TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-485-5p
miRNA Sequence: AGAGGCUGGCCGUGAUGAAUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr143917 705 310 --1128 --
NM_000024chr5------1496
NM_000037chr842373 1874 1567 28 11550 12043 --
NM_000038chr51511 --11280 --
NM_000074chrX----3904 669 652 --
NM_000084chrX76693 6558 5894 5694 5197 4674 1726 16424 66149 5248 4355 4222 2535 824 37007 5769 1595
NM_000089chr7------1692
NM_000109chrX----11064 11994
NM_000138chr1521808 986 ----1782
NM_000163chr532214 1530 644 --21757 1623 12262
NM_000165chr611351 ----21644 114
NM_000178chr202354 132 --1281 --
NM_000208chr1984607 4564 4499 3423 3081 1148 1032 66 54460 1046 822 484 373 ----
NM_000217chr1274634 3970 3754 3458 2118 1889 824 --24653 3337 --
NM_000237chr831918 424 343 ----1169
NM_000248chr332619 1099 584 13064 --11127
NM_000259chr1586232 5102 4595 4517 4410 1290 1129 439 11862 11455 35081 2434 1801
NM_000267chr1721218 165 1546 12812 --
NM_000278chr101852 127 41708 312 46 40 1128
NM_000304chr171867 1265 1252 --
NM_000314chr1063073 2809 2605 2534 2338 1050 13294 13102 13087
NM_000319chr1241090 1024 937 119 --1402 --
NM_000445chr82731 165 --1621 --
NM_000461chr344490 3495 3154 985 1353 23369 453 --
NM_000462chr1521525 368 --11728 --
NM_000478chr13292 198 92 --2205 101 --
NM_000489chrX63041 3015 2999 2667 2368 670 ----23285 660
NM_000495chrX31002 963 194 ------
NM_000503chr841595 606 518 133 --3345 86 69 --
NM_000525chr1141478 1264 1050 542 1164 21283 105 195
NM_000526chr17------1139
NM_000530chr11117 1958 --1148
NM_000555chrX76603 5698 4932 2964 2500 1394 337 45151 2283 2176 1842 45574 5174 5031 922 1503
NM_000598chr7----2491 91 --
NM_000615chr1132800 2759 1870 --1627 153
NM_000633chr1855152 3621 1043 1000 175 11963 11686 --
NM_000634chr22824 205 11089 1994 11095
NM_000637chr81475 ------
NM_000719chr12126546 6484 6070 5703 4558 4170 4058 1989 1162 688 498 397 16618 12375 --
NM_000723chr17----21249 501 --
NM_000725chr122778 659 ----1136
NM_000757chr16837 758 724 594 566 543 --2889 34 --
NM_000767chr1921057 472 21251 247 2338 120 11144
NM_000793chr1443416 1957 615 559 --21262 536 --
NM_000794chr5------1319
NM_000801chr203705 292 162 11087 --1933
NM_000813chr585371 4392 1945 1871 1173 280 246 59 11477 --15353
NM_000814chr1522796 2719 ----21378 792
NM_000828chrX11365 12144 ----
NM_000838chr63659 234 102 --22717 849 --
NM_000868chrX--1932 11714 --
NM_000875chr1584414 4370 2818 2390 1588 912 201 95 11713 2293 149 --
NM_000883chr71288 --166 --
NM_000891chr1741287 1263 635 288 ----12632
NM_000901chr442269 2188 693 196 1972 11001 --
NM_000921chr121488 --1217 --
NM_000924chr121307 --1261 --
NM_000945chr221798 673 1141 ----
NM_000961chr20123507 3464 2810 1560 1499 1333 1203 864 592 71 53 43 --53331 3035 2902 950 64 --
NM_000965chr331285 830 246 --1993 --
NM_000966chr122836 779 ------
NM_001001132chr2121029 937 11230 2926 97 --
NM_001001323chr1223148 786 196 ----
NM_001001323chr1223148 786 196 ----
NM_001001330chr103895 326 269 1409 1352 --
NM_001001331chr3----12262 --
NM_001001394chr2------1125
NM_001001396chr174250 3647 3409 3137 2976 1411 803 13555 53821 1580 1562 1503 1132 156
NM_001001433chr2032413 2323 2162 --32720 2645 96 1663
NM_001001484chr1052441 1841 955 461 192 22345 1900 --11734
NM_001001521chr2--1281 ----
NM_001001664chr232634 2553 176 13929 14034 --
NM_001001870chr17148 ----172
NM_001001890chr2154244 4198 1360 718 65 13537 33099 2976 175 --
NM_001001974chr1031536 1509 881 1676 11997 --
NM_001002259chr122278 214 ------
NM_001002838chrX41874 1604 609 293 --21444 704 --
NM_001002860chr1443755 3255 911 686 24184 3342 1562 11276
NM_001003674chr18146110 5617 5559 5339 4477 2304 2198 2172 1752 1743 1441 1220 1156 733 ----11810
NM_001003694chr31405 --183 1119
NM_001003800chr951507 1217 908 858 447 --12282 --
NM_001003954chr81127 1415 ----
NM_001004051chrX175 ----132
NM_001004317chr644074 2917 2829 1747 --43888 3286 906 849 --
NM_001005271chr172339 207 --21086 397 --
NM_001005366chr122747 69 --1648 --
NM_001005404chr1743973 1150 556 340 22922 1609 2732 161 --
NM_001005473chr566561 5651 1725 1460 328 99 14016 --14567
NM_001005782chr2--1194 --1742
NM_001006600chr521991 340 12198 11976 --
NM_001006636chr2131 ------
NM_001006641chr92515 50 --21777 1575 11366
NM_001006938chrX----1190 --
NM_001007156chr1531759 1287 233 --21839 1611 1392
NM_001007246chr2141546 420 368 29 11733 ----
NM_001007250chr1130 ----1100
NM_001007271chr102954 288 --1207 --
NM_001007279chr222853 665 1868 1702 --
NM_001007553chr12958 211 --1811 --
NM_001007559chr1831870 695 319 --21736 152 11990
NM_001007565chr32274 46 ------
NM_001008223chr121136 --2508 499 --
NM_001008239chr1833501 2380 870 21138 85 12350 191
NM_001008529chr17----21322 441 1870
NM_001008541chr1052093 1437 604 494 192 --2757 91 --
NM_001008564chr132758 596 1890 ----
NM_001008660chr11----11355 --
NM_001008710chr831655 1348 1235 --1164 --
NM_001009554chr464471 3473 3256 2902 1867 792 33603 2884 88 ----
NM_001009894chr1211566 11494 ----
NM_001010867chr1116270 5958 4864 4617 4451 4320 2572 1792 1757 739 59 35167 1028 372 75403 5256 2227 2099 1580 786 335 35789 5219 1370
NM_001010898chr1113532 3249 2283 1324 1267 1176 997 841 637 244 67 22486 1051 33176 3068 2643 --
NM_001010980chr163198 2957 981 665 94 42 11279 21370 1332 183
NM_001011553chr72903 49 --1871 --
NM_001011666chr7124891 4476 4406 2380 1619 1259 1127 1030 956 352 209 23 35775 5722 1358 1487 14433
NM_001011708chr272611 2401 2216 1789 1117 1073 205 --1424 --
NM_001012267chr941736 1554 666 566 ----2513 313
NM_001012393chr1174443 4182 1982 1490 1275 168 82 1370 35002 3524 1338 14332
NM_001012426chr673288 3274 2414 1261 884 875 676 22519 94 32797 2659 1081 12792
NM_001012732chr41975 2485 138 1345 --
NM_001013415chr441207 596 367 255 ------
NM_001013693chr142199 1970 1135 126 --32277 2152 916 12487
NM_001013739chr72306 23 ------
NM_001013843chr15------1329
NM_001014797chr10137995 7756 7151 5960 5345 2833 2765 2010 1979 1789 1079 365 93 27681 1066 11458 --
NM_001015048chr1463036 2808 2540 535 499 280 --23254 963 1103
NM_001015053chr1741449 1181 1039 619 --1112 1431
NM_001015508chr81239 185 1268 --
NM_001015881chrX1240 --2861 512 1390
NM_001017424chr121209 562 1299 1450 --
NM_001017930chrX------2484 417
NM_001018108chr1541749 771 415 170 ------
NM_001023587chr32940 315 --143 --
NM_001024218chr14--1577 1666 --
NM_001024649chr562455 2102 944 908 701 318 ------
NM_001024680chr251808 1642 1447 693 326 ----1720
NM_001024937chr17----2244 225 --
NM_001025076chr10105829 5223 5167 4755 4559 2486 2322 2235 2208 501 22244 1120 55234 5213 4975 2017 1873 --
NM_001025081chr1831391 451 155 --136 --
NM_001025105chr52396 194 ------
NM_001025108chr242971 1662 1488 1217 --22977 2836 24079 2799
NM_001025202chr72306 23 ------
NM_001025205chr3--1419 --1385
NM_001025233chr1242714 1910 486 441 ------
