TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-483-3p
miRNA Sequence: UCACUCCUCUCCUCCCGUCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001008408chr796167 4435 4266 4197 4182 2222 1876 574 565 11008 25218 4281 15863
NM_001024647chr1267115 7100 6009 2294 2170 735 --27222 746 192
NM_004774chr1752606 2515 1138 855 270 --1279 2555 81
NM_152624chr586596 4918 4738 2414 2132 1264 1256 1007 ----11782