TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-491-3p
miRNA Sequence: CUUAUGCAAGAUUCCCUUCUAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr531686 1398 747 ----2596 531
NM_000088chr17----11340 --
NM_000092chr223398 3317 33623 3353 667 14344 --
NM_000109chrX22384 573 12466 --12273
NM_000138chr1552082 942 707 594 564 --11045 2754 122
NM_000141chr103602 258 101 ----1416
NM_000173chr171432 --1444 --
NM_000176chr553574 785 474 444 415 --11022 160
NM_000210chr242154 1598 826 753 ----12097
NM_000217chr1265295 3998 1481 1052 546 444 14247 11158 --
NM_000248chr333007 2046 177 12879 11922 12083
NM_000252chrX41360 1338 557 439 ----11020
NM_000264chr963168 3162 2440 2128 1027 459 --2385 372 13150
NM_000325chr42698 477 --1614 --
NM_000332chr687158 6897 6840 6009 5280 4920 647 170 11622 ----
NM_000335chr31300 ----12215
NM_000337chr522069 989 24687 36 14728 1213
NM_000346chr1711994 ----31800 1432 1354
NM_000362chr2263582 3150 1016 1004 576 542 --23603 2429 --
NM_000378chr11----11173 1837
NM_000415chr121936 1872 154 --
NM_000430chr1773761 3681 3266 2811 1391 182 164 ----11065
NM_000439chr532353 2180 712 ----12039
NM_000459chr95879 746 306 193 154 --1313 --
NM_000461chr364549 3706 1592 1438 740 534 34235 1394 138 13472 13968
NM_000484chr211331 ----21080 282
NM_000489chrX52706 2341 2321 2093 833 ----2652 93
NM_000492chr71970 ----11204
NM_000503chr831312 689 531 --1657 11820
NM_000531chrX----1304 --
NM_000600chr7------1387
NM_000610chr1153002 2994 2958 2367 615 1122 11036 --
NM_000720chr3----1130 --
NM_000724chr1041716 556 422 234 --21807 49 --
NM_000726chr2------1549
NM_000728chr11----1411 --
NM_000788chr41270 21265 1231 11466 11399
NM_000813chr585239 4519 3434 3424 1523 1388 801 674 --11802 14205
NM_000814chr1561034 1024 293 194 176 132 23611 903 11016 --
NM_000828chrX62119 2111 1943 1526 612 103 12131 --21837 1789
NM_000859chr511697 ----11358
NM_000861chr342357 2335 1683 530 --21740 463 12654
NM_000875chr1556911 6086 5461 2649 1190 ----16842
NM_000891chr1743474 2553 731 353 21163 175 ----
NM_000899chr1294301 4201 2981 2760 1186 1086 337 324 230 11523 --1836
NM_000901chr42913 752 --1918 1725
NM_000909chr41256 1879 --11099
NM_000944chr441960 933 76 60 12410 --11533
NM_000945chr221874 1582 --32036 1626 1566 --
NM_001001344chrX4955 716 687 629 ----22604 2260
NM_001001396chr174316 4110 3993 2893 2825 1441 1150 13183 14172 1731
NM_001001419chr545213 4906 878 765 ----14176
NM_001001481chr852794 2591 912 714 595 23122 551 1416 --
NM_001001484chr1072228 2162 2077 2069 2055 1780 838 135 1673 12249
NM_001001523chr1------1496
NM_001001664chr273866 3501 2706 2579 1357 1153 915 --33152 1595 1276 24009 2908
NM_001001669chr542398 2259 2203 1779 ----1228
NM_001001709chr952750 1031 856 827 163 1651 ----
NM_001001890chr2133861 2661 523 ----13816
NM_001001933chr1------159
NM_001001995chrX21425 1295 --11568 11752
NM_001002295chr1031148 1024 281 1346 --1761
NM_001002800chr3------181
NM_001002838chrX------1569
NM_001002860chr1434720 1720 136 14378 24464 1363 --
NM_001002926chr752604 2089 1070 931 617 22575 2392 22797 978 --
NM_001003652chr1867894 7434 3110 1696 970 777 26976 260 46540 1968 958 911 1373
NM_001003681chr222588 56 2795 233 11962 12104
NM_001003712chr1243536 688 278 262 21334 698 13398 13139
NM_001005463chr101783 --11831 22594 291
NM_001005781chr21575 ----1391
NM_001006623chr232217 704 551 ----12515
NM_001006665chr1------1229
NM_001006681chrX----144 --
NM_001007067chr82910 735 --1110 11096
NM_001007214chr131244 485 81 11651 --1411
NM_001007245chr7------1207
NM_001007565chr31149 ----1392
NM_001007794chr11197 --1114 --
NM_001008239chr1812707 13825 21489 373 1936
NM_001008391chr111168 ------
NM_001008405chr711432 --1466 193
NM_001008564chr1391957 1859 1788 1764 1692 1510 1487 648 490 --11809 --
NM_001008925chr423471 3089 2311 111 13033 13072
NM_001009552chr82551 541 --1436 --
NM_001009566chr121428 440 ----1446
NM_001009569chr10------11593
NM_001009881chr12569 217 ------
NM_001009899chr396503 5751 5092 2254 1606 1064 818 206 61 11297 36329 5647 111 21813 601
NM_001010867chr185505 5430 4131 2560 2528 2209 736 366 15199 11659 --
NM_001010888chrX63733 1337 1081 973 875 863 14555 34145 3007 1020 14660
NM_001010935chr13998 949 194 ------
NM_001010942chr122392 318 --21218 865 --
NM_001010989chr16----1484 --
NM_001011663chr101196 ----11072
NM_001011666chr763996 2590 2025 1977 694 283 --12595 14244
NM_001011722chr11411 ----1426
NM_001012279chr6185 ------
NM_001012398chr1621024 368 --1138 11065
NM_001012759chr16------1108
NM_001013031chr1053389 2941 2196 316 157 11192 23419 3260 --
NM_001013399chr62340 277 11135 ----
NM_001013406chr731169 651 422 --1552 --
NM_001013438chr3------1898
NM_001014812chr15----2301 187 --
NM_001015877chrX63096 3017 2418 2349 372 256 ----1907
NM_001017368chr17----1762 32701 1885 216
NM_001017424chr131537 1312 28 --195 11904
NM_001017440chr787829 5730 2121 1949 780 541 340 49 25998 368 --38224 8155 5496
NM_001018004chr15----1703 --
NM_001018054chr1----1214 --
NM_001018057chr112461 138 11344 11280 11314
NM_001018064chr911685 ----2593 352
NM_001018065chr975404 5312 5018 4230 2352 921 901 --11826 --
NM_001018067chr1104902 4798 4026 3909 3859 3334 1456 683 448 61 --14444 --
NM_001020658chr141543 1105 1067 247 --11591 --
NM_001020818chr19------11794
NM_001025076chr1045632 4504 624 207 --11316 11181
NM_001025077chr1046990 5862 1982 1565 --12674 22539 1363
NM_001025079chr344139 2728 1282 1005 23669 965 23747 1086 --
NM_001025108chr244086 3705 3175 607 --12990 13699
NM_001025580chrX64103 3962 3863 3341 1398 531 ------