NM_001025366chr62695 23 ------
NM_001025579chr17197 --3816 805 748 --
NM_001025596chr11----1124 --
NM_001029863chr623163 1973 22058 452 22623 2036 --
NM_001029875chr521912 1101 32196 2066 577 22406 725 --
NM_001031695chr22135071 4870 4611 4340 3901 3397 1955 1690 1283 1255 1228 846 654 --25421 5188 --
NM_001031716chr271030 898 866 307 299 249 179 1981 ----
NM_001031732chr442846 2564 654 549 13392 23066 481 --
NM_001032288chr204473 429 362 56 --11582 --
NM_001032393chrX----1145 --
NM_001033045chr253309 2728 813 601 433 23546 108 ----
NM_001033087chr2032839 502 24 --11261 --
NM_001033566chr17----1957 --
NM_001033602chr1342542 2012 1027 504 11789 22469 651 --
NM_001033723chr842463 2383 849 216 11846 ----
NM_001034837chr5----1180 --
NM_001034841chr16115308 4489 4048 3976 2203 1909 1664 1343 1180 661 43 --54700 4652 4270 4135 4097 --
NM_001034954chr103605 475 418 --32667 1246 260 22359 350
NM_001035260chr1041155 1112 545 76 ----11634
NM_001035chr1----1363 --
NM_001037331chr181649 ------
NM_001037339chr131644 1620 1498 ------
NM_001037494chr122192 56 --192 --
NM_001037582chr431476 657 420 1230 61432 626 458 321 283 267 --
NM_001037954chr1182917 2747 2443 2373 1253 671 454 123 22176 393 ----
NM_001038493chr261356 1202 635 483 405 362 --1560 --
NM_001039111chr3------1107
NM_001039140chr20------138
NM_001039348chr2------1355
NM_001039459chr71804 --1768 --
NM_001039574chr12881 783 --1875 --
NM_001039577chr174424 3601 2857 1681 1283 1089 394 ------
NM_001039690chr1692338 2030 1844 1667 1490 815 764 420 350 --21811 868 1221
NM_001039771chr1411091 1413 2335 306 --
NM_001039840chrX65899 5824 5257 1807 1542 951 --13887 1930
NM_001039877chr194641 236 194 106 --2739 81 --
NM_001039916chr122256 122 --2433 237 --
NM_001040001chr61591 --12033 11665
NM_001040056chr16127 1618 ----
NM_001040110chr731384 1304 88 ------
NM_001040142chr222004 1920 --11585 --
NM_001040152chr714308 --31204 1068 333 --
NM_001040152chr714308 --31204 1068 333 --
NM_001040284chr1695389 5383 4747 4446 4438 4119 1399 1154 941 192 25907 4704 --
NM_001040429chr1311246 --12293 12253
NM_001040446chr552172 1739 1016 841 438 ------
NM_001040624chr822694 2528 1363 1153 --
NM_001040709chr162478 2168 2119 606 556 422 --41919 1896 300 286 22187 691
NM_001040712chr933347 2988 57 --22523 750 --
NM_001042355chr1643833 3622 1620 330 15331 14780 24946 1025
NM_001042413chr974008 3971 3830 2925 2847 1538 603 1260 33903 1592 998 12508
NM_001042424chr452737 2661 2481 972 128 --11136 32990 2520 236
NM_001042486chr2021470 177 --31172 388 303 --
NM_001042494chr1553676 3156 2852 2768 1329 1145 22624 574 1427
NM_001042533chr333054 2034 343 --12805 --
NM_001042555chr1241449 581 437 356 ----1720
NM_001042600chr191103 ------
NM_001042603chr1264867 4592 1773 1381 960 556 24934 3833 11805 --
NM_001042604chr343873 3750 1279 432 34793 888 327 --13515
NM_001042632chr2062500 1898 967 891 488 299 1285 21710 883 1624
NM_001042632chr2062500 1898 967 891 488 299 1285 21710 883 1624
NM_001042681chr132038 831 266 12472 1559 --
NM_001042749chrX21762 623 ----1680
NM_001043318chr14103834 3240 1613 1529 1353 1116 986 788 492 155 23588 2632 63826 2866 2723 1374 1012 826 --
NM_001043351chr131964 602 64 --21649 1512 --
NM_001083621chr1114548 4256 4043 2899 1787 1528 846 228 155 60 25 14477 23268 257 43421 1661 1439 132
NM_001092chr1762269 1820 710 499 471 50 --4787 461 419 128 22018 195
NM_001095chr122517 290 11214 --21259 474
NM_001096chr17--1190 1837 --
NM_001100108chr1157884 7511 6627 6298 6138 5939 5902 5663 5291 2775 2450 2272 1792 712 498 26556 3145 --11708
NM_001106chr387867 6795 6328 3768 3170 2814 2059 1700 21858 299 26219 2641 --
NM_001124chr112689 196 ------
NM_001140chr17--1552 1476 1439
NM_001148chr42789 639 11837 1223 --
NM_001174chrX52046 799 457 307 98 ------
NM_001204chr2107513 6743 5316 5077 3108 2027 1842 1788 1035 223 15337 16916 --
NM_001219chr7--11992 21811 50 --
NM_001273chr12----167 --
NM_001292chr15----1986 1208
NM_001292chr15----1986 1208
NM_001310chr1212989 --2674 468 --
NM_001356chrX21669 503 186 12492 --
NM_001364chr1154566 3527 3272 1821 292 --1389 --
NM_001387chr5102942 2911 2267 1171 1128 1007 878 709 586 203 2132 125 12777 --
NM_001396chr2111766 --1549 --
NM_001417chr1251413 1300 553 499 231 1484 1171 --
NM_001430chr211408 21891 383 --153
NM_001431chr61834 ----11190
NM_001438chr153679 3338 1170 1064 149 --1746 --
NM_001455chr694405 4308 4083 3868 3751 3703 3208 3046 119 --11131 --
NM_001518chr71307 --1377 --
NM_001614chr171111 192 ----
NM_001616chr221361 487 13114 --13294
NM_001620chr11----152 --
NM_001668chr111539 ------
NM_001678chr1751551 1444 1424 266 158 1127 11670 --
NM_001701chr921380 621 --11278 --
NM_001722chr82512 459 --1117 --
NM_001742chr741523 657 199 185 ----11367
NM_001753chr721515 195 --1728 --
NM_001755chr162872 778 --1622 1476
NM_001760chr62780 613 ------
NM_001761chr1651449 1130 492 361 227 21754 300 11354 --
NM_001783chr19----1324 --
NM_001800chr19----1488 --
NM_001804chr5--191 --1793
NM_001829chr41768 ------
NM_001859chr983815 3649 3117 2495 1538 816 763 597 11245 1171 --
NM_001873chr41152 ------
NM_001895chr2031057 449 66 ----1327
NM_001901chr6--2897 718 ----
NM_001903chr5------1679
NM_001904chr33826 692 244 --1302 --
NM_001923chr112540 255 ----1219
NM_001927chr21229 --2118 68 199
NM_001935chr22804 777 ------
NM_001939chrX42756 1309 865 58 21425 622 21495 69 --
NM_001949chr612137 12562 2976 616 --
NM_001968chr4173 1146 ----
NM_001969chr1453156 2964 2850 1157 884 13119 12936 --
NM_001981chr122234 309 2639 601 ----
NM_001987chr1253779 1705 1294 962 954 --23306 699 11269
NM_002006chr475424 5257 4957 4013 2165 616 578 11527 1800 13534
NM_002015chr1363078 3057 2465 848 656 590 21208 441 32576 2117 543 --
NM_002025chrX108726 8652 7972 7024 6756 6013 3093 2483 1985 1557 13526 --11922
NM_002026chr2182 --1154 1137
NM_002062chr61464 --31531 1274 227 --
NM_002063chrX2960 493 ------
NM_002070chr34367 354 315 188 ------
NM_002071chr184575 173 134 83 1545 1195 --
NM_002112chr152262 211 --1249 --
NM_002129chr4--198 ----
NM_002137chr71826 1923 --176
NM_002156chr2----1372 --
NM_002158chr232869 1373 1240 --1275 --
NM_002181chr22282 52 --1680 --
NM_002193chr24709 570 316 142 --1276 1164
NM_002205chr123817 631 278 --2407 267 --
NM_002214chr774948 4889 3751 1858 1818 1746 1057 33582 1497 841 41764 1740 1415 1280 --
NM_002247chr10----1525 --
NM_002254chr242318 1829 626 267 1548 42035 1723 646 567 --
NM_002264chr314789 13664 24444 628 --
NM_002267chr1352130 1744 961 749 436 11884 1290 --
NM_002270chr5105036 4283 3953 2203 1406 565 298 221 68 47 15073 11908 --
NM_002271chr1341509 626 439 332 --1580 --
NM_002293chr162170 1014 966 874 751 642 12347 12701 1385
NM_002372chr5189 --1285 --
NM_002384chr18----2170 153 --
NM_002398chr211379 ------
NM_002399chr1531070 1035 1015 ------
