TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-486-3p
miRNA Sequence: CGGGGCAGCUCAGUACAGGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000034chr16----245 24 --
NM_000037chr81543 --22281 237 --
NM_000081chr121234 531 1452 11869 --
NM_000088chr1771229 1158 1110 948 512 452 325 --41244 1137 364 355 --
NM_000118chr91350 --3864 153 95 1218
NM_000125chr684133 2702 1709 1383 1192 1178 726 373 13921 33747 2893 688 --
NM_000127chr8155 1223 ----
NM_000188chr101215 --128 --
NM_000202chrX63312 3301 2630 2545 1219 37 12710 12499 --
NM_000238chr73316 258 78 ------
NM_000248chr33489 304 203 --32660 2380 2343 --
NM_000319chr1241044 364 264 254 ----1135
NM_000399chr101967 --2143 95 --
NM_000408chr21107 ----12599
NM_000435chr192848 814 --154 1724
NM_000458chr172251 221 --1624 --
NM_000461chr3104379 4130 3812 3624 3305 3218 3114 1476 1300 155 23190 1123 41716 1310 1227 581 --
NM_000476chr931415 1179 1120 --2386 95 --
NM_000482chr11----249 44 --
NM_000503chr82145 34 ----1613
NM_000525chr1151498 1427 1028 195 117 --1201 --
NM_000530chr12443 278 --4717 417 296 291 --
NM_000555chrX137798 7289 6990 5688 5163 4820 2049 1952 1829 438 328 313 69 --27008 5353 26798 5026
NM_000612chr1193639 3585 3442 3185 3057 2938 2919 2669 142 --33484 2572 2528 --
NM_000618chr12125906 5854 5748 5587 5533 4782 4086 2648 2567 2560 2036 1477 26280 1271 35328 5165 294 25405 5204
NM_000660chr193258 237 64 1102 1228 --
NM_000678chr204572 309 268 124 --2795 355 1296
NM_000682chr23688 106 63 --51406 1386 722 100 82 --
NM_000719chr12116413 6038 4477 4240 4224 2341 2009 2000 1850 1219 564 22393 73 54771 4455 4426 4207 247 25940 1387
NM_000721chr132246 368 306 22046 1721 21784 223 --
NM_000723chr1781510 1383 1314 1165 1157 482 248 206 11220 51402 1279 1095 674 487 --
NM_000738chr114853 688 405 93 --1858 3871 820 762
NM_000757chr15825 682 629 215 126 --4842 730 670 108 --
NM_000767chr1931116 258 49 --21420 94 1333
NM_000801chr2021024 63 --1135 --
NM_000813chr575273 4335 4172 1913 1896 1403 1088 21960 256 22175 1073 14818
NM_000826chr411000 --21812 116 --
NM_000828chrX--11748 ----
NM_000836chr192990 859 ------
NM_000837chr82128 99 --2436 57 1375
NM_000841chr68838 830 797 764 745 590 251 99 --3847 806 773 --
NM_000845chr7------1364
NM_000868chrX32499 1796 470 --1620 --
NM_000875chr1596261 5169 2804 1347 871 733 581 215 134 45891 5514 2373 675 91593 1494 1484 856 851 720 417 306 126 --
NM_000883chr71576 --7558 534 514 478 213 196 161 1268
NM_000901chr422392 1975 11709 1537 12371
NM_000903chr16----11286 1425
NM_000908chr52522 31 --1178 --
NM_000924chr1261150 1123 1091 1083 459 382 11163 31344 1192 967 188
NM_000950chrX21067 912 11011 13342 --
NM_000961chr20103890 3843 3457 3251 3024 2822 2486 1256 328 38 23836 556 42870 2557 334 249 43326 2897 59 49
NM_000965chr3----11056 --
NM_000966chr123430 156 94 --51019 679 219 214 100 1282
NM_001001395chr1252687 2607 2475 1797 953 2173 61 ----
NM_001001433chr2062734 2653 850 472 164 80 ------
NM_001001522chr112317 169 --1365 174
NM_001001557chr851555 763 656 617 550 --2874 699 1410
NM_001001586chr11411 --168 --
NM_001001974chr1032325 538 24 --3835 115 29 --
NM_001002259chr12173 1331 --1296
NM_001002762chr1082858 2097 1009 952 707 464 407 237 --62824 2337 1031 260 149 50 --
NM_001002843chr15----11315 --
NM_001002876chr22----2152 86 --
NM_001002909chr1771837 1635 1550 1544 339 218 201 --22108 1906 --
NM_001003656chr101200 ------
NM_001003674chr1856088 4912 2689 1179 1135 46162 5827 4930 4855 26923 969 12525
NM_001003694chr3265 33 --1558 1154
NM_001003786chr171293 1605 1653 1180
NM_001003799chr72672 640 --1249 --
NM_001004419chr1221504 551 14278 31815 1782 1015 --
NM_001005271chr1721112 133 --21074 1055 --
NM_001005336chr91121 --2568 408 --
NM_001005366chr121737 ----1671
NM_001005386chr231969 702 304 11697 1107 --
NM_001005417chr14555 444 184 75 ------
NM_001005505chr33455 338 231 --41704 1657 1163 513 3384 361 70
NM_001005609chrX83557 2985 2578 798 697 565 31 24 2760 123 51540 1377 1321 1100 411 33541 3331 3267
NM_001005611chrX1104 --1211 --
NM_001005845chr81345 --1355 --
NM_001005910chr31468 ------
NM_001006115chr392774 2632 2429 1882 663 502 296 264 244 --42153 2017 1930 872 12134
NM_001006944chr112106 76 --1255 3675 511 291
NM_001007098chr13824 355 71 --1241 --
NM_001007156chr1591734 1593 1553 1315 662 449 219 193 133 21708 386 11697 --
NM_001007271chr101268 ----1837
NM_001007278chr1383895 3604 3493 1559 1547 1466 684 474 --3922 625 564 --
NM_001008220chr5103903 3640 3626 3537 3524 2694 1090 1062 899 373 12619 83766 2584 2507 862 476 336 311 117 33648 3547 2639
NM_001008222chrX31268 1257 525 --21102 98 --
NM_001008392chr363222 2706 829 605 313 63 43050 1415 1124 109 33326 586 339 --
NM_001008495chr811393 ----1780
NM_001008701chr1982921 2778 2663 2484 2098 2051 1211 121 --82412 2384 1203 663 654 637 526 432 --
NM_001009185chr51646 ----1135
NM_001009554chr473642 1377 1252 736 352 344 149 --148 13814
NM_001009880chr22144439 4109 4004 3807 3638 1584 1495 1366 1015 563 417 223 186 71 23765 1669 54557 4154 1105 1032 211 11358
NM_001009955chr1----1118 --
NM_001010867chr1166476 5733 5663 5655 5481 5354 5176 2050 1887 1727 1710 1694 713 359 150 64 26396 2131 65871 4708 4095 2601 2067 1797 25251 2094
NM_001010942chr12149 1333 ----
NM_001011513chr413937 ------
NM_001011537chr33420 345 174 11953 11464 --
NM_001011713chr1421574 1439 ----1407
NM_001012393chr1154585 4160 3546 2022 483 24608 3474 34732 1947 257 21953 1502
NM_001012426chr682627 2579 2160 1256 953 597 541 454 --83341 3238 2908 2460 1236 1072 516 276 23182 2654
NM_001012614chr42646 632 --1191 --
NM_001012643chr194514 212 76 24 --1221 1106
NM_001012716chr18------133
NM_001012755chrX41493 1220 1176 1054 --21724 481 11296
NM_001012977chrX41166 1156 1102 415 --1280 --
NM_001012989chrX----1560 --
NM_001013415chr4--11351 153 --
NM_001013620chr1247972 6336 2860 2788 --23072 999 36417 5981 2937
NM_001013690chr1291898 1778 1662 1571 886 873 576 437 309 11970 42224 1804 899 469 --
NM_001013693chr192556 1835 928 902 751 615 600 392 231 1624 11828 22285 1858
NM_001014283chr1321520 735 1462 11476 --
NM_001014435chr162574 128 --3411 239 189 --
NM_001014442chr13----1131 --
NM_001014809chr41972 1196 2799 290 --
NM_001014831chr194754 734 704 107 --2789 678 --
NM_001014839chr14731 422 383 240 --1771 1370
NM_001015053chr173263 233 116 1642 31113 186 126 2225 140
NM_001015055chr2130 ----1257
NM_001017395chr3103278 2853 2777 2644 2552 2395 2327 1406 1078 395 22273 1208 42452 1011 959 588 12961
NM_001017523chr1221681 282 --2129 120 --
NM_001017961chr1----1153 --
NM_001018108chr1582147 1769 795 780 643 580 122 31 --31927 1433 332 --
NM_001024226chr1133 --2759 93 --
NM_001024401chr1642537 2519 2295 391 --62531 1875 1844 860 583 469 22506 933
NM_001024649chr532771 2485 2476 11915 21880 462 --
NM_001024666chrX2488 113 1104 2535 476 163
NM_001024668chr122833 789 1337 2746 240 --
NM_001024808chr1271833 1059 1035 831 490 431 219 175 22394 1028 1547
NM_001024937chr171604 --1218 126
NM_001024948chr172921 2614 2167 1139 385 274 237 13397 22637 332 --
NM_001024959chr34870 784 675 556 --2818 803 1182
NM_001025077chr10147056 6611 6434 6258 6046 5842 5565 5192 1445 447 424 411 151 25 12688 36199 6166 1170 1886
NM_001025079chr363442 2574 1645 1593 1479 221 --21122 377 --
NM_001025233chr1231816 1714 241 --1938 11049
NM_001025366chr61612 1581 11484 --
NM_001025579chr172246 180 --4960 192 118 75 1405
NM_001025579chr172246 180 --4960 192 118 75 1405
NM_001025616chr41756 1182 ----
NM_001029863chr652856 2839 2507 1133 1001 22773 2457 ----
NM_001029875chr521094 780 --42031 2025 145 135 22585 260
NM_001029882chr1----3131 119 111 --
NM_001030007chr1653057 1010 914 528 388 23794 3024 --12750
NM_001030272chr11------1194
NM_001031677chr51131 ------
NM_001031695chr22115131 4845 4319 4040 3892 3315 2014 1768 1292 878 203 21196 1059 34481 1732 1381 15416
NM_001031738chr2----1445 --
NM_001031740chr111192 11116 --1265
NM_001031801chr221126 --1153 --
NM_001031804chr1643467 547 213 42 11097 --21387 1170
NM_001032289chrX2315 188 --3762 169 105 --
NM_001032296chr1332720 2533 658 2807 718 12519 12427
NM_001033045chr234365 3010 144 ------
NM_001033081chr141405 1368 403 279 11180 ----
NM_001033117chr394783 4592 4499 4349 3807 3510 1543 1424 1273 14105 64761 4466 4434 810 749 705 11737
NM_001033925chr1021990 174 11487 ----
NM_001034833chr51258 --172 --
NM_001034837chr53740 687 585 --172 1277
NM_001035003chr41907 --11336 --
