TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-483-5p
miRNA Sequence: AAGACGGGAGGAAAGAAGGGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX25393 5379 --36330 2201 1320 --
NM_000117chrX------1319
NM_000192chr12----1392 --
NM_000278chr1081839 1685 1665 1656 1650 885 605 304 --21739 62 --
NM_000314chr10----1285 --
NM_000332chr656580 6187 5904 5818 2241 12188 26208 5403 --
NM_000362chr2243144 2415 1240 565 --12995 23494 3089
NM_000430chr1743065 2904 2535 2483 22543 2441 ----
NM_000480chr1121446 531 ----11589
NM_000484chr21----1101 --
NM_000599chr263829 3763 3241 3098 865 562 ----14481
NM_000633chr1854240 3268 2109 1152 849 15237 21181 290 11465
NM_000723chr1731387 516 103 11328 31636 1299 1195 --
NM_000806chr5195 --1155 --
NM_000814chr152692 63 13231 13023 --
NM_000829chr1121965 126 --22224 2039 --
NM_000844chr31318 --1334 --
NM_000870chr551245 486 313 291 113 --2460 436 --
NM_000875chr1555439 4913 1200 706 310 16987 26613 1958 --
NM_001003681chr22----1417 --
NM_001004360chr2----1200 --
NM_001005463chr1032495 695 306 --11838 --
NM_001005473chr536077 5927 2331 1347 ----
NM_001007098chr11209 --1131 --
NM_001007102chr631401 1316 1162 1198 ----
NM_001007226chr17--128 1313 --
NM_001007471chr91862 --1633 --
NM_001008222chrX----11356 --
NM_001008701chr1932885 2851 2382 ------
NM_001010888chrX11584 11071 --14219
NM_001011537chr311840 --1202 --
NM_001012393chr1121809 1432 --24189 884 --
NM_001012398chr16----1168 --
NM_001013690chr1231918 512 41 12493 12464 --
NM_001013693chr122623 279 149 22111 688 --
NM_001014443chr1------164
NM_001015887chr321365 437 --1677 --
NM_001017969chr91547 ------
NM_001018050chr2222908 777 ------
NM_001024688chr8----11595 --
NM_001024808chr1231797 912 268 ------
NM_001025077chr10116266 6246 6116 6030 5280 1846 1480 1419 1168 1118 1069 1954 21202 69 --
NM_001025079chr3--13256 1729 --
NM_001025596chr112454 52 --1114 --
NM_001025780chr9----11391 --
NM_001029875chr532649 2545 1158 ------
NM_001031695chr2225089 4597 --21889 616 --
NM_001037164chr7--11914 191 --
NM_001038493chr24613 581 554 249 --3566 194 28 --
NM_001038493chr24613 581 554 249 --3566 194 28 --
NM_001039590chrX1137 ----11350
NM_001039616chr19----151 --
NM_001040056chr162667 34 ----1773
NM_001040152chr755008 1733 1157 414 347 ------
NM_001040153chr13----1690 --
NM_001040439chr161556 --31356 1180 576 --
NM_001040450chr1532921 2803 87 --22756 1143 --
NM_001042404chr11690 11617 1121 --
NM_001042537chrX------11899
NM_001042555chr12----1226 --
NM_001042599chr2----16713 --
NM_001042603chr1264397 3272 1821 1677 757 731 --23705 1456 --
NM_001100108chr198325 8243 7035 5684 5235 2648 2560 831 812 --26162 5943 --
NM_001106chr387511 6921 3306 2820 1673 1169 354 312 --39363 3800 390 --
NM_001206chr92595 470 --23077 240 --
NM_001222chr102659 187 ------
NM_001270chr511020 --11032 --
NM_001304chr1711317 ------
NM_001364chr1144434 3446 3020 2966 --23877 2983 --
