TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-486-5p
miRNA Sequence: UCCUGUACUGAGCUGCCCCGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr54844 813 598 416 12638 --11209
NM_000217chr1244831 4614 3999 760 14074 21307 1301 --
NM_000314chr1023126 2599 1115 --23193 726
NM_000332chr677068 6779 2512 871 749 648 366 16384 25125 374 12711
NM_000555chrX86729 5913 5318 5195 5052 4958 1548 1407 11735 ----
NM_000618chr1286303 5565 5431 5344 4539 4028 2585 326 26074 861 --15045
NM_001003712chr1283943 3932 3887 3266 2940 2855 2693 664 ----13539
NM_001004317chr673780 3182 2986 2731 1672 1166 333 33646 1319 284 163 --
NM_001007466chr644826 1357 678 547 13328 150 25061 1648
NM_001007466chr644826 1357 678 547 13328 150 25061 1648
NM_001010867chr1126195 5277 4175 2569 2554 2535 2204 2120 1912 1101 1010 424 ------
NM_001013031chr101299 13151 1200 13396
NM_001025076chr1024505 378 16195 --1755
NM_001025077chr1045863 5068 1736 721 17553 --12113
NM_001025108chr283891 3852 3825 3420 3097 2595 1630 145 ----14093
NM_001025780chr921182 195 --2504 121 11285
NM_001030055chr1443375 1874 1676 857 13109 --11899
NM_001043318chr14124011 3849 3123 2887 2744 2657 1225 1208 1192 566 293 194 13676 190 --
NM_002581chr985598 4205 3939 3538 1810 1329 560 247 11620 ----
NM_003017chr661344 1159 937 539 396 62 ----132
NM_003298chr364080 1799 1739 1354 1248 863 --14021 1543
NM_003566chr1222373 2108 12850 --12532
NM_003799chr1842922 1786 1427 455 13323 12910 21485 115
NM_004612chr964604 4522 4116 3146 1705 1587 --11460 14068
NM_005596chr965473 4652 3991 1901 1714 642 --14839 --
NM_006544chr1473771 2436 1733 1328 1042 849 574 2869 412 14319 --
NM_006599chr1687937 6968 6630 5852 2611 1252 565 304 15969 11829 --
NM_014586chr21114853 4367 4055 4013 3345 3183 2959 1760 1315 1132 403 --11429 --
NM_014667chr372048 1828 1643 953 674 667 283 ----11986
NM_014810chr173477 3284 2940 2808 2728 721 357 --12802 --
NM_015271chr484067 4042 3826 3552 3187 2931 2803 1058 ------
NM_015335chr1252555 2544 1901 1662 670 ----11618
NM_015455chr573795 3703 3307 2810 1589 1121 430 --13909 --
NM_017637chr958171 7709 2966 2536 2317 48538 5815 5789 630 37196 6882 949 --
NM_018482chr8------22446 298
NM_020119chr773540 2863 2815 2766 528 391 304 13582 23534 2857 13300
NM_020772chr1788412 8341 8281 6840 2218 1463 1344 1311 18164 ----
NM_021964chr376415 5144 4866 2432 744 489 88 14497 1782 14417
NM_024947chr3138717 8325 8102 7574 7439 7352 7137 6832 2693 2566 2114 215 155 29557 3846 ----
NM_024989chr277941 7843 7814 6543 3078 2450 2229 --15865 25056 4962
NM_030647chr786143 6075 6059 5133 1542 1183 763 103 --15910 155
NM_030806chr199113 7631 6889 6677 6502 6133 1842 870 825 17366 29373 7120 --
NM_030918chr1115149 4468 3858 2102 1962 1590 1512 1466 1385 448 126 13328 ----
NM_032828chr19154460 4391 4270 4137 3387 3254 3121 1912 1773 1466 1334 695 406 193 185 --14327 --
NM_032859chr1363733 2890 1270 1245 709 43 32430 1319 919 1603 --
NM_033285chr884114 3137 1692 778 709 678 668 70 --21605 1370 --
NM_052918chr102498 23 13350 1399 13595
NM_144664chr1142514 1699 787 617 21850 711 --1598
NM_175876chr142115 657 367 207 ----12178