NM_001035254chr9162121 2105 2087 1880 1813 1707 982 899 893 769 669 474 459 404 163 116 --51819 967 824 642 551 22514 1733
NM_001035267chr12----1205 --
NM_001035chr1169 ------
NM_001037164chr71326 --196 --
NM_001037290chr11--1326 ----
NM_001037324chr34566 244 188 171 --4494 303 294 194 --
NM_001037334chr183908 504 322 ----1204
NM_001039141chr2222391 385 22434 1004 32290 2150 694 32469 563 538
NM_001039574chr131005 992 750 2384 317 41062 949 912 887 --
NM_001039577chr184154 3962 3874 1716 1300 926 236 23 --64174 3924 3513 3119 3098 1268 --
NM_001039583chr224434 417 162 135 --3360 128 120 --
NM_001039590chrX23509 1120 13062 12473 1378
NM_001039618chr1165815 5383 4386 508 478 430 --35314 5027 545 --
NM_001039690chr1661971 1945 1851 1565 825 52 --21788 667 --
NM_001039711chr121119 106 ------
NM_001039802chr11117 --1366 --
NM_001039840chrX55680 4147 768 568 319 23856 1684 15998 --
NM_001040056chr162690 217 --3562 222 211 1496
NM_001040110chr731309 695 557 --1573 21868 227
NM_001040613chr821474 102 ------
NM_001040708chr8--1331 11023 --
NM_001040712chr933274 2546 442 ----13034
NM_001040715chr163863 400 168 1356 1237 --
NM_001040876chr4--2338 94 1410 --
NM_001042404chr111751 --1388 --
NM_001042473chr1021456 542 --21461 258 --
NM_001042486chr2031348 1166 406 11519 31556 1452 1230 --
NM_001042506chrX31176 1112 415 --21328 280 --
NM_001042595chr19181 --189 --
NM_001043318chr1463934 3916 3389 1382 772 692 --41358 1033 1003 781 33515 2718 924
NM_001043351chr131895 743 452 1701 3782 172 30 21644 1507
NM_001044385chr233871 3612 3597 23009 44 33338 1047 785 --
NM_001066chr161973 1560 1464 461 222 138 --32015 1354 295 1391
NM_001092chr1792345 1903 1839 1809 1001 664 503 247 182 --2436 219 --
NM_001095chr1231936 1302 1295 --91660 1279 1202 503 274 254 170 85 71 --
NM_001144chr1631012 303 76 11115 127 2331 67
NM_001149chr10----1553 --
NM_001153chr2----1125 --
NM_001174chrX--21975 1784 2445 423 --
NM_001191chr2051332 1055 1024 243 116 11046 21394 1344 21132 48
NM_001197chr221340 --2278 51 --
NM_001198chr61264 --22254 841 --
NM_001206chr942832 2135 2081 123 --13073 --
NM_001220chr7173 --155 --
NM_001222chr1011314 11634 11663 11776
NM_001264chr62598 264 --2896 715 --
NM_001270chr5----1284 --
NM_001304chr1723014 2549 33061 1120 1023 12936 --
NM_001365chr174566 554 256 71 --3319 282 36 --
NM_001395chrX3785 268 53 --1191 133
NM_001404chr11127 ------
NM_001406chr177496 303 231 213 138 106 50 11508 31482 371 191 1180
NM_001407chr331638 1085 639 2505 122 1104 --
NM_001408chr16622 586 577 426 107 61 21671 1273 4596 459 89 66 --
NM_001416chr172404 391 1196 ----
NM_001420chr1972666 2155 992 508 400 383 325 1862 22517 227 11144
NM_001438chr133315 1392 329 23524 1419 1643 --
NM_001449chrX41018 434 359 221 21252 369 1506 2423 70
NM_001453chr61391 --11578 --
NM_001458chr72210 127 ----1631
NM_001493chrX4730 672 515 251 --1290 3678 495 30
NM_001497chr952465 2118 2067 1736 171 12652 22266 1786 --
NM_001543chr5114533 4350 4305 4205 3779 3293 1802 1566 1226 658 389 --94405 4120 1868 1824 1518 1424 325 301 249 22939 1384
NM_001610chr112673 242 --174 --
NM_001614chr17160 ------
NM_001617chr2111165 1156 1149 942 509 317 300 285 264 192 169 --3502 69 31 1933
NM_001627chr331902 1700 904 2530 460 ----
NM_001635chr73884 822 405 --1351 --
NM_001650chr1853054 1327 1074 539 45 13592 12589 11064
NM_001654chrX158 --187 199
NM_001662chr7187 --2136 130 --
NM_001665chr111395 1474 5483 387 193 34 28 --
NM_001677chr13763 424 316 ------
NM_001678chr1751564 309 63 52 41 --21558 1346 --
NM_001679chr32189 181 --2636 198 --
NM_001694chr161163 ------
NM_001702chr81359 1234 150 --
NM_001703chr11239 --1250 --
NM_001707chr71197 --3701 633 35 2719 298
NM_001716chr1151228 1126 431 249 61 11286 61279 1172 1131 627 364 341 --
NM_001753chr781506 1430 1413 1380 1254 1163 560 368 ------
NM_001759chr1275202 4784 4038 3319 3279 1596 1052 --43870 3284 1068 114 13786
NM_001783chr191248 --2299 26 --
NM_001806chr1912009 --22864 2401 --
NM_001810chr209796 688 577 539 295 274 200 188 23 --1766 --
NM_001834chr5----1230 --
NM_001839chr1----1162 --
NM_001842chr91525 --2502 471 --
NM_001844chr121282 --1297 --
NM_001859chr953331 1359 460 147 94 11103 33536 3523 1167 176
NM_001895chr20--1807 11050 --
NM_001927chr24487 197 179 44 --154 --
NM_001938chr11714 --1366 --
NM_001949chr6180 3995 586 231 12125 --
NM_001961chr19--1376 193 --
NM_001964chr541171 331 222 178 --1391 --
NM_001970chr171466 --4560 530 232 175 --
NM_002023chr141427 572 520 465 --31591 1343 474 11599
NM_002024chrX11668 --11378 --
NM_002025chrX159094 8838 8730 8685 8328 8298 7880 7572 7100 6823 6255 2737 1890 1430 793 38641 7688 2285 28766 913 --
NM_002028chr1441107 983 501 398 --21268 507 --
NM_002048chr921250 888 --1894 --
NM_002062chr661597 1261 1058 576 560 186 --11331 --
NM_002063chrX1979 135 ----
NM_002071chr18145 --2150 110 --
NM_002086chr1761660 1611 1600 1387 527 289 --52025 1874 1692 241 76 --
NM_002128chr1341034 783 531 183 ------
NM_002137chr711748 --12404 --
NM_002140chr92773 412 ------
NM_002146chr172579 200 ----1887
NM_002149chr28735 676 649 572 563 134 95 79 ------
NM_002196chr202403 219 --1849 --
NM_002205chr1261014 932 895 868 399 374 --1918 1715
NM_002214chr744927 3689 1993 52 --11248 21275 953
NM_002221chr182763 2440 2330 1070 1050 901 597 575 11148 32304 371 313 --
NM_002228chr11501 --2258 237 --
NM_002229chr19----1361 --
NM_002232chr1369 62 50 ------
NM_002240chr212469 224 --1165 --
NM_002254chr2112391 1908 1561 1464 894 666 619 317 226 148 22 --52250 860 796 510 332 --
NM_002264chr344328 1641 1293 146 24302 3107 --14753
NM_002267chr132334 107 ----1644
NM_002270chr554549 4061 1980 1396 1202 11513 ----
NM_002280chr17--144 181 --
NM_002305chr22----246 40 --
NM_002336chr1244536 4487 3547 1554 13613 3743 676 28 --
NM_002355chr1231061 993 162 --11029 --
NM_002359chr17133984 3915 3735 3710 3608 3310 3166 2886 1645 1413 661 488 357 34181 3809 3066 104191 3989 3819 3678 3614 3319 2785 1126 70 65 --
NM_002360chr762364 2007 1782 815 574 434 --62577 2145 2091 545 476 234 --
NM_002373chr152883 160 --21307 975 --
NM_002375chr3102325 2012 1805 1749 1683 1585 1548 717 530 235 22334 386 61998 1602 722 690 620 404 31564 696 332
NM_002382chr1431071 443 329 --2383 233 --
NM_002390chr1771731 1717 1608 1381 688 629 324 2736 554 71975 1922 1387 774 257 165 64 11653
NM_002398chr231052 142 130 ------
NM_002419chr11135 --1414 3462 387 94
NM_002442chr1261340 1288 555 281 220 132 --3172 164 137 --
NM_002467chr8------1146
NM_002473chr2231039 215 113 --2500 123 --
NM_002479chr1--1279 2207 95 --
NM_002501chr1993407 3326 2939 1591 1436 1203 1130 965 349 1732 93934 3897 3651 2957 2515 1013 997 991 629 1493
NM_002505chr631506 1171 575 11435 1100 --
NM_002515chr1431330 1289 423 11580 11538 --
NM_002516chr19----1104 1272
NM_002522chr1732756 2422 1478 1238 72589 2451 2399 870 825 186 176 1810
NM_002556chr1141507 1414 370 355 --21345 310 --
NM_002576chr114873 826 431 82 --11209 --
NM_002581chr985058 4272 4195 1581 929 855 131 79 --15348 --
NM_002585chr11275 138 1267 --
NM_002589chr4--124 179 --
NM_002594chr2042426 900 720 53 22504 190 ----
NM_002608chr2281331 1225 1150 572 417 381 212 60 --21270 477 11259
NM_002616chr171444 158 2490 167 1107
NM_002632chr143690 560 125 --3813 640 88 --
NM_002634chr172636 361 --3855 606 79 --
NM_002648chr62524 493 --1169 1961
NM_002651chr11842 1792 2270 218 --
NM_002655chr811998 150 ----
NM_002660chr2031125 739 477 21086 195 11168 1331
NM_002698chr1941007 994 337 311 --52797 2459 2033 751 98 1520
NM_002699chr12268 257 --51086 969 952 306 276 --
NM_002717chr81511 --1489 --
NM_002721chr9--1456 2114 37 1476
NM_002739chr192470 26 --1129 2262 92
NM_002745chr22114098 3915 2952 2833 1600 1544 1413 1330 1309 1143 351 1901 --11297
NM_002753chr41145 --1545 --
NM_002824chr122365 97 --1454 1351
NM_002827chr2051756 717 197 46 36 --11295 11329
NM_002849chr1211038 ----2917 717
NM_002851chr7------1501
NM_002855chr11223452 3404 3344 3220 3194 3116 3087 2701 2680 2674 2665 1285 968 924 865 845 820 720 275 115 107 65 43307 2458 1470 1209 62656 1487 811 770 452 280 33436 994 851
NM_002857chr162647 2567 2156 1853 723 106 11930 2968 114 --
NM_002868chr1242260 2230 1842 1567 --31823 365 127 --
NM_002880chr31133 --3692 222 69 --
NM_002959chr194169 3966 3683 3393 3367 3092 1010 875 648 24218 3931 13047 23663 369
NM_002971chr31415 ------
NM_003011chr921434 1151 11704 21360 308 --
NM_003026chr9----31109 1004 421 --
NM_003038chr222639 427 2764 42 186 --
NM_003051chr1----2776 733 --
