TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4804-5p
miRNA Sequence: UUGGACGGUAAGGUUAAGCAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5--1327 --1165
NM_000053chr1331812 1341 128 11390 11428 --
NM_000093chr972185 2060 2036 1804 1662 993 703 --1260 --
NM_000332chr636285 5905 1487 ----15821
NM_000368chr954808 4109 4056 3288 3024 11779 ----
NM_000376chr1272266 1268 838 786 655 413 100 ----1162
NM_000430chr1753258 3066 2972 2894 2493 --23470 2441 --
NM_000461chr354130 3295 2833 1226 298 ------
NM_000719chr1266038 4477 4425 4206 1385 558 --24241 2001 --
NM_000813chr523754 1072 --14340 11915
NM_000831chr186003 5598 5255 4395 1762 1636 1325 79 ------
NM_000872chr1051440 1318 1067 442 67 1272 ----
NM_000875chr1556095 551 416 311 305 --1708 --
NM_001001664chr232613 1367 107 ----1637
NM_001001924chr811867 11380 --1194
NM_001001925chr811867 11380 --1194
NM_001001931chr811867 11380 --1194
NM_001003810chr4------1530
NM_001006932chr662204 787 737 622 519 75 --13020 --
NM_001007466chr665194 4872 4141 3821 1488 37 25114 4383 ----
NM_001008220chr54998 894 475 335 --23538 900 --
NM_001009993chr254323 3555 3472 1492 583 ------
NM_001010000chr1833086 3066 2787 --13119 --
NM_001010862chrX----1919 1180
NM_001010888chrX11071 14220 11586 14060
NM_001011666chr745380 4853 4738 2135 26194 542 ----
NM_001014797chr1047034 6636 6509 1750 11939 11801 --
NM_001017440chr756236 5562 3026 1992 607 16078 27703 128 --
NM_001017535chr1272266 1268 838 786 655 413 100 ----1162
NM_001017999chr151955 1716 1497 580 504 21862 481 ----
NM_001017999chr151955 1716 1497 580 504 21862 481 ----
NM_001018000chr151955 1716 1497 580 504 21862 481 ----
NM_001018000chr151955 1716 1497 580 504 21862 481 ----
NM_001018001chr151955 1716 1497 580 504 21862 481 ----
NM_001025076chr1054759 4688 3834 425 118 ------
NM_001025077chr1066117 6046 5192 1783 1476 1169 ------
NM_001030007chr16------13059
NM_001031695chr2255090 4588 1292 887 625 ----13894
NM_001033117chr3104827 4760 4433 3998 3476 3316 1273 1197 172 116 --1792 --
NM_001033551chr1753941 3127 2843 2571 1372 --23934 3804 --
NM_001035005chr181511 ----1490
NM_001039577chr143830 2879 1716 926 11311 --125
NM_001040152chr761733 674 589 556 351 262 1119 ----
NM_001042355chr1654976 4579 656 645 85 ------
NM_001042412chr1654976 4579 656 645 85 ------
NM_001042555chr1264568 1292 1113 1041 681 588 23884 2993 ----
NM_001100108chr168244 7689 6920 6162 5685 595 12893 12650 --
NM_001106chr356922 3778 1170 1164 313 18311 124 --
NM_001122679chr5--1327 --1165
NM_001128chr16------13059
NM_001206chr923072 240 23151 2030 ----
NM_001257chr1621104 569 --1575 --
NM_001259chr744995 4341 4247 4154 ------
NM_001390chr1843306 3186 2606 1045 12397 12740 --
NM_001419chr1953897 3704 3574 3387 1683 14281 2777 570 --
NM_001543chr573293 1867 584 394 324 300 238 ------
NM_001546chr61198 ----11431
NM_001650chr1841327 1062 335 45 24055 3810 ----
NM_001659chr1251698 367 339 200 119 --22367 171 --
NM_001677chr1------1426
NM_001845chr13------1102
NM_001987chr1232729 646 364 13554 --1937
NM_002025chrX38765 8328 793 27193 890 17573 --
NM_002092chr434798 2006 726 14084 23416 241 --
NM_002138chr4------1530
NM_002158chr212877 1238 --11003
NM_002203chr543471 2876 2848 690 ------
