015347chr1231048 948 64 1514 12929 --
NM_015349chr643046 2319 813 523 42699 2675 708 565 12586 --
NM_015361chr21809 1609 ----
NM_015365chrX53577 2992 1011 892 188 31033 1000 602 ----
NM_015382chr141618 ------
NM_015387chr21160 ------
NM_015436chr452759 1237 1166 415 320 32726 1213 790 ----
NM_015458chr875344 4903 2004 1991 1593 1072 200 1767 11397 11058
NM_015462chr17--1256 ----
NM_015464chr7--1146 ----
NM_015475chr21900 1857 11112 1701
NM_015526chr191396 ------
NM_015553chr654985 3955 1355 739 658 24669 3596 --14368
NM_015577chr521541 1343 1670 --11561
NM_015640chr194641 4434 4270 3852 3838 3634 3520 3429 1216 --14585 --
NM_015676chr14----1371 --
NM_015678chr1331650 1517 352 ------
NM_015833chr211330 ------
NM_015878chr81240 1726 2677 43 --
NM_015879chr1867578 6430 5885 3136 2919 2273 37070 6631 1256 18565 --
NM_015885chr11--2777 697 ----
NM_015888chr133032 2796 2762 23384 867 13054 22721 709
NM_015902chr8--1910 ----
NM_015906chr131905 1036 85 11624 14153 --
NM_015932chr131570 ------
NM_015975chrX51859 1321 300 233 50 ----1202
NM_016009chr193169 1957 1801 1506 1100 1059 680 264 100 34715 1391 1207 11434 178
NM_016021chr663024 2518 2201 1982 1921 344 ------
NM_016040chr13417 192 145 11057 ----
NM_016048chr5----1106 --
NM_016072chr1212260 ------
NM_016083chr653863 3150 840 222 48 53448 2753 1437 980 709 23707 3065 --
NM_016084chr17----150 --
NM_016087chr72687 595 --11399 --
NM_016093chr5--1144 ----
NM_016098chr6--1342 ----
NM_016103chr51412 ------
NM_016129chr41309 ------
NM_016131chr21701 --22317 1917 --
NM_016132chr1532935 2205 727 --13197 23314 2181
NM_016152chr3--11150 2860 316 --
NM_016156chr1142014 1543 1513 174 22205 224 ----
NM_016206chr365460 2683 2545 1792 1028 483 28566 6480 28906 25 38273 3417 3341
NM_016227chr151321 1208 612 599 446 11224 1974 --
NM_016230chr62540 476 ------
NM_016252chr2--1731 ----
NM_016258chr12628 324 1135 --1820
NM_016260chr246448 4775 2517 636 36718 5484 5335 --11732
NM_016261chr171832 ------
NM_016300chr3--191 ----
NM_016308chr131997 554 403 11865 ----
NM_016322chr942857 1174 1102 373 --12780 --
NM_016373chr16--1154 ----
NM_016488chr1212002 ------
NM_016530chr1544035 994 823 761 43360 3256 2974 778 ----
NM_016542chrX31138 279 242 2494 263 ----
NM_016559chr31976 ------
NM_016623chr81513 ------
NM_016628chr102769 73 2719 85 1103 --
NM_016831chr13581 108 65 22386 1537 21602 214 --
NM_016953chr275856 4722 4590 4421 4271 981 954 25675 1059 15339 --
NM_017415chr564450 3925 3682 2997 2898 745 ----23635 1825
NM_017420chr1443792 3680 1114 433 11281 --2467 162
NM_017447chr2134249 3903 1633 34104 3752 1465 ----
NM_017455chr151685 --1708 --
NM_017489chr8------138
NM_017522chr111339 ------
NM_017548chr32514 408 1881 ----
NM_017599chr12--1274 ----
NM_017612chr12163 ------
NM_017632chr41338 ------
NM_017635chr1121100 162 11154 ----
NM_017637chr9108385 8060 7737 7396 6473 6385 3588 3340 2791 1855 38294 7344 3098 11161 --
NM_017649chr101392 ------
NM_017650chr765768 5409 2405 2384 2145 1229 1242 ----
NM_017658chr1454586 3887 1656 1629 1337 2822 754 --13160