NM_003055chr104312 296 137 54 ----1378
NM_003076chr1251534 663 519 78 60 1211 31601 1079 362 21050 66
NM_003098chr202197 73 ------
NM_003128chr211965 11064 125 --
NM_003131chr671884 1866 1585 807 519 246 172 31724 1419 323 3585 470 177 --
NM_003144chr631994 1900 399 ----144
NM_003155chr872028 1931 1924 1862 906 668 591 1370 2281 222 11996
NM_003156chr1121320 200 2490 450 3210 205 147 21225 327
NM_003162chr21314 --196 --
NM_003170chr176577 536 525 489 226 56 --3545 76 64 --
NM_003173chrX101285 1265 1203 1196 1190 1153 1088 548 358 135 --4126 116 106 70 2401 195
NM_003179chrX1430 --3286 177 61 --
NM_003185chr20----3507 500 299 --
NM_003198chr11314 ------
NM_003202chr541703 464 364 123 --2513 54 1395
NM_003204chr1731593 1494 1206 --31582 1341 604 11617
NM_003205chr1521790 564 ------
NM_003214chr691393 1214 1188 1139 1039 465 257 229 58 1477 21099 1006 --
NM_003216chr22122909 2307 2266 2165 2073 2061 1130 1039 964 841 51 32 2816 271 --11320
NM_003234chr321906 858 --2687 271 --
NM_003246chr1531831 1272 303 --11278 1159
NM_003257chr151156 11275 ----
NM_003269chr61250 --31112 829 297 --
NM_003340chr42338 237 --189 --
NM_003342chr1733076 3043 2603 22671 2660 22487 990 12105
NM_003344chr721319 1105 --2642 505 --
NM_003367chr192208 90 --2449 52 --
NM_003370chr191166 1493 169 --
NM_003371chr961978 1356 787 718 426 121 1541 5743 467 412 323 182 1378
NM_003373chr104705 449 325 76 --31946 607 331 1753
NM_003394chr122569 271 --1227 --
NM_003406chr831721 1429 340 ----272 27
NM_003412chr322923 819 --11060 --
NM_003413chrX21284 175 ------
NM_003458chr3143998 3959 3446 3438 3249 3237 3047 1588 1022 972 583 571 277 204 --43430 1505 1028 443 23702 2668
NM_003468chr233159 220 105 32830 1637 1061 23488 2802 1164
NM_003470chr1661666 1654 713 554 351 79 --2324 175 --
NM_003482chr1252670 2377 1014 626 468 --52096 770 483 378 233 1745
NM_003557chr151582 1384 1314 1184 284 2207 72 1140 --
NM_003562chr171163 --173 1155
NM_003574chr1855175 3881 3817 2209 453 1900 --1564
NM_003575chr731121 610 278 21308 1159 41455 1346 1088 441 11222
NM_003586chr163513 195 148 --4539 491 457 96 --
NM_003629chr143141 2808 820 811 23502 1175 22182 1376 22554 1385
NM_003632chr174717 208 195 104 --2352 56 1252
NM_003660chr193601 558 70 ------
NM_003679chr12868 830 1296 22414 738 --
NM_003685chr191961 --1391 --
NM_003686chr1----132 --
NM_003737chr11145 --3393 387 74 --
NM_003741chr32116 109 --2346 122 --
NM_003743chr252211 1846 614 560 398 --11526 --
NM_003760chr11545 --1550 --
NM_003768chr161810 1779 1631 1495 1463 640 --21468 1163 --
NM_003779chr11423 ------
NM_003822chr153034 2893 2642 2501 2272 1799 1520 22545 101
NM_003825chr1521359 183 ----1588
NM_003861chr1412638 --1141 12433
NM_003893chr103412 166 33 ----143
NM_003936chr261189 1062 984 432 337 135 --21198 997 --
NM_003955chr1751204 1146 1029 533 243 --31118 305 148 11442
NM_003958chr683885 3177 2710 2539 1332 1144 937 91 12896 2525 386 1251
NM_003966chr5107588 7272 6231 2700 1845 1511 1225 628 489 66 36864 136 57 21164 404 27499 5054
NM_003969chr193146 126 114 ------
NM_003980chr61249 ------
NM_003988chr1092281 1879 1772 892 838 679 340 184 63 --41695 1679 825 660 1685
NM_003993chr1----1233 --
NM_004036chr22269 195 --1514 --
NM_004050chr1462247 2126 1856 857 507 71 21800 634 42253 788 619 590 --
NM_004064chr122928 448 --1188 --
NM_004077chr1261247 1223 1075 937 216 202 --1414 11063
NM_004082chr2157 --3223 117 23 --
NM_004093chr134671 401 57 49 1368 22642 774 --
NM_004107chr19------1149
NM_004132chr1021132 1065 --31029 301 199 --
NM_004140chr173246 131 72 --3231 137 35 --
NM_004186chr35903 589 369 223 45 --1115 1159
NM_004200chr1161242 1069 811 802 234 53 22853 958 72953 2743 2120 2101 2061 1050 760 11021
NM_004202chrY1468 --1127 --
NM_004228chr19----141 --
NM_004274chr1442925 2819 2211 326 --13057 1276
NM_004308chr1161816 1726 522 450 193 136 --71516 651 605 533 470 314 211 11187
NM_004309chr1791148 1055 910 369 287 233 158 113 61 --41116 783 393 276 --
NM_004311chr1052361 2261 2251 1090 510 --62722 2334 2272 1263 1196 689 21016 696
NM_004349chr811100 ----1893
NM_004364chr1971237 1223 1188 499 153 124 86 1978 2375 144 --
NM_004379chr21120 --1189 --
NM_004392chr13--11063 12034 --
NM_004393chr351952 1894 1798 1790 93 21978 899 12238 31859 1749 1508
NM_004397chr11104080 3855 3749 3459 3035 2649 1587 1580 884 70 23390 959 ----
NM_004411chr71262 2163 143 ----
NM_004423chr382425 2063 1855 669 594 529 224 137 --3692 509 199 2682 538
NM_004427chr11902 --21096 302 --
NM_004429chrX31288 1126 183 --41274 1027 312 153 11088
NM_004436chr11575 1158 177 150
NM_004438chr242238 2117 1277 541 11120 1292 --
NM_004443chr33591 584 261 1740 1525 --
NM_004444chr73643 295 88 1885 ----
NM_004451chr114591 472 244 42 --2583 223 --
NM_004459chr171341 --1432 --
NM_004463chrX147 --3470 408 227 --
NM_004474chr13928 912 386 --1293 1755
NM_004475chr1751186 857 457 391 172 11021 21191 351 21180 1111
NM_004480chr143284 269 201 ------
NM_004499chr5------1108
NM_004503chr121307 ----1521
NM_004530chr163983 479 40 --2885 299 --
NM_004540chr211152 --1781 --
NM_004575chr431160 1018 242 --167 --
NM_004586chrX73895 3455 3440 1996 1473 1394 344 14993 1143 1105
NM_004588chr11113657 3201 2509 950 831 601 456 348 340 70 32 --63382 3223 2969 2806 1625 467 33188 2895 1058
NM_004593chr3------129
NM_004596chr19----2156 25 --
NM_004637chr341185 1079 253 229 2492 485 21252 1234 11010
NM_004643chr142319 280 ----1296
NM_004654chrY------1102
NM_004687chr1731845 439 21 2835 328 --11927
NM_004689chr141428 198 ----
NM_004705chr11------1757
NM_004711chr22233390 3365 3261 3185 3028 2991 2776 2728 2579 2424 2318 2267 1145 1133 998 991 907 704 634 583 499 207 108 2925 115 93302 2755 2652 1391 1158 82 67 41 21 1793
NM_004717chr721557 579 --150 1344
NM_004748chr151732 1402 13770 --
NM_004756chr1951393 1277 475 304 254 141 2469 83 --
NM_004762chr1772037 1745 616 338 287 207 48 --41231 716 590 497 --
NM_004765chr16127 ------
NM_004776chr2072984 2396 1198 985 895 882 267 --42213 854 374 260 --
NM_004788chr1142607 1677 193 145 --11841 --
NM_004798chr2073415 1433 1103 924 609 596 325 13041 23420 2547 13208
NM_004805chr22239 22 ----21352 562
NM_004834chr223401 1109 ----1849
NM_004852chr181113896 12663 11000 10845 9134 3783 3519 3511 3392 2684 2293 414251 13781 12746 2220 714329 12047 10957 9689 8883 3361 3102 23108 1721
NM_004860chr17292 45 ------
NM_004861chr22129 --1264 --
NM_004921chr11933 --11609 1344
NM_004922chr103981 325 198 --1965 --
NM_004929chr821340 1302 ----1421
NM_004930chr1----2283 74 --
NM_004938chr911107 ------
NM_004953chr31166 1362 1289 --
NM_004961chrX--11447 21389 164 1121
NM_004979chrX21085 307 1259 31136 1124 108 1768
NM_004985chr1221058 866 ----1111
NM_004992chrX218083 7703 7317 6992 6970 6919 6694 6162 5675 5262 5212 5190 5171 2993 2530 2398 2226 2088 1364 1237 415 12165 78060 6780 5432 3189 2644 1806 1369 1643
NM_004995chr1461207 1084 1075 1060 281 45 --61307 1198 369 250 179 134 --
NM_004996chr1651173 1097 689 250 174 1558 2388 241 11574
NM_004999chr644511 3362 3131 64 --12979 --
NM_005017chr32222 24 ----139
NM_005032chrX3337 323 32 --1273 --
NM_005053chr192230 154 --1201 --
NM_005070chr21161 ----1252
NM_005095chr141993 1587 801 638 --11580 --
NM_005096chrX61002 412 251 139 58 44 --41189 811 422 115 --
NM_005099chr111130 --71164 249 240 176 163 127 21 3885 141 82
NM_005110chr54799 738 595 113 --2732 542 156
NM_005117chr116962 729 715 652 227 216 --2672 245 --
NM_005154chr15------1239
NM_005157chr991952 1720 1627 725 576 482 463 222 41 1307 51852 1847 564 251 187 11345
NM_005160chr2286421 4654 4382 4350 2031 1352 886 160 44567 1267 411 357 66725 5639 1159 1132 581 576 16705
NM_005178chr191271 --296 51 --
NM_005183chrX124 ------
NM_005184chr19101391 1357 1212 1172 1141 1134 1038 451 221 202 1151 41177 1153 398 306 --
NM_005186chr114537 504 195 31 --3278 170 137 --
NM_005187chr1651635 1613 1536 593 328 --21492 160 31665 812 213
NM_005206chr172898 406 --11095 1281
NM_005207chr22113526 3439 3215 3145 3125 2833 1440 1400 942 305 40 12774 1166 33406 2721 686
NM_005220chr1771070 987 476 395 205 183 126 --11092 1278
NM_005229chrX21085 1045 --1421 --
NM_005238chr1133006 2544 2534 ----13200
NM_005273chr7143 --2230 127 --
NM_005281chr11295 1908 2775 670 --
NM_005312chr9102720 2333 2094 2078 1869 1047 943 667 453 379 22630 979 2634 176 --
NM_005316chr111979 ----1122
NM_005354chr19----2247 205 1427
NM_005374chr1792331 2235 2134 1825 1524 1477 648 217 113 --51975 1779 1729 730 357 --