NM_002264chr334093 3306 1884 ----14330
NM_002293chr12973 123 --1114 --
NM_002309chr2262750 2741 2518 2222 2155 965 --22503 2163 171
NM_002359chr17104221 3924 3608 2886 2784 1610 1164 1140 1076 69 ------
NM_002481chr157222 6342 5434 1733 325 ------
NM_002501chr1984046 3946 3785 3607 2679 1563 1170 844 --23023 1437 --
NM_002519chr11------11237
NM_002577chr313143 ----13988
NM_002716chr1173606 3556 3271 3218 3108 3062 219 ------
NM_002745chr2272833 1544 1295 1143 595 568 95 ----11415
NM_002788chr14------184
NM_003099chr1576285 5887 4553 1151 140 124 55 --1506 --
NM_003155chr822157 1994 ----1593
NM_003199chr1834623 4554 802 24444 3515 ----
NM_003221chr644177 3729 1570 490 --1240 --
NM_003337chr5------1655
NM_003387chr222217 377 1482 --1524
NM_003607chr163787 3511 3102 1128 1099 747 ------
NM_003748chr13555 423 35 --240 24 --
NM_003895chr2141445 1394 1376 704 ------
NM_004028chr1841327 1062 335 45 24055 3810 ----
NM_004171chr1189302 8334 7741 6009 2376 2023 1002 976 ----1210
NM_004302chr1272755 2503 2376 2220 2124 902 703 --1544 12932
NM_004316chr12------11034
NM_004321chr283498 3478 3384 2854 1370 853 286 63 ----13565
NM_004323chr93897 613 58 --22449 221 --
NM_004600chr111013 1409 --11289
NM_004687chr1721925 439 ----123
NM_004747chr1041397 440 394 91 --196 --
NM_004836chr2------171
NM_004845chrX63961 3809 3723 3255 389 238 11373 13846 --
NM_004904chr745380 4853 4738 2135 26194 542 ----
NM_004992chrX66623 5431 5190 2802 2449 2403 --1420 25677 2090
NM_004992chrX66623 5431 5190 2802 2449 2403 --1420 25677 2090
NM_005028chr1032256 806 727 --21787 1705 --
NM_005116chr20104095 4020 3912 1682 1664 1361 1291 1279 883 227 ------
NM_005436chr1032993 2621 238 --153 13882
NM_005455chr1----1424 188
NM_005491chrX52095 2073 850 534 369 1447 --152
NM_005578chr323970 880 ----1984
NM_005596chr932527 2404 1476 155 14176 --
NM_005614chr72834 63 ----2917 169
NM_005776chr141322 ----185
NM_006095chr422845 1237 1507 13087 --
NM_006224chr176936 786 655 270 186 102 ------
NM_006242chr2021817 672 ----11743
NM_006251chr512109 ----13161
NM_006283chr831829 1420 143 14137 --13903
NM_006454chr432822 2005 1144 --43051 452 444 436 --
NM_006546chr1775992 5471 4115 2427 2318 865 812 16149 ----
NM_006561chr1054759 4688 3834 425 118 ------
NM_006644chr13------1467
NM_006650chr54998 894 475 335 --23538 900 --
NM_006651chr471450 1394 1263 1072 544 538 481 --1531 --
NM_006654chr1264568 1292 1113 1041 681 588 23884 2993 ----
NM_006690chr2072222 952 926 706 483 328 226 --22006 1784 --
NM_006838chr12------1163
NM_006888chr142831 191 --23074 151 --
NM_007007chr1241912 591 537 68 --14627 --
NM_007050chr2056796 6655 6647 2040 668 21267 1145 22601 640 --
NM_007189chr741104 457 244 199 --1221 --
NM_007249chr1378660 8361 8144 7100 2903 726 196 17835 18101 17248
NM_012129chr711952 ----12225
NM_012214chr245802 5054 1534 187 11130 16383 --
NM_012288chr675208 4984 1328 429 258 246 105 ------
NM_012300chr542447 687 447 85 ----1492
NM_012306chr1283418 2897 1062 783 529 413 57 24 12396 13493 --
NM_013286chr363526 3007 1348 1025 992 647 --2800 144 --
NM_014023chr1052802 2473 1820 1782 785 ------
NM_014112chr824627 739 11055 --14163
NM_014190chr45696 429 374 316 73 ----1288
NM_014231chr12102039 1840 1791 1758 1619 592 163 149 95 28 ------