NM_017744chr162252 2132 1697 798 413 393 1476 11786 --
NM_017761chr151040 570 272 215 190 ------
NM_017770chr611023 32686 2171 434 12414 --
NM_017780chr8--1178 ----
NM_017813chr874920 4605 3972 3540 2300 1842 97 25566 4660 15583 --
NM_017822chr12--1309 ----
NM_017864chr8----170 --
NM_017866chr84950 855 826 815 ----1792
NM_017919chr975616 5362 5033 4001 3937 671 185 24272 4217 14674 --
NM_017922chr141244 ------
NM_017952chr263954 2952 1507 810 532 170 34423 1158 228 ----
NM_017987chr1031829 1384 90 21964 1888 ----
NM_018028chr1911051 ------
NM_018030chr18----1690 --
NM_018084chr263291 2938 2880 2803 1291 269 1697 22070 324 --
NM_018098chr31264 ------
NM_018105chr8----1996 --
NM_018157chr1232831 2728 2000 32644 2602 2025 12340 --
NM_018169chr121441 ------
NM_018184chr33859 791 472 ----21427 1390
NM_018229chr1431088 914 846 ------
NM_018247chr621065 520 32315 2189 955 12945 --
NM_018254chr151669 813 468 413 404 22187 273 --1923
NM_018257chr2012281 1580 ----
NM_018263chr232341 2170 921 --22539 1669 1937
NM_018266chr311022 ------
NM_018313chr352536 2454 2089 525 187 ------
NM_018361chr872945 2527 1562 1439 1130 803 750 1328 ----
NM_018362chr1123519 1317 33542 705 462 --13862
NM_018364chr143701 2619 176 76 1891 24057 81 --
NM_018374chr764608 4490 3776 1679 1364 985 35100 4832 3385 13443 --
NM_018403chr354052 1403 610 506 107 --1259 --
NM_018420chr132888 1066 232 32152 832 152 --1862
NM_018433chr21563 ----1571
NM_018440chr888421 7198 7074 6135 2856 2194 1981 843 37292 7209 3115 --16912
NM_018460chr21149 ------
NM_018471chr2129 ------
NM_018557chr211261 11629 ----
NM_018566chr1105136 4531 4501 4023 3917 3581 2019 983 282 155 23400 1506 1542 1878
NM_018569chr421423 178 ------
NM_018590chr1021670 1441 1606 ----
NM_018638chr1275700 5592 5405 3653 1095 385 347 23795 1180 11765 25512 1350
NM_018657chr3--2698 209 ----
NM_018684chrX--11237 ----
NM_018685chr71939 198 ----
NM_018686chr12--172 ----
NM_018704chr122031 691 1157 ----
NM_018834chr5----2186 153 --
NM_018844chr741464 533 327 75 11822 ----
NM_018999chr1054853 4609 3270 1586 1258 34483 917 727 23648 3431 --
NM_019001chr354339 4308 946 136 21 34404 1943 194 13906 --
NM_019044chr234496 3251 964 32967 1418 45 --11750
NM_019050chr462304 1943 1852 762 751 611 11988 ----
NM_019072chr562732 2672 1441 912 796 435 23751 381 13179 --
NM_019083chr131517 1460 384 ------
NM_019095chr20--1144 ----
NM_019610chr122126 640 --2239 132 --
NM_019617chr21128 ------
NM_020066chr11813 ------
NM_020123chr10--11226 ----
NM_020135chr61290 ------
NM_020166chr3------129
NM_020205chr193243 3160 2806 2496 1087 577 493 134 85 --21152 44 --
NM_020244chr12184 ------
NM_020307chr31342 ------
NM_020348chr101825 ------
NM_020357chr311416 ------
NM_020390chr344373 3031 1390 382 23733 1406 34817 3255 1395 13816
NM_020420chrY61781 751 518 383 337 140 ------
NM_020432chr741879 1750 1709 505 32025 518 210 --12117
NM_020647chr811946 ------
NM_020666chr51818 1832 1116 1164
NM_020673chr20106976 6462 5746 5377 2987 2629 1210 460 293 286 11700 17151 --