NM_002481chr1177510 7092 7081 6893 5680 5361 4812 3160 2724 2299 2275 1613 1442 1415 1376 1184 381 --35923 5291 1717 --
NM_002499chr151186 --22311 213 --
NM_002500chr2--1120 --1512
NM_002515chr1411392 --11602 --
NM_002519chr1111502 --1159 --
NM_002522chr1762926 1495 1258 985 781 139 11560 23812 2506 --
NM_002524chr1------1109
NM_002547chrX54183 3273 3094 121 22 129 1759 --
NM_002556chr111771 11676 ----
NM_002581chr984694 4443 1491 1039 925 588 259 93 ----23654 1379
NM_002588chr551350 666 641 480 437 31267 1218 78 255 35 --
NM_002595chr1211563 11787 137 --
NM_002613chr16135123 5112 4821 4768 4507 3871 1906 1244 1122 942 612 495 249 --25208 1153 --
NM_002645chr1152425 2165 710 575 384 ------
NM_002655chr854674 4314 3961 607 453 14369 25249 977 --
NM_002657chr2043414 708 335 187 32690 635 49 22881 840 --
NM_002698chr1952673 841 690 184 176 22574 944 32524 794 159 --
NM_002699chr131363 578 65 --21076 343 --
NM_002707chr2--185 ----
NM_002709chr211003 12583 22268 1277 --
NM_002715chr531230 437 159 ------
NM_002721chr9----1376 --
NM_002734chr1712225 --1112 --
NM_002737chr1775543 4364 2626 2023 1792 1699 93 1483 34929 4796 1043 15322
NM_002745chr2241392 1110 657 549 11762 --1832
NM_002748chr151808 --11164 --
NM_002753chr44845 289 103 94 ------
NM_002822chr122538 48 ----1664
NM_002827chr2021278 1254 --21168 488 --
NM_002833chr1521215 1171 11261 2149 35 --
NM_002834chr1273348 3291 2913 1475 1015 996 912 13593 ----
NM_002840chr151580 1349 543 365 322 ------
NM_002855chr1163409 2636 2587 2390 1235 935 23229 3031 1348 12363
NM_002859chr1241565 1183 635 188 ------
NM_002868chr1272212 2101 1898 1675 1555 405 197 21920 934 1757 11949
NM_002874chr921655 240 --22052 403 --
NM_002886chr363296 928 593 334 306 137 13378 24889 1213 --
NM_002892chr141209 ------
NM_002918chr193916 400 64 ----194
NM_002956chr121164 ------
NM_002971chr3--2896 329 ----
NM_002998chr822008 901 1737 ----
NM_003076chr12--31171 1089 319 1200 --
NM_003079chr173980 400 389 1239 ----
NM_003081chr20----1148 --
NM_003108chr2106918 6477 5325 2867 2688 2428 2028 1612 940 885 15356 17199 --
NM_003131chr621650 273 --2404 198 --
NM_003137chr61655 --1257 --
NM_003143chr7139 ------
NM_003150chr1751642 1576 860 566 332 --2939 914 --
NM_003155chr842793 2467 2034 1840 --11942 --
NM_003156chr1131054 434 31 1557 1311 --
NM_003182chr71350 ----131
NM_003189chr173098 2188 1201 592 542 515 147 --32437 2400 380 11096
NM_003198chr11218 ------
NM_003202chr551734 1647 1481 1287 507 11316 21328 131 --
NM_003205chr152896 801 --1729 --
NM_003216chr2292334 1244 1091 866 830 765 584 479 354 --2348 197 2249 149
NM_003221chr663442 2643 1555 1389 1189 1025 --1827 --
NM_003244chr18----1123 --
NM_003253chr2131195 545 443 --1395 --
NM_003255chr176907 765 652 640 570 43 --1471 1699
NM_003262chr344196 3783 3743 1330 14434 34662 4526 1842 1893
NM_003269chr641033 987 419 116 171 ----
NM_003288chr2041484 1127 635 629 --11187 147
NM_003320chr1143006 1292 898 34 1547 1827 --
NM_003359chr4--1129 2352 218 --
NM_003390chr111196 --2406 239 --
NM_003394chr124656 459 173 131 ------
NM_003404chr2011339 ----21610 127
NM_003411chrY31828 505 67 --11710 --
NM_003412chr322732 1072 --21103 607 --
NM_003413chrX2711 414 --1811 --
NM_003458chr363173 3030 1531 1314 1119 390 42885 2643 1344 169 32868 1618 477 1876
NM_003468chr274110 3660 3337 2775 2737 840 593 24183 876 21107 494 22792 643
NM_003470chr1631551 1396 57 ------
NM_003473chr102997 95 ------
NM_003478chr1132975 2796 1216 11026 12445 --
NM_003483chr121259 --12922 1842
NM_003490chr2231127 853 223 --175 --
NM_003575chr731561 1095 50 21579 1074 11259 --
NM_003583chr1242862 1049 951 633 3717 242 53 --12678
NM_003590chr231592 921 140 2580 182 --24092 2549
NM_003603chr461879 1798 1622 1508 713 79 --1348 11832
NM_003607chr184181 3316 2852 1043 585 214 177 92 2689 363 23654 3456 11273
NM_003615chr343922 2778 2684 284 ------
NM_003620chr171268 --1244 --
NM_003659chr21363 1957 ----
NM_003680chr12152 59 ------
NM_003737chr11--1432 184 --
NM_003743chr231806 779 497 --1515 --
NM_003758chr1511054 ----1361
NM_003762chr11224 ------
NM_003768chr141847 1681 1552 1453 ----11316
NM_003795chr61250 --1198 --
NM_003800chr61155 1330 --1239
NM_003872chr233036 2289 515 --1475 --
NM_003873chr1031751 1713 203 32446 539 137 ----
NM_003913chr632962 2848 1496 ----11670
NM_003939chr1093988 3891 3359 3112 2673 1121 620 566 414 12614 23415 1005 1457
NM_003947chr31237 --1129 --
NM_003958chr673699 3548 2757 2462 1193 1151 617 13515 33558 3196 2481 1537
NM_003988chr101929 1104 41785 389 123 117 1205
NM_004019chrX----193 --
NM_004060chr531080 373 39 1101 --1386
NM_004077chr1221043 371 ------
NM_004112chr1741761 1516 1368 572 21569 1326 41711 1402 1284 550 1671
NM_004124chr1423550 1161 --13514 12265
NM_004145chr19------2333 254
NM_004162chr31915 --11122 --
NM_004171chr11198818 8647 7216 6979 6872 6720 6353 6248 3544 3464 2723 2635 2535 2411 2192 1678 1176 1163 461 26294 2794 58591 6014 2059 1259 289 --
NM_004187chrX21425 226 --1949 149
NM_004229chrX21515 1404 --166 --
NM_004230chr1971872 1503 1496 924 782 775 688 11602 41829 1694 597 463 --
NM_004274chr1442064 1153 188 97 32752 945 74 11088 --
NM_004309chr171267 --2426 201 1853
NM_004337chr8--1114 22191 329 --
NM_004379chr241764 1597 1337 1298 --1390 --
NM_004393chr332233 692 230 ------
NM_004423chr341949 1787 1072 1050 12709 1870 --
NM_004426chr1241514 278 183 26 ----1303
NM_004427chr131004 891 470 --1456 --
NM_004428chr11665 ----1143
NM_004432chr91631 11478 ----
NM_004438chr22332 254 42878 2691 2047 846 12136 --
NM_004447chr123450 433 69 1798 ----
NM_004449chr211582 --11098 --
NM_004451chr112557 101 ------
NM_004463chrX----1489 --
NM_004474chr1199 --144 --
NM_004528chr1------1107
NM_004529chr941029 273 264 155 ----1218
NM_004535chr204719 639 552 283 --21654 1146 --
NM_004540chr21------1789
NM_004555chr16----2210 144 --
NM_004555chr16----2210 144 --
NM_004586chrX63549 2047 1735 1568 1080 202 24894 3953 --14356
NM_004588chr1193708 3638 3463 2933 2602 1373 914 648 126 12851 23193 23 --
NM_004592chr12----1166 --
NM_004598chr55898 864 846 764 260 ----3979 571 402
NM_004606chrX2128 46 --130 --
NM_004630chr114881 853 427 204 ----1386
NM_004687chr1711639 --31341 500 268 --
NM_004730chr542128 2110 478 209 ------
NM_004739chr111241 --1666 --
NM_004742chr311686 --169 11818
NM_004745chr875961 5786 5180 5013 1739 586 330 11811 --21842 160
NM_004748chr1543970 3477 1357 436 2820 602 --13176
NM_004758chr171357 ------
NM_004772chr521230 124 ------
NM_004774chr17----21926 982 --
NM_004775chr1821870 606 --1583 --
NM_004788chr1152350 1890 1847 1672 648 12474 11815 11055
NM_004801chr2----11072 --
NM_004849chr631122 600 536 ------
NM_004852chr181813958 13855 13266 12882 12141 12024 11300 11271 11102 10488 9575 9516 9384 8843 5718 5217 1330 678 713622 8610 5560 5439 2376 1907 515 32939 2481 376 310385 9565 9441