NM_001029884chr662710 2553 2462 2099 902 82 --12309 12370
NM_001030055chr1484586 3371 1570 767 741 249 188 58 11543 14016 24206 3152
NM_001031684chr21590 11418 11431 1386
NM_001031692chr7------1292
NM_001031695chr2265226 4798 3708 3461 2099 670 13989 --25359 3861
NM_001031732chr423534 672 --13549 22481 755
NM_001031812chr542045 1769 1503 392 12085 21739 888 --
NM_001032221chr9------11122
NM_001032296chr1351891 1023 954 438 321 --1476 --
NM_001032380chr1021898 239 ----11882
NM_001033045chr274165 3605 3361 3051 1366 906 681 13256 --13674
NM_001033057chr321937 220 ----11596
NM_001033117chr373994 1213 478 414 384 370 356 --11393 11205
NM_001033578chr842420 2347 1590 525 --190 --
NM_001037132chr731840 498 195 1718 11623 22071 311
NM_001037174chr231699 690 472 ----135
NM_001039395chr952201 1728 1627 943 238 --12417 21721 1696
NM_001039538chr243678 2334 262 42 1971 12744 1498
NM_001039548chr11------1124
NM_001039580chr464616 4564 4546 3966 1650 949 --23984 1367 --
NM_001039590chrX73250 2772 1589 1552 955 243 191 --22751 1574 --
NM_001039840chrX74177 4004 2177 1944 1819 1341 236 12106 1577 25501 2073
NM_001039877chr191665 ----1675
NM_001040020chr711427 --1116 11263
NM_001040100chr321201 33 ----1447
NM_001040107chr12------2608 587
NM_001040142chr292141 891 826 810 798 790 782 255 122 1926 1536 --
NM_001040159chr441507 1478 1014 429 --1122 --
NM_001040214chr632011 1842 1632 --1722 11782
NM_001040272chr952036 2024 1757 772 157 --1741 12245
NM_001040284chr1665287 4629 1052 503 478 453 12371 21966 1420 --
NM_001040402chr442946 2292 278 257 12726 22936 641 22235 288
NM_001040429chr1321260 1048 --12989 1559
NM_001040456chr7------1558
NM_001040633chr73990 323 99 ------
NM_001040665chr745016 3795 3339 793 11520 21488 491 21258 1209
NM_001040708chr83981 385 258 --1909 --
NM_001040712chr952947 2602 1296 1277 931 23484 875 12850 13407
NM_001042368chr9------1753
NM_001042459chr3------2240 122
NM_001042493chr612020 1421 31513 317 286 --
NM_001042494chr1543563 1509 1240 639 --13607 --
NM_001042537chrX51879 1629 918 737 85 1130 11914 --
NM_001042555chr1284292 4112 4006 3913 3645 3566 1361 924 44647 4333 3817 1634 23751 1826 23836 3260
NM_001042599chr2157331 7262 7005 6771 6470 6375 6317 4922 4756 2856 2686 1830 1444 434 229 26638 5706 23009 2109 --
NM_001042762chr71391 2825 60 --11087
NM_001106chr389785 9183 9005 8753 6379 6086 3629 878 17936 26888 3680 --
NM_001121chr1021519 752 31831 766 557 --21875 1761
NM_001149chr103263 191 134 21419 448 --1509
NM_001167chrX85487 5129 4964 4671 2298 1414 678 372 11610 16714 1721
NM_001186chr2173189 2858 2567 2560 2381 1255 815 11160 12389 --
NM_001198chr651543 1506 968 723 220 2449 178 2503 303 --
NM_001201chr453699 3530 3455 3198 570 --43913 3340 2707 2602 --
NM_001204chr277275 5969 5897 5636 2794 1834 1507 17558 37527 7498 2885 --
NM_001212chr17----1204 --
NM_001241chr242339 1920 645 515 --22108 1869 --
NM_001259chr765720 4483 3910 1752 716 412 15423 11161 --
NM_001304chr1733487 2753 30 1290 --13852
NM_001310chr1262904 2569 2362 1904 911 555 --12151 1522
NM_001380chr101763 --2974 410 --
NM_001396chr2122560 2416 ----1377
NM_001400chr1------11207
NM_001412chrX73511 3449 3370 2702 778 393 378 22607 97 12436 --
NM_001427chr731562 1301 145 21837 167 --179
NM_001432chr463726 3540 2940 2725 1489 768 --32987 1331 179 12980
NM_001451chr16189 --21371 1320 11249
NM_001455chr694575 4416 4014 3224 1769 1564 1453 1423 1323 --1694 34555 1521 1495
NM_001465chr52829 600 ----1574
NM_001498chr61873 11178 177 --
NM_001543chr554457 3938 3689 3279 1036 ----14638
NM_001546chr641290 1027 540 509 ------
NM_001616chr252645 1358 1304 941 878 ----13193
NM_001621chr773052 2646 2434 2306 1914 586 116 ----23003 1072
NM_001627chr321803 652 159 1378 21662 1635
NM_001656chr521981 105 --11746 21508 633
NM_001663chr1422284 986 12164 21780 741 1794
NM_001688chr1----1358 --
NM_001690chr341620 1043 349 57 21764 552 12587 --
NM_001704chr6------1573
NM_001706chr32806 343 ------
NM_001709chr1152632 984 301 113 56 ----1119
NM_001731chr121863 ------
NM_001742chr741833 1825 1781 1222 ----11789
NM_001759chr1285119 4675 3637 2094 428 394 231 215 ------
NM_001827chr9252 44 ------
NM_001845chr1311395 1534 1140 11300
NM_001920chr121542 ----1134
NM_001938chr131295 675 210 ----1602
NM_001946chr123414 294 210 ----21018 946
NM_001949chr61440 --32914 2643 2312 12580
NM_001967chr31617 1222 ----
NM_001981chr152313 2011 1988 1954 825 ----11601
NM_002009chr1532241 2109 697 11833 1831 --
NM_002015chr1341156 1059 1017 335 --11164 13256
NM_002025chrX68304 8096 8074 7977 821 578 27165 5922 58565 7201 5836 3565 1796 19081
NM_002040chr2143041 1200 1095 671 11136 22244 121 13184
NM_002069chr72515 283 --1258 --
NM_002114chr61182 ----1394
NM_002136chr12----1192 --
NM_002137chr722350 569 --1607 2127 36
NM_002158chr263059 2920 2892 1433 793 216 13634 43830 3519 1279 711 13510
NM_002166chr21515 --1748 --
NM_002167chr12517 456 --1490 --
NM_002196chr201749 --11112 --
NM_002203chr584071 3977 3845 3817 2540 1136 452 322 13130 23827 3281 11126
NM_002210chr262920 2745 1150 916 425 261 21293 861 --2680 497
NM_002214chr755223 4728 3629 1441 589 25153 271 24005 2292 14843
NM_002226chr141935 --187 1166
NM_002233chr113312 139 103 ----159
NM_002247chr1071902 1754 1507 1448 778 146 128 --22303 1986 --
NM_002267chr1342428 790 393 192 1866 1199 --
NM_002268chr321287 67 1396 --21646 1481
NM_002270chr594496 3700 3674 2088 1990 1870 1428 1233 517 13935 45192 4804 4785 4234 11312
NM_002310chr556571 6213 3991 2591 368 --26419 606 --
NM_002319chr7------1433