NM_020739chr1552701 1413 693 286 214 34238 4020 180 ----
NM_020742chrX1451 12690 12403 --
NM_020766chrX41717 1172 485 284 24334 3626 --14074
NM_020801chr511944 ------
NM_020806chr141654 ------
NM_020809chr111467 ------
NM_020841chr1221066 812 21555 746 22622 213 --
NM_020920chr141406 ------
NM_020921chr1452741 2506 522 504 82 13191 13433 --
NM_020948chr131072 867 848 1984 12609 --
NM_020964chr1864642 4038 4023 3833 3338 224 24579 4234 --14822
NM_020975chr10--21953 1936 --1241
NM_020977chr411427 ------
NM_021038chr333413 2540 651 1638 12095 11237
NM_021102chr19--1358 ----
NM_021176chr211565 ------
NM_021183chrX31872 420 154 --11926 1715
NM_021205chr152312 2237 976 314 179 ----12864
NM_021255chr1463952 3580 3218 3070 1086 959 1523 ----
NM_021818chr14123 --21499 1101 --
NM_021911chr544046 3857 1547 394 32035 602 541 --13696
NM_021935chr31915 ------
NM_021988chr202537 530 ------
NM_022037chr21993 ------
NM_022058chr231581 1478 682 ----1711
NM_022143chr72448 108 1594 ----
NM_022173chr21993 ------
NM_022340chr323012 681 --1710 --
NM_022442chr202537 530 ------
NM_022459chr1356071 4746 4272 1637 458 23874 1128 25163 190 --
NM_022473chr1563628 3574 571 429 219 179 1414 ----
NM_022484chr711340 1141 --11037
NM_022650chr5----11006 --
NM_022716chr152886 2099 1013 774 701 ------
NM_022726chr61251 11469 ----
NM_022731chr11217 ------
NM_022802chr1031613 644 415 --21190 241 --
NM_022824chr551665 1500 1359 1224 318 ----1733
NM_022826chr21453 ------
NM_022843chr131191 ------
NM_022845chr1632195 2094 1791 2201 130 ----
NM_022894chr221152 23 ------
NM_022977chrX62652 2377 2113 2010 677 69 21645 405 ----
NM_023012chr121489 ------
NM_023039chr51335 ------
NM_023929chr812655 ------
NM_024007chr542043 1173 796 293 1652 11116 --
NM_024052chr171246 13158 --12739
NM_024090chr411307 11598 --11582
NM_024345chr996037 5838 4131 2132 2034 1323 1281 607 578 1546 ----
NM_024595chr11372 ------
NM_024659chr21644 ------
NM_024713chr1511510 ------
NM_024725chr111219 ------
NM_024761chr933308 2105 427 15249 13924 --
NM_024770chr264078 2578 1064 843 361 282 56594 6516 6289 4369 154 2708 641 25891 4194
NM_024811chr11----11688 --
NM_024813chr11127 1278 ----
NM_024893chr201980 ------
NM_024900chr411705 11774 ----
NM_024900chr411705 11774 ----
NM_024920chr411418 ------
NM_024947chr3119086 7898 7720 7142 7099 6136 3667 3649 2901 878 713 59390 9327 3226 3082 2400 27005 1676 17853
NM_024949chr474851 4778 4384 4374 1317 808 339 11573 24465 328 13789
NM_024953chr12102837 2455 2024 1015 1008 1001 950 750 637 419 22771 341 ----
NM_025073chr184750 4478 1770 1585 995 875 513 80 21242 313 ----
NM_025077chr11209 ------
NM_025134chr1642264 2144 739 80 ----12497
NM_025146chr322703 415 1568 12308 11778
NM_025191chr152822 2299 2207 1319 947 1106 --12876
NM_025263chr61416 ------
NM_030594chr151859 ------
NM_030625chr1042450 2003 1689 300 1205 --1257
NM_030627chr524012 3489 13853 23983 2704 --
NM_030647chr755574 5488 2286 2072 1176 26122 1647 --11341
NM_030650chr283694 3420 2887 1514 1051 496 402 354 ----1566
NM_030755chr1423114 613 1189 ----