NM_005392chr93762 481 110 --51681 550 146 67 29 2230 91
NM_005400chr242490 2216 516 456 1151 1449 12443
NM_005415chr2----2497 59 --
NM_005424chr11324 --1260 1101
NM_005430chr1241030 879 659 346 --4665 376 271 222 1352
NM_005455chr121621 423 31589 682 299 ----
NM_005504chr1244981 2603 1321 285 --1349 15872
NM_005507chr11121 --270 50 --
NM_005517chr111288 ------
NM_005563chr11715 2648 596 1583 --
NM_005569chr2261232 622 521 497 392 48 160 11561 --
NM_005578chr311275 44097 3310 783 253 13766 1882
NM_005587chr15--1229 --151
NM_005596chr976382 5023 4910 4175 2156 1405 790 --15898 --
NM_005599chr111005 --132 --
NM_005604chr622023 700 ----12351
NM_005618chr61204 168 ----
NM_005619chr19----133 --
NM_005629chrX61076 337 318 214 112 86 1264 41002 991 835 297 --
NM_005639chr1231566 1448 30 11777 1196 --
NM_005688chr3153 ----1854
NM_005708chr13----1142 --
NM_005717chr12921 869 --282 27 --
NM_005736chr1051108 449 410 262 88 --31557 1002 434 --
NM_005737chr272844 1928 807 709 645 601 325 --32696 416 229 --
NM_005746chr711075 --2604 124 --
NM_005768chr122656 132 176 --2662 281
NM_005779chr533629 1469 1197 ----2398 367
NM_005796chr16--2370 79 --1330
NM_005824chr71629 ------
NM_005842chr131689 ------
NM_005860chr1921594 1116 21195 257 21271 1222 21657 1312
NM_005904chr182948 436 --3588 565 479 --
NM_005907chr61472 ----129
NM_005909chr563623 3590 3561 2930 2904 813 --23970 3248 --
NM_005910chr17133663 3021 2947 2666 2526 2508 1482 1456 1223 1194 1120 1030 689 13846 53630 3448 1632 104 94 1916
NM_005911chr22252 97 21399 303 1191 --
NM_005920chr142837 2747 1461 597 33665 1239 990 53504 2910 1498 1182 73 12846
NM_005922chr6----1151 --
NM_005933chr1152430 2005 1958 794 643 --22675 2076 22201 1930
NM_005938chrX31299 357 23 --21075 1069 1167
NM_005941chr823182 2984 1884 ----
NM_005955chr1144971 4617 3816 1884 1706 1530 1494 1335 1314 1033 882 749 416 354 33883 3757 477 44782 4242 1473 1049 11956
NM_005967chr123514 224 213 --3251 121 110 2564 134
NM_006022chr13----178 --
NM_006047chr2023491 2371 --1926 --
NM_006051chr52234 107 --1112 --
NM_006062chr241247 1072 990 185 ----131
NM_006079chr6----1603 --
NM_006091chr151711 --11791 1519
NM_006156chr141235 --189 --
NM_006160chr1741472 1320 1308 41 --31255 1035 54 1175
NM_006162chr1831439 1423 616 ------
NM_006166chr122785 386 --1616 --
NM_006176chr114579 230 190 101 --1324 --
NM_006191chr12--1333 2125 31 2933 38
NM_006194chr1441192 830 260 110 --195 --
NM_006201chrX91017 886 443 431 141 132 123 104 96 ----2458 449
NM_006206chr442899 2706 2356 197 1210 1948 --
NM_006212chr1105275 5167 4836 4490 4225 3660 1130 790 754 503 1313 168 13648
NM_006224chr1782292 2229 2065 936 720 460 355 159 11986 4861 557 505 222 1657
NM_006245chr651019 868 679 300 197 1799 4274 263 75 55 --
NM_006265chr8154 ------
NM_006283chr8114426 4160 3901 3057 1829 1420 739 581 547 139 88 --33360 899 144 1875
NM_006289chr9189 1432 1166 --
NM_006293chr152713 656 --2399 368 1893
NM_006301chr122639 512 1493 --2243 109
NM_006306chrX65893 4688 1959 1113 520 309 1901 34931 4462 45 14350
NM_006328chr111118 --2469 246 --
NM_006336chr931123 941 551 --41280 1037 934 457 11080
NM_006340chr174453 312 111 32 --2437 75 --
NM_006369chr13381 306 68 --1293 --
NM_006373chr1751420 1111 942 919 459 11300 5524 370 259 153 107 1348
NM_006420chr2043346 1353 816 678 --11341 --
NM_006454chr4223050 2894 2851 2822 2798 2751 2708 2542 2365 2183 2111 1991 987 844 817 639 451 435 179 149 139 29 12405 72856 2808 2420 2331 2117 2006 184 12147
NM_006458chr111132 --1281 --
NM_006494chr194737 73 56 29 --3766 687 110 --
NM_006516chr121419 517 --31511 1394 31 --
NM_006517chrX62113 1955 543 369 58 25 1717 21478 572 --
NM_006540chr8----1184 --
NM_006544chr1465674 5308 5279 5253 2309 507 --14385 14556
NM_006546chr17115426 5157 5125 4333 4110 2631 2223 1038 1018 783 129 14314 85993 5888 4123 4116 2490 1920 866 214 --
NM_006547chr731724 1480 387 12092 --11583
NM_006557chr931697 626 615 ----11085
NM_006591chr1131660 343 242 21336 328 1478 11846
NM_006602chr20184 ------
NM_006633chr51719 ----1607
NM_006662chr16----1249 --
NM_006670chr61455 177 ----
NM_006690chr20122203 2005 1908 1873 1841 1783 1639 1510 1486 483 462 226 21610 188 31578 953 859 2708 577
NM_006698chr2041290 1267 918 479 --1233 1317
NM_006742chr16111840 1731 1506 1295 1275 698 601 324 274 160 75 1487 22007 1247 --
NM_006761chr171605 --1134 --
NM_006772chr661402 1235 692 139 116 104 1250 41691 1219 463 221 1312
NM_006815chr121474 11379 1220 --
NM_006823chr81128 --1527 --
NM_006851chr12----32576 2474 866 --
NM_006856chr122734 86 --11026 1294
NM_006874chr4----1208 --
NM_006875chrX3889 872 179 ------
NM_006885chr1664245 3819 1144 1077 1050 340 --12865 --
NM_006888chr1453371 2575 2539 565 150 --1192 --
NM_006897chr12------123
NM_006917chr1----1107 --
NM_006941chr227995 981 877 833 317 68 57 --41035 975 156 42 --
NM_006943chr2062825 1335 1000 693 362 157 --43029 2619 817 115 --
NM_006946chr113537 385 94 ------
NM_006950chrX----1647 --
NM_006981chr92820 93 --32918 812 29 --
NM_006990chr1132423 2299 2201 2161 1870 1787 1764 656 618 568 535 373 49 --21756 1664 31574 514 502
NM_006999chr551866 1324 823 785 227 --31592 436 47 --
NM_007005chr921373 1093 --1344 --
NM_007011chr15126346 5067 4314 4236 4166 2557 2374 1161 1108 933 257 250 36042 2401 712 46615 4625 4555 4418 --
NM_007026chr17--1392 263 49 --
NM_007040chr1921051 234 1716 5918 142 124 77 60 1375
NM_007051chr1----1122 --
NM_007111chr132567 287 ------
NM_007122chr13242 207 72 ----189
NM_007125chrY21316 38 --1156 --
NM_007126chr93366 70 36 ----1107
NM_007146chr1752804 2610 2120 1058 928 11850 ----
NM_007150chrX81973 1769 1605 1498 1474 1393 727 135 173 2740 60 --
NM_007170chr11821 --1245 1655
NM_007174chr1221719 1516 --1211 --
NM_007178chr121490 --1449 --
NM_007181chr19----137 --
NM_007185chr14778 338 286 231 --2171 88 --
NM_007189chr761438 1130 611 220 199 148 --2137 117 1955
NM_007192chr14--1751 1908 11031
NM_007221chr11366 --1284 --
NM_007225chr1741051 811 764 51 ------
NM_007236chr1571874 925 780 691 626 370 159 --42091 1831 1721 1560 --
NM_007245chr164746 715 120 109 1884 2721 178 126
NM_007245chr164746 715 120 109 1884 2721 178 126
NM_007249chr13108660 8100 7246 6656 6617 3379 1619 1197 933 616 39136 7946 7902 48145 3261 855 739 1807
NM_007260chr12684 115 --3593 504 96 --
NM_007275chr3----136 --
NM_007286chr532077 1749 767 1684 32130 2070 2021 11307
NM_007327chr96462 420 379 340 199 144 --51146 998 826 794 27 --
NM_007367chr201220 ----152
NM_012064chr121876 ------
NM_012081chr543728 3419 3341 178 13090 ----
NM_012090chr12194 130 ----148
NM_012095chr1033409 2900 1332 52830 1347 945 938 587 32853 479 433 2978 580
NM_012104chr11103698 3530 3386 1350 1332 1149 954 530 393 132 11137 ----
NM_012117chr12--1127 ----
NM_012189chr183583 536 446 1249 ----
NM_012193chr1195300 5156 4652 4627 4469 4165 3323 2166 297 --24012 143 --
NM_012199chr1103247 3200 3030 2998 1538 1491 1066 643 598 213 --33165 1794 1605 21827 658
NM_012229chr10------11490
NM_012234chr383623 3486 3446 3103 2462 1124 254 63 22746 1118 --1753
NM_012257chr711029 ------
NM_012281chr7----12148 11948
NM_012282chrX4840 834 767 662 --1253 --
NM_012284chr121293 --3309 299 210 --
NM_012290chr21246 --11325 --
NM_012293chr251912 1901 810 689 337 ----12205
NM_012294chr794113 3177 3135 2526 1438 1345 1072 947 417 --13911 --
NM_012297chr442157 1658 793 357 --21828 765 --
NM_012308chr11132424 2285 2117 2011 1994 1827 857 819 608 344 265 184 116 11907 72484 2456 1812 954 833 189 125 12585
NM_012316chr1134410 4180 4134 3554 2048 1989 1761 1707 1457 1073 718 645 86 11401 54419 1564 415 143 118 21902 1859
NM_012325chr2021274 598 11575 ----
NM_012326chr24863 738 217 44 --4788 772 685 311 2662 57
NM_012343chr52884 310 ------
NM_012410chr163450 378 363 --296 85 --
NM_012423chr192450 57 --2157 41 --
NM_012434chr61233 --125 --
NM_012446chr52428 139 1217 1434 --
NM_012448chr1752081 1832 1795 902 699 1434 21865 1681 12479
NM_012464chr421851 763 1294 --12867
NM_013233chr2179 139 1454 --
NM_013246chr113698 670 214 1965 3838 709 43 --
NM_013260chr175532 430 309 190 55 31251 474 346 11237 --
NM_013279chr1192145 1980 1525 850 665 413 368 311 233 --32305 2021 2015 11766
NM_013346chrX----123 --
NM_013357chr8------1237
NM_013368chr19----1405 1548
NM_013372chr1541283 946 850 340 --21128 119 --
NM_013446chr721318 117 11087 21423 53 1427
NM_013449chr1252906 2844 746 193 132 2358 146 42364 2276 701 86 --
NM_013958chr8----198 --
NM_014001chr172614 88 11123 61628 1363 1307 558 272 48 --