NM_002332chr12------1110
NM_002336chr1234033 3630 1981 24139 2028 1904 35017 5002 230
NM_002349chr221639 302 ----11427
NM_002356chr631827 729 313 --22794 452 1819
NM_002380chr8----1850 1178
NM_002397chr531367 842 422 1172 12080 11713
NM_002408chr14----1833 1710
NM_002449chr5------1262
NM_002482chr12674 43 --183 --
NM_002515chr1451386 640 322 229 144 ----1525
NM_002546chr8----1636 --
NM_002581chr954980 4954 1782 348 235 15337 24171 3587 --
NM_002594chr2071905 1879 1869 1810 772 615 591 --11819 22090 1899
NM_002634chr171669 ----1903
NM_002645chr1142992 2257 103 50 132 23073 2550 12818
NM_002655chr835021 4958 1846 2139 93 25104 112 35068 4347 409
NM_002687chr1431271 300 104 --2420 171 --
NM_002718chr342525 2408 512 77 --12680 --
NM_002719chr1412172 1961 --11794
NM_002731chr112030 22409 1933 --11203
NM_002734chr1752092 1913 1898 1880 908 11617 ----
NM_002736chr762047 2008 1561 1532 1495 604 1536 21991 1984 11778
NM_002737chr1744955 4592 1546 1253 11315 46638 6616 6504 2414 --
NM_002740chr332676 1092 49 --22844 2649 --
NM_002745chr2284551 4510 4038 3947 3642 1380 1091 928 12773 --23764 3629
NM_002786chr11----1206 --
NM_002822chr1211707 11530 --11149
NM_002824chr12----1476 --
NM_002827chr2021650 1624 ------
NM_002858chr131348 1149 198 --21226 497 --
NM_002885chr1------11053
NM_002892chr1441537 1484 1346 117 --1301 --
NM_002902chr152575 569 --1600 --
NM_002918chr19------1979
NM_002948chr32324 259 ----1241
NM_002956chr1221249 389 1989 ----
NM_002971chr3--1284 --21071 1058
NM_002976chr2----1350 --
NM_002998chr822234 511 ----2555 65
NM_003010chr1732167 1975 144 ----12253
NM_003011chr921683 393 11376 11469 21573 362
NM_003016chr1721790 1457 ----11508
NM_003017chr631280 936 927 21226 1110 11368 --
NM_003027chr15------1165
NM_003043chr334253 3258 1072 ----14182
NM_003054chr10------2203 42
NM_003069chrX4630 615 274 41 ------
NM_003070chr9----1584 --
NM_003088chr7----11112 --
NM_003108chr297011 6904 6760 6164 5321 4991 1463 1282 306 15900 --36286 5946 4710
NM_003110chr171897 --1905 --
NM_003112chr753143 3102 3004 2614 2136 ----22007 884
NM_003128chr222436 734 --1751 11782
NM_003155chr842782 2697 819 409 --12521 1141
NM_003161chr1732979 2550 844 ----22627 2315
NM_003178chr332043 1878 1715 --31741 506 218 --
NM_003200chr1932375 2296 618 ----22159 650
NM_003201chr101155 1881 1873 1643
NM_003211chr122434 194 ----1345
NM_003239chr14--2970 958 --11008
NM_003247chr641279 567 353 38 1405 21428 380 --
NM_003262chr375188 4741 4688 4269 4167 1223 713 24875 1685 1391 --
NM_003272chr13675 215 57 --1267 --
NM_003274chr2112636 --21093 840 --
NM_003286chr20------1881
NM_003298chr386136 5621 4124 4115 4086 2253 1247 356 ----16157
NM_003299chr12------1244
NM_003304chr32466 166 1142 21568 63 --
NM_003337chr521477 182 --2250 44 1209
NM_003338chr102757 435 ------
NM_003390chr112904 762 ------
NM_003400chr21550 --1143 1214
NM_003403chr14183 --1612 --
NM_003410chrX194 --11001 12704
NM_003412chr332182 1234 856 11140 11964 1659
NM_003418chr32743 677 --1216 --
NM_003453chr132761 735 --1296 --
NM_003462chr1----11771 --
NM_003478chr1132181 572 172 1979 13342 12818
NM_003482chr12----12383 --
NM_003489chr21102988 2937 2911 2903 2853 2709 2488 157 100 78 1292 12865 22979 67
NM_003566chr1213166 11002 1844 63419 3231 3092 3063 2777 2593
NM_003620chr171197 --1382 --
NM_003626chr111262 ----1350
NM_003633chr572366 2285 2022 1939 827 692 31 --22482 2430 --
NM_003668chr122222 120 ----158
NM_003677chr1292081 240 220 198 172 164 144 126 104 --11986 1371
NM_003711chr51240 ----1276
NM_003713chr1------21639 1429
NM_003722chr321769 1748 12339 --1348
NM_003749chr1322330 2128 --11717 22097 1780
NM_003762chr151040 549 335 290 84 11480 2426 61 --
NM_003783chr151199 966 836 308 56 --1218 1260
NM_003787chr1811693 2315 263 ----
NM_003795chr6197 ----1549
NM_003873chr10--12489 2493 474 1986
NM_003887chr242219 2049 1493 592 --22229 601 --
NM_003913chr6104317 4181 1536 1216 852 680 631 250 117 75 33396 1045 372 --11169
NM_003922chr15----1348 --
NM_003939chr1043589 600 562 410 11570 22521 1172 --
NM_003941chr762551 2507 2362 2239 1985 110 12199 ----
NM_003948chr442242 2052 1063 326 ----1431
NM_003972chr1091161 1136 1087 1073 1024 924 863 358 127 21114 876 --1938
NM_004064chr1231267 1252 258 --1127 1393
NM_004079chr152846 2238 2172 581 294 ----22084 1179
NM_004080chr771417 1274 1167 594 248 235 39 11121 11468 1201
NM_004093chr1333036 897 427 13015 12266 12927
NM_004094chr14------23044 2161
NM_004100chr622721 2200 12422 1454 --
NM_004114chrX31234 1070 913 11096 21105 202 --
NM_004133chr822345 202 12300 12594 --
NM_004161chr221234 521 ----1414
NM_004171chr11139656 8907 8558 8139 8115 8017 6692 6660 3744 2933 2741 1377 99 39136 8044 8004 18979 13004
NM_004180chr21619 ----1232
NM_004206chr31573 ----2596 555
NM_004225chr831070 582 445 --1541 11314
NM_004229chrX31758 560 195 --1183 --
NM_004232chr1843256 2390 789 730 13080 13866 --
NM_004236chr151406 ----1439
NM_004274chr145982 963 852 642 462 3897 525 25 2885 861 --
NM_004316chr122835 796 --11141 --
NM_004323chr952715 2694 2618 2414 2365 ------
NM_004329chr10----21435 1001 --
NM_004330chr154867 756 748 448 ----1331
NM_004331chr82844 92 1359 12669 1651
NM_004337chr812045 --21612 570 1643
NM_004379chr221350 1294 ----1425
NM_004388chr1----1352 --
NM_004397chr111979 23298 3145 1988 --
NM_004405chr2------1835
NM_004422chr17------1494
NM_004429chrX21009 530 ----11433
NM_004430chr822334 2207 12796 12218 12456
NM_004432chr922135 1543 11530 11867 11817
NM_004438chr212188 1396 13063 12510
NM_004444chr7------1861