NM_004860chr172223 126 1402 ----
NM_004883chr5----1240 --
NM_004888chr91909 ------
NM_004922chr102255 38 --3660 339 107 --
NM_004926chr1441580 449 439 210 1318 1529 --
NM_004930chr11699 ------
NM_004952chr13221 68 61 ----1711
NM_004969chr101367 ------
NM_004985chr1233221 1734 849 ----13372
NM_004992chrX158169 6545 6351 5972 5860 3370 3330 2656 2300 2132 1632 1556 967 879 90 36671 3232 2419 66801 6468 5963 3416 3138 2999 12553
NM_004995chr1431342 1203 146 --3469 244 116 --
NM_005095chr131425 842 661 ------
NM_005103chr111299 --122 --
NM_005105chr111655 21515 507 156 1344
NM_005109chr351678 1622 890 547 25 1652 --1533
NM_005110chr51753 --2623 132 --
NM_005116chr2043855 2863 1656 730 23655 3580 --14080
NM_005126chr342317 2037 1972 687 ------
NM_005153chr161719 --1168 1305
NM_005156chr995275 5153 5137 4912 4770 3952 3791 1303 887 14227 --1340
NM_005184chr1951396 1022 504 300 190 --21435 1063 --
NM_005198chr222209 38 ------
NM_005220chr171457 --31448 1249 321 --
NM_005249chr14----1128 --
NM_005276chr1231371 1364 584 11695 21433 524 1193
NM_005277chr421886 1344 --1224 --
NM_005281chr12852 653 1893 1702 --
NM_005308chr10--1511 ----
NM_005370chr1931025 319 25 1348 11134 --
NM_005374chr1721842 534 --22119 672 --
NM_005376chr121116 286 --187 --
NM_005392chr931538 597 320 11625 2416 284 11263
NM_005399chr184038 3335 2920 1095 588 239 126 69 ------
NM_005412chr122138 78 --1486 --
NM_005415chr21540 --1744 --
NM_005430chr121762 --1832 --
NM_005433chr1822601 2500 11932 12567 --
NM_005440chr1793320 3199 2506 2478 2415 2288 1266 1198 298 --13263 12601
NM_005458chr952331 766 404 118 27 1192 2530 384 11646
NM_005465chr141909 1700 1550 219 ------
NM_005494chr71145 ------
NM_005512chr1142022 1708 1414 353 22011 1582 1576 --
NM_005522chr7----1100 --
NM_005539chr102975 49 --1149 1172
NM_005546chr562063 1974 611 292 253 113 21933 1709 2929 548 --
NM_005552chr14--1395 2120 80 --
NM_005576chr15----166 --
NM_005578chr343860 3175 1917 95 24703 702 ----
NM_005595chr1----1916 --
NM_005596chr986363 6189 5425 4364 2498 1343 626 352 14513 45703 4144 1102 674 --
NM_005604chr6--11788 32462 2171 408 --
NM_005634chrX----1570 --
NM_005665chr1114551 4358 3249 3028 1805 1670 1629 890 792 526 155 --33986 749 613 --
NM_005698chr1----1228 --
NM_005721chr211019 --1818 --
NM_005736chr1031351 1325 278 --11569 --
NM_005748chr1223042 2749 --23446 2976 --
NM_005754chr52825 96 1965 169 --
NM_005766chr131503 11183 --1460
NM_005786chr1841080 911 86 74 ------
NM_005822chr632054 260 133 --21827 728 --
NM_005828chr1784706 4362 3586 3515 3207 1356 777 728 13952 25034 3526 --
NM_005853chr16--1585 ----
NM_005896chr21237 --1151 --
NM_005907chr61133 --1501 --
NM_005909chr574120 3760 3453 3289 2677 1151 579 --23903 1183 --
NM_005911chr261366 1158 596 480 407 53 --11029 --
NM_005920chr183163 2622 2561 2432 1160 969 735 693 --22510 28 --
NM_005928chr15----1684 --
NM_005933chr1132041 2020 117 1655 22849 2757 --
NM_005937chr17113738 3634 3112 2854 1471 1210 1189 1104 245 104 68 22661 2637 43587 1481 1456 611 --
NM_005941chr861303 1035 574 531 186 109 13352 --1693
NM_005955chr195022 4996 4685 4281 3869 1467 1108 687 629 --34288 2095 1961 11074
NM_006011chr15133950 3645 3047 2995 2795 2701 2629 1506 919 637 568 464 408 ----13755
NM_006015chr11143 --1124 --
NM_006037chr274571 3735 3216 3116 2972 1473 148 --1447 24366 208
NM_006041chr171505 2457 160 2469 379 --
NM_006106chr1132655 1266 1099 --1418 --
NM_006122chr1572329 2114 1940 1059 917 891 569 1964 --11072
NM_006135chr1--1132 1461 --
NM_006141chr1621810 1086 21819 1047 12257 12705
NM_006176chr111210 --1625 --
NM_006185chr11----1526 --
NM_006237chr1321930 185 --11507 --
NM_006238chr631454 1351 99 11641 42030 1777 1467 150 --
NM_006246chr1421027 954 ------
NM_006251chr523084 470 --43347 788 744 611 --
NM_006275chr202915 80 1596 11952 --
NM_006288chr1131222 1173 858 134 1880 --
NM_006317chr51654 ------
NM_006319chr16--1186 1139 192
NM_006336chr971392 1344 1308 1057 543 394 97 --41210 986 300 271 --
NM_006338chr13522 263 66 --1174 --
NM_006352chr141617 1435 403 86 ----1651
NM_006361chr1721582 161 1310 ----
NM_006369chr1143 1391 --124
NM_006400chr12161 --1320 --
NM_006424chr441421 496 478 425 --31889 1436 1298 11373
NM_006472chr13329 118 25 --2988 89 --
NM_006480chr5--1329 ----
NM_006496chr111274 --1776 11817
NM_006517chrX51718 1509 567 481 323 --22257 1461 1707
NM_006546chr17176273 6215 5883 5874 5369 5211 5152 5146 4770 4488 4305 2180 1993 1731 1514 1414 971 24695 4189 1464 1375
NM_006547chr721955 205 1290 --12104
NM_006558chr82491 205 1317 ----
NM_006565chr16--11074 ----
NM_006591chr1121421 231 1682 ----
NM_006593chr2----1189 --
NM_006624chr1021372 461 --1111 --
NM_006644chr13------1247
NM_006662chr162243 101 ------
NM_006690chr2042291 2281 2173 1978 --32343 1449 220 --
NM_006698chr2031299 1138 542 --195 1350
NM_006738chr15114638 4308 4224 4217 3907 2879 1675 1597 477 276 81 13236 21011 916 14621
NM_006772chr621544 454 --11231 11670
NM_006775chr641980 1099 325 186 --1572 --
NM_006807chr1721091 872 --1355 --
NM_006814chr2032270 2079 138 12217 ----
NM_006844chr19--169 --1275
NM_006852chr1792859 2452 2121 1844 1778 1152 821 813 686 --21993 587 --
NM_006861chr1221786 357 --1512 21653 83
NM_006873chr222314 876 13143 ----
NM_006876chr112596 211 --134 --
NM_006885chr1633473 300 95 11384 13948 --
NM_006888chr1442654 2442 2250 325 --23541 1352 12170
NM_006940chr12------1161
NM_006943chr2053138 2892 945 825 110 --12955 --
NM_006946chr11----1617 --
NM_006982chr12----1211 --
NM_006990chr162489 2478 1970 1589 794 592 --1357 --
NM_007011chr1586654 5960 5633 5467 4310 2346 1352 1117 46198 5837 5795 2492 36056 1871 632 --
NM_007019chr201139 ------
NM_007026chr17----1444 1439
NM_007040chr191744 --2388 249 --
NM_007050chr20227756 7637 6720 6562 6194 6068 5636 5619 5359 4984 2829 2787 2729 2149 2005 1907 1312 1123 934 624 513 491 --37774 2300 2014 35649 1817 1698
NM_007144chr17136 2866 340 1947 --
NM_007159chr3------1641
NM_007178chr12----168 --
NM_007185chr11729 --2669 428 --
NM_007197chr122397 239 ------
NM_007249chr13119196 8720 8255 6937 5867 2913 2885 2516 2132 1647 722 38125 6188 2745 13179 --
NM_007271chr691702 1652 1638 1475 1454 698 572 124 81 ----2553 473
NM_007286chr551895 1486 838 230 82 21739 1511 11965 --
NM_007294chr173987 193 138 1367 --11184
NM_012082chr81808 1376 ----
NM_012099chr191421 --31152 805 219 --
NM_012104chr1123221 754 ----11371
NM_012120chr662923 2384 1831 1171 872 400 ----1906
NM_012180chr42658 98 1118 1533 --
NM_012193chr1154524 3288 2016 957 277 11843 34176 4044 1513 13778
NM_012199chr1104359 4143 3645 3634 3514 2994 1473 1169 1021 342 22843 466 --12872
NM_012202chr11------1339
NM_012244chr1431514 751 733 --41502 1306 622 189 --
NM_012247chr101645 --1214 --
NM_012249chr2----11362 12336
NM_012262chr154524 4418 3998 3732 75 24898 1601 13854 --
NM_012282chrX1565 ------