NM_014010chr92596 575 --1551 --
NM_014112chr864627 4161 1612 1236 643 110 24807 1363 13921 --
NM_014117chr1631965 525 172 --32566 1042 694 12253
NM_014190chr431331 429 374 11244 41652 548 219 74 --
NM_014231chr1271758 1624 1356 454 345 241 185 11771 31841 164 57 --
NM_014232chr17111648 1618 1374 1339 1245 1163 1118 489 434 132 24 11236 31625 1263 443 --
NM_014235chrX41790 1712 1196 1154 --11649 --
NM_014286chr9153571 3270 2970 2809 2435 2418 2257 1225 922 774 707 516 445 387 164 --72992 2751 2548 956 950 288 128 --
NM_014289chrX41435 1118 1000 586 --11210 --
NM_014299chr19101807 1798 1785 1552 1440 604 512 251 243 202 21896 393 42052 1696 1509 141 11353
NM_014368chr961888 1808 620 496 128 26 --148 --
NM_014409chr11231 --1988 --
NM_014417chr192644 125 --1130 1589
NM_014419chr19126 ------
NM_014423chr584781 4718 1970 1846 1652 1402 364 23 ------
NM_014431chr1051200 584 472 443 352 --1484 11589
NM_014445chr31479 1873 --1107
NM_014449chr12--1160 182 --
NM_014470chr121251 1559 1709 --
NM_014494chr1621844 1649 12137 --2920 447
NM_014516chr19154 --2190 72 --
NM_014554chr1231618 578 159 --185 --
NM_014575chr3----1409 --
NM_014613chr5122707 2289 2211 2068 1986 1071 752 703 670 632 502 182 22998 320 2973 441 --
NM_014615chr1683494 3386 2664 2324 2304 2232 1150 226 1399 33338 2769 1155 --
NM_014620chr123787 139 36 --2189 23 --
NM_014630chr1583298 2702 799 747 525 489 426 366 2994 249 3134 90 59 1827
NM_014636chr963878 3455 3356 3105 1002 614 13070 13390 23689 444
NM_014663chr12970 305 1378 ----
NM_014665chr883554 3011 2538 2323 2307 1366 571 251 2197 172 22580 2368 --
NM_014666chr5----1386 --
NM_014667chr332329 2286 1684 --1294 1257
NM_014671chr72977 504 ----1624
NM_014699chr16----1395 --
NM_014701chr15187 --21383 1208 --
NM_014705chr7137 1849 ----
NM_014707chr71646 --1470 --
NM_014712chr163193 103 50 --1176 1469
NM_014720chr1011325 ----1107
NM_014723chr20153060 2833 2751 2626 2527 2513 2474 985 797 582 441 404 396 367 318 --72667 2050 1283 1130 972 382 287 --
NM_014726chr1751205 471 450 293 218 --2910 99 11138
NM_014727chr19160 --1197 --
NM_014730chr12155278 4981 4887 4335 4322 4265 3844 3655 3246 3237 1976 1317 1303 653 280 15231 53738 3596 3435 2105 1709 --
NM_014731chr20101592 1499 1174 1114 698 634 565 542 272 63 1335 2179 159 11623
NM_014732chr16135734 4867 4656 3660 1964 1915 1468 1270 1110 915 836 214 178 --54780 4271 3919 1264 1020 23735 129
NM_014741chr11141987 1817 1798 1421 757 658 584 548 501 375 352 342 280 94 --2771 77 --
NM_014746chr254357 3354 3148 3029 1462 24043 109 44053 3198 336 33 13225
NM_014747chr1135257 4915 3855 3828 3793 3768 3665 3658 2101 1947 1877 773 381 11243 73964 1463 1457 1413 1289 1253 430 25082 1273
NM_014755chr241000 764 538 444 23503 2797 23840 3511 --
NM_014757chr531968 868 571 --42324 1845 1827 941 1372
NM_014761chr161830 --1156 --
NM_014767chr10123628 3550 3085 2722 2708 2509 2330 2324 1188 1031 988 778 13041 113609 3030 2737 1384 1216 1059 946 667 531 484 261 32853 803 108
NM_014772chr1863354 3339 3054 2811 2566 183 23243 2600 32871 2460 891 11168
NM_014806chr9----1138 1176
NM_014807chr112279 244 --3608 596 522 --
NM_014810chr142297 1380 1045 688 --52559 1413 1267 791 58 --
NM_014819chr521942 354 ----11798
NM_014827chr131670 1355 604 2674 111 ----
NM_014840chr1262972 2540 1082 849 409 262 --22107 1034 --
NM_014846chr8----1247 --
NM_014847chr1--1136 1107 1153
NM_014871chr12------1590
NM_014900chr2----21140 1043 1409
NM_014901chr58711 421 415 247 238 211 113 35 --1100 --
NM_014912chr1022753 422 11037 --169
NM_014925chr122652 181 1749 --1372
NM_014945chr551245 264 226 167 103 1280 1627 --
NM_014947chr163030 2955 1154 950 942 628 ----31160 1025 219
NM_014952chr1561733 1521 1497 674 593 392 --21825 1502 --
NM_014962chr201306 --12179 --
NM_014967chr1541119 166 103 54 --1361 --
NM_014974chr1021755 229 --21525 364 11647
NM_014982chr1454879 4073 3849 702 157 24763 1989 13621 14924
NM_014989chr631893 1860 1809 1143 ----
NM_014990chr1411157 1532 ----
NM_014994chr1542260 2031 788 567 2192 36 42159 1468 213 65 42330 2167 1939 294
NM_015000chr122305 278 21083 486 12319 --
NM_015009chr3----163 --
NM_015015chr19102041 1988 1843 1828 1733 1675 131 93 84 55 1294 22047 1837 11270
NM_015020chr1623632 638 23643 3576 3360 192 74 --
NM_015023chr1111809 1775 1726 1707 1268 673 436 355 276 251 194 --51701 1681 1541 361 51 2315 298
NM_015025chr252332 2158 1688 914 44 1468 ----
NM_015032chr131605 21167 686 ----
NM_015039chr164017 3327 1268 572 448 392 13081 169 --
NM_015042chr15164372 4001 3974 3837 3781 3763 3127 2847 2778 2675 1729 1339 908 844 695 333 --23632 3272 33693 3289 676
NM_015044chr1663200 3048 3013 2616 2201 429 --22859 324 33055 1130 331
NM_015049chr233279 3208 1153 ------
NM_015064chr12133141 3099 3018 2607 2308 1429 1344 1266 1019 771 711 540 320 22983 1285 1669 --
NM_015074chr174557 3728 3224 1965 1701 879 749 --34153 3825 1674 11349
NM_015075chrX62056 1964 1747 1642 1592 259 32277 550 390 72089 1984 1724 609 593 321 177 --
NM_015076chr674235 3641 3279 3180 1243 627 494 24359 1772 --44408 3603 2849 528
NM_015080chr112900 355 --4916 400 221 34 1109
NM_015090chr1235796 5715 5708 5651 5466 5217 5160 4594 4342 4050 2434 2002 1784 1548 1301 1030 1010 960 748 711 594 303 265 11216 135843 5802 5662 5131 4674 2503 2394 2131 1356 1236 1123 766 619 --
NM_015092chr1624526 3289 13936 13276 --
NM_015107chrX82387 1761 1744 1674 933 432 293 200 2484 457 31508 526 88 1585
NM_015125chr19----3510 465 134 --
NM_015138chr1542772 2704 2485 401 138 1500 --
NM_015155chr1093143 3110 2645 2505 2284 1009 843 826 754 11140 12478 --
NM_015161chr162308 44 --21316 121 --
NM_015192chr2032357 654 79 --1453 --
NM_015210chr1821137 292 ----1132
NM_015267chr1221462 197 --2595 221 --
NM_015270chr1272239 2217 2178 1924 1877 1864 531 11713 32035 635 163 1884
NM_015271chr414150 --1777 --
NM_015291chr163281 2242 451 316 264 49 32514 1283 294 1821 12939
NM_015296chr13----11206 --
NM_015310chr8147834 7429 7084 2958 2701 2457 2278 2135 2026 1842 1742 1584 453 304 2526 491 47879 6255 5650 5470 12689
NM_015313chr1174400 1739 1581 1366 1236 587 112 14144 34415 935 461 --
NM_015317chr222537 2383 22496 2158 --1656
NM_015327chr12942 134 11116 31250 1189 51 1264
NM_015328chr7102716 2691 2510 2167 2148 2069 734 659 502 107 --32805 257 197 12554
NM_015343chr17296 76 --2131 112 --
NM_015345chr652424 1056 852 245 217 --22436 292 12719
NM_015361chr22636 253 --142 --
NM_015458chr864656 4338 3513 1767 1491 67 --1884 15272
NM_015460chr35808 746 207 196 145 --136 --
NM_015466chr3159 --1188 --
NM_015475chr21264 ------
NM_015477chr152992 855 --2700 245 --
NM_015481chr121220 --21118 876 --
NM_015488chr281595 1530 1521 1462 1331 1304 401 134 --61513 1368 1337 1292 1179 519 3628 542 225
NM_015497chr152983 398 1847 1235 --
NM_015526chr1931472 1449 1160 --21434 390 --
NM_015534chr11851 --1808 --
NM_015609chr192915 2721 2700 2600 2426 2162 2124 1983 141 22012 1127 62681 2666 2441 2415 1056 1033 32707 1845 230
NM_015649chr191282 --3380 35 28 --
NM_015680chr21113 1251 2563 86 --
NM_015686chrX72508 2142 1987 1816 953 450 344 2604 515 62433 2416 2247 2241 2195 790 --
NM_015695chr65780 517 337 296 30 --271 36 --
NM_015711chr191298 --2701 291 --
NM_015719chr19----1586 2675 554
NM_015726chr131571 1541 50 --11696 171
NM_015852chr723465 927 ------
NM_015872chr151492 1374 1217 387 373 --5661 599 427 277 267 --
NM_015879chr18148187 7818 6646 6456 6247 5943 5870 2745 1724 1708 1626 693 342 146 22612 46 58371 3296 3290 1929 298 28583 524
NM_015906chr154736 4197 3271 1237 105 --24564 4321 --
NM_015981chr5133118 2793 2759 2587 2561 1987 1966 671 618 534 435 299 52 --22363 2083 22018 525
NM_015982chr171318 --190 --
NM_016022chr17742 429 300 289 84 48 37 11067 1370 --
NM_016037chr1------1892
NM_016076chr122320 1290 --1203 11221
NM_016097chr18----1718 --
NM_016131chr242252 1494 915 74 21796 1775 ----
NM_016147chr1151107 987 853 845 262 --3979 956 229 1415
NM_016151chr16----1358 --
NM_016169chr10113254 2957 2796 2787 2428 2349 1995 1104 1042 319 265 22826 1145 32554 1115 45 22080 995
NM_016174chr92457 50 --2338 133 --
NM_016201chr38829 806 768 714 508 490 405 273 12331 4909 333 94 50 --
NM_016202chr192308 110 --126 --
NM_016257chr193059 2859 2792 2679 2531 2337 573 398 130 32813 2153 278 12500 --
NM_016284chr16------1128
NM_016287chr12758 451 --2272 190 --
NM_016319chr123231 85 45 --2281 54 --
NM_016322chr932842 2569 2193 13025 12550 173
NM_016338chr51389 --21167 24 --