NM_001406chr1731327 419 222 --2198 144 --
NM_001407chr31274 --11684 11346
NM_001420chr1922565 991 --1259 --
NM_001495chr81901 --1138 --
NM_001616chr222350 1130 --12565 --
NM_001627chr311571 11592 --12414
NM_001664chr3----3875 731 179 --
NM_001665chr11----1579 --
NM_001701chr9----11331 --
NM_001760chr6------1880
NM_001958chr20----1261 --
NM_002025chrX48764 6407 6247 3004 --18958 --
NM_002126chr1754145 811 714 577 248 --22699 54 --
NM_002147chr171870 --1885 --
NM_002306chr14----1149 --
NM_002332chr12----2705 578 --
NM_002356chr621014 497 --147 --
NM_002359chr17113607 3525 3393 2790 2783 1610 1139 815 599 179 68 ------
NM_002375chr32720 28 --122 --
NM_002382chr143231 47 34 --11083 --
NM_002419chr111529 ------
NM_002469chr12------1346
NM_002501chr1984081 3987 3784 3399 3021 1562 1435 843 --24046 3946 --
NM_002576chr111825 --11025 --
NM_002577chr323985 3082 --13509 --
NM_002581chr923718 1580 14649 14888 15028
NM_002698chr1922031 1207 --12318 12748
NM_002713chr11106 --1185 --
NM_002719chr1431839 810 116 1744 ----
NM_002731chr122882 518 ------
NM_002734chr1712200 --1118 --
NM_002742chr14----1276 --
NM_002745chr222567 128 --295 84 --
NM_002855chr1133433 2673 23 --1306 1881
NM_002869chr11----1139 --
NM_003011chr911430 1465 1246 --
NM_003081chr202454 427 --11152 --
NM_003107chr632585 763 153 12131 21945 645 --
NM_003108chr247025 5400 2105 255 --16181 --
NM_003112chr722639 510 ------
NM_003139chr113929 352 154 --193 --
NM_003161chr17--21136 1073 1749 --
NM_003179chrX41241 284 239 165 --1115 --
NM_003185chr20----11228 --
NM_003205chr151292 --11426 --
NM_003221chr633729 3321 1570 --22819 490 --
NM_003298chr355906 5276 5266 4921 2191 --1118 --
NM_003345chr16----1178 --
NM_003404chr2011484 --21831 1358 --
NM_003557chr111027 11351 31388 1145 366 11198
NM_003618chr2----1100 --
NM_003633chr521793 716 --12403 --
NM_003768chr111831 --11565 --
NM_003806chr12----1100 --
NM_003913chr623562 3087 ------
NM_003936chr221192 1181 --2367 250 --
NM_003980chr6----198 --
NM_004041chr111253 --165 --
NM_004056chr8127 --1403 --
NM_004098chr10--1425 --1248
NM_004104chr171107 --1737 --
NM_004112chr17----165 11478
NM_004171chr1136481 3479 2920 1209 22052 530 --
NM_004202chrY----1186 --
NM_004272chr5145 11317 1446 --
NM_004274chr1443136 2950 273 230 1127 --1395
NM_004309chr1751114 1045 914 797 307 --1216 --
NM_004330chr15----1398 --
NM_004504chr222928 1866 --1562 --
NM_004774chr1753064 2495 2157 1990 480 ----12381
NM_004783chr162511 494 ------
NM_004831chr19----1895 --
NM_004866chr5----23948 1091 --
NM_004921chr14563 537 182 97 --22186 937 --
NM_004926chr14----21861 656 --
NM_004965chr211260 --136 --
NM_004992chrX77733 6811 5655 2876 2818 2402 1896 12282 78465 8181 6058 3093 1455 637 396 1420
NM_005067chr3------1841
NM_005229chrX11084 --41209 1090 801 445 --
NM_005312chr942090 1731 701 452 --22642 2398 --
NM_005329chr16----22192 243 --
NM_005386chr20----1885 --