NM_014232chr1731374 584 58 --1490 --
NM_014232chr1731374 584 58 --1490 --
NM_014286chr9102970 2542 955 537 463 456 387 305 164 89 ------
NM_014299chr1981837 1798 733 512 476 251 164 140 --11786 --
NM_014309chr2255080 4578 1282 877 615 ----13884
NM_014390chr72440 393 ----1408
NM_014494chr163918 445 418 12204 ----
NM_014665chr843312 2245 1328 282 13635 1572 11191
NM_014730chr1254676 4322 3737 1317 207 --25279 654 --
NM_014730chr1254676 4322 3737 1317 207 --25279 654 --
NM_014767chr1093416 2330 1319 1215 1188 945 801 666 530 ------
NM_014819chr531942 1796 354 ------
NM_014826chr163787 3511 3102 1128 1099 747 ------
NM_014830chr1231065 783 288 13745 1932 13676
NM_014835chr2042090 1552 819 194 ----1669
NM_014840chr1222766 2540 --21083 263 --
NM_014850chr3104827 4760 4433 3998 3476 3316 1273 1197 172 116 --1792 --
NM_014860chr22259 27 ----1774
NM_014864chr143097 2880 1261 459 ------
NM_014997chr732609 1943 1134 --12068 --
NM_015033chr973025 2095 816 796 769 336 51 12460 ----
NM_015035chr2045542 1779 1622 94 --25042 1445 --
NM_015071chr566132 5701 5576 4033 1896 1840 ------
NM_015074chr164117 3951 1633 1182 154 131 ------
NM_015090chr1115796 5160 5098 4805 4673 2434 2130 1784 1415 1355 303 --21031 1011 16147
NM_015209chr151955 1716 1497 580 504 21862 481 ----
NM_015247chr1654976 4579 656 645 85 ------
NM_015288chr593797 3679 3232 2797 2665 2641 2539 1143 1122 ------
NM_015310chr867992 6745 6254 2278 1730 1070 --12458 --
NM_015313chr1144414 1739 1722 934 14002 1588 --
NM_015332chr753435 2362 2337 961 857 13150 11251 --
NM_015493chr1972195 1994 594 528 74 57 44 ------
NM_015575chr212650 1156 11091 12854
NM_015678chr132333 89 ----1599
NM_015850chr871906 1818 1727 980 936 91 81 ----11804
NM_016083chr663210 3180 3019 1107 389 370 13942 ----
NM_016621chr1184473 4100 4039 3725 3625 3033 3023 835 --13333 --
NM_017563chr365969 4247 1802 664 655 225 ------
NM_017596chr184544 4312 3507 1496 1420 185 167 136 12941 13768 13101
NM_017860chr11228 ----1692
NM_018416chr126748 553 303 282 92 79 --1269 --
NM_019008chr2253720 3269 2645 1195 396 --13120 --
NM_019009chr1152565 1729 280 247 74 --3741 590 141 --
NM_019106chr2262778 2297 2170 2130 1073 92 --22966 273 12878
NM_019859chr1051471 1349 1098 473 98 1303 ----
NM_019860chr1051519 1397 1146 521 146 1351 ----
NM_019884chr192468 133 ----2585 426
NM_020182chr2073355 3187 3174 2922 2650 2600 796 --13077 --
NM_020245chr655100 4778 4047 3727 1394 25020 4289 ----
NM_020310chr17122223 2089 2043 2037 1119 917 909 840 793 777 245 51 ------
NM_020337chr412558 12121 --13195
NM_020749chr811867 11380 --1194
NM_020772chr1756683 2347 2312 1579 52 ----12586
NM_020909chr263198 1527 1403 1216 87 41 ----1163
NM_020918chr1063466 3396 3061 835 586 111 --11059 --
NM_021135chr662204 787 737 622 519 75 --13020 --
NM_021911chr523754 1072 --14340 11915
NM_022166chr1645810 5529 1753 1032 14682 21119 795 --
NM_022477chr201577 --11465 1645
NM_022648chr244144 4126 3672 877 14156 23595 3058 1698
NM_022780chr2------11167
NM_022894chr2------1631
NM_023105chr871906 1818 1727 980 936 91 81 ----11804
NM_023106chr871906 1818 1727 980 936 91 81 ----11804
NM_023110chr871906 1818 1727 980 936 91 81 ----11804
NM_023111chr871906 1818 1727 980 936 91 81 ----11804