NM_016339chr1781764 1736 1524 1517 647 397 332 190 21537 1511 61562 1555 1314 665 604 226 1114
NM_016357chr121929 --2818 57 --
NM_016422chr113528 507 143 ------
NM_016424chr1731926 249 235 ------
NM_016463chr5146 --125 --
NM_016521chrX1294 ------
NM_016532chr1761170 1070 1013 480 311 55 1338 1994 --
NM_016577chr364537 3320 1685 1262 764 432 12855 63922 3739 3506 2768 1411 689 --
NM_016592chr2021088 252 ------
NM_016604chr511174 ----1157
NM_016605chr542556 1843 841 486 --52714 2576 2045 947 833 --
NM_017412chr811012 11042 ----
NM_017420chr1423204 1292 13704 13257 --
NM_017450chr1751473 1121 976 518 28 1230 --2183 124
NM_017514chrX3354 304 140 --3838 742 250 --
NM_017519chr61113 ----1122
NM_017553chr1541160 1009 991 79 --2996 944 --
NM_017575chr1751364 1188 1140 566 505 --51598 1390 650 638 164 --
NM_017582chr151591 1432 1284 671 128 1310 2629 84 --
NM_017596chr1194544 4512 4150 4116 4096 3938 3780 3767 3507 3210 3099 2921 1257 669 597 396 348 159 136 14192 144476 4313 4247 4061 3468 3144 1421 1394 1342 1018 888 760 703 168 24321 1643
NM_017602chrX6899 223 216 110 92 49 --1378 --
NM_017607chr19----1469 --
NM_017610chr1521663 24 11383 ----
NM_017633chr643707 3196 3054 129 2946 572 1334 23138 901
NM_017643chr1713120 --12813 --
NM_017670chr116757 712 702 199 187 174 --3212 34 26 --
NM_017728chr17152957 2581 2384 2341 1976 1216 1188 916 909 501 393 225 185 136 84 1381 52661 1894 760 455 245 2770 410
NM_017738chr91854 --1842 194
NM_017739chr1----1391 1164
NM_017744chr121639 1576 1628 --31707 872 348
NM_017749chr1131034 405 24 --1186 --
NM_017753chr91164 --1380 --
NM_017754chr684308 3792 3459 1112 1018 569 223 79 34651 4217 427 23532 1192 11121
NM_017763chr171259 137 2350 75 1185
NM_017772chr651495 1321 1140 319 31 11626 21133 262 1471
NM_017780chr81350 ------
NM_017799chr1451697 1530 1422 1374 26 ------
NM_017811chr973110 2336 2068 673 628 505 160 --22450 30 --
NM_017824chr1042659 2076 1838 347 --1107 --
NM_017848chrX74480 4329 4013 3245 1746 771 157 24599 1111 1709 --
NM_017873chr973030 2942 2840 2461 2267 2227 556 12865 52537 2383 1166 440 204 22125 1193
NM_017893chr1091384 1149 942 522 336 255 237 220 132 --21306 66 149
NM_017902chr10145109 4716 4673 4494 4463 4390 4014 3846 1175 1169 1129 1059 781 206 2434 216 31555 524 236 --
NM_017907chr11----1360 --
NM_017919chr974418 3915 3762 3538 2278 1566 729 --33928 739 622 --
NM_017944chr1122082 916 12759 12429 1132
NM_017988chr121136 ----1675
NM_018013chr632251 864 552 12345 ----
NM_018027chr1043120 1317 319 304 --1162 1897
NM_018030chr181946 1744 11019 --
NM_018113chr122399 51 ------
NM_018150chr12807 759 --147 --
NM_018159chrX21414 255 --11176 --
NM_018181chr18132 --1528 --
NM_018240chr1191 1187 1205 1855
NM_018244chr2021028 424 ------
NM_018247chr6--12531 --1823
NM_018254chr111953 --1343 --
NM_018364chr113065 12828 ----
NM_018367chr1131640 755 204 32171 1705 263 21017 613 --
NM_018387chr91392 1443 ----
NM_018403chr353557 3503 3337 2745 2549 2616 560 2974 626 --
NM_018416chr1282412 2102 1923 1915 1005 573 553 268 --22513 283 1183
NM_018425chr1081765 1684 1657 700 461 315 186 136 --22223 2178 21899 1690
NM_018449chr95780 615 300 120 85 --2243 137 --
NM_018469chr1741343 933 348 134 --1128 --
NM_018489chr13542 187 66 1309 2599 60 --
NM_018490chr111104 ----1482
NM_018509chr1721223 1186 --125 --
NM_018689chr1551974 1797 984 278 106 1724 2553 177 11940
NM_018712chr1131535 1106 201 --11111 143
NM_018898chr51326 12168 2319 79 --
NM_018952chr171111 ------
NM_018964chr212222 53 --21038 734 --
NM_018970chr722987 2372 13191 --1235
NM_018977chrX1878 --1884 --
NM_019046chr101835 --2361 355 --
NM_019074chr152109 29 --2687 266 1847
NM_019096chr63439 220 133 --270 34 1864
NM_019106chr2293190 2965 2876 2559 2170 898 717 681 272 31277 320 300 32505 2353 229 43157 2780 2200 94
NM_019106chr2293190 2965 2876 2559 2170 898 717 681 272 31277 320 300 32505 2353 229 43157 2780 2200 94
NM_019106chr2293190 2965 2876 2559 2170 898 717 681 272 31277 320 300 32505 2353 229 43157 2780 2200 94
NM_019114chr972273 2259 2115 2057 2050 1861 45 11716 11651 --
NM_019605chr11295 ------
NM_019606chr74486 386 173 45 177 137 1155
NM_019845chr23617 65 41 ----1598
NM_019884chr191468 --3476 134 87 --
NM_020062chr201204 --2990 251 --
NM_020066chr1194 --1865 --
NM_020142chr126594 512 483 462 436 177 --3604 526 105 1154
NM_020144chr721680 1436 128 1473 --
NM_020148chr1822456 660 32502 1168 653 ----
NM_020150chr1031930 575 150 12054 --1200
NM_020159chr411170 1676 ----
NM_020168chr15----51249 1117 174 143 83 31157 1109 551
NM_020177chr543233 3016 2697 2444 ----1898
NM_020211chr152619 383 --11321 --
NM_020214chr15----288 51 --
NM_020235chr31304 1121 ----
NM_020309chr195892 815 692 167 96 --21084 87 41090 749 250 103
NM_020318chr11319 ----133
NM_020337chr433193 2354 169 1845 11093 12415
NM_020338chr10123733 2327 2282 1486 1452 1364 1324 1169 1078 837 366 86 31411 1196 905 52950 1302 1205 1187 403 11291
NM_020390chr32801 392 13163 11004 21168 1031
NM_020403chr132626 97 ------
NM_020443chr1116959 5645 4563 4468 2506 2305 1908 1478 1445 654 219 --56844 6359 2589 2117 665 --
NM_020457chr161491 --2497 196 --
NM_020526chr151422 1385 1177 1136 646 --51790 1433 299 219 108 11848
NM_020647chr842323 466 414 338 --11867 --
NM_020676chr3----142 189
NM_020689chr2031444 1331 116 --31513 1454 214 --
NM_020699chr1114708 3891 3859 3819 2146 1642 1534 1459 1255 1220 831 24797 1050 31561 1325 173 23756 25
NM_020703chr12392 89 ----132
NM_020708chr2062458 2342 1893 942 739 131 --2410 237 12385
NM_020713chr2092746 2720 2557 2462 1172 765 617 252 82 11966 83076 2874 2618 2385 1062 679 637 564 12164
NM_020718chr16126159 6145 5878 5360 4139 2609 1977 1951 1894 1361 1148 995 11824 35486 5381 61 --
NM_020764chr163979 331 258 --31264 1041 229 1404
NM_020772chr17108397 7952 7714 6683 6563 2584 1996 1961 1946 78 22724 916 26127 1718 15993
NM_020794chr11344 ----1365
NM_020796chr512069 --32533 652 81 12633
NM_020801chr532047 820 113 ----1188
NM_020810chr1433600 3589 2275 --12743 1449
NM_020839chr311253 --21277 199 --
NM_020850chr16132908 2601 2579 2360 2220 1070 975 880 870 613 531 168 122 22511 1319 264 59 23101 2472
NM_020888chr171616 1572 813 691 528 521 166 2713 668 32013 1280 806 --
NM_020895chr191219 1311 ----
NM_020898chr121142 2555 197 ----
NM_020899chr1732359 2010 687 --4827 696 347 83 --
NM_020927chr1642249 435 378 196 177 --1747
NM_020956chr19234519 4454 4036 3949 3790 3644 3181 3166 2932 2903 1696 1475 1459 1280 1140 1126 1117 1099 1007 951 533 412 35 23864 3771 144727 4208 4133 4027 3215 3171 1428 978 779 753 744 605 570 77 2556 92
NM_020971chr19----1186 1334
NM_021012chr1792970 2217 1170 1141 885 363 339 274 98 12043 63091 2832 2813 2396 2058 1193 21961 1086
NM_021076chr221452 --1198 --
NM_021103chr21190 ------
NM_021109chrX----1127 --
NM_021140chrX----1169 --
NM_021155chr1983020 2394 2360 1072 812 300 136 121 12934 21973 655 22962 682
NM_021165chr12611 98 --1639 1852
NM_021202chr2072715 1156 1131 590 541 304 237 --52701 831 806 331 172 --
NM_021238chr1221573 701 --11502 1190
NM_021643chr251689 1624 1473 664 641 ----1348
NM_021648chr662298 1685 1079 551 295 172 22630 1948 11734 1798
NM_021724chr17----130 --
NM_021813chr674960 4472 4393 4071 1460 1396 210 34125 1804 500 54010 2220 1653 1356 85 --
NM_021914chr1432087 451 261 --11863 --
NM_021945chr683398 3336 3300 2757 2357 2246 1072 424 23589 3018 31243 1237 946 1101
NM_021946chrX11330 11185 41307 1015 930 361 --
NM_021947chr1741019 336 270 252 ----11068
NM_021948chr11276 1245 2253 40 --
NM_021960chr11176 --12110 --
NM_021961chr1186973 6441 2198 2034 1959 1585 1503 118 12026 31967 1913 1098 14554
NM_021973chr4----1184 --
NM_021977chr663413 3187 3089 2841 1534 551 ------
NM_022006chr19136 ------
NM_022037chr2--1708 ----
NM_022048chr15145826 5704 5169 4176 2556 2378 1606 1410 1300 1027 257 245 198 138 34363 4242 1633 1648 11376
NM_022058chr2----1185 --
NM_022066chr173288 91 56 --3299 119 99 --
NM_022112chr1131399 742 220 12073 --1682
NM_022130chr541007 985 534 375 ------
NM_022166chr16156363 5538 4607 4386 4155 4117 2089 1671 1338 1159 794 537 468 403 182 35641 4518 1513 96125 5456 4961 4358 2350 2337 1467 1409 572 14590
NM_022343chr951329 1183 1171 1005 845 --31011 944 88 --
NM_022455chr5----2103 36 --
NM_022465chr1252244 1120 1080 569 330 1860 41131 491 66 41 --
NM_022473chr1542764 1441 1139 612 24278 1639 13954 14289
NM_022474chr14166 1222 12401 --
NM_022574chr752104 2011 1986 867 465 --62167 2056 2048 1625 1454 1423 --
