TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-485-3p
miRNA Sequence: GUCAUACACGGCUCUCCUCUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr563808 3302 2778 1378 1289 1247 --23620 332 23506 670
NM_000176chr563808 3302 2778 1378 1289 1247 --23620 332 23506 670
NM_000176chr563808 3302 2778 1378 1289 1247 --23620 332 23506 670
NM_000809chr458726 7564 7557 7225 1498 16192 27567 6678 1659
NM_001002860chr1444299 4137 4108 1716 --11518 24572 3926
NM_001003679chr131541 1462 1374 1446 22047 222 12167
NM_001004317chr644340 2982 892 259 --33911 1555 234 23167 498
NM_001005473chr564496 4485 2401 2002 1983 1936 --34463 736 406 12179
NM_001008220chr5163356 3126 2908 2825 2803 1566 1554 1522 1431 1360 1310 1295 1255 1238 1196 1103 --23916 2911 --
NM_001008408chr7106400 6348 5384 5154 5139 4285 2206 1762 1555 557 --16362 16305
NM_001013620chr1266376 6120 5956 5883 2406 295 --26127 673 17454
NM_001014380chr1353912 3887 773 389 287 --44342 4277 4156 4051 14451
NM_001018067chr185031 3793 3781 3738 967 957 855 507 1325 24877 3329 1971
NM_001024855chr32576 168 ----31592 1192 174
NM_001024948chr122579 734 21108 207 32833 1068 30 22910 254
NM_001024948chr122579 734 21108 207 32833 1068 30 22910 254
NM_001025079chr373186 1289 1276 1268 1020 572 473 --1561 23192 1316
NM_001039618chr1165552 4776 4614 3828 809 365 14090 21037 372 13870
NM_001040110chr731482 287 271 1305 21485 298 2415 390
NM_001042603chr12125345 4967 4961 4585 4354 3981 3858 3646 1874 1593 1510 1437 14629 12082 23650 1514
NM_001257chr162375 359 --1364 21115 1062
NM_001364chr1124072 807 24123 208 14077 2593 151
NM_002006chr465756 4318 4122 3691 1353 749 15806 14323 15548
NM_002737chr1776400 4559 4432 1850 1767 1757 1540 35610 5236 749 --26688 6406
NM_003028chr93519 503 110 --3524 512 115 --
NM_004432chr922321 1603 --11627 21682 848
NM_004815chr133235 1575 1319 --11219 21190 895
NM_005095chr112071 --11654 21852 1625
NM_005121chr1753416 2965 1238 1210 705 --11231 22783 399
NM_005238chr1162250 2237 2229 2217 1086 825 ----43569 2241 2223 829
NM_005359chr1865740 5713 2139 1265 1082 651 26252 1594 35716 5209 1669 1266
NM_006047chr2063238 2819 2626 709 512 189 12595 12589 13119
NM_006827chr1422986 656 11094 41361 1261 404 316 2955 864
NM_007038chr2145384 4191 2374 796 --56062 5530 4397 945 803 --
NM_013261chr463344 1314 363 337 308 300 ----23721 2575
NM_014331chr477289 6862 6358 5915 5424 5232 1657 15118 15587 17677
NM_014423chr5103825 3574 3534 2241 1256 1196 1078 952 703 648 ----13544
NM_015271chr434194 3732 646 ----23977 3766
NM_015317chr221022 58 ----32843 2829 62
NM_015458chr875257 4967 1942 1391 938 922 630 14103 14946 21701 154
NM_015569chr194242 4206 3310 3243 3232 3225 1471 1334 96 --34251 3937 3272 --
NM_015886chr844887 1593 364 340 23983 1106 14016 21309 372
NM_016083chr643414 1090 1068 551 11078 23276 1071 12971
NM_017644chr343585 1078 352 340 24285 316 14351 11994
NM_017650chr7105342 5162 5140 4722 1862 1619 815 491 321 136 15782 --24865 4796
NM_017848chrX91732 1577 1036 1014 936 912 889 881 837 ----1875
NM_018157chr1282671 2570 2370 1285 1165 940 928 588 --2945 361 --
NM_018403chr354036 3700 3418 2670 804 24016 1072 13813 21614 808
NM_018440chr868641 7718 7638 5583 3093 2359 ----22886 322
NM_020718chr1676493 6472 2421 1569 148 140 122 --21092 133 11573
NM_020935chr244651 4033 2968 279 11073 --54657 4546 4278 4055 442
NM_020951chr1972393 880 741 715 675 491 135 12051 3744 729 680 --
NM_021072chr521607 921 --12573 32480 2363 760
NM_021813chr6105384 5112 4808 4545 4457 4444 4428 4398 3643 2248 13869 --12121
NM_022781chr983165 2475 528 453 419 244 203 81 --63339 494 468 446 273 137 --
NM_024900chr481825 1465 714 705 697 648 577 562 --11796 --
NM_024947chr3108110 6491 6436 3711 3625 3041 2687 2147 1825 1373 35861 549 472 16439 19340
NM_031439chr831738 589 460 ----21834 1630
NM_032505chr342459 2313 2038 878 ----22218 2136
NM_032968chrX63934 2804 1634 1415 872 343 --24177 2798 14009
NM_032973chrY53926 2799 1415 872 343 --24169 2793 14001
NM_033224chr748079 6958 6123 4949 1958 32081 1641 983 17486
NM_138459chr662591 1114 682 611 202 162 --12621 32769 2669 208
NM_152374chr1121095 516 486 471 428 410 365 324 257 188 139 115 11499 156 1153
NM_153607chr512635 --1645 2995 987
NM_173531chr1943188 2373 1248 338 --11192 22379 330
NM_213589chr295316 1203 667 313 205 199 175 132 98 --23977 3789 --