NM_012296chr1133715 3014 1395 1443 32532 288 122 1117
NM_012297chr422029 922 --197 12248
NM_012301chr721667 1528 11647 ----
NM_012306chr1252365 1075 535 425 109 22312 1120 22587 1270 --
NM_012309chr1184952 4681 4584 1203 685 459 290 266 14029 54104 3814 1761 1360 1225 --
NM_012330chr1051670 1647 1251 727 258 1167 ----
NM_012334chr574420 4161 1012 872 687 204 122 33786 1503 719 53090 1711 1594 1556 527 23767 3054
NM_012343chr5------1275
NM_012399chr2241408 1338 514 482 --11964 --
NM_012428chr151141 ------
NM_012464chr452530 2288 1971 589 279 1710 --22831 565
NM_012470chr7----1166 --
NM_012479chr762586 2128 2033 552 455 47 ----2687 219
NM_013261chr473398 2888 2598 960 937 276 258 11379 21171 625 13765
NM_013277chr12----176 --
NM_013309chr1562328 2170 1697 986 159 144 --2429 124 --
NM_013316chr71921 ----1282
NM_013322chr721205 182 167 ----
NM_013335chr2----169 --
NM_013346chrX166 ------
NM_013368chr191113 --1492 1484
NM_013390chr931415 1230 345 --21159 476 1165
NM_013433chr1941400 766 722 565 1622 11865 1735
NM_013438chr931286 1157 319 ------
NM_013444chrX2936 454 --1997 --
NM_013449chr1222983 2386 12176 32928 826 769 31025 988 933
NM_013960chr81549 --1289 --
NM_014023chr1021876 147 11838 31916 653 509 --
NM_014028chr642592 2160 1144 915 11012 1506 --
NM_014112chr823858 855 34619 3830 1301 14031 --
NM_014159chr31442 --1559 --
NM_014191chr12----1739 --
NM_014240chr323760 1154 43285 1186 858 500 43376 3338 2585 951 --
NM_014253chrX11948 --11583 --
NM_014289chrX41401 1342 1254 410 ------
NM_014299chr1981971 1665 1578 1399 728 637 547 225 11389 31944 1466 262 --
NM_014368chr951983 1896 1592 348 260 ------
NM_014372chr11211 ------
NM_014417chr192856 171 ----1756
NM_014423chr594969 4652 4472 4024 3904 2234 1871 1095 1070 23830 1856 ----
NM_014491chr7----1889 --
NM_014494chr161280 11937 ----
NM_014554chr12--1631 --21812 300
NM_014569chr731488 372 299 --1140 1337
NM_014607chr221533 254 --1269 --
NM_014614chr221317 463 2309 258 1162 --
NM_014615chr1623333 2318 --1779 2696 439
NM_014620chr122675 608 ------
NM_014632chr11290 23 --175 --
NM_014640chr2382 65 22 ----1277
NM_014663chr1188 1331 ----
NM_014665chr872677 2378 828 645 348 243 150 1809 53583 3133 2524 2292 41 --
NM_014701chr1542245 988 585 223 1640 ----
NM_014712chr16--1152 1170 176
NM_014715chr11----131 --
NM_014731chr2031827 1708 1512 1604 11439 --
NM_014742chr202622 469 1451 2583 548 11490
NM_014751chr832175 1878 657 1686 ----
NM_014755chr244262 3437 2920 472 --33649 1434 1280 --
NM_014761chr1611092 --21138 400 --
NM_014795chr22520 23 1546 ----
NM_014803chr1012871 ----2705 374
NM_014810chr163521 3410 2369 1100 601 432 --23454 173 --
NM_014830chr1273713 3413 2862 1481 787 704 420 11398 2903 310 1367
NM_014847chr12372 51 ----1142
NM_014849chr151198 909 847 826 462 11165 ----
NM_014868chr121560 --1185 --
NM_014873chr174654 3801 3596 1416 770 525 502 14026 31498 1319 1281 11892
NM_014903chr1222412 780 22010 936 ----
NM_014905chr231666 1549 364 1504 21521 682 --
NM_014912chr1043136 1245 837 551 11351 ----
NM_014947chr132483 2182 1150 --21165 1030 12334
NM_014948chr2072337 2100 2082 1955 1789 605 386 --11552 1473
NM_014977chr14----2440 78 --
NM_014989chr621517 606 1539 21634 1331 --
NM_014991chr433178 617 65 --187 --
NM_014997chr772264 2251 2172 2019 2013 1964 1894 --12130 --
NM_015011chr131376 --11124 --
NM_015023chr131798 1735 443 11769 21421 1206 --
NM_015025chr231770 750 412 --12220 --
NM_015026chr1233009 1224 119 1683 21482 469 --
NM_015039chr184078 3997 3525 3496 3461 3412 1552 203 --43569 3535 3403 1642 1616
NM_015040chr263258 2863 1323 1156 677 592 ----12892
NM_015042chr1573843 3428 2976 1152 968 648 268 42741 1289 939 313 24072 1358 23711 35
NM_015044chr1652780 2484 2395 897 762 1737 1410 12827
NM_015051chr982580 2371 2273 2181 1331 656 180 27 22878 1024 ----
NM_015064chr1263646 3486 3254 3076 1278 698 1963 52526 1458 1095 1034 163 1232
NM_015076chr633211 3045 1796 --42989 2854 1485 820 --
NM_015084chr521358 1092 1401 2492 91 186
NM_015086chr1261585 1272 1060 576 568 353 11450 21279 1244 --
NM_015091chr141134 ------
NM_015092chr1623657 1766 --14582 24704 66
NM_015093chr61721 ----11730
NM_015094chr2284658 4319 4295 3567 3089 2955 1406 1322 24026 379 11771 11663
NM_015100chr141848 1725 1665 1656 --11775 11867
NM_015107chrX81877 1739 1679 956 924 716 696 573 --11929 --
NM_015138chr1542425 1932 663 79 11824 31006 960 195 --
NM_015144chr1623003 1279 --13745 23636 1479
NM_015155chr1052520 2381 1342 471 308 11034 1666 --
NM_015176chr14559 336 100 39 ------
NM_015191chr1142661 2555 2336 1849 --168 12707
NM_015199chr342566 2191 1099 615 21147 38 22856 2040 --
NM_015205chr1385093 4579 4428 4271 3905 3463 346 85 11460 75054 4743 4468 4213 4104 3520 829 14030
NM_015206chr1543881 2774 2465 28 --23026 2607 --
NM_015210chr181934 ----1140
NM_015254chr892219 2093 1284 1247 1235 1167 873 700 158 1202 53196 2980 846 527 475 --
NM_015271chr433397 3067 1238 ----13861
NM_015284chr15852 397 361 296 166 11403 31787 1775 772 11644
NM_015288chr533310 1405 963 32993 1091 52 42998 2594 874 81 --
NM_015293chr61118 --1494 --
NM_015299chr1452931 2639 1554 1403 648 33722 2778 678 23552 3250 1214
NM_015305chr1431840 614 26 11264 1204 --
NM_015313chr1134340 3630 3538 13313 13324 --
NM_015315chr562841 2651 2118 1322 235 186 12270 1637 --
NM_015323chr611190 --11410 --
NM_015326chr1112654 2581 1889 1868 1077 652 537 522 437 382 130 21187 325 22478 559 --
NM_015335chr1232600 2470 378 --1356 1591
NM_015344chr841763 1652 419 103 ----11368
NM_015358chr212837 54 ------
NM_015382chr14154 --1286 --
NM_015396chr331475 1375 953 ----168
NM_015415chr1----1169 --
NM_015439chr6148 ----1399
NM_015455chr542813 1476 578 446 --33890 898 25 --
NM_015457chr111847 --11074 --
NM_015465chr5------1285
NM_015477chr156862 734 321 240 154 111 1102 ----
NM_015481chr122841 797 ------
NM_015497chr153783 213 66 ------
NM_015534chr12379 125 --1801 --
NM_015542chr10----2882 166 11232
NM_015560chr331128 660 451 --32434 2301 73 22500 2022
NM_015567chr1311194 --1134 11286
NM_015569chr142949 1235 677 616 --14566 --
NM_015570chr731828 1336 656 11589 ----
NM_015576chr322332 610 2910 448 1429 12518
NM_015635chr911755 11531 32101 1621 1402 --
NM_015678chr1321099 610 --1385 --
NM_015686chrX82501 2453 2346 2276 1790 1719 1684 1559 2859 189 1354 --
NM_015852chr721415 759 ------
NM_015872chr151700 1363 1253 369 105 11617 ----
NM_015902chr83900 879 790 ----1721
NM_015906chr133768 1178 879 ----14470
NM_015982chr172400 127 --1171 --
NM_016002chr12686 304 --149 --
NM_016009chr184077 3822 3807 3441 3214 1932 1761 1556 53278 3203 3173 1961 268 1253 --
NM_016037chr13798 467 124 1444 31036 897 332 --
NM_016072chr121132 22257 696 12194 --
NM_016107chr51273 ------
NM_016131chr212268 --11657 --
NM_016147chr113935 921 293 --1870 --
NM_016257chr143274 2424 2327 77 --1478 --