NM_005436chr10--23249 53 12671 --
NM_005539chr104903 895 483 187 --1192 --
NM_005596chr934738 4343 391 --12371 --
NM_005602chr321337 66 --1132 --
NM_005610chr1----1622 --
NM_005618chr61177 --130 --
NM_005639chr121447 --1688 --
NM_005647chrX72707 2676 2388 2267 681 619 602 --1129 --
NM_005766chr131927 --3999 133 94 --
NM_005789chr1761416 1334 788 721 347 231 --21543 1328 --
NM_005819chr143378 3126 434 250 184 --13199
NM_005967chr12----1461 --
NM_006009chr12----1207 --
NM_006037chr244693 948 44 34 --24043 1464 --
NM_006201chrX3245 235 168 --1189 --
NM_006216chr21632 --1596 --
NM_006224chr176943 935 830 654 269 186 ------
NM_006246chr14----1145 --
NM_006265chr8----21393 364 --
NM_006306chrX14347 11563 127 --
NM_006315chr422996 835 --1980 11781
NM_006352chr12609 271 --11501 --
NM_006403chr631811 1207 63 ------
NM_006547chr71653 --1156 --
NM_006577chr2------1959
NM_006593chr22584 131 --1293 --
NM_006763chr121337 428 --12000 --
NM_006790chr5----1375 --
NM_006838chr12--1162 --1229
NM_006852chr1732691 697 525 ------
NM_006885chr1622738 1115 --13349 --
NM_006888chr1433244 2983 190 --22356 1246 --
NM_007008chr2----1168 --
NM_007124chr61344 1649 ----
NM_007189chr721535 198 --31236 1104 188 --
NM_007249chr1358268 3586 2653 725 196 ----1791
NM_007260chr17736 667 599 502 194 114 94 --1729 --
NM_012104chr1123615 995 --13482 --
NM_012199chr123246 1723 --23026 746 --
NM_012300chr5----2240 22 --
NM_012319chr181136 --11007 --
NM_012333chr111060 --1591 --
NM_012334chr524349 1849 --34185 776 24 --
NM_012402chr111348 ----1200
NM_012479chr742184 425 266 130 --2393 136 --
NM_013286chr343007 1347 242 142 --22684 1360 12482
NM_013364chrX21934 1720 --1538 --
NM_013446chr7----1143 --
NM_013449chr1222955 547 --1693 --
NM_013995chrX21930 263 1320 12597 --
NM_014015chr16------1762
NM_014039chr111329 ----1215
NM_014212chr12----182 --
NM_014283chr111062 --11374 --
NM_014460chr2241480 317 136 129 11318 11133 --
NM_014472chr10----1167 --
NM_014480chr19----1539 --
NM_014587chr1641011 1005 521 255 --11457 --
NM_014665chr883311 3277 2342 1328 1149 676 648 282 --12431 --
NM_014705chr7--1599 --142
NM_014723chr2082642 2136 1093 701 679 422 395 337 12227 12055 --
NM_014729chr821527 869 --11973 --
NM_014767chr1093618 3415 2375 2329 1187 944 790 665 529 1567 1479 --
NM_014810chr122316 1411 ----13500
NM_014840chr1253285 2985 2766 2611 123 ------
NM_014868chr12----1191 --
NM_014872chr91887 --2471 440 --
NM_014887chr13----162 --
NM_014918chr15----11077 --
NM_014939chr18----21150 446 --
NM_014949chr1----1684 --
NM_014991chr432754 273 58 193 22087 917 --
NM_014994chr1532206 787 429 --12376 11693
NM_015039chr131615 1415 278 --23519 92 --
NM_015071chr594649 4549 4532 4297 4032 1404 594 263 124 16019 14636 15188
NM_015090chr155268 4229 4173 1029 1009 16146 ----
NM_015092chr1632943 753 673 --11621 --
NM_015097chr331664 904 524 ------
NM_015100chr111398 --11888 --
NM_015107chrX2285 270 --12392 --