NM_004457chr231604 361 68 --1324 1659
NM_004459chr1721328 829 ----1651
NM_004464chr484337 4235 3442 3178 3073 1706 1429 1020 12650 24219 2628 12702
NM_004491chr1944210 4075 1409 1316 ----13779
NM_004496chr1461182 929 268 204 102 31 ------
NM_004501chr133179 1206 585 44017 3790 3219 2558 1864 11176
NM_004503chr12------1801
NM_004504chr24903 886 319 225 --1568 --
NM_004505chr1711950 21241 623 --11834
NM_004521chr10------1135
NM_004586chrX1509 24821 785 24763 4486 12025
NM_004655chr1721083 341 ----11236
NM_004690chr61317 --1526 --
NM_004719chr1242488 2415 778 292 ----1323
NM_004734chr1333256 2360 496 12023 --1446
NM_004748chr15--13201 13334 23558 1229
NM_004768chr14403 277 100 30 ----1985
NM_004775chr183735 402 340 --1743 1454
NM_004788chr1132522 2130 994 ------
NM_004794chrX1125 ------
NM_004824chr6--1257 --1320
NM_004850chr231650 646 446 11402 --1590
NM_004852chr181012872 11768 10692 10623 10350 10308 9030 1554 1178 962 112235 311258 10206 5433 24538 2124
NM_004857chr1464339 1757 1062 1046 575 388 33690 3626 3254 24618 3656 --
NM_004866chr594085 3484 3428 3335 3060 1815 1558 595 129 24988 1455 ----
NM_004898chr442478 954 564 215 ----2991 612
NM_004948chr1851287 433 377 324 75 146 1246 --
NM_004972chr921024 369 --1393 --
NM_004985chr1244281 2874 879 276 23886 820 23535 2970 11368
NM_005023chr5140 21324 1152 170 --
NM_005056chr1234493 1120 397 --12238 1141
NM_005065chr1425306 1594 13929 1345 13674
NM_005068chr62286 104 1572 ----
NM_005077chr9------1468
NM_005095chr121974 1874 --2259 83 21819 319
NM_005121chr1723202 1224 13441 13233 1469
NM_005124chr651009 697 417 400 313 ------
NM_005126chr341850 253 74 60 --32032 1943 1593 --
NM_005156chr975315 5260 5253 5111 3551 1335 578 --11578 23775 537
NM_005160chr2285807 5653 5407 5207 2560 2353 1015 949 35518 1319 1100 ----
NM_005164chr121292 1840 22035 387 2578 70
NM_005171chr1221253 501 ----138
NM_005180chr1021068 506 ----1456
NM_005206chr17------11120
NM_005230chr12----1556 --
NM_005233chr332146 1612 1602 21849 263 --12465
NM_005238chr1163144 3057 2491 2233 1133 1090 22423 1063 ----
NM_005254chr152944 568 1427 --11305
NM_005259chr231521 962 124 ----11224
NM_005295chr71219 --1305 --
NM_005339chr474340 3610 3096 2647 1502 1396 449 ----182
NM_005349chr4----1398 1228
NM_005359chr1866476 4131 1206 1065 655 344 11290 ----
NM_005378chr22837 593 ----1791
NM_005385chr322691 505 1383 1275 12654
NM_005436chr1083945 3639 3169 1527 1320 1276 1076 979 13516 ----
NM_005460chr5--139 1399 1534
NM_005465chr141825 1565 1277 491 ----1204
NM_005483chr19------1354
NM_005504chr1275576 5082 4166 2564 1162 903 837 14916 35096 2645 107 --
NM_005507chr11------1395
NM_005537chr132444 95 ------
NM_005596chr9105804 5589 4770 4710 4219 3990 1713 1386 1323 818 --25353 442 --
NM_005627chr6------1823
NM_005639chr1251338 663 623 348 277 1245 11633 --
NM_005650chr22----11191 --
NM_005668chr5114581 4069 4045 4035 4011 3813 3718 3558 3542 3019 590 23146 2883 21661 246 --
NM_005721chr21275 --11005 --
NM_005725chr162306 2288 2261 2190 2077 1859 --1134 --
NM_005730chr121284 ----22990 2295
NM_005749chr171192 1672 ----
NM_005751chr72169 126 --1440 --
NM_005754chr52342 283 --1122 --
NM_005759chr263653 3445 1355 341 268 260 14160 1719 14394
NM_005772chr9----1760 --
NM_005776chr143633 562 37 1222 1833 1571
NM_005780chr131686 ----1697
NM_005795chr222667 379 --1687 31929 834 333
NM_005801chr17----1102 --
NM_005813chr242507 969 811 673 --32297 2288 785 --
NM_005828chr1755096 4621 3488 482 280 --15042 14630
NM_005841chr42961 465 ----1974
NM_005842chr132739 550 --1239 --
NM_005848chr15------153
NM_005859chr541539 966 608 39 --11580 --
NM_005871chr103888 765 755 ----11008
NM_005880chr1621563 457 --3401 160 124 --
NM_005885chr541405 651 287 206 --1583 --
NM_005898chr1172541 2453 2286 1111 529 515 202 --32548 2400 646 --
NM_005902chr1563989 3353 1611 923 764 753 ----21537 1510
NM_005904chr18------11344
NM_005941chr811471 13491 --21443 1363
NM_005955chr144570 3635 1066 51 11369 13506 25454 309
NM_005956chr142201 83 ----1182
NM_005968chr19------189
NM_006016chr621991 128 --1595 1213
NM_006037chr233706 3692 3673 21126 1101 11145 11853
NM_006047chr2052883 1111 547 497 111 ----13168
NM_006055chr252951 1165 946 267 47 12122 134 --
NM_006080chr742607 1913 1075 394 --21156 965 12470
NM_006133chr1132483 2476 2460 ----12497
NM_006141chr1632644 1915 47 ------
NM_006154chr1562370 2196 2188 887 756 339 --11072 --
NM_006166chr123976 277 105 --32508 1655 474 --
NM_006167chr832097 554 211 --12336 1704
NM_006186chr221166 1002 1275 1337 --
NM_006197chr852283 1846 1536 909 49 ----188
NM_006206chr432641 2372 1045 21016 851 12297 1499
NM_006251chr5133308 2803 2786 2308 2257 1355 1331 1321 1301 1234 989 223 215 --22759 45 11122
NM_006256chr142624 970 951 517 1197 ----
NM_006265chr821236 285 --11534 11331
NM_006283chr853495 1872 1703 1205 564 --21515 195 21735 827
NM_006306chrX95121 4996 3663 3607 1736 1694 1406 807 361 25738 143 25345 4122 11454
NM_006313chr1231704 1365 1089 21127 478 11644 --
NM_006364chr142472 312 ----11174
NM_006380chr1743967 3792 2893 1528 --33752 2662 827 --
NM_006420chr2043202 370 281 197 --23435 1009 13360
NM_006445chr17------1168
NM_006494chr19------1141
NM_006495chr171481 ----2333 148
NM_006504chr1042890 2606 2484 109 --12717 --
NM_006538chr234014 2865 2633 12740 --1775
NM_006540chr8----11287 --
NM_006549chr1221023 988 ----12879
NM_006575chr1411301 --1563 --
NM_006599chr1658245 8094 7256 6125 5851 65934 2741 2729 2026 1174 1101 27430 6948 1710
NM_006620chr674809 4733 4437 3778 3419 1112 648 --14773 --