NM_030759chr101667 ------
NM_030791chr1431526 655 89 21603 125 ----
NM_030806chr178289 3662 3483 2384 1810 1531 659 58765 5692 2734 2569 2034 2834 496 --
NM_030820chr6--1103 ----
NM_030917chr4----1166 --
NM_030920chr1----12055 --
NM_030979chr13--1393 ----
NM_031216chr1822124 244 11404 --1642
NM_031217chr111216 ------
NM_031296chr441745 479 156 68 22259 1939 ----
NM_031362chr2--12580 ----
NM_031365chr2--12716 ----
NM_031366chr2--12716 ----
NM_031492chr111423 ------
NM_031845chr252621 2571 623 613 521 33308 2631 39 ----
NM_031847chr252621 2571 623 613 521 33308 2631 39 ----
NM_032047chr321734 849 1708 ----
NM_032116chr13105725 4630 4527 4508 4295 1563 1184 592 438 159 35231 5174 1346 12100 12051
NM_032121chrX31856 1831 738 22705 267 ----
NM_032145chr611671 21395 1236 --1438
NM_032175chr541832 1608 1545 1444 21585 167 11670 --
NM_032221chr20--11921 ----
NM_032228chr1132177 1353 244 ----13511
NM_032229chr1321020 49 1319 ----
NM_032246chr1511142 31348 1323 197 ----
NM_032291chr131452 1381 461 21930 752 ----
NM_032315chr1--1270 --1235
NM_032321chr243218 1306 816 689 21153 164 ----
NM_032373chr1085539 4740 4071 3696 1403 1111 894 483 14851 11226 --
NM_032505chr321122 611 22587 2368 22156 616 --
NM_032521chr2022752 196 32995 2560 720 ----
NM_032539chrX3792 778 669 1559 ----
NM_032859chr1363227 2990 2459 2451 1402 704 1372 ----
NM_032883chr201593 ------
NM_033012chr131716 ------
NM_033020chr131905 1036 85 11624 14153 --
NM_033029chr31375 ------
NM_033030chr211480 ------
NM_033081chr2011178 ------
NM_033089chr20152 ------
NM_033181chr653863 3150 840 222 48 53448 2753 1437 980 709 23707 3065 --
NM_033224chr7126950 6276 6022 3182 3168 2878 2849 2318 2286 1886 1725 143 17652 ----
NM_033285chr884281 4234 4132 4063 3836 3811 1648 615 23098 378 ----
NM_033300chr111339 ------
NM_033394chr221165 483 1543 ----
NM_033430chr473306 2764 1579 1238 1228 534 412 11312 ----
NM_033437chr473306 2764 1579 1238 1228 534 412 11312 ----
NM_033480chr64862 698 265 254 1275 ----
NM_033481chr64862 698 265 254 1275 ----
NM_033505chr275075 4393 4216 1709 1576 861 649 35869 2187 327 --1220
NM_033656chr2144047 2070 988 933 15190 --25198 1787
NM_052811chr1383481 2084 1852 1761 1662 1603 1387 546 13758 1977 --
NM_052832chr832429 2037 1208 12461 12879 --
NM_052860chr52959 831 2708 389 --1252
NM_052879chr1243572 3382 1455 1132 21113 960 13367 --
NM_052885chr1234886 3211 1540 1235 14327 --
NM_052897chr121316 ------
NM_052927chr532104 1858 109 22199 1948 ----
NM_052958chr8--1591 1743 --
NM_053016chr9117468 6790 6683 6464 6281 5947 5176 2941 2311 1478 1226 25892 806 --36945 2271 1201
NM_053024chr3167 ----122
NM_057168chr72687 595 --11399 --
NM_058170chr121577 255 ------
NM_080422chr18----1213 --
NM_080423chr18----1213 --
NM_080546chr91827 21608 855 ----
NM_080597chr18----1690 --
NM_080629chr111195 21306 980 ----
NM_080630chr111195 21306 980 ----
NM_080645chr611899 --11677 11670
NM_080672chr201445 ------
NM_080927chr333199 2701 2489 1777 ----
NM_100264chr102769 73 2719 85 1103 --
NM_100486chr102769 73 2719 85 1103 --