NM_016269chr42315 110 --11107 --
NM_016281chr12------1443
NM_016289chr261973 1770 1702 1601 1558 615 1575 11948 --
NM_016322chr922267 376 22784 551 ----
NM_016353chr821921 1542 --1618 1520
NM_016396chr1521188 1069 --12486 --
NM_016424chr1721936 149 ------
NM_016436chr2042234 1685 659 58 1465 1781 --
NM_016442chr521993 856 --2690 262 --
NM_016448chr111897 11501 2585 199 --
NM_016472chr1421407 388 ----1452
NM_016485chr6170 ----1168
NM_016486chr1----1160 --
NM_016505chr13577 94 49 ------
NM_016506chr113271 255 212 ------
NM_016521chrX------128
NM_016525chr92918 615 --4855 793 144 90 --
NM_016530chr1532853 1432 309 --22968 1159 2160 78
NM_016531chr443993 2972 2599 842 1821 1826 --
NM_016559chr3----1160 --
NM_016578chr11----1550 --
NM_016605chr532312 2133 1725 1465 31972 1679 392 --
NM_016653chr221148 943 --11074 --
NM_016829chr32304 38 --3173 162 69 --
NM_017420chr1443252 2984 2438 1519 --1193 --
NM_017451chr173772 213 132 21063 1009 1892 --
NM_017553chr1561219 1043 930 473 394 372 ------
NM_017582chr141710 650 322 279 11405 11324 --
NM_017590chr2262687 2383 2222 2104 673 300 1532 21818 294 1289
NM_017602chrX3793 662 370 --1876 --
NM_017607chr19--1102 --1402
NM_017628chr463845 2090 1866 1847 389 297 11667 44960 4059 2111 2000 --
NM_017629chr121759 268 ----148
NM_017633chr643684 3083 3059 2880 12630 ----
NM_017637chr959208 5837 1970 1778 537 37952 5904 1950 39098 8949 6226 11729
NM_017643chr1742288 2172 1971 744 --2872 460 --
NM_017668chr163776 687 113 --2708 141 --
NM_017709chr174166 2930 2825 2812 1529 1250 68 --12751 13272
NM_017728chr1772945 2483 2253 2181 1091 789 175 12428 22606 2303 --
NM_017742chr1842004 775 409 183 ----1454
NM_017754chr674618 3327 3247 1296 640 434 265 54885 4796 4502 3836 3217 --14812
NM_017778chr861056 513 445 238 220 45 11369 ----
NM_017799chr141260 --139 11713
NM_017811chr952702 2375 2241 2136 2034 22626 666 11911 --
NM_017824chr1042149 2055 1981 1005 12020 11788 --
NM_017848chrX54001 3214 3174 1826 439 1242 23570 1725 --
NM_017851chr1531083 1057 1022 --2836 511 --
NM_017857chr111637 1663 --4195 180 153 126
NM_017893chr1031194 1185 39 --2997 179 --
NM_017902chr10205363 4917 4830 4751 4500 3898 3812 3790 3639 1438 1205 1151 1125 903 846 630 519 438 276 21 25635 5580 34512 4446 983 --
NM_017913chr9----1356 --
NM_017919chr965188 4315 2308 1027 698 431 14721 25523 5168 --
NM_017944chr1112192 22370 351 22676 2272 --
NM_017964chr22836 703 ------
NM_018014chr22151 102 ------
NM_018026chr1121040 528 ----148
NM_018032chr162815 607 ------
NM_018061chr11257 ------
NM_018085chr1156951 6724 6352 6184 5737 5343 2941 2199 1844 1678 1255 1042 832 527 126 12831 22273 545 1516
NM_018110chr1611283 --11234 179
NM_018120chr81300 1359 ----
NM_018121chr10152 ----12702
NM_018126chr4------21500 1095
NM_018157chr1252761 2149 2105 847 432 --12995 1552
NM_018178chr121316 699 --21764 420 11790
NM_018207chr141634 1503 226 140 --1134 --
NM_018208chr11778 154 31091 864 66 1389
NM_018222chr1131722 1372 291 --11753 --
NM_018240chr13849 836 587 --2192 108 --
NM_018244chr2021200 882 ------
NM_018247chr672875 2184 2144 2076 903 286 133 ------
NM_018254chr12210 200 12086 --11558
NM_018358chr3------1113
NM_018362chr1133117 2881 2748 21464 964 43421 3286 3243 2776 23466 473
NM_018375chr1431184 709 668 --186 --
NM_018381chr191321 1668 --1297
NM_018448chr1211245 199 ----
NM_018462chr3----172 --
NM_018476chrX1158 ------
NM_018482chr852167 1813 785 468 192 --11823 1619
NM_018509chr173620 455 281 --133 11681
NM_018566chr184737 1265 974 816 468 421 361 314 41815 1356 1090 685 1789 --
NM_018571chr2--1518 ----
NM_018638chr1234978 4968 3541 15246 13438 25492 3813
NM_018644chr1152077 1824 1428 146 21 --22003 1463 --
NM_018685chr7--1245 ----
NM_018712chr111376 11057 ----
NM_018718chr781797 879 751 719 450 335 230 128 1490 11718 1827
NM_018970chr772928 2803 2089 1153 773 136 25 11272 --11100
NM_018979chr124593 217 172 78 12220 --1238
NM_018992chr1671646 1410 449 423 365 352 244 11290 11219 --
NM_018999chr1074924 862 801 794 684 589 346 33862 582 192 31869 305 101 --
NM_019116chr1663454 2731 2466 1303 871 703 --23222 2445 1220
NM_019556chrX31119 1019 372 --11241 --
NM_019593chr2042929 2885 584 341 --43092 2922 2862 199 --
NM_019594chr951582 1486 1224 597 74 1241 1106 --
NM_019606chr7----1160 --
NM_019624chr121232 1676 1742 1613
NM_019884chr19------1163
NM_020122chr2125294 5133 5022 4947 4782 4067 3968 2042 1408 1159 1093 668 15649 25725 1331 13992
NM_020150chr103781 634 130 11768 160 --
NM_020152chr21----1153 --
NM_020354chr10--2768 79 ----
NM_020357chr331378 1057 491 ----21310 412
NM_020443chr196536 5760 4637 4568 2403 2130 1964 398 240 36069 2680 1925 76430 5987 5852 4879 1893 1164 744 14489
NM_020463chr2----2545 260 --
NM_020466chr694811 4654 4562 4360 4149 550 383 86 34 11811 23771 573 --
NM_020474chr1811459 --1179 --
NM_020638chr122556 440 --31892 1382 681 1788
NM_020645chr111667 ----1258
NM_020651chr22557 205 ------
NM_020713chr2042490 1260 707 559 21974 464 42169 984 864 832 12039
NM_020718chr16115471 5315 5051 4897 4529 4224 2167 1800 700 534 75 26191 5870 11134 --
NM_020728chr742862 2691 2245 910 --12915 --
NM_020769chrX----2682 116 --
NM_020772chr1788237 7432 6781 3060 2943 1990 1303 1155 22604 2539 1616 15263
NM_020791chr171424 21418 1411 178 1561
NM_020794chr1----1214 --
NM_020795chr1721376 248 --21314 183 --
NM_020801chr55664 589 520 255 246 --1370 --
NM_020824chr10----1101 --
NM_020839chr311192 --31559 1442 177 --
NM_020888chr141909 514 238 136 21365 252 --1123
NM_020899chr1762193 1739 648 231 212 75 --2591 253 --
NM_020920chr141315 ------
NM_020927chr1612245 --1284 --
NM_020939chr631163 369 95 2963 170 21445 1260 --
NM_020949chr3----1107 --
NM_020962chr1531738 311 119 22318 1883 1392 --
NM_020988chr1621311 1261 --1107 --
NM_021003chr14----1753 --
NM_021020chr873212 3146 3127 2798 1192 870 443 --22525 727 13461
NM_021035chr202355 189 --11165 --
NM_021038chr332643 1314 1046 11305 13164 --
NM_021083chrX12510 --33445 2280 2220 --
NM_021097chr242904 2621 2165 231 --1690 1121
NM_021117chr1122111 552 11500 1249 1821
NM_021131chr951466 1287 893 317 292 1937 11071 --
NM_021132chr1011055 --1101 --
NM_021151chr71805 1267 ----
NM_021155chr1932893 2176 1178 --42967 2201 1851 823 1688
NM_021156chr204401 363 275 105 1153 150 --
NM_021174chr8----2660 135 --
NM_021202chr2072640 1933 1119 706 575 523 347 --22631 2264 --
NM_021222chr121200 493 ----11113
NM_021249chr1441562 1133 277 177 ------
NM_021639chr11708 --2600 334 --
NM_021784chr201159 ------
NM_021813chr665309 5045 1408 1317 265 61 35207 4575 4197 21749 391 --
NM_021814chr611305 ------
NM_021831chr2----1302 --
NM_021926chr11----172 --
NM_021943chr632132 852 428 3543 317 55 --11673
NM_021945chr6102906 2535 2425 1414 1401 1004 734 574 116 42 --42920 1355 1177 1087 32575 2191 624
NM_021960chr13816 672 593 22021 461 12026 --