NM_022737chr195523 339 203 92 57 21147 994 71258 1245 1137 1119 470 407 99 --
NM_022742chr72290 221 ----1108
NM_022748chr782775 2235 895 676 670 433 333 35 32339 1836 992 22874 2597 --
NM_022749chr881124 1075 962 550 485 479 62 32 --41200 556 106 56 146
NM_022780chr221165 167 21708 120 --1560
NM_022823chr24477 349 191 85 ----1338
NM_022836chr121343 438 --1571 --
NM_022841chr15173 2237 162 ----
NM_022843chr13----1369 --
NM_022893chr263178 2977 2647 999 964 400 ------
NM_023002chr1941632 1425 781 135 --32032 1474 355 --
NM_023008chr19----1733 --
NM_023009chr16254 122 89 81 67 50 --3480 284 260 --
NM_024040chr10121 1119 1148 --
NM_024046chr3101258 1151 995 971 495 410 318 292 114 98 31066 814 343 11231 --
NM_024293chr23280 162 143 2645 316 1759 1289
NM_024295chr831789 433 385 --1451 --
NM_024308chr175495 424 211 103 48 --155 1430
NM_024326chr101103 ----1109
NM_024345chr945924 5638 4751 1299 14940 2336 228 --
NM_024496chr141770 129 --1526
NM_024519chr162251 29 ------
NM_024541chr1061385 1334 1251 482 476 382 --41501 1188 87 34 1668
NM_024551chr1221822 1724 ------
NM_024565chr51134 ------
NM_024567chr83700 693 157 1536 1264 --
NM_024665chr364606 4547 4069 3225 1319 237 --161 --
NM_024674chr152326 971 617 565 196 --12173 22200 503
NM_024721chr812096 --1648 --
NM_024742chr16131686 1527 1415 1344 1290 1254 725 534 476 405 202 148 87 --31330 771 73 1466
NM_024745chr16------153
NM_024757chr93451 383 173 --1438 --
NM_024762chr192710 100 --1758 1585
NM_024811chr112688 666 --21625 448 1151
NM_024877chr1931176 1011 174 --21181 69 11018
NM_024887chr161497 867 507 284 171 28 12051 51452 861 519 41 34 21915 1760
NM_024922chr1642099 2010 727 301 --11410 21607 1521
NM_024954chr104678 246 139 65 --2497 487 --
NM_024969chr21885 --1756 --
NM_024979chr1331519 1492 1482 --31270 1016 296 --
NM_025040chr193298 142 120 1167 1979 --
NM_025054chr844215 1380 911 182 ------
NM_025079chr1----1572 2548 205
NM_025109chr17146 1100 140 --
NM_025146chr3----11942 12031
NM_025160chr174021 3964 3590 3577 1178 643 534 13508 13255 23753 3379
NM_025164chr1131924 670 88 ----21936 1798
NM_025179chr184709 4687 3667 3625 3440 3253 1881 39 --94481 3924 3910 3211 1752 1376 1364 295 109 23953 988
NM_025182chr95828 739 311 304 40 --1205 2179 51
NM_025187chr1681364 1332 882 554 389 188 55 21 1314 2521 29 --
NM_025191chr122789 469 ----1197
NM_025248chr17123201 2819 2796 2694 2247 2180 2111 2065 1215 830 597 120 22153 549 52938 1220 603 31 22 13039
NM_025251chr84955 409 374 160 --3462 337 318 --
NM_030576chr1741707 488 339 216 --52567 2452 1883 1667 534 2560 150
NM_030621chr1453289 3264 2688 1673 1548 12593 ----
NM_030627chr522764 2727 21631 1507 ----
NM_030636chr75681 622 461 286 91 31833 1789 136 41656 1433 791 522 --
NM_030648chr475454 4547 2104 1843 1682 1635 90 34320 3713 3420 24651 4574 --
NM_030766chr122680 120 --2215 27 --
NM_030792chr111212 ----1577
NM_030809chr1231938 1667 547 --298 22 --
NM_030913chr13504 284 180 ------
NM_030914chr94914 309 113 101 1773 3633 119 89 --
NM_030916chr13773 269 109 --2735 653 1890
NM_030957chr19----2585 523 1402
NM_030981chr11101119 1070 1036 940 367 314 269 246 153 52 --51106 1075 976 406 161 11060
NM_031407chrX--1133 --1142
NM_031417chr194902 510 413 109 --32215 964 174 32311 746 145
NM_031445chr273385 2802 2685 2409 2126 1070 72 12161 1143 --
NM_031450chr112527 25 --4597 563 247 159 --
NM_031453chr102710 209 ------
NM_031483chr2042997 2866 2737 63 23542 1365 --12215
NM_031934chr172225 29 --1117 --
NM_032017chr1101847 1761 1679 1633 1550 1500 1323 1286 445 321 21524 1444 41334 713 621 375 11557
NM_032042chr532183 300 272 --12794 --
NM_032052chr223940 402 145 --2507 249 --
NM_032153chr341878 1796 1049 755 --11932 --
NM_032172chr71276 1991 ----
NM_032199chr1063505 3423 1549 1021 718 413 13392 12371 --
NM_032207chr1921030 308 1487 4850 437 292 207 --
NM_032229chr13--11027 --1205
NM_032236chr151010 952 891 419 109 ----1148
NM_032256chr12----1728 --
NM_032268chr1662629 2618 2520 2183 1195 385 --33249 2094 1076 2479 53
NM_032283chr141652 1293 710 168 --2744 175 --
NM_032298chr193386 339 61 ------
NM_032320chr111663 --1500 --
NM_032364chr1231017 320 146 --1847 --
NM_032410chr8--21127 928 ----
NM_032420chr54773 751 678 579 --2744 560 --
NM_032429chr101414 --1400 --
NM_032430chr193436 126 53 --1323 --
NM_032457chr433257 3204 1232 --1136 --
NM_032499chr1531187 577 120 --194 --
NM_032512chrX41172 1087 1075 207 ------
NM_032514chr208444 413 339 322 291 283 120 56 --3300 156 89 --
NM_032536chr91110 --2635 166 --
NM_032538chr6152787 2772 2674 2495 2341 2293 1094 992 968 830 779 745 433 410 393 12571 62285 2161 1985 1897 1857 226 22037 649
NM_032539chrX----144 --
NM_032552chr981719 1604 1381 1339 1249 717 554 104 --4683 441 274 137 11671
NM_032575chr1671464 582 356 286 213 101 29 11285 101634 1541 1400 1355 524 486 456 395 244 53 11550
NM_032578chr101291 1983 31335 1147 299 --
NM_032580chr171395 --1191 1205
NM_032595chr17111561 1483 1359 1331 1291 1220 1092 565 404 109 64 2537 234 21077 398 11227
NM_032603chr23555 278 208 --2747 521 --
NM_032682chr333483 472 409 --11281 --
NM_032689chr1921405 1382 ----11418
NM_032859chr13----1131 --
NM_032959chr731223 761 125 185 1265 2934 62
NM_032982chr732516 677 153 --21937 99 --
NM_032983chr753330 967 720 532 372 --22751 913 32117 569 330
NM_033027chr351119 1039 949 942 223 1888 31113 759 743 1734
NM_033036chr114388 295 286 276 --5470 80 67 40 35 --
NM_033058chr82948 145 1936 1134 --
NM_033089chr2051169 1075 372 310 231 1391 ----
NM_033103chr192980 872 --11355 1472
NM_033121chr1221731 1290 --31737 178 124 --
NM_033129chr203345 253 105 --41459 827 749 608 21653 460
NM_033132chr131455 --1912 --
NM_033133chr17173274 3214 3112 2804 2705 2602 2348 1200 1108 958 947 925 842 342 166 56 25 32656 2392 1331 53238 2626 2595 1118 718 23632 3562
NM_033141chr1481842 1764 1654 1623 1583 848 597 262 1619 3458 334 176 21533 661
NM_033224chr797830 6836 6679 5918 2835 1967 1730 895 71 15066 11715 16706
NM_033225chr862493 2418 2092 2005 535 371 1304 12310 --
NM_033259chr36880 824 799 695 573 161 --2587 336 --
NM_033285chr83958 894 817 --13405 --
NM_033309chr16----1873 --
NM_033315chr1772096 1657 1407 1374 740 196 179 11932 71989 1881 1857 1770 1386 1379 190 --
NM_033389chr17104687 3729 3721 3394 1537 1026 1016 756 413 322 44817 4640 4273 3374 13821 14066
NM_033449chr562117 1882 1854 1444 751 145 --51491 1455 1354 570 40 11847
NM_033512chr861206 1129 813 252 156 70 --2368 41 --
NM_033626chrX71615 1333 1217 564 404 311 259 1292 41470 1257 1141 323 11488
NM_033631chr173847 2489 1322 879 703 440 247 --53726 2855 560 34 27 165
NM_044472chr1------142
NM_052845chr1262920 2773 2625 2013 849 66 1127 33173 897 195 23218 2404
NM_052848chr1962038 1503 1388 635 349 69 42052 1912 1896 109 51832 1345 645 483 219 2582 30
NM_052854chr114607 573 147 87 --2516 93 --
NM_052874chr161148 1691 --190
NM_052885chr122556 536 11780 176 --
NM_052897chr123844 789 771 --2783 675 --
NM_052898chr821696 314 ----11639
NM_052907chr1251606 467 396 248 189 43517 3373 2866 1509 13189 --
NM_052925chr193778 662 51 1196 3980 678 138 --
NM_052937chr8--11730 1640 11900
NM_052998chr1----1148 --
NM_053023chr1152809 1262 306 190 115 12613 1723 22604 420
NM_053024chr31452 --1171 --
NM_053025chr31636 ------
NM_053046chr191109 --174 1180
NM_057161chr6----278 53 --
NM_057175chr4--12353 ----
NM_078487chr92234 151 ----189
NM_080546chr922088 1452 --12174 --
NM_080738chr141947 1708 1541 744 11627 11535 --
NM_080872chr831161 1082 79 1374 13653 --
NM_101395chr2152538 2418 2398 1084 906 --170 --
NM_130387chr31465 11238 138 --
NM_133265chrX----31344 1326 1284 1595
NM_133328chr195627 579 549 540 229 --1820 --
NM_133369chr58945 753 670 635 389 187 160 102 1855 4731 725 684 133 --
NM_133452chr1951098 965 323 255 207 ----1316
NM_133509chr146488 463 274 235 226 34 2432 255 ----
NM_134269chr222239 43 --1262 --
NM_138300chr171527 1477 1412 1239 1195 356 45 11558 21646 1597 --
NM_138334chr19----1133 1153
NM_138350chr131443 1154 466 11232 --31398 1071 951
NM_138357chr10----1390 --
NM_138360chr142100 41 --2271 200 --
NM_138370chr21305 1487 1246 1672
NM_138385chr441084 886 468 177 1102 3530 479 362 1183
NM_138447chr162625 306 1878 1154 --
NM_138473chr1275029 4582 4068 3981 949 773 188 34802 4564 4287 25051 4365 34745 4377 3701
NM_138479chr121521 284 11412 11526 11742
NM_138689chr11----150 --
NM_138782chr5--1824 12241 --
NM_138795chr131347 229 188 21113 237 41601 1503 570 254 --