NM_006626chr921073 847 2726 344 12457 1531
NM_006628chr1551768 1229 1218 682 240 --1854 122
NM_006646chr1323026 94 ----1109
NM_006666chr19------167
NM_006682chr722139 902 --12807 --
NM_006717chr9103186 2750 2690 2644 2401 1287 1222 1031 420 349 ----12517
NM_006726chr4----1969 11041
NM_006738chr1554490 4255 3311 621 443 ----24512 691
NM_006750chr1687965 7446 7262 6627 6181 2608 2020 1397 37920 7751 5538 16454 17988
NM_006777chrX52760 2246 994 761 432 1441 --1904
NM_006791chr15----1101 --
NM_006948chr2152447 1622 1609 503 495 11645 22417 2385 --
NM_006956chr752284 311 272 238 188 1680 --1822
NM_007005chr91469 --21310 487 --
NM_007006chr1673027 3007 2530 2247 1364 644 529 ----13469
NM_007007chr1243289 1784 1658 1164 34255 3839 1057 24129 3972 1158
NM_007034chr121015 988 ----2131 91
NM_007036chr57977 929 673 244 219 126 90 ------
NM_007038chr2196111 5762 5695 5229 5102 4352 4310 4008 1612 12160 34371 3994 764 15634
NM_007050chr2056873 6027 5771 1878 584 36446 5453 2067 27744 1132 --
NM_007054chr573962 3943 3709 3353 2497 797 331 ----13921
NM_007118chr51592 ------
NM_007124chr61299 --1293 --
NM_007125chrY1964 --1932 --
NM_007146chr1731817 1018 629 --12335 --
NM_007147chr194805 773 459 136 --1864 11026
NM_007214chr621065 868 --1138 --
NM_007217chr3------184
NM_007246chr431084 906 395 1847 --1935
NM_007249chr1379068 8005 6972 3051 2250 1252 28 29370 491 29349 6714 27448 6822
NM_007282chr3--1364 1949 1720
NM_007374chr14----1365 --
NM_012081chr563205 2802 2612 2444 569 547 ----1798
NM_012096chr313504 --13746 --
NM_012104chr1121537 1105 13234 --23826 500
NM_012115chr63507 483 38 --2602 457 2574 560
NM_012120chr632299 636 498 12245 21066 439 --
NM_012129chr71333 ----21996 1746
NM_012164chr947231 7138 5090 2665 21916 1812 15735 185
NM_012224chr451146 1081 986 411 260 ----1137
NM_012233chr22884 243 11136 ----
NM_012238chr101304 --11549 11414
NM_012243chr12941 154 --1896 --
NM_012249chr243562 2808 2365 1398 --23136 754 --
NM_012286chrX----1104 --
NM_012287chr373506 3391 3199 3044 1807 1090 50 11214 34381 3307 630 --
NM_012294chr753938 3919 3577 926 112 13204 23617 2968 43564 3163 2668 374
NM_012297chr431887 1783 890 ----11013
NM_012311chr101136 ----1105
NM_012329chr1741689 1590 1425 458 1145 11552 --
NM_012330chr1031527 1109 425 ----11121
NM_012347chr632284 443 100 ----136
NM_012395chr773343 3033 2990 2929 2835 2820 677 21366 441 12980 --
NM_012428chr153958 649 304 --1945 11003
NM_013281chr203947 586 393 11529 ----
NM_013309chr15----1409 --
NM_013374chr33777 561 217 32848 2369 205 2433 126 32314 1146 595
NM_013381chr1271789 708 681 675 642 352 303 11807 12200 1937
NM_013396chr2121429 463 --1218 132
NM_013436chr2----2685 518 1609
NM_013438chr951645 1201 609 476 210 ------
NM_013444chrX2913 331 ----11102
NM_013448chr14----1737 177
NM_013995chrX32218 1867 506 --12142 12506
NM_014016chr331468 1165 1111 --11086 --
NM_014021chr172715 2603 1139 951 764 387 240 12418 ----
NM_014023chr1062524 2192 211 201 121 70 ----1154
NM_014106chr1542721 2422 846 451 --32193 2119 132 --
NM_014112chr855411 5198 3775 1230 1118 24711 921 ----
NM_014154chr33344 214 67 --21563 649 --
NM_014181chr222550 495 22467 968 22057 1087 1609
NM_014265chr81530 --1570 2785 200
NM_014280chr1----1674 --
NM_014294chr8------11042
NM_014296chr341610 269 222 168 1602 11053 21124 260
NM_014301chr12----1307 1428
NM_014319chr127723 711 685 576 553 392 332 11413 31906 407 246 2771 586
NM_014331chr497663 6651 5959 5740 5637 2829 2110 1687 358 26148 5007 25651 764 --
NM_014343chr71305 ----1283
NM_014344chr111845 ----1857
NM_014391chr102719 280 ----1713
NM_014421chr421732 1494 --12111 11855
NM_014423chr555425 5001 3987 1351 1322 1396 ----
NM_014445chr322353 1881 --2651 368 1335
NM_014458chr1124 --11408 --
NM_014494chr1612210 ------
NM_014572chr1341518 1335 589 579 --1659 --
NM_014575chr31442 ----1554
NM_014577chr222839 60 ----1694
NM_014584chr1441606 1526 1162 72 --1183 --
NM_014614chr211434 ----21446 947
NM_014615chr1643261 791 686 344 ----1124
NM_014618chr9------1173
NM_014633chr111135 --2544 465 --
NM_014635chr241534 1141 233 96 --11664 11605
NM_014644chr11267 ----31009 885 782
NM_014671chr711464 --11323 --
NM_014701chr1521226 877 ----13068
NM_014702chr673083 1191 464 399 315 293 253 1710 12780 --
NM_014707chr731847 884 112 --11975 --
NM_014709chr21432 --162 --
NM_014720chr1061860 1721 1589 1552 586 242 ------
NM_014729chr8--1446 21986 1650 1783
NM_014746chr244136 3752 3708 533 ----34240 4117 4105
NM_014751chr851994 1910 1762 1635 816 ----22123 316
NM_014755chr294115 4078 4032 1519 1117 450 340 334 79 ------
NM_014774chr133239 473 328 21306 809 23177 2622 --
NM_014787chr142233 517 328 207 12523 --12261
NM_014803chr10------21806 1128
NM_014819chr522076 1623 ------
NM_014846chr8------1280
NM_014877chr17127447 7071 6181 5963 5748 4981 4857 2819 2808 2798 2615 875 46460 4851 1818 920 ----
NM_014903chr1222417 2228 22150 88 12080 11696
NM_014904chr10103939 3900 3847 3628 3436 2879 2636 917 872 501 1830 23999 3983 14021
NM_014905chr2194 --1231 --
NM_014912chr1042616 890 866 188 33014 2502 922 --12978
NM_014917chr11612 ------
NM_014920chr633142 873 264 197 --22941 207
NM_014932chr331660 1389 163 1575 1622 --
NM_014946chr232376 1995 314 ----23097 1177
NM_014947chr132909 2694 262 22073 641 --13128
NM_014962chr2022235 1089 11816 22896 915 --
NM_014982chr1464911 4260 3431 2087 1693 1267 35250 4066 469 25124 4552 1245
NM_014991chr443203 2990 942 419 --12950 32879 2808 971
NM_015000chr1242895 2470 733 287 --22568 2095 12962
NM_015001chr11666 --1818 --
NM_015025chr221915 514 ----22528 1905
