TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-490-5p
miRNA Sequence: CCAUGGAUCUCCAGGUGGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX53135 2375 2160 1293 860 --23460 386 157
NM_000109chrX102006 1885 1758 1723 772 682 541 273 178 131 --1553 --
NM_000216chrX64073 3554 3475 2667 1500 267 --33898 2604 1606 --
NM_000217chr1245028 4239 3587 3319 --15307 1197
NM_000390chrX63391 3067 2461 2439 523 312 --12336 12538
NM_000430chr1753471 3254 2339 1172 104 --43750 522 436 160 --
NM_000555chrX86387 6280 5598 5563 2742 2198 1288 834 26368 272 24843 965 --
NM_000813chr5105453 5446 4342 3755 3475 3445 1593 1346 258 141 11860 11159 1462
NM_000872chr1031509 1030 443 --1279 1360
NM_000875chr1565772 1242 1167 1150 709 84 16187 25856 5340 11313
NM_001001323chr1243131 2591 2547 2191 ----12615
NM_001001419chr574830 3648 3448 1736 642 466 183 13743 24517 177 --
NM_001002860chr1454432 3685 3533 1712 1248 13639 1415 --
NM_001005340chr74770 627 617 609 ------
NM_001005473chr596364 5834 5441 4973 4758 2451 1683 1635 566 44877 4036 1253 24 16551 1294
NM_001005753chr2102338 2320 2231 2165 2155 1909 1679 1561 554 245 --12002 --
NM_001005845chr8--11284 11209 11466
NM_001008707chr1451783 1742 1599 1248 181 1300 --11450
NM_001008925chr452967 2363 942 746 463 22607 486 1270 --
NM_001009554chr484731 4054 3476 3294 3160 1620 1437 237 --13102 --
NM_001010861chr152698 1766 605 411 55 ----22369 738
NM_001011537chr352340 2018 1559 1518 220 --11920 --
NM_001011666chr7125381 4969 4854 4144 4041 2401 2297 1985 1885 650 532 203 --22458 1053 --
NM_001012393chr11114672 4578 2078 1026 979 921 902 809 565 559 229 13736 34947 3542 491 --
NM_001014797chr10108032 7035 6480 5322 3286 2816 2546 2504 1657 302 26640 1645 --16951
NM_001017440chr756612 5769 2185 1557 1015 35651 5135 2256 --15551
NM_001018065chr9135981 5869 5578 5396 4592 4579 4221 1627 1517 1316 980 736 87 --25456 62 --
NM_001024647chr12117364 7139 6727 6383 6371 6183 4915 2592 1807 1215 586 36530 5512 2252 2660 162 --
NM_001025076chr1085964 5565 5383 4046 1539 928 298 55 --56016 5621 1399 704 266 --
NM_001025077chr10117322 6923 6741 5404 2897 2286 1656 1413 1195 1040 147 --57374 6979 2757 2062 1624 --
NM_001025079chr363676 2939 1624 1573 1534 1097 --21078 211 1402
NM_001029875chr582386 2278 1973 1938 468 431 365 110 --22306 2088 --
NM_001030007chr1643029 2782 1045 870 23289 811 1346 13334
NM_001030055chr1494562 4546 3561 2974 1366 1106 994 719 85 1877 --1783
NM_001031695chr2285351 5253 4589 4217 1484 888 303 289 145 ----
NM_001031700chr422532 909 --11639 12245
NM_001031804chr1644108 1077 650 388 1459 13238 13217
NM_001033045chr254202 3700 2862 1665 51 13992 21580 887 --
NM_001033578chr862411 2307 2193 2035 500 150 1470 ----
NM_001033925chr1041864 1812 1796 547 22159 194 --133
NM_001039569chr263255 3208 2712 2562 560 293 1710 --2760 369
NM_001039840chrX115964 5914 5876 5050 4346 3946 3790 1498 1410 1269 1140 12126 26093 4749 --
NM_001039937chr1384151 3435 1671 1174 1137 962 645 82 13564 --11218
NM_001040152chr7104962 4296 3893 3725 3422 3161 1751 862 409 89 22032 1699 ----
NM_001040284chr1695936 5895 5167 4274 3682 1320 1256 1203 648 --22103 1119 --
NM_001040450chr1532474 301 201 ----2447 237
NM_001040665chr754133 3129 1586 1496 1358 13704 13134 13767
NM_001040712chr953319 3310 3099 927 907 1992 21435 50 --