NM_024052chr1752707 2629 2388 1924 319 13124 ----
NM_024554chr141461 1432 174 60 ----11741
NM_024594chr511845 ----11611
NM_024761chr943591 609 267 249 11539 ----
NM_024811chr1141909 1624 1506 268 1305 --1344
NM_025073chr134186 3381 1124 1659 2159 74 --
NM_025179chr163966 3253 3217 1619 208 108 ----2427 41
NM_025251chr86955 809 803 461 415 409 ------
NM_030623chr2------1188
NM_030674chr1254287 1766 1520 1333 963 1850 11343 --
NM_030806chr169092 8162 7161 6397 1982 266 --26870 3165 --
NM_031369chr4------1530
NM_031370chr4------1530
NM_031468chr756236 5562 3026 1992 607 16078 27703 128 --
NM_032013chr201577 --11465 1645
NM_032199chr1043329 2370 1021 718 ------
NM_032236chr12891 146 --11011 --
NM_032242chr373155 2676 2312 1160 938 747 382 ------
NM_032711chr17104221 3924 3608 2886 2784 1610 1164 1140 1076 69 ------
NM_032975chr1843306 3186 2606 1045 12397 12740 --
NM_032980chr1843306 3186 2606 1045 12397 12740 --
NM_033131chr121286 1172 --11313 11792
NM_033181chr663210 3180 3019 1107 389 370 13942 ----
NM_033224chr767203 6627 6310 6177 5350 5184 25617 357 --17794
NM_033644chr542447 687 447 85 ----1492
NM_033645chr542447 687 447 85 ----1492
NM_052918chr10------13207
NM_053016chr925528 516 --15713 1964
NM_133170chr2056796 6655 6647 2040 668 21267 1145 22601 640 --
NM_144498chr2042090 1552 819 194 ----1669
NM_144582chr22979 268 1400 --1440
NM_145206chr1023326 2351 22068 1200 1463 --
NM_145259chr226023 4811 ----14985
NM_145313chr1041130 1094 681 550 ----1590
NM_148894chr4------11024
NM_148955chr1576285 5887 4553 1151 140 124 55 --1506 --
NM_152132chr14------184
NM_152253chr2253986 2701 1735 1463 1381 --24301 524 --
NM_152470chr1854095 2863 573 342 206 14065 11493 --
NM_152694chrX------1281
NM_152733chr695505 5266 5188 4921 2522 2244 1436 1195 1119 ----16341
NM_152826chr1576285 5887 4553 1151 140 124 55 --1506 --
NM_152988chr1981693 1567 1538 1526 1302 270 117 92 ------
NM_153029chr1683808 3395 3380 2799 1532 1501 1294 1285 --33784 3648 723 --
NM_153035chr12868 127 ----163
NM_153487chr683630 1486 1339 1170 566 558 395 54 --21540 610 --
NM_153812chr122050 1616 11610 11818 1148
NM_172071chr132351 1500 865 15602 --11146
NM_173172chr2--1172 --11210
NM_173470chrX------12928
NM_173642chr147812 6533 2960 1052 ------
NM_176801chr45696 429 374 316 73 ----1288
NM_177968chr212171 21597 573 11605 --
NM_178013chr1453082 3000 2632 780 97 --11976 --
NM_182898chr745380 4853 4738 2135 26194 542 ----
NM_182899chr745380 4853 4738 2135 26194 542 ----
NM_182970chr2033975 577 368 --1592 24026 317
NM_194247chr2187 11221 --13597
NM_198843chr231465 462 34 ----11351
NM_199000chr72362 269 12236 1652 --
NM_199169chr2073355 3187 3174 2922 2650 2600 796 --13077 --
NM_199170chr2073355 3187 3174 2922 2650 2600 796 --13077 --
NM_199171chr2073355 3187 3174 2922 2650 2600 796 --13077 --
NM_199245chr12122445 2246 2197 2164 2025 998 569 555 501 434 388 364 ------
NM_203327chr20104095 4020 3912 1682 1664 1361 1291 1279 883 227 ------
NM_203446chr2152255 2204 2186 1842 718 ------
NM_203458chr143691 3660 2720 1463 ------
NM_206907chr512109 ----13161
NM_206909chr867992 6745 6254 2278 1730 1070 --12458 --
NM_207577chr1142657 2557 2520 581 ----1786
NM_213589chr22927 118 --24787 398 --