NM_021961chr11116767 5838 5357 5192 5131 5025 2871 2747 2369 1128 308 25473 615 66525 5388 4689 2705 1594 384 --
NM_022058chr221470 375 --11729 --
NM_022060chr1441215 1096 900 892 11268 11024 --
NM_022068chr181445 ----1562
NM_022095chr202299 202 ----1266
NM_022459chr1365867 5133 4326 4275 1330 527 --21972 179 --
NM_022463chr1751556 1287 1167 490 443 11379 31073 120 42 --
NM_022465chr1252852 2453 2024 586 428 12235 12706 --
NM_022488chr3------1160
NM_022491chr1252390 2384 533 361 186 22332 2261 32288 1102 115 11015
NM_022552chr21957 --1902 --
NM_022730chr21360 --2760 258 --
NM_022733chr121083 916 --162 --
NM_022735chr121562 288 1508 11694 --
NM_022749chr821103 426 ------
NM_022756chr121196 24 1943 --1323
NM_022826chr2------1463
NM_022897chr53227 193 152 --2380 33 --
NM_022912chr232828 861 646 --12090 1175
NM_023009chr11526 --1224 --
NM_024016chr173335 183 123 ------
NM_024046chr321173 405 1262 1159 1820
NM_024077chr91631 1573 ----
NM_024082chrX--1407 1432 198
NM_024090chr42530 136 1645 --11374
NM_024328chr14----1238 --
NM_024522chr151833 1693 1202 515 112 --2320 284 --
NM_024529chr13882 412 191 ------
NM_024551chr12160 --22071 113 22405 2256
NM_024567chr8----1164 --
NM_024594chr51243 --1228 --
NM_024629chr4--144 ----
NM_024646chr143219 2984 2818 2482 --32644 2612 159 1358
NM_024665chr331762 1060 192 --1345 --
NM_024670chr1031767 1601 253 ----1588
NM_024700chr111138 ----1246
NM_024713chr15177 ----1211
NM_024721chr821980 86 22537 2504 12300 --
NM_024749chr1--12095 11802 11427
NM_024817chr15114328 4310 2392 1692 1243 1138 1094 966 877 765 448 --35246 3703 1797 14623
NM_024834chr101576 1308 11307 --
NM_024911chr12783 608 ------
NM_024939chr162424 93 21204 1019 ----
NM_024944chr2111008 ------
NM_024947chr3159636 8828 8357 8347 8168 7553 7515 6665 3859 3807 3272 3020 2986 2904 734 28079 2611 48304 7418 6475 1193 --
NM_024969chr2----1184 --
NM_024989chr266948 6260 5700 3116 1345 506 32205 2136 1574 48131 5935 2295 1470 1350
NM_025104chr1771780 1614 1405 1298 1270 517 358 --11159 --
NM_025134chr1621735 815 --1369 --
NM_025138chr13------1336
NM_025160chr163944 3812 1442 743 529 510 12949 ----
NM_025164chr1141957 760 452 29 --11820 1431
NM_025182chr92231 155 ----1946
NM_025187chr163854 253 65 ----11105
NM_025191chr12533 373 ----1916
NM_025208chr1122425 103 1138 1143 --
NM_025248chr1752778 2353 1977 728 283 22970 678 ----
NM_030625chr10----1399 --
NM_030627chr532760 1445 108 132 22617 976 --
NM_030630chr173743 616 27 --1802 --
NM_030761chr162433 1845 676 666 481 186 12510 168 --
NM_030763chrX----2836 100 --
NM_030784chr6171 ------
NM_030820chr62946 25 --1331 --
NM_030885chr3--1218 1939 --
NM_030911chr1311213 --165 11132
NM_030912chr101600 ----1618
NM_030913chr12566 127 --1109 --
NM_030918chr1105044 4902 4001 3731 3645 1711 819 698 262 55 22058 1107 64148 3430 3306 2081 1120 535 24884 4227
NM_030920chr121916 399 ------
NM_030964chr563498 3354 2558 1185 628 91 13347 43129 2598 2330 137 --
NM_031216chr183786 409 124 --11773 --
NM_031300chr56370 301 292 239 78 24 ------
NM_031422chr181396 ------
NM_031427chr1485378 4404 4385 4218 1967 1930 1775 1609 --13619 1250
NM_031445chr252643 743 710 418 125 22384 206 2384 216 --
NM_031483chr2082781 2350 1429 1098 905 825 624 402 1308 ----
NM_031492chr112201 193 --2385 230 --
NM_031964chr173389 352 43 ------
NM_032027chr1131 ------
NM_032028chr52513 105 1608 2554 121 --
NM_032182chr1021137 150 --1428 11536
NM_032195chr211169 ------
NM_032207chr19--1281 3857 303 57 --
NM_032239chr4----11177 11143
NM_032242chr373041 3028 2909 2890 2876 428 373 22377 1248 12524 --
NM_032289chr51747 1246 1487 --
NM_032353chr17----1441 --
NM_032439chr1011675 ------
NM_032440chr1012967 1796 --11058
NM_032511chr6------1143
NM_032538chr692767 2618 2395 2206 2156 1911 798 541 124 --52360 1749 572 515 294 52118 2026 488 284 90
NM_032552chr91126 --31733 1479 155 1781
NM_032560chr142221 206 --1120 --
NM_032594chr142871 234 --1435 --
NM_032595chr1741088 433 337 94 --2990 222 1148
NM_032603chr2--1603 --1714
NM_032682chr352455 673 654 404 104 12428 12873 12532
NM_032689chr1921660 1433 ------
NM_032727chr1041395 1053 230 66 ----1123
NM_032786chr123440 75 32 1213 ----
NM_032801chr1122011 984 22561 2273 32240 1978 1665 21859 469
NM_032810chr101213 ----1264
NM_032828chr19104870 4761 4708 3365 1402 1221 551 416 219 196 34025 1490 749 104879 4249 4116 3233 1891 1752 1313 976 840 251 14410
NM_032873chr1133392 818 404 1312 13634 --
NM_032906chr41232 1654 2218 172 --
NM_032961chr4----11352 --
NM_032968chrX53283 881 763 522 455 ------
NM_032973chrY43278 881 522 455 ------
NM_033030chr2------175
NM_033132chr1331882 528 498 ------
NM_033133chr1793657 3087 3038 2435 1505 1337 1293 976 968 33512 1447 814 21265 586 --
NM_033136chr531521 416 350 2635 92 1171 --
NM_033198chr172505 28 2695 220 1114 --
NM_033222chr91531 --1556 --
NM_033224chr7138058 7130 6890 6317 5560 5541 5326 5160 3171 2930 2675 2527 26 27914 434 47353 6847 6711 267 --
NM_033225chr833167 935 782 --11108 --
NM_033259chr32691 355 --2599 38 --
NM_033315chr1772091 1979 1866 1781 1711 845 111 --2513 276 21683 710
NM_033389chr1774203 3449 3435 3356 3220 1694 1684 11584 1493 14257
NM_033396chr111328 --1109 135
NM_033397chr1072075 1902 1875 1762 450 367 126 --12038 11667
NM_033467chr11131 ----1321
NM_033495chrX----1784 11017
NM_033549chr55943 922 894 274 181 --1193 --
NM_044472chr12549 100 ------
NM_052840chr1541548 1484 1374 521 21095 458 11409 --
NM_052905chr231437 1397 687 --187 --
NM_052910chr131109 11902 --11863
NM_052934chr171450 1412 1404 658 342 274 183 42259 1810 1725 404 1734 11918
NM_052968chr11261 48 --2224 168 --
NM_053023chr1153132 1098 1078 497 359 --21006 733 --
NM_053024chr321494 1210 --1330 --
NM_054035chr173252 206 195 --1261 --
NM_057161chr63399 392 350 1342 ----
NM_057175chr422618 1763 ----1694
NM_058237chr14----1909 --
NM_080391chr11566 ----1576
NM_080546chr91821 ------
NM_080625chr2011044 1399 2172 134 --
NM_080737chrX31069 407 320 ----1216
NM_080744chr72636 198 ------
NM_080832chrX11172 ----131
NM_080836chr20114410 4037 3753 3594 3383 3194 3125 1416 1011 607 531 --34162 3514 1785 164
NM_080867chr1464037 3933 3586 3534 3195 1168 21840 1706 23813 3484 --
NM_133265chrX83476 3347 3163 2874 1268 896 868 174 12974 23228 2582 1947
NM_133369chr5137 --2941 743 --
NM_133446chr10--1209 126 --
NM_133452chr196999 922 841 797 495 251 1187 21189 1122 1231
NM_133478chr232008 979 813 --1213 170
NM_133499chrX3841 148 36 --158 --
NM_133625chr351042 997 360 252 76 ----1176
NM_138357chr10----1487 --
NM_138370chr22285 193 1694 ----
NM_138468chr2105731 5716 5274 4887 3970 2437 2271 1688 1609 506 16150 15671 --
NM_138473chr1295169 4322 4038 3755 3691 3208 603 550 286 --1692 14109
NM_138492chr521492 1324 ----1136
NM_138693chr7121 ----1360
NM_138774chr194858 781 725 214 ------
NM_138811chr711148 --132 --