NM_001042481chr1442657 2464 2273 690 1970 22378 730 --
NM_001042510chr862126 2043 477 392 220 158 11877 --124
NM_001042555chr1294762 4654 3606 3510 3335 1819 1114 315 129 21336 591 --14718
NM_001042599chr2157499 6916 6874 6248 6170 6092 6058 5923 2533 2085 1933 1859 1379 1018 840 12044 16108 --
NM_001042604chr3104870 4856 4767 4533 4294 3815 1664 1467 1298 154 23138 1504 167 --
NM_001099678chr366314 4139 2312 2006 1862 1761 22332 1660 11506 26127 1642
NM_001106chr379564 8857 7041 3327 3201 2929 2274 --19505 13464
NM_001148chr431565 1492 471 --1543 22159 463
NM_001167chrX106726 5719 1823 1380 1341 1194 508 447 279 199 12543 15003 --
NM_001204chr2116287 6250 5996 5438 5205 3111 2018 1933 929 922 912 27641 633 37593 5790 415 --
NM_001259chr786022 5674 5304 4342 3966 2282 1113 1066 --12307 --
NM_001310chr1272912 758 740 650 605 405 352 --1361 --
NM_001412chrX21296 1273 --13463 13668
NM_001438chr193536 2519 2426 1444 1302 913 735 602 33 --1918 --
NM_001759chr12115037 4460 4449 4122 3840 3658 3649 1718 687 359 37 --11903 --
NM_002025chrX169064 8334 8070 7690 7574 7185 6311 6062 5624 3435 3358 3226 1551 1420 1213 955 32554 1673 1236 58908 6217 6187 1510 996 --
NM_002040chr2162902 2833 2715 2560 2138 1084 --12097 --
NM_002158chr243810 1324 1101 1025 11087 12829 11174
NM_002182chr322666 2513 --1640 12731
NM_002500chr231293 1143 1093 1942 21038 339 --
NM_002577chr353349 3115 3087 1549 327 --12478 11270
NM_002645chr1162971 2964 2956 2751 2244 913 --2562 464 --
NM_002655chr895194 4793 4518 4472 1582 1346 1227 910 21 14261 24618 3974 --
NM_002745chr2233699 1226 979 --11669 11635
NM_002748chr1541184 1101 907 797 137 --1391
NM_002977chr272454 1352 652 629 391 380 80 33304 2296 1285 --13376
NM_002998chr862099 1872 685 578 252 153 --12127 --
NM_003108chr265940 5773 5742 5405 1616 678 14747 ----
NM_003253chr2171835 1760 1362 598 576 493 477 11903 1531 --
NM_003262chr3105217 5051 3817 1764 914 804 246 213 106 53 ----15074
NM_003372chrX1904 1950 --1790
NM_003392chr342972 1216 1052 416 1436 --12868
NM_003410chrX31181 951 54 --1381 12352
NM_003411chrY41439 304 80 51 --21321 298 --
NM_003413chrX81671 1487 1468 1414 1309 1294 611 296 11577 --11268
NM_003468chr264034 3736 3145 1587 1497 93 22943 521 --23247 1593
NM_003478chr1133189 2051 188 --1394 1239
NM_003489chr2163369 3277 2860 2614 993 315 13196 ----
NM_003566chr1273205 2903 1204 1013 779 519 237 ----12833
NM_003607chr174057 3826 3432 3353 2985 1472 239 --13098 --
NM_003626chr1121261 258 1554 --1167
NM_003842chr832412 597 348 ----12508
NM_003895chr2151984 1792 1510 1447 530 --11746 --
NM_004093chr1362783 2527 2299 1273 638 627 --12392 13223
NM_004100chr62195 25 11743 --11041
NM_004274chr1463083 1101 952 908 431 379 --1607 11981
NM_004293chr983777 3671 3428 3158 2752 2471 847 753 1210 1743 --
NM_004392chr1362579 2468 2435 2401 2336 1883 --125 12221
NM_004464chr464228 4070 3602 2965 1684 1485 2998 955 24175 1091 1713
NM_004501chr133633 1058 815 --1421 12976
NM_004505chr1742015 1631 1335 1273 ----11772
NM_004586chrX103840 1980 1954 1304 1022 895 815 535 410 340 14508 --15387
NM_004736chr1------21607 529
NM_004852chr182613406 12510 11691 11342 10709 10148 9673 9287 9014 8891 8802 5275 4174 3990 3535 3470 3044 2812 2490 2364 2247 1744 1111 1074 730 352 --22884 2693 --