NM_130395chr61290 ------
NM_130847chr1154852 2125 2045 1379 254 44538 4340 4239 4173 ----
NM_133369chr51901 ------
NM_133465chr9------1350
NM_133478chr212122 11909 ----
NM_133493chr643209 1661 688 559 23377 347 --11625
NM_133507chr12--1333 ----
NM_133646chr244944 4553 197 117 11175 --14952
NM_134428chr9158 ------
NM_138292chr113696 654 103 186 ----
NM_138333chr921999 328 22377 615 ----
NM_138348chr585971 5432 4839 2338 2293 1561 1119 516 44627 2511 643 376 14527 --
NM_138395chr221177 93 ------
NM_138401chr191262 ------
NM_138437chrX1238 ------
NM_138468chr276175 5955 5414 5089 4884 2019 355 35924 5464 4277 1329 --
NM_138694chr652882 1222 681 369 272 32632 1416 336 23294 2522 --
NM_138713chr1656383 1543 1500 1244 832 48024 7934 6673 2184 --13177
NM_138714chr1656383 1543 1500 1244 832 48024 7934 6673 2184 --13177
NM_138727chr162252 2132 1697 798 413 393 1476 11786 --
NM_138728chr162252 2132 1697 798 413 393 1476 11786 --
NM_138731chr1463662 1230 962 752 414 333 1826 33985 3794 3604 --
NM_138735chr211091 ------
NM_138771chr711282 1357 ----
NM_138779chr13----1253 --
NM_138798chr2138 ------
NM_138927chr211368 ------
NM_139070chr5--1443 ----
NM_139168chr511330 ----21476 97
NM_139215chr171106 ------
NM_144570chr1662826 2280 2261 1203 775 769 ------
NM_144571chr466198 4960 2715 2420 1368 95 15010 ----
NM_144578chr1494949 4668 4551 4320 1742 1226 1050 589 462 13925 11124 --
NM_144583chr21157 ------
NM_144632chr241978 1896 1783 1765 ------
NM_144664chr112971 161 --12499 --
NM_144949chr242130 2081 902 760 1985 190 1593
NM_145005chr95832 668 337 328 306 1967 ----
NM_145010chr10--1453 --133
NM_145014chr111335 ------
NM_145055chr181553 --12809 --
NM_145259chr245022 458 311 123 16585 14611 1164
NM_145307chr1044174 3937 3176 1802 ----13157
NM_145341chr1031177 426 230 195 1393 1558
NM_145725chr14------1402
NM_145726chr14------1402
NM_145805chr151510 ------
NM_145808chr763122 932 697 576 554 504 --12806 22665 2408
NM_148174chr81240 1726 2677 43 --
NM_148955chr1545036 4645 4508 425 76045 4815 4758 2028 2006 743 218 ----
NM_152261chr124925 488 461 197 ------
NM_152263chr195834 5657 5254 4499 4368 3680 2416 1766 1459 --25763 181 --
NM_152330chr1412013 21982 172 ----
NM_152371chr111726 ------
NM_152375chr112568 ------
NM_152388chr273821 3276 3099 2857 1390 1040 975 ----11020
NM_152390chr21547 ------
NM_152407chr552688 1268 1177 964 908 12605 11246 --
NM_152417chr82397 273 11223 ----
NM_152422chr92462 182 1275 ----
NM_152519chr211662 12114 --12006
NM_152522chr21789 2741 223 1406 --
NM_152529chr254405 3463 3433 2955 1415 12880 1848 --
NM_152549chr51143 ------
NM_152556chr731807 918 772 1800 --11743
NM_152594chr1541886 1603 1466 111 ----12194
NM_152608chr142333 2075 1804 1601 1975 ----
NM_152622chr563008 1263 1137 1057 966 243 13458 11070 12634
NM_152624chr5106403 6089 5998 2739 2252 1898 1202 669 291 230 35675 5569 559 12009 16647
NM_152672chr31195 ------
NM_152726chr13188 ------
NM_152727chr16--1245 ----
NM_152734chr645390 4226 4089 1727 24610 1498 --11703
NM_152758chr862999 2833 2754 2652 2128 545 --12708 --