NM_015144chr1653338 3236 3112 1081 1046 ------
NM_015150chr32615 321 --1927 --
NM_015155chr1022970 2287 13334 23101 2892 --
NM_015161chr163433 404 56 --11457 --
NM_015185chrX2307 280 --22142 955 --
NM_015192chr2022089 903 ------
NM_015246chr1651994 1291 469 256 73 --192 --
NM_015270chr1252177 2033 1725 901 856 --31648 355 158 --
NM_015272chr1611608 11588 11485 --
NM_015296chr13----1110 --
NM_015299chr1433604 3346 32 --23492 3475 --
NM_015305chr1431738 729 356 11716 11698 --
NM_015326chr142337 2294 1928 633 --2810 138 --
NM_015349chr6----1107 --
NM_015384chr5------1109
NM_015443chr1721425 220 --11049 --
NM_015447chr9----1686 --
NM_015455chr534104 3275 925 11438 1231 --
NM_015589chr14----1133 --
NM_015626chr17--11008 1495 --
NM_015635chr931438 604 389 --1178 --
NM_015678chr131104 ----189
NM_015984chr1----1127 --
NM_015994chr141562 --1478 --
NM_015995chr1554425 3804 3470 1239 847 ------
NM_016131chr211493 --141 --
NM_016250chr141626 --1782 --
NM_016284chr16----1155 --
NM_016396chr1521973 601 --1109 --
NM_016628chr10----1337 --
NM_017586chr941932 1879 786 27 ----11619
NM_017778chr82990 435 ------
NM_017922chr14----1107 --
NM_017943chr14----11035 --
NM_018086chr2----1522 --
NM_018144chr10----1130 --
NM_018214chr61142 --159 --
NM_018275chr7----2429 133 --
NM_018489chr11711 --11722 --
NM_018898chr512034 1147 1339 --
NM_018999chr10----1702 --
NM_019063chr221854 567 --12282 --
NM_019102chr7----1404 --
NM_019106chr2272296 1356 1237 1229 661 283 271 --43316 3205 721 105 --
NM_019116chr1633750 2702 1352 --12312 --
NM_019605chr1------1565
NM_019854chr12180 --1298 --
NM_019886chrX2626 522 --1426 --
NM_020122chr276017 4426 3769 1458 1443 1424 631 15157 1672 --
NM_020123chr10----11212 --
NM_020179chr11----1126 --
NM_020205chr142728 1340 602 270 --1725 --
NM_020337chr422557 1118 ----1881
NM_020346chr11----11347 --
NM_020378chr196589 571 553 451 170 69 ------
NM_020546chr573207 983 550 505 486 153 101 --3999 694 600 --
NM_020640chr32838 347 --11878 1781
NM_020692chr141726 --21095 283 --
NM_020699chr144960 3419 1219 227 --13639 --
NM_020708chr202733 464 186 22508 259 --
NM_020772chr1768274 6788 5669 2580 2346 931 --11268 --
NM_020870chr42868 230 --21985 1422 --
NM_020939chr651386 418 390 345 311 --31432 1362 1125 --
NM_020956chr1964589 4414 742 532 368 42 --24732 3784 --
NM_020988chr1621043 341 ----1128
NM_021033chr1323031 479 --1914 --
NM_021038chr31804 ----1251
NM_021117chr1122024 1532 --22330 1941 --
NM_021132chr10------11348
NM_021183chrX----1120 --
NM_021724chr171221 --1267 --
NM_021964chr334994 4737 1359 --11888 --
NM_022049chr11384 --21183 479 --
NM_022340chr322940 1049 --33275 882 559 13421
NM_022494chr10----1449 --
NM_022574chr72597 464 --42100 1836 1478 558 --
NM_022728chr7------145
NM_022836chr1----1564 --
NM_023009chr12282 258 ----1485
NM_024779chr1231563 1443 147 --11109 --
NM_024804chr11370 --172 --
NM_025160chr12537 110 --1309 --
