TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-490-3p
miRNA Sequence: CAACCUGGAGGACUCCAUGCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000104chr232692 2290 140 1870 --12591
NM_000217chr1265248 4921 4496 3842 2035 293 --11291 --
NM_000259chr1594581 4481 4369 2487 2478 1663 1377 1005 231 35628 1726 1111 ----
NM_000332chr697078 7070 6365 4650 2705 2464 2273 1737 112 1894 ----
NM_000337chr566370 5891 5135 4745 4259 919 12225 16450 --
NM_000719chr1285644 5150 4654 4244 1864 1587 876 675 --14332 16010
NM_000899chr1224358 1740 ----11041
NM_001005404chr1774375 4002 3743 3407 2860 1060 699 ----1584
NM_001010867chr196077 5792 5383 4102 1903 1413 577 526 265 --26227 2074 --
NM_001025580chrX63402 3117 2813 522 447 300 --11093 --
NM_001030055chr1424664 1498 13772 11838 11314
NM_001033576chr1762079 975 809 320 275 81 --12499 12310
NM_001039547chr367737 5867 5482 5016 2753 1261 ------
NM_001042473chr1031447 737 699 ----1228
NM_001046chr552804 2509 2163 2046 1092 1556 ----
NM_001304chr1743006 1537 1512 502 13420 --12914
NM_001343chr521627 1353 ----1185
NM_002581chr925600 644 ----1897
NM_002737chr1775884 5640 5275 4118 2438 2258 1368 --24771 2084 1262
NM_002760chrY75821 5126 4996 4175 2125 1894 926 --26012 5190 --
NM_003298chr364926 4023 2322 2102 1315 730 --25971 4365 --
NM_003559chr1753740 3342 866 666 111 --1375 1265
NM_004852chr181113903 12429 12105 11429 10792 9924 3334 2831 1577 364 170 15160 1994 112581
NM_004992chrX98024 7673 6082 5729 5205 3392 3205 1495 210 --37426 5757 2714 --
NM_005339chr453767 3247 2741 730 673 --1855 --
NM_005955chr155344 4038 2075 995 535 13592 21939 1011 --
NM_006047chr2013055 1793 22543 993 184
NM_006546chr1774087 2624 1454 815 798 338 123 15626 11959 --
NM_006750chr16107437 7247 5737 5700 2337 2136 1697 754 434 267 --27311 2053 1825
NM_014393chr822063 464 ----12231
NM_014877chr1767401 7168 6543 5130 1522 1463 16296 12779 --
NM_014906chr1764090 3889 2925 2848 1111 851 ------
NM_014951chr1032511 1046 820 ----12505
NM_015326chr163007 983 860 276 263 103 1249 ----
NM_015458chr875124 5005 4853 4042 3464 858 759 --13757 --
NM_015569chr173899 3817 3186 1421 1146 330 238 1811 ----
NM_016206chr335950 2795 71 --17479 21960 585
NM_017542chr121678 1247 1668 --1649
NM_018364chr143446 1072 452 423 11464 12972 --
NM_020122chr284704 4622 4081 3798 1266 835 600 98 ----11197
NM_020772chr1765757 5399 3269 2781 2220 265 22761 1466 27838 1836 --
NM_020781chr752878 2254 2164 359 336 --22916 594 --
NM_021809chr2052206 2007 1802 551 395 ----22149 1710
NM_021964chr355413 5284 2303 2027 984 ----12368
NM_024761chr954488 3258 492 434 344 ----13921
NM_024949chr435004 4334 3840 --14381 13464
NM_033224chr7117837 7384 6920 5154 2268 1628 1581 1202 548 489 393 1590 ----
NM_057175chr422218 1016 ----12605
NM_152409chr553096 1307 654 556 210 13585 2824 26 --
NM_152608chr142236 1867 1606 437 --1572 1308
NM_172071chr176920 6645 5817 5778 5091 5046 371 --12287 --
NM_173468chr456037 5560 5360 5117 2150 1776 1104 --
NM_194071chr785250 4924 4556 3818 2046 1932 1645 1232 15273 ----
NM_198581chr237024 5071 2030 --57135 6504 5229 4932 920 17195