NM_004866chr553579 3119 1886 1778 1580 --13252 11544
NM_004956chr784499 4421 3273 3111 1647 1423 1141 153 12802 1378 --
NM_004985chr1284178 3060 2930 1779 1588 1579 1389 113 ------
NM_005121chr1733184 2401 694 ----33855 3494 2637
NM_005188chr11148208 8191 6900 6736 6371 6151 5590 5202 2797 2537 2244 2150 1646 923 12452 25643 2390 --
NM_005221chr7179 --1113 1228
NM_005433chr1852703 2427 2345 2071 651 --1645 --
NM_005436chr1063380 1399 1127 239 230 133 23972 379 23657 603 --
NM_005596chr9126125 6025 5094 4888 4659 4599 4177 1787 1409 1376 794 777 1397 11216 --
NM_005604chr642434 1905 765 641 ----1563
NM_005665chr184768 3515 3183 1413 1277 1229 992 302 44599 4544 1304 847 --1924
NM_005725chr122029 1801 11738 1209 1969
NM_005748chr124652 610 244 108 32779 2557 84 22102 98 --
NM_005909chr553353 2837 2817 1020 88 23844 1222 13013 --
NM_005941chr8103657 3437 3387 2997 1608 1523 1355 895 767 706 1191 13571 --
NM_006016chr62120 36 1697 11909 1155
NM_006080chr742137 1139 560 91 11083 --1160
NM_006166chr1211713 1180 --21797 377
NM_006206chr452907 1884 1118 922 435 --2652 440 11168
NM_006283chr854969 4859 1979 1452 973 --11398 --
NM_006306chrX124815 4786 4497 4371 4132 3920 3710 1717 1459 1430 560 544 25885 668 ----
NM_006375chrX31682 1457 714 ----11726
NM_006380chr1783785 3669 1039 586 408 286 118 51 11433 ----
NM_006599chr16167508 7126 6715 6644 6463 6436 6089 5878 5332 3218 2816 2445 1493 1299 859 238 2922 65 18176 --
NM_006628chr1523005 1149 --11053 1954
NM_006729chrX75633 5517 5376 5118 4638 4504 590 12160 11370 --
NM_006754chr73994 979 892 ----11234
NM_006827chr1443026 1087 934 672 1519 21186 699 --
NM_006885chr1663734 3503 2915 2700 1536 1019 12602 1171 --
NM_006956chr752310 2030 942 627 303 --1816 --
NM_007007chr1234543 4284 46 24630 1915 44185 1187 1170 112 --
NM_007011chr1586658 6320 6020 5974 4696 2691 2033 805 ----16030
NM_007013chr861019 828 706 404 336 268 ------
NM_007038chr2154315 4228 2311 1571 445 --12231 --
NM_007050chr20148085 8022 7079 6797 6754 6480 6289 5767 5069 2405 2272 2102 2041 1508 47782 6622 2475 1984 18114 --
NM_007124chr661624 1614 811 581 227 94 1558 1543 --
NM_007172chr2222664 2545 ----33328 2419 683
NM_007249chr13158663 8362 8185 8179 7897 7766 7484 7464 6550 5730 3205 2904 2477 2066 256 16166 28353 7314 --
NM_012164chr9126564 6542 5967 5959 5883 5021 2924 2585 2141 2069 1822 327 15621 31998 918 138 --
NM_012234chr363536 2428 2358 1039 949 306 22467 603 32433 657 526 --
NM_012262chr1104837 4330 3992 3798 3190 1552 1446 1151 778 377 11604 ----
NM_012281chr762375 2089 1600 702 607 600 ------
NM_012287chr364393 3000 2863 1041 347 138 13119 --14436
NM_012297chr442378 1858 1799 43 ----12169
NM_012300chr532515 1886 933 ----12390
NM_012309chr1154653 4624 4108 1966 109 14796 34529 3292 625 --
NM_012316chr165474 5432 3743 3715 3543 1577 15228 24115 1985 --
NM_012465chr1062419 1126 821 782 695 400 13392 11244 1231
NM_013261chr463713 3476 3380 3141 2355 1362 1438 1247 --
NM_014021chr153404 2397 1379 568 164 32484 1150 685 ----
NM_014112chr875287 3732 3356 1919 1822 731 285 --14582 11209
NM_014423chr5114744 4633 4391 4166 1678 1495 1451 1398 797 281 128 1246 ----
NM_014600chr251663 1614 1586 1507 460 ----11623
NM_014683chr171380 --21833 751 12103
NM_014774chr142113 2031 820 42 13219 1574 22251 205