NM_138967chr15152448 2125 2079 1904 1709 1531 1522 998 977 970 927 634 357 257 193 1696 62403 2135 985 710 348 230 --
NM_139057chr1562176 1786 1053 739 551 464 --22575 873 12251
NM_139278chr871254 1127 904 420 413 349 114 1395 41187 945 370 289 1479
NM_144499chr371079 1005 984 847 461 199 55 --31093 354 218 --
NM_144571chr466932 6831 6719 5619 2654 2168 ----14301
NM_144578chr14114678 4513 4476 4237 3685 2200 1980 1564 940 903 467 33624 2211 451 25218 146 13414
NM_144582chr292531 2284 2020 1726 1014 663 597 540 438 --52227 1939 1873 269 105 1566
NM_144618chr131541 1018 403 ------
NM_144631chr21249 --1214 --
NM_144635chr32401 230 --2488 202 --
NM_144691chr192134 28 --1259 --
NM_144726chr5----1289 --
NM_145008chr113674 38 23 1346 2750 133 190
NM_145117chr1132442 1016 180 13263 ----
NM_145171chr14125 ----187
NM_145239chr162148 49 --1154 1196
NM_145251chr141627 ----11275
NM_145260chr21128 --1199 1527
NM_145263chr432117 1903 1510 ----184
NM_145296chr192833 659 ----1638
NM_145349chr1781895 1639 1554 513 203 192 85 58 11657 51997 1836 1786 348 169 11863
NM_145798chr173848 776 698 1230 4866 281 101 48 1917
NM_145799chrX22395 1934 12659 1450 1867
NM_145800chrX4951 755 710 214 ------
NM_145891chr16----21506 1192 --
NM_146388chr193961 931 85 --1473 11008
NM_147161chr15941 459 339 259 231 1298 2104 47 11170
NM_147192chr151218 547 404 195 40 1245 51264 623 560 333 132 31330 424 410
NM_148170chr1175114 4831 1992 1651 1321 1072 474 --21575 197 13670
NM_152237chr2281451 1221 1126 650 449 400 351 313 11780 41583 1514 1275 479 1458
NM_152253chr22134300 3614 3395 3154 3076 2865 2705 1041 523 491 92 73 62 24337 422 44104 3979 3300 812 --
NM_152263chr175911 5795 5597 5354 5304 1419 480 --32221 238 35 15672
NM_152271chr841096 832 432 70 ----11056
NM_152335chr152210 126 --1131 --
NM_152346chr174410 368 58 33 --61072 380 334 217 142 64 --
NM_152380chr131618 1221 225 11258 11299 --
NM_152384chr291694 1657 1518 1481 1306 825 785 745 475 --31490 1344 1315 1490
NM_152390chr2121 --1704 --
NM_152441chr125525 131 113 103 54 --2583 145 --
NM_152470chr1854095 3439 3205 1492 342 22588 1395 43401 3093 1081 207 12890
NM_152493chr151629 1504 1253 584 154 --21270 1008 --
NM_152550chr5----2164 62 --
NM_152570chr9----1105 --
NM_152608chr11564 ----1592
NM_152622chr523144 482 23324 2689 1323 --
NM_152653chr3169 --2590 170 --
NM_152694chrX3695 279 188 --2628 567 --
NM_152721chr18140 --174 --
NM_152734chr6115253 4769 4396 3714 3461 1976 1013 883 805 764 426 --34596 299 118 --
NM_152758chr81227 --1171 --
NM_152787chrX23333 2830 12502 ----
NM_152860chr1241522 1364 487 168 --41437 612 380 35 11031
NM_153029chr16154171 3886 3783 3570 3542 3259 2771 2671 1510 1387 1281 1263 1154 923 244 21629 438 74062 3809 3638 3548 3396 2648 482 --
NM_153334chr22--1729 1710 1635
NM_153371chr131707 1298 11976 --
NM_153487chr6164772 4324 4308 4270 3313 3161 1875 1772 1567 1539 1423 1170 1001 929 609 34 --64376 3789 3674 3577 3241 396 34478 3724 560
NM_153607chr522409 2395 ------
NM_153613chr15--161 177 --
NM_153685chr123824 786 170 --51061 1009 971 222 119 --
NM_153695chr9139 ------
NM_153756chr151799 562 448 152 21 --21494 432 --
NM_153812chr191979 1817 786 526 510 503 485 146 61 --12051 1516
NM_170606chr7137 --2387 382 --
NM_172005chr203598 298 27 --1360 --
NM_172071chr187346 6693 6576 4859 2232 1623 1298 1144 22872 1676 36788 6371 33 12307
NM_172375chr141739 ----1760
NM_173156chr12701 304 --1563 11503
NM_173172chr211508 --2420 37 --
NM_173460chr20----179 --
NM_173475chr1631432 1163 122 --144 --
NM_173511chr233256 1439 1048 1102 --33946 1514 168
NM_173525chr11----184 --
NM_173588chr11----1377 --
NM_173595chr12195333 4780 4177 4043 4000 3914 3337 1995 1560 1534 1507 1384 1225 1030 911 499 425 357 145 25131 248 104988 4978 4322 4274 1041 820 712 699 418 373 23566 1077
NM_173602chr1252759 2600 2572 2553 776 13164 --33303 3107 3011
NM_173674chr6164 ------
NM_173681chr771821 1405 477 233 87 66 49 --41843 1801 1748 316 22060 246
NM_173825chr332489 857 182 11203 22676 212 11091
NM_173828chr52361 275 --2318 92 --
NM_175061chr721424 624 --22212 1642 --
NM_175063chr1941088 731 375 266 --21188 1128 --
NM_175069chr93708 138 73 --1106 --
NM_175575chr1721024 61 --41241 1235 1206 23 11226
NM_175733chr1182232 2209 1969 1701 1684 1645 1498 398 31491 522 510 32181 624 355 --
NM_175736chr12207765 7640 7394 6574 6409 6328 5681 5619 5354 5024 4835 2998 2971 2780 1877 1860 1088 579 554 205 33049 1709 501 117117 6351 6342 6032 5722 5252 2638 1806 1290 774 541 33138 2425 1123
NM_175895chr124996 371 318 226 --190 --
NM_176823chr193670 3343 1514 1104 974 682 547 419 182 --63848 2479 1533 425 253 228 31260 583 440
NM_176871chr873168 2540 2320 1183 643 575 219 --42725 2610 2284 331 12939
NM_177999chr9103593 3505 3403 3024 2830 2790 1119 326 285 97 13428 73100 2946 2458 1003 767 498 167 12688
NM_178026chr201479 1101 130 --
NM_178126chr1771776 799 683 517 470 368 224 --32225 1743 1417 1545
NM_178496chr3----1189 --
NM_178502chr12----385 78 38 1391
NM_178554chr3143473 3465 3393 3144 2454 1443 1389 1247 1039 858 808 476 355 287 1136 32258 1044 555 2898 128
NM_178562chr73763 358 314 --1616 --
NM_178566chr91749 1132 ----
NM_178580chr202495 24 1452 2341 42 --
NM_178830chr192557 543 --3705 522 49 1205
NM_178835chr42706 228 --1575 --
NM_178863chr163451 80 21 --1118 --
NM_178864chr112645 635 ------
NM_181356chr61326 --1294 --
NM_181491chr9113133 3069 2859 2675 2574 2387 1268 1232 900 65 34 --52457 2392 2007 966 338 1784
NM_181671chr172179 107 1140 --1215
NM_181672chrX11799 ------
NM_181706chr111537 --22248 870 --
NM_181712chr11157 2681 435 12109 --
NM_181715chr1----196 --
NM_181723chr81498 --22343 818 --
NM_181782chr622033 649 ----197
NM_181784chr232385 2028 1831 --1660 --
NM_181809chr1143686 3573 3133 3111 2902 2570 1587 1370 1079 1058 899 876 200 169 1658 73651 3305 3231 1071 888 631 389 33177 1412 1212
NM_181844chr1721706 1632 --31697 610 181 --
NM_182485chr422723 2550 ----1384
NM_182488chr13------135
NM_182540chrX----2635 276 --
NM_182553chr111115 --2455 66 1502
NM_182557chr1182221 2023 1923 1894 1870 1748 1502 699 --61984 1560 1435 1416 402 240 11905
NM_182577chr191129 1325 ----
NM_182580chr172550 2535 2465 1952 1633 974 846 --32310 1965 651 --
NM_182701chr63904 735 379 190 1695 --
NM_182734chr2052604 901 326 254 157 --3700 144 71 --
NM_182830chr14--11942 ----
NM_182970chr20153503 3361 2887 1699 1558 1533 1162 699 605 577 545 355 337 315 172 23086 1351 41053 962 610 139 1453
NM_183425chr2051486 1399 633 422 77 1217 4687 600 315 67 --
NM_194282chr41201 --11028 11055
NM_194286chr12166118 6111 6050 5615 4898 4505 3846 2021 1903 1858 1782 1246 1085 1003 368 21 45151 4428 861 412 32445 681 66 --
NM_194314chr124766 1974 ------
NM_194449chr182756 694 1908 --2832 700
NM_198081chr662766 2413 2097 2043 367 60 1454 21171 409 1489
NM_198273chr543130 1247 1030 742 ------
NM_198281chr433360 1323 702 --12217 1346
NM_198334chr114726 714 361 71 --1657 --
NM_198440chr2252402 2291 584 467 118 1776 81784 1668 1603 937 848 389 144 108 11610
NM_198458chr1951716 1710 1700 1229 397 11354 21649 1318 --
NM_198560chr3113564 3181 3167 2983 2491 1536 981 813 729 218 51 12903 61435 1086 969 569 406 59 31114 555 436
NM_198571chr771493 576 547 519 206 182 167 11256 5485 391 159 130 122 --
NM_198834chr1752008 1901 380 333 56 --61679 870 736 325 27 21 --
NM_198859chr355110 4315 1031 689 310 14327 23788 724 --
NM_198867chr192174 77 --1319 --
NM_198904chr511345 11832 12074 --
NM_198993chr1751479 1178 363 187 35 11751 41618 1290 447 111 21578 1168
NM_199141chr196931 684 355 324 259 47 --3690 672 348 --
NM_201263chr121633 267 1314 ----
NM_201521chr62332 71 --1139 --
NM_201550chr1221323 1175 1989 21302 1000 --
NM_201634chr541802 563 463 222 --3612 153 107 2494 69
NM_203303chrX--1199 --1224
NM_203413chr172363 79 --2994 119 11001
NM_203446chr211220 --41843 727 719 326 --
NM_203458chr143691 2460 2446 850 22349 666 43661 2864 2721 151 --
NM_205833chrX--1828 1713 --
NM_206914chr1232145 1880 1835 ----2901 282
NM_207043chr142081 1616 926 538 21876 322 1445 11958
NM_207313chr171363 1873 3271 202 122 2671 310
NM_207371chr10------1981
NM_207381chr1531111 395 366 --11275 1405
NM_207387chr1731370 723 94 181 1481 --
NM_207396chr12431 128 --21563 176 2339 203
NM_212464chr1582043 1859 1794 1701 791 632 428 310 2750 154 21823 767 11954
NM_212467chr1582620 2436 2371 2278 427 238 106 39 --12400 32531 592 489
NM_213589chr275341 5070 4786 4268 4097 2035 397 21640 1036 --24141 929
NM_213604chr193847 838 629 --2881 369 --