NM_138959chr1155726 5720 5453 5355 5333 4953 4839 4605 2317 2181 1701 1694 702 300 253 25738 776 36487 4679 4303 --
NM_138962chr17------1124
NM_139057chr15112726 2461 2433 2164 1999 1137 1074 765 607 578 459 22636 1968 22390 73 1849
NM_139207chr1231966 650 46 ----176
NM_139214chrY191 ------
NM_139246chr932219 1844 396 --11463 --
NM_139280chr1751254 1207 1077 122 91 --1553 --
NM_139283chr1242544 2249 1859 991 12084 11952 --
NM_144591chr10----1100 --
NM_144631chr2----1255 --
NM_144635chr351072 992 238 104 58 ------
NM_145113chr141547 21497 1430 1155 --
NM_145185chr1931819 1657 1458 --21836 285 --
NM_145203chr131193 ------
NM_145207chr485166 4669 4345 3355 2016 1147 949 562 64548 3553 3433 1950 926 723 54820 1973 1837 1387 1246 14511
NM_145239chr162357 130 --3337 250 143 --
NM_145251chr141494 ------
NM_145274chr171798 --2639 23 1729
NM_145284chrX11799 22185 930 --1511
NM_145313chr1021188 572 188 --11484
NM_145349chr1741490 646 577 331 --32003 1868 185 2429 392
NM_145349chr1741490 646 577 331 --32003 1868 185 2429 392
NM_145753chr351635 1324 1147 1100 214 ------
NM_145800chrX21006 867 ------
NM_145808chr732557 457 233 149 191 12570
NM_145891chr1631678 1333 1123 --1685 --
NM_147190chr121178 ------
NM_147223chr261989 1528 962 680 159 93 --1698 --
NM_152253chr2292768 1607 1514 961 855 823 677 429 359 43411 3315 2713 51 43479 3122 2954 1417 22949 1069
NM_152272chr82357 274 --1323 --
NM_152280chr183368 2884 2463 2279 2236 2133 1003 644 --3522 478 343 12771
NM_152309chr1041995 385 56 49 11432 11752 --
NM_152335chr152513 110 1169 ----
NM_152344chr17----11317 --
NM_152398chr4----243 36 --
NM_152406chr521712 40 11240 1136 --
NM_152450chr1532030 1846 778 --12118 --
NM_152470chr1844113 2599 1306 818 13147 13495 --
NM_152519chr212015 11714 ----
NM_152546chr551455 1288 328 254 202 ----1120
NM_152556chr752375 2264 2169 2098 1768 --11985 --
NM_152586chr101310 --1949 --
NM_152608chr142378 1711 874 504 1913 32068 731 597 --
NM_152622chr543077 2233 911 238 ------
NM_152641chr1252401 1839 601 245 143 22412 1876 --12418
NM_152678chr321027 861 1527 22026 1744 --
NM_152739chr71103 ------
NM_152740chr72217 54 ------
NM_152745chr721117 285 ----1181
NM_152753chr641807 578 501 331 ------
NM_152756chr544324 3474 2855 202 31024 586 69 --12728
NM_152787chrX11258 --192 --
NM_152835chr12864 628 1973 ----
NM_152896chr9--1241 ----
NM_153020chr6197 ------
NM_153184chr321429 397 1710 --1266
NM_153207chr1233016 2854 49 12924 1287 --
NM_153208chr162766 195 --1828 --
NM_153252chrX----1329 --
NM_153335chr17199 ----11065
NM_153343chr452245 1658 928 715 51 194 12019 --
NM_153350chr1631083 707 637 --21118 652 --
NM_153360chr2021382 562 11179 21071 863 --
NM_153365chr442194 350 315 200 ----1415
NM_153367chr1053984 3494 3385 1349 326 1943 23693 344 --
NM_153453chr61928 --147 1957
NM_153487chr673974 3694 3523 3211 1896 741 421 33223 1559 814 24755 3064 --
NM_153607chr532836 970 949 ------
NM_153619chr1553434 3194 2399 1185 995 31244 577 419 11086 --
NM_153634chr12----1367 --
NM_153756chr131377 297 180 --1461 --
NM_153810chr101920 14449 1319 --
NM_153812chr12559 398 --12124 --
NM_172071chr177114 5466 4939 2935 2173 1486 484 26825 612 26417 2312 27337 4587
NM_172097chr151809 --1550 --
NM_172115chr4----122 --
NM_172236chr20------131
NM_173039chr11--1245 ----
NM_173468chr435151 3995 1957 12059 34203 3720 539 --
NM_173469chr15----1166 --
NM_173470chrX42585 2365 2218 1038 ------
NM_173475chr1621605 266 --11756 --
NM_173496chr1032253 744 709 --12448 1157
NM_173517chr71181 ----130
NM_173559chr6289 22 --1347 --
NM_173595chr1284472 4378 4305 4269 1940 1660 739 707 23672 463 43822 3812 1626 1406 --
NM_173667chr51715 1226 3940 807 769 --
NM_173676chr62208 42 ------
NM_173681chr731779 415 152 --3795 223 41 21889 178
NM_173683chr811103 11131 ----
NM_173812chr12----1457 1188
NM_173829chr574548 3833 1895 1667 1155 716 196 11536 1106 14042
NM_175077chr2071228 1034 991 546 375 69 23 --2164 58 --
NM_175736chr12167417 7112 6389 6324 3020 2992 2887 2859 2373 2329 1999 1920 1749 1713 1318 1117 21590 1236 35985 2395 2266 32769 442 281
NM_175854chr1331045 940 730 --12770 --
NM_175898chr15--11067 31289 280 259 --
NM_176812chr201283 ------
NM_177401chr19----1341 --
NM_177424chr121708 572 --1324 11821
NM_178026chr20------1425
NM_178126chr1782241 1736 1729 1584 1549 787 690 145 --3878 841 550 --
NM_178140chr542693 2363 1716 192 1784 11934 --
NM_178148chr6----1162 --
NM_178229chr1----11006 1890
NM_178423chr72444 413 --11271 1151
NM_178500chr17175 --1706 --
NM_178502chr122537 61 --1528 --
NM_178557chr421370 76 --21181 329 --
NM_178812chr821506 1229 ------
NM_178818chr1662117 1745 1654 682 254 169 22338 610 ----
NM_178830chr192171 108 --1580 --
NM_181358chr174014 3814 3299 3102 2655 1103 839 ------
NM_181457chr2------11297
NM_181672chrX1346 21587 42 ----
NM_181712chr162069 1639 1472 839 641 38 --1284 --
NM_181784chr282508 2394 2293 1633 1606 1039 828 522 1729 21903 117 --
NM_181844chr1742016 1679 1650 730 ------
NM_182481chr211458 --11029 --
NM_182485chr473650 3585 2863 2687 2292 315 161 ------
NM_182488chr131954 --1270 --
NM_182509chr1411274 11580 21395 134 --
NM_182687chr16367 51 21 ------
NM_182691chr721252 568 ------
NM_182757chr683508 2981 2787 2604 2539 1302 963 677 --1144 1618
NM_182830chr1421824 1558 ------
NM_182831chr1641532 318 268 63 --1124 156
NM_183425chr2041470 1370 284 114 1395 2578 185 --
NM_194247chr244311 3371 3028 163 23771 3441 13841 --
NM_194285chr1122789 2647 11246 1254 --
NM_194314chr154948 3887 3438 1970 397 21700 339 --15416
NM_198282chr53188 45 27 ------
NM_198504chr3----1662 --
NM_198560chr3173650 3624 3250 3220 3092 3013 2678 1509 1427 1100 820 805 750 704 564 358 42 13803 33475 1119 533 --
NM_198581chr297064 6663 5766 5439 5391 5384 5254 5134 148 25368 230 46526 5719 5583 5216 15165
NM_198834chr171351 42273 1666 1511 465 22223 700 --
NM_198859chr374429 4207 3905 3427 1971 1312 1037 ----13577
NM_198993chr173409 286 147 --1354 --
NM_199131chr1093439 3207 2701 2236 1458 843 758 364 235 11262 33047 1301 1245 11131
NM_199351chr1--1465 1152 --
NM_199461chr1053434 2490 2324 732 414 ------
NM_201280chr661332 1166 1068 415 193 83 11618 ----
NM_201520chr1731604 1465 61 11385 31280 1242 1149 179
NM_203434chr911078 --1986 --
NM_206538chr192340 45 --2906 368 --
NM_206853chr6192 163 171 --
NM_206996chr1245 27 1148 ----
NM_207043chr172278 2098 1518 774 546 343 94 ------
NM_207303chr1043032 818 571 555 13074 23079 764 --
NM_207335chr383290 2237 1330 1289 1006 797 186 165 --22466 2333 1615
NM_207356chr1----1504 --
NM_207380chr1593415 3281 3225 3016 2479 922 395 310 168 13427 33432 1417 500 --
NM_207396chr131472 1199 610 --41141 648 344 208 --
NM_207517chr15------11573
NM_212467chr1522325 962 22156 973 147 --
NM_212551chr12862 793 --31024 336 131 --
NM_213589chr265581 5283 3538 1275 408 89 --24190 4146 24717 613