NM_152826chr1545036 4645 4508 425 76045 4815 4758 2028 2006 743 218 ----
NM_152835chr141045 861 689 597 22229 309 22664 1870 --
NM_153020chr611120 11619 ----
NM_153188chr5125148 4596 4419 4400 4247 4110 3863 3639 2043 1448 1127 187 --21896 1647 --
NM_153331chr3--1499 ----
NM_153456chr13115776 4908 4802 4015 2348 2226 2162 1539 1090 649 62 22146 216 ----
NM_153607chr553133 2559 2416 1036 252 1243 12590 --
NM_153686chr4----12335 --
NM_153810chr1084580 4445 3663 2031 1708 981 724 606 33157 1287 359 ----
NM_170674chr1521362 1060 --11433 --
NM_170675chr1521038 736 --11109 --
NM_170676chr1521038 736 --11109 --
NM_170677chr1521362 1060 --11433 --
NM_172097chr151223 2330 317 ----
NM_172315chr1521362 1060 --11433 --
NM_172316chr1521362 1060 --11433 --
NM_173054chr72751 384 1305 ----
NM_173078chrX1397 ------
NM_173214chr1656383 1543 1500 1244 832 48024 7934 6673 2184 --13177
NM_173468chr455058 4532 4326 941 381 13891 ----
NM_173503chr171144 ------
NM_173531chr1943696 2740 811 229 11241 --11257
NM_173552chr352194 1832 1588 562 224 --1285 11542
NM_173582chr11105911 5053 4188 2481 1838 1667 1586 900 413 325 35743 3907 1087 11999 --
NM_173607chr1462107 1515 349 282 256 34 ------
NM_173808chr134290 3217 3051 ------
NM_173848chr82617 180 ----1623
NM_174911chr853918 2585 1585 1175 610 1334 --1628
NM_175624chr1273033 3020 2882 2381 2257 2248 46 36811 4894 2908 --12187
NM_175625chr1273033 3020 2882 2381 2257 2248 46 36811 4894 2908 --12187
NM_175876chr152569 2504 640 169 70 12453 ----
NM_177538chr2107950 7206 6920 5548 5410 2998 2547 2437 2151 1267 26948 1844 ----
NM_177995chr92462 182 1275 ----
NM_178151chrX44835 2497 2214 1473 11273 16215 --
NM_178152chrX44835 2497 2214 1473 11273 16215 --
NM_178153chrX44835 2497 2214 1473 11273 16215 --
NM_178154chr141320 ------
NM_178155chr141320 ------
NM_178156chr141320 ------
NM_178157chr141320 ------
NM_178424chr51205 1214 ----
NM_178470chrX21715 685 ------
NM_178507chr111789 ------
NM_178815chr1031695 603 583 22741 627 ----
NM_180989chr1321556 844 21691 145 22072 1922 --
NM_181077chr151143 ------
NM_181332chrX1451 12690 12403 --
NM_181354chr811342 11385 ----
NM_181489chr334855 1181 1136 56429 6017 5924 4932 2131 --25144 4473
NM_181571chr10----1156 --
NM_181581chr7--2827 626 ----
NM_181689chr201794 ------
NM_181726chr41202 ------
NM_181869chr1242554 2352 2186 1127 12250 --197
NM_182503chr654926 3777 2182 1195 146 1702 34729 4397 3425 15257
NM_182717chr10----1561 --
NM_182718chr10----1156 --
NM_182719chr10----1156 --
NM_182720chr10----1561 --
NM_182721chr10----1561 --
NM_182722chr10----1561 --
NM_182723chr10----1561 --
NM_182724chr10----1156 --
NM_182725chr10----1156 --
NM_182765chr1031775 728 125 --11978 --
NM_182769chr10----1156 --
NM_182770chr10----1156 --
NM_182771chr10----1156 --
NM_182772chr10----1156 --
NM_182850chr10----1156 --
NM_182853chr10----1561 --
NM_182896chr321124 474 21723 1189 ----
NM_182898chr786279 5925 5718 5570 4538 1155 632 442 12561 16437 11277
NM_182899chr786279 5925 5718 5570 4538 1155 632 442 12561 16437 11277