NM_025208chr11----1642 --
NM_030567chr5----1119 --
NM_030576chr17----1714 --
NM_030647chr7----15898 11901
NM_030648chr444808 3724 2008 1448 --14718 13393
NM_030758chr22----11084 --
NM_030914chr92843 87 ------
NM_031216chr1821919 96 --11597 --
NM_032017chr171906 1796 1624 711 476 287 270 --1787 --
NM_032124chr181323 --1989 --
NM_032182chr1021579 1417 ------
NM_032199chr1012540 --23509 622 --
NM_032217chr41196 --11380 --
NM_032221chr20--1347 1131 --
NM_032283chr1----135 --
NM_032354chr17----1746 --
NM_032373chr102491 54 ------
NM_032452chr142295 205 --1170 --
NM_032514chr20----1287 --
NM_032595chr1751384 1277 564 490 63 ------
NM_032859chr13----192 --
NM_032871chr1121215 352 --1678 --
NM_033133chr1733730 2601 165 --23179 1356 --
NM_033224chr735349 4900 1445 --15184 --
NM_033296chr42844 121 --1662 1111
NM_033626chrX2403 374 --11726 --
NM_033631chr143781 3220 378 251 --23851 1445 --
NM_052925chr191294 --1143 --
NM_057175chr412340 --11841 --
NM_058167chr141136 1034 804 193 --1293 --
NM_058243chr191851 --1174 --
NM_080617chr201253 --1142 --
NM_080621chr2011290 --21320 1315 --
NM_080723chr61403 --1416 --
NM_080867chr141461 11382 13490 --
NM_101395chr2122537 1370 1490 1353 140
NM_130474chr112877 866 --1120 --
NM_133265chrX----11339 --
NM_138350chr12948 438 --11027 --
NM_138396chr122284 110 ----1772
NM_138409chr61364 --11366 --
NM_138426chr7------1333
NM_138473chr1233136 1155 726 14552 ----
NM_139283chr1222190 2153 --1132 --
NM_144604chr16----1514 --
NM_145206chr1033050 1176 461 --1773 --
NM_145207chr425059 3359 --14826 --
NM_145808chr71395 --164 --
NM_147202chr931056 736 242 --32511 1036 84 --
NM_152253chr223914 228 196 12653 12701 --
NM_152275chr21469 --11863 --
NM_152641chr121729 1429 12889 --
NM_152754chr7----11543 --
NM_153035chr113269 --33103 460 52 --
NM_153184chr32488 90 ----11347
NM_153607chr5--12878 12447 --
NM_153686chr422292 1545 --12370 --
NM_153756chr1----1566 --
NM_153812chr131816 1616 859 --1736 --
NM_170607chr1711404 --11589 --
NM_173075chr441703 1672 385 368 --1159 --
NM_173485chr201275 --1280 --
NM_173595chr1234726 3333 3258 --11851 --
NM_173808chr1----13621 --
NM_175736chr1245615 2453 1938 1876 15767 47747 2654 1717 762 --
NM_175747chr63999 744 139 --11059 --
NM_177424chr1----1755 --
NM_178500chr17------1711
NM_178835chr44856 602 560 227 --1552 --
NM_181358chr1--1921 1167 --
NM_181491chr942908 2759 2354 691 --12397 --
NM_181825chr221614 --189 --
NM_181844chr17----11393 --
NM_182970chr2041449 764 590 576 ----24025 949
NM_183397chr2074813 4720 4065 3680 3674 347 52 13701 11012 1199
NM_194285chr11----33300 2815 2195 --
NM_194314chr124261 2168 --14182 --
NM_198270chrX32868 2850 2267 ------
NM_198904chr5------12081
NM_199000chr7------11889
NM_199245chr1232444 2196 363 --21678 347 --
NM_199262chr171392 --12256 --
NM_201613chr12------1551
NM_203463chr244743 4596 4248 244 --1157 --
NM_212467chr1522460 730 --1853 --