NM_014877chr17117340 6468 6411 5547 4761 3092 1450 1139 1102 464 80 34879 3113 1569 27745 7067 --
NM_014904chr1053719 3371 3014 2991 1256 23094 1461 31422 1393 490 12905
NM_014906chr1773955 3087 2671 2615 2604 1308 270 13245 1108 1783
NM_014982chr1494333 3963 3668 3306 2168 2076 1231 731 406 --15226 14977
NM_015071chr596429 6169 5577 4881 1877 1469 999 698 430 1168 11236 25837 45
NM_015076chr674410 4008 3773 3637 1604 773 698 23799 421 11145 11339
NM_015091chr141179 --1800 2216 205
NM_015092chr1644238 4136 3159 1079 --11159 11363
NM_015192chr2072962 2359 2125 1006 779 284 177 ----1152
NM_015231chr113656 649 290 1697 1794 --
NM_015251chr1672032 1801 1453 608 499 285 256 --12099 --
NM_015265chr272600 2445 2229 2105 1855 992 659 1272 11647 --
NM_015271chr453485 2708 396 218 29 --24293 3148 12823
NM_015272chr1651576 1511 1375 536 98 --1106 --
NM_015278chr673379 3009 2933 974 884 778 761 12361 13450 --
NM_015310chr8106521 5285 5184 3300 2459 2281 1251 856 544 369 11733 12151 174
NM_015455chr572710 2584 2559 2541 1523 560 286 --13513 1740
NM_015458chr8114215 2132 1709 1498 1186 1045 996 556 484 289 188 --34918 1438 1171 --
NM_015569chr183689 3496 3167 3097 1857 1002 644 137 --13287 --
NM_016009chr1114287 4201 3813 3084 1775 1077 1054 777 342 194 87 ------
NM_016018chr832174 1942 798 --22209 374 1202
NM_016289chr212145 1273 12021 182
NM_016315chr231864 457 323 --290 28 --
NM_016353chr852262 923 552 444 23 ----12477
NM_016531chr462837 1638 1508 1317 954 330 --1887 11164
NM_017420chr1463161 2526 981 953 848 415 152 12925 --
NM_017643chr1732079 1174 984 ----22225 2139
NM_017770chr662802 2579 2496 739 730 426 ----22990 2267
NM_017919chr9105791 5265 5081 4951 4404 3646 2135 1562 495 174 15607 14968 --
NM_018084chr262616 2534 2216 1203 712 634 --1388 --
NM_018098chr331132 948 350 1836 1191 1367
NM_018227chr462904 2876 2726 2504 2465 419 --12598 1719
NM_018364chr163786 2896 2797 2789 2647 682 1941 1690 13303
NM_018371chr821190 360 --11386 1332
NM_018439chr1872657 2132 1060 590 560 295 184 --21926 189 --
NM_018440chr887979 7968 7230 7191 3028 2938 2324 928 27277 813 11921 15302
NM_018638chr12125391 5060 4449 3853 2205 2113 1036 1018 991 657 196 147 14994 15498 --
NM_018685chr721106 185 1893 --1280
NM_018976chr1262393 2334 2284 1767 1127 31 22630 1785 12373 --
NM_018999chr1093179 3126 1529 1331 1277 1225 1017 993 360 ----11600
NM_019022chr1863135 2405 999 973 481 390 12327 --13179
NM_019860chr1031588 1109 522 --1358 2439 44
NM_020122chr2115799 5733 5683 5456 5450 5190 3840 2082 1525 1447 765 15762 ----
NM_020144chr732031 1646 1362 1254 --11509
NM_020177chr593367 2835 890 796 576 532 314 261 89 12688 ----
NM_020198chr1731609 1586 77 11386 --1259
NM_020340chr661619 1410 890 367 358 241 ------
NM_020341chr2011976 21784 811 --11668
NM_020342chr242308 1846 1684 686 1234 1454 --
NM_020443chr186990 6961 6857 6590 6376 5362 2435 2016 35432 4753 2211 36892 1383 1048 --
NM_020772chr1787393 6429 6074 5380 2313 1126 1072 54 47151 5605 1656 1054 21448 776 --
NM_020774chr18126229 6006 5942 5238 5026 4658 3804 2460 1868 1630 1349 749 12181 32205 1704 220 1831
NM_020935chr274156 4029 3990 556 422 198 166 1656 --23287 3018
NM_021097chr253079 2815 2530 1046 563 12216 1995 --
NM_021183chrX52341 1990 233 183 148 --21653 855 --
NM_021815chr272087 1949 1049 652 506 203 126 ----11245