NM_015026chr1233407 3301 2983 23039 1106 34346 1566 505 23807 528
NM_015032chr1342696 1085 886 305 --22531 2129 12459
NM_015051chr913174 22452 1174 11352 1890
NM_015071chr536159 5815 518 25535 3956 1774 16311
NM_015074chr134907 3626 677 21437 628 14707 --
NM_015076chr674245 3471 1699 1532 1294 405 220 --31729 1172 1013 13893
NM_015092chr1614639 ----14491
NM_015097chr341815 1649 1597 177 ----1325
NM_015110chr91462 12428 ----
NM_015124chr22------12492
NM_015132chr761656 1636 1621 436 327 216 1603 11299 --
NM_015156chr1463779 3597 3253 2722 2634 380 --13744 1407
NM_015162chr15----1566 --
NM_015192chr2062978 1040 1010 486 221 31 --32937 706 397 --
NM_015215chr173063 3006 1183 1174 1128 1018 687 ----11209
NM_015230chr43408 300 161 ----1340
NM_015263chr15--11117 --1916
NM_015267chr1211766 --12226 --
NM_015268chr3----1538 --
NM_015271chr434066 2802 1124 13651 11690 --
NM_015272chr1672091 1437 810 720 579 156 90 1358 ----
NM_015275chr1242169 756 544 386 --11482 1341
NM_015278chr643220 2140 1035 52 13389 11074 12474
NM_015310chr878384 8209 8135 6210 2449 2155 136 --26268 2384 22934 2531
NM_015315chr521048 145 ----13486
NM_015317chr272795 1761 971 690 430 260 167 22625 2014 --32806 1823 501
NM_015335chr1252372 1745 1615 534 362 --12150 11773
NM_015336chr1231663 980 763 22510 792 2743 689 --
NM_015338chr2041726 200 73 29 11641 ----
NM_015339chr201396 --1988 1856
NM_015375chr184996 3154 3086 1021 1015 1001 842 321 13251 25033 1849 --
NM_015396chr3------21286 486
NM_015423chr1141719 1663 1491 507 ----11577
NM_015424chr11----124 --
NM_015429chr32458 275 11128 --1100
NM_015435chr831462 1414 1018 1486 21184 434 --
NM_015441chr1----1120 --
NM_015443chr17--11125 --11266
NM_015455chr553794 2884 2629 979 459 --13979 --
NM_015548chr6--1637 1161 --
NM_015550chr733207 1390 583 13249 1426 11041
NM_015560chr33733 434 32 ------
NM_015576chr372213 2096 1150 933 856 565 553 1516 ----
NM_015578chr1941576 1476 654 256 ----1664
NM_015678chr1341508 1218 533 54 ----1488
NM_015681chr17----1124 --
NM_015686chrX22459 1536 --11940 --
NM_015695chr622058 1615 --11569 --
NM_015711chr19----1787 --
NM_015850chr81626 ----1656
NM_015878chr83866 791 634 ----2881 833
NM_015879chr18118496 7136 7104 6861 5862 5846 5825 5470 1887 581 446 --17376 22146 1770
NM_015886chr885772 5491 5020 4684 3779 348 233 54 ----1137
NM_015891chr62536 364 ----12037
NM_015904chr2------1139
NM_015971chr17------1435
NM_015984chr14528 189 180 142 ----167
NM_016009chr164334 3926 1351 873 835 154 21395 380 34863 1975 761 --
NM_016018chr842376 2317 352 263 ------
NM_016021chr642357 1953 414 64 2866 142 1893 --
NM_016023chr812164 --1702 12127
NM_016059chr61282 --1668 1882
NM_016078chr171808 ----11127
NM_016083chr643768 3267 2422 914 11159 13757 --
NM_016100chr201341 --1422 1408
NM_016107chr511033 --1880 --
NM_016120chrX----1969 --
NM_016131chr231618 775 201 12190 32205 2100 336 --
NM_016156chr1122293 2052 ----1889
NM_016205chr4--1440 --11281
NM_016206chr388569 7914 7663 6180 5603 2931 1286 721 3829 105 36 35787 5659 5512 --
NM_016224chr61462 ----11602
NM_016271chr183915 891 94 ----11438
NM_016299chr10------1103
NM_016304chr151303 ------
NM_016315chr221775 45 --11565 1483
NM_016320chr112967 183 ----21070 1027
NM_016322chr942394 1060 697 219 21272 747 --22209 659
NM_016374chr131165 345 303 --1484 11049
NM_016396chr1552950 2710 2327 1009 630 --21095 1063 --
NM_016441chr211640 22095 2062 ----
NM_016531chr463088 3011 3005 2923 1574 834 --14149 13475
NM_016545chr1------2906 840
NM_016577chr32356 291 ------
NM_016626chr1841610 1198 325 59 21327 1284 ----
NM_016628chr101722 ----1740
NM_017420chr14103640 3554 3501 3217 3062 2676 697 476 338 119 22611 632 --1147
NM_017423chr421881 102 --11850 12147
NM_017440chr123550 505 41 --1637 --
NM_017519chr6--11317 1203 11028
NM_017553chr153975 456 255 ----11269
NM_017610chr1551313 510 245 164 76 1621 11625 1441
NM_017633chr663560 2919 2828 1077 1045 182 ----43350 1026 972 660
NM_017634chr841949 1798 321 289 --21496 155 --
NM_017637chr998160 8104 8035 7411 6991 6549 3700 3604 2965 18528 39377 8373 6126 49369 9089 2720 929
NM_017641chr1221096 956 --11029 --
NM_017643chr1722981 878 --12856 --
NM_017644chr354984 1559 1443 356 297 --25144 394 --
NM_017645chr922403 607 --1723 12444
NM_017658chr1434497 848 683 23583 121 23544 995 151
NM_017741chr41941 11070 11865 12738
NM_017747chr5----2310 135 --
NM_017762chr1521900 730 --11990 --
NM_017769chr1443059 2704 2414 499 12136 12319 11087
NM_017770chr621848 876 --33001 2077 451 1895
NM_017801chr3------31634 656 365
NM_017813chr895103 4826 4102 3577 1808 1489 999 750 91 14698 25637 4047 13835
NM_017845chr41713 ----1198
NM_017943chr141679 1944 1841 1798
NM_018010chr321639 1547 ----169
NM_018015chrX1331 --1221 --
NM_018030chr181156 --1195 1718
NM_018036chr1454131 3806 3570 1481 1220 --34184 1244 661 --
NM_018061chr11525 --1323 11312
NM_018151chr25814 755 707 514 319 --1691 --
NM_018157chr1253186 2687 2098 1169 1155 1805 --1526
NM_018181chr1841904 1344 201 78 --11361 --
NM_018184chr341911 1623 532 313 1432 21792 544 --
NM_018200chr1532092 296 188 --22545 2107 --
NM_018224chr7------1275
NM_018247chr672787 1181 1023 607 410 362 31 22319 188 13037 2495 281
NM_018287chr103836 821 483 --11228 --
NM_018293chr322789 895 --1450 12281
NM_018310chr8------1591
NM_018317chr4197 ----176
NM_018360chrX----144 --
NM_018362chr1163637 3098 1554 1442 465 175 ------
NM_018364chr163892 3877 3693 1620 1516 449 23197 2810 14092 --
NM_018368chr6----1266 --
NM_018375chr1421783 1634 --11505 --
NM_018394chr31463 --31027 636 147 1504