NM_182944chr141111 1454 ----
NM_183011chr10----1561 --
NM_183012chr10----1561 --
NM_183013chr10----1561 --
NM_183060chr10----1156 --
NM_183244chr201445 ------
NM_183246chr201445 ------
NM_194291chr81279 2567 558 ----
NM_194292chr161729 656 639 533 262 110 21273 135 ----
NM_194298chr1011979 ------
NM_194301chr141177 2782 423 ----
NM_194434chr18115732 5627 4588 4542 2197 1967 1941 1859 1428 923 754 13946 --13560
NM_194454chr711089 ----11463
NM_194455chr711089 ----11463
NM_194456chr711089 ----11463
NM_197970chr211480 ------
NM_198077chr12509 64 ------
NM_198261chr121489 ------
NM_198262chr121489 ------
NM_198270chrX53401 2891 2427 2415 997 32532 2319 201 ----
NM_198395chr51114 ------
NM_198401chr81545 ------
NM_198507chr51107 ------
NM_198513chr811955 1651 --11936
NM_198565chr31229 ------
NM_198581chr266064 5868 2893 2877 2773 2646 21916 1058 11518 --
NM_198715chr152313 1457 1101 573 222 54921 4737 4317 785 73 --25423 4535
NM_198793chr364068 3983 3642 3359 3279 3114 2523 66 1157 --
NM_199076chr101392 ------
NM_199144chr202537 530 ------
NM_199185chr5--1212 ----
NM_199188chr1243572 3382 1455 1132 21113 960 13367 --
NM_199189chr5----2186 153 --
NM_199190chr1243572 3382 1455 1132 21113 960 13367 --
NM_199203chr202537 530 ------
NM_199246chr53868 430 89 ------
NM_199482chr21160 ------
NM_201263chr11321 12044 --21833 1648
NM_201266chr2--1616 ----
NM_201278chr1142014 1543 1513 174 22205 224 ----
NM_201279chr2--1616 ----
NM_201281chr1142014 1543 1513 174 22205 224 ----
NM_201413chr211361 ------
NM_201414chr211361 ------
NM_201434chr172216 209 ------
NM_201613chr121638 ------
NM_203282chr1921246 730 ------
NM_203301chr1411288 ------
NM_203354chr142803 74 157 1859 --
NM_203355chr142803 74 157 1859 --
NM_203356chr142803 74 157 1859 --
NM_203434chr9--1225 ----
NM_203459chr172308 2138 1653 522 331 186 119 ----12488
NM_203504chr42830 341 --12208 12533
NM_203505chr42830 341 --12208 12533
NM_206594chr143297 2700 1377 904 22873 765 ----
NM_206595chr143297 2700 1377 904 22873 765 ----
NM_206832chr17----1215 --
NM_206853chr643528 1308 538 343 1412 13565 --
NM_206854chr644789 1799 1604 513 11673 14826 --
NM_206855chr625754 1478 --15791 --
NM_206907chr522538 1147 33332 2800 2320 12571 --
NM_206909chr868091 7538 6348 6113 5507 568 25214 476 --16806
NM_207012chr1042504 1393 859 174 32237 830 524 1916 13487
NM_207123chr42781 159 ------
NM_207292chr333413 2540 651 1638 12095 11237
NM_207293chr333413 2540 651 1638 12095 11237
NM_207294chr333413 2540 651 1638 12095 11237
NM_207295chr333413 2540 651 1638 12095 11237
NM_207296chr333413 2540 651 1638 12095 11237
NM_207297chr333438 2565 676 1663 12120 11262
NM_207647chr942569 2040 1881 1870 11026 12425 --
NM_212460chr73595 518 423 11946 ----
NM_212474chr23919 390 106 1354 ----
NM_212475chr23919 390 106 1354 ----
NM_212476chr23919 390 106 1354 ----
NM_212478chr23919 390 106 1354 ----
NM_212482chr23919 390 106 1354 ----
NM_213589chr245466 3994 2235 472 44729 1953 1200 1089 14653 --
NM_213590chr1383481 2084 1852 1761 1662 1603 1387 546 13758 1977 --