NM_021961chr1187474 7394 5203 2918 1348 694 248 176 26448 2467 --14954
NM_022112chr1131681 696 379 ----11595
NM_022484chr721016 299 --11384 11172
NM_024345chr975861 4816 4499 4009 638 538 196 24793 130 14346 14018
NM_024524chr373159 2051 1203 897 821 794 202 --12846 --
NM_024638chr392406 2277 2231 1576 1552 902 795 721 265 22132 2097 12108 22290 1944
NM_024854chr1221438 1330 ----21349 1263
NM_024947chr3229523 9282 8487 8403 8379 8019 7837 6892 6800 6698 6644 6530 6343 6093 5866 3492 3460 2978 1951 1110 522 168 11631 39268 6787 3318 --
NM_024949chr444819 4646 1545 1073 ----1704
NM_025009chr451675 671 494 248 186 ----1265
NM_025054chr861390 1079 1038 948 531 474 32695 515 285 ----
NM_025235chr1061966 1905 1387 896 792 513 21992 1926 ----
NM_030648chr425389 5213 35399 5169 4104 25107 50 --
NM_030918chr194822 3722 1784 1646 1165 980 870 193 151 ----11322
NM_031442chrX72988 2612 1276 1159 1012 964 174 13175 33204 3076 2593 --
NM_032121chrX62292 2027 1878 979 944 439 1631 12422 --
NM_032373chr1085229 5148 3802 3722 3671 1860 841 621 1815 25813 158 --
NM_033364chr32614 523 1396 11737 1113
NM_033656chr21145423 5216 4954 4767 2022 1999 1961 1898 1616 1181 1070 1012 323 231 1118 --11811
NM_080867chr1454981 3943 1925 521 143 --1423 23445 3129
NM_101395chr2162802 2644 2112 876 314 147 2342 28 ----
NM_138333chr982659 2545 2515 2471 1684 489 396 158 ------
NM_138694chr683567 3349 3103 3031 2947 2598 2293 562 21314 626 23531 2608 --
NM_144571chr496210 6120 5212 4343 2626 2509 1858 1434 525 ------
NM_144578chr14115175 5118 4931 4912 4658 4294 3440 2092 2077 1464 238 14580 --1106
NM_144778chr1352671 2199 1960 1700 1086 12078 11674 --
NM_145117chr1152682 2498 1039 688 615 ----23313 711
NM_145176chr673366 3231 3092 2351 2242 1400 633 32369 1044 880 ----
NM_145808chr773087 2823 2729 2583 757 652 136 --12081 --
NM_152409chr563574 2481 2393 2210 1418 708 13519 22761 1423 --
NM_152424chrX73468 1807 1670 1451 1113 823 663 --33497 1440 175 --
NM_152447chr142338 287 ----1306
NM_152622chr552856 2790 2417 630 174 --22721 2445 --
NM_152641chr123758 647 388 --12688 12584
NM_152756chr573366 2778 1365 1309 1137 946 44 1217 ----
NM_152787chrX93747 3421 3395 1538 957 910 898 700 80 ----11000
NM_153619chr1553470 3334 1280 110 49 --1287 12543
NM_173468chr435112 4817 1925 24092 1064 15265 1499
NM_173602chr1273524 2936 2409 1353 1042 897 737 1826 13419 --
NM_174916chr1542262 662 573 113 ----12312
NM_175866chr161446 1388 1337 998 430 302 --1225 --
NM_178011chr1033174 2427 1304 ----1148
NM_178313chr292209 2199 1628 1533 1426 1415 826 505 102 21345 492 21997 142 --
NM_180989chr1342466 2047 810 251 32415 1720 956 11000 --
NM_181521chr1687167 6831 5835 4845 4819 4560 478 85 1841 ----
NM_182485chr453176 2713 2298 1148 218 11488 11060 --
NM_194285chr1143293 2980 2201 774 22411 449 2584 486 --
NM_198066chr1482317 1235 1124 1026 894 799 688 641 ------
NM_198270chrX43268 3230 2664 217 1296 22980 1186 --
NM_198859chr3104932 4595 4108 4058 3948 3878 3669 1600 882 409 14064 15106 --
NM_198990chr762938 2400 2261 2026 1269 42 22088 2046 13099 --
NM_199420chr31606 ----2572 247
NM_206853chr684119 3354 2710 1388 875 793 669 265 13193 ----
NM_207303chr1073406 3262 2969 1137 879 305 67 1167 21099 676 --
NM_213589chr275608 4788 3520 2115 1833 502 399 2866 25 --12010