NM_018448chr12----1431 --
NM_018490chr1131696 1590 1387 ----11614
NM_018557chr241598 1501 1267 671 ----3613 37 29
NM_018569chr461531 1514 1501 1198 1046 413 --165 --
NM_018638chr1245220 5206 2258 1446 45164 1184 674 239 12070 --
NM_018650chr11296 --1267 22185 443
NM_018682chr73555 502 50 ----1107
NM_018698chrX41930 1873 1807 517 --11901 --
NM_018704chr1----3712 561 117 22096 837
NM_018710chr8--11275 1112 11344
NM_018718chr742197 2025 688 274 11765 --11634
NM_018945chr623600 2316 12614 --1862
NM_018951chr7------21111 1053
NM_018976chr1252786 2452 2417 686 605 --11935 --
NM_018979chr12------1851
NM_019003chrX----144 --
NM_019030chr5----1164 --
NM_019035chr42125 35 ------
NM_019072chr563063 2889 1189 654 297 145 --1690 --
NM_019080chr133386 242 217 --1590 --
NM_019094chr12103773 3630 3587 3450 2820 2801 1511 723 675 134 --33040 2687 2343 23006 2765
NM_019593chr20122547 1093 1087 1050 1041 774 755 711 486 436 293 184 --1395 1681
NM_019842chr63410 160 26 ----2152 58
NM_019843chr223494 360 319 ----1347
NM_020066chr12888 168 --1120 --
NM_020116chr441571 643 624 513 --1678 11522
NM_020122chr265944 5551 5529 5127 4314 2170 24189 1081 2395 374 11231
NM_020159chr41473 --11217 --
NM_020177chr542938 1178 1062 660 12853 --11201
NM_020184chr212207 --12191 12357
NM_020193chr1111273 ----1983
NM_020309chr1911115 ------
NM_020337chr453087 2998 2683 1220 336 23096 818 43079 3011 2146 1005 --
NM_020338chr1013632 --13383 --
NM_020342chr222163 598 --1609 1497
NM_020346chr1121352 1122 --1540 11336
NM_020363chrY1602 --1205 11859
NM_020390chr3114564 4535 4198 4144 3819 3383 3077 2993 1553 1199 1063 2757 356 1185 --
NM_020443chr166803 6605 4710 4556 4548 1016 16275 25607 797 --
NM_020463chr211470 --1405 --
NM_020640chr32914 370 22174 333 1759 --
NM_020651chr231602 1177 397 --21401 322 --
NM_020718chr1656267 4417 4184 1595 376 14391 26438 1600 --
NM_020734chr1282969 2751 2703 2190 1308 1182 1116 378 11026 22672 638 1430
NM_020742chrX42061 2000 967 631 ----12729
NM_020752chr1052719 2637 2597 2517 376 12351 1564 --
NM_020760chr22611 504 --31744 1460 1405 1700
NM_020770chr111185 ----1336
NM_020772chr1778140 6453 6104 5316 1739 1310 592 37608 3047 3006 33195 1926 872 --
NM_020792chr342568 2229 1746 894 12580 12653 11836
NM_020794chr121385 375 1612 1122 11272
NM_020801chr532675 746 536 12081 12181 12295
NM_020809chr1121769 105 11942 22155 82 --
NM_020818chr14----1318 --
NM_020825chr1643654 3001 2890 1010 --1271 23842 3671
NM_020845chr1212503 ----21575 533
NM_020856chr194598 589 536 284 --2172 144 11466
NM_020870chr421751 345 12045 1211 --
NM_020873chr31660 --1782 --
NM_020921chr1453571 3463 2940 2880 495 ----1968
NM_020925chr1------11457
NM_020943chr2------194
NM_020981chr2------1654
NM_021005chr1531088 972 902 ----1261
NM_021038chr392823 2459 952 739 611 500 307 146 88 --42485 2299 1177 965 --
NM_021047chr19------1720
NM_021097chr232367 1129 1090 1616 162 --
NM_021101chr331845 863 302 --1759 12528
NM_021111chr921248 1093 11038 --11347
NM_021136chr14----2533 260 1744
NM_021140chrX2947 239 ----1984
NM_021145chr711149 1234 --11030
NM_021183chrX42275 1673 871 446 --1160 --
NM_021229chr1261099 901 510 493 276 128 1451 ----
NM_021813chr654044 2003 930 913 495 14596 15462 --
NM_021814chr631554 1092 361 ----11386
NM_021914chr1432200 1717 614 ----1766
NM_021943chr6------1220
NM_021961chr1154873 4525 1210 1167 33 24998 991 --16888
NM_021964chr3115143 4478 2406 2213 1845 1403 1165 861 721 656 384 --25724 107 16057
NM_021998chrX21195 258 ----11072
NM_021999chr132675 46 --1602 --
NM_022048chr1543928 2362 2332 798 1384 15858 15769
NM_022049chr131826 1400 515 --21652 363 1414
NM_022114chr144734 4253 4115 1412 11804 24394 677 --
NM_022130chr541444 1079 475 356 --11405 --
NM_022133chr841366 1215 379 324 ----2278 125
NM_022166chr1626300 4815 --12491 15888
NM_022374chr22122 99 ----190
NM_022461chr3----1406 21423 459
NM_022465chr1222997 1239 ----12508
NM_022473chr153730 339 138 24405 3292 ----
NM_022484chr731372 1215 1040 --1224 --
NM_022497chr313167 13198 --23438 3270
NM_022728chr7----1731 --
NM_022763chr353180 3127 2833 2584 803 --1642 11274
NM_022782chr12----150 --
NM_022826chr221025 147 ------
NM_022832chr412166 ------
NM_022843chr131559 ----11276
NM_022915chr21563 --1575 --
NM_023073chr541186 1165 1111 250 --1291 --
NM_024019chr411046 --1753 --
NM_024295chr8----11728 12033
NM_024336chr162289 79 ----2110 62
NM_024408chr132830 2624 704 --12900 13692
NM_024524chr332885 2850 1969 12506 --1525
NM_024574chr41141 166 ----
NM_024613chr8----11172 --
NM_024639chr642722 2365 1884 525 ------
NM_024646chr193862 3662 3454 3436 3183 3099 3028 2727 449 23768 773 11129 1423
NM_024665chr364190 3684 3665 1293 652 147 --22884 1521 1508
NM_024680chr11----1421 1202
NM_024713chr151628 --156 1326
NM_024715chr5--11727 --2239 149
NM_024721chr821643 1057 ----11039
NM_024745chr162843 198 --1449 1356
NM_024757chr9------1848
NM_024899chr182234 131 2590 223 --1201
NM_024911chr14846 832 826 558 ------
NM_024913chr731629 262 133 ----11256
NM_024944chr211367 --2413 48 --
NM_024947chr388595 8330 7579 6985 2880 2448 1314 160 13473 19219 13676
NM_024953chr1242783 2584 242 181 1345 --1120
NM_024989chr2117992 7940 7495 6574 6009 5173 5053 2687 2667 1030 272 35452 1244 1037 37915 7821 975 16254
NM_025009chr441854 1526 1319 193 1801 --1722
NM_025054chr853873 3823 3611 2985 890 23556 3245 1138 23096 1685
NM_025160chr143072 1095 781 721 13838 --23525 2675
NM_025191chr163498 3486 3430 3156 2926 2762 ----1670
NM_025222chr382989 1974 1146 1140 1114 446 383 29 13025 --12954
NM_030621chr1444076 1384 1145 836 ----2648 176
NM_030627chr574117 3711 3199 2581 1364 222 128 22893 2528 32795 2575 593 1908
NM_030629chr16------1667
NM_030647chr795908 5299 4807 4156 1713 1182 672 592 102 36289 5139 1457 --16307
NM_030648chr465024 3989 1728 1169 466 410 --15500 --
NM_030797chr2149 ------
NM_030939chr631104 1048 227 1418 1755 --
NM_030945chr542722 2462 2244 743 12392 12622 --
NM_031216chr1852163 1925 853 172 47 11464 --12270
NM_031365chr22963 544 --1867 149
NM_031412chr12----11224 --
NM_031418chr1122582 1990 22096 2008 22729 112 11098
NM_031442chrX62806 2555 2054 2037 788 357 22660 835 1731 --
NM_031453chr1042467 2168 1028 1000 12136 12539 --
NM_031461chr861754 1595 877 792 315 129 --12136 166
NM_031469chr613895 23926 2975 1170 23112 363
NM_031483chr2043426 2684 2400 2336 1531 13379 --
NM_031889chr421234 608 ----11918
NM_032102chr1133069 1902 592 --13000 1508
NM_032172chr71252 --1645 --
NM_032181chr21705 ----1724
NM_032199chr1063656 3600 3547 911 534 457 ----13207
NM_032217chr421140 545 21430 574 ----
NM_032228chr1163100 1338 1244 1181 591 305 12504 23285 70 --
NM_032246chr1521121 266 ----21028 985
NM_032291chr111257 ------
NM_032325chr1142023 1987 1979 372 --1100 12006
NM_032373chr1055004 4869 3783 1470 829 --35944 5838 213 23603 1061
NM_032408chr71254 ----1432
NM_032410chr821217 476 --1252 --
NM_032439chr1021178 428 1408 --1579
NM_032440chr1041150 301 221 168 --22210 1013 --
NM_032457chr473551 3109 2758 2522 1476 389 210 --13864 --
NM_032505chr322509 1041 1233 1747 11745
NM_032521chr2053214 2080 546 327 105 ----13248
NM_032560chr141888 ----1426
NM_032574chr2----1100 --
NM_032582chr1711613 11260 --11846
NM_032588chr1----1349 --
NM_032682chr343109 2795 2693 456 --13577 12446
NM_032765chr52885 365 --180 1322
NM_032804chr1031767 695 601 11663 1441 12425
NM_032833chr122656 935 --22546 271 --
NM_032859chr1341269 769 523 255 13787 1450 --
NM_032869chr841777 1740 1517 1335 --31793 1703 615 --
NM_032873chr1123307 1071 --24203 2932 11483
NM_032918chr1211311 ----21218 1206
NM_032968chrX64248 3503 3063 1499 627 40 --21669 1603 1655
NM_032973chrY64240 3499 3058 1499 627 40 --21663 1602 1655
NM_033055chr131023 1009 955 --1729 1127
NM_033211chr521612 245 ------
NM_033222chr921338 95 --1385 1345
NM_033224chr797727 6873 6204 6009 5225 2379 1747 1707 667 35273 857 416 12789 1253
NM_033285chr874126 3828 3774 3136 633 445 63 --1658 14260
NM_033626chrX----11841 --
NM_052832chr82861 462 22465 1189 21861 144 --
NM_052879chr1233792 1116 252 12741 21342 783 24036 2794
NM_052896chr122517 1605 1400 --12419
NM_052907chr1213885 14271 21376 747 --
NM_052910chr1361747 756 709 655 520 121 1466 ----
NM_052939chr11447 ----1375
NM_052961chr6----1375 --
NM_053042chr433161 2407 2387 23183 2175 ----
NM_053064chr1432444 456 137 1949 --1775
NM_080546chr971737 1499 123 117 109 95 87 --22284 449 1421
NM_080743chr6----2394 310 2782 403
NM_080794chr21----172 --
NM_080867chr1433839 3077 244 --24900 4576 --
NM_130773chr24888 880 716 289 2977 701 ----
NM_130847chr1165165 5086 4602 1416 1284 447 12074 35108 4591 869 --
NM_133265chrX73255 3173 3084 2820 1231 817 434 --1379 --
NM_133468chr772413 2047 790 680 644 196 129 --12203 3924 540 264
NM_133638chr53391 376 362 ------
NM_138391chr1187 ------
NM_138426chr732386 1698 549 1303 167 --
NM_138444chr1364270 4122 4049 3591 1977 1693 --24884 3626 13191
NM_138731chr1474079 3181 3041 2765 1586 1010 621 1534 24116 571 --
NM_138771chr731142 626 596 11182 11039 1279
NM_138779chr13------1192
NM_138782chr51579 --1753 --
NM_138959chr116755 --12189 36540 6131 5107
NM_139136chr122823 307 --1927 1834
NM_144571chr486946 6398 6221 5339 4777 2318 2055 156 12079 --25095 2287
NM_144599chr1564492 4244 1676 1234 1133 707 22219 1682 34815 778 467 --
NM_144642chr321438 424 ----31296 534 329
NM_144658chrX----1307 --
NM_144664chr1152513 1693 863 780 770 --1273 12245
NM_144778chr131109 --1976 22386 2280
NM_144973chr12--34647 3911 190 13690 15119
NM_145251chr1421616 548 ----11337
NM_145284chrX42558 2526 2404 970 ----12568
NM_145735chr1352788 2768 2734 2634 2623 11029 --12597
NM_145808chr772906 2849 2835 2639 2461 735 499 --11129 --
NM_152261chr1222370 2038 --1344 --
NM_152277chr5----32128 803 781 --
NM_152409chr552918 2577 830 371 182 11360 23263 2564 11429
NM_152462chr171231 ----2738 687
NM_152510chr22----1342 162
NM_152556chr732248 1700 296 12128 22234 2067 1104
NM_152594chr1552151 1733 1651 308 185 1264 --1494
NM_152622chr543049 2400 2315 128 --22383 70 --
NM_152624chr554733 1903 1577 1062 582 --12635 12897
NM_152727chr16----1264 --
NM_152739chr741071 793 384 292 --1826 1713
NM_152756chr574335 4297 3239 1245 1188 782 319 --44289 4214 4148 1375 23765 634
NM_152758chr842841 2698 2522 700 --11192 --
NM_152765chr841580 677 642 548 ----1557
NM_152774chr7112675 2655 2645 2209 1955 1056 756 730 683 316 286 22589 545 ----
NM_152787chrX53910 3636 3416 1086 774 33280 3258 1467 ----
NM_152854chr202735 273 ----1758
NM_152857chr6----1860 --
NM_153020chr611690 11196 11292 --
NM_153184chr321691 140 11826 --11315
NM_153207chr1242933 1172 303 215 11159 23817 2864 22840 1067
NM_153261chr16----11241 11482
NM_153262chr163169 3087 2463 2457 2418 2288 ----22787 980
NM_153267chr93869 732 184 ----1227
NM_153354chr51831 ------
NM_153456chr1365303 4880 4774 4116 3914 1043 2436 314 12542 --
NM_153607chr562639 745 448 154 143 80 1191 --1798
NM_153690chr31835 ----1853
NM_153812chr122322 1990 1898 --12295
NM_153836chr222156 1310 --31773 1422 623 1743
NM_170606chr731660 1625 1617 11541 11786 --
NM_170662chr3------1654
NM_170665chr1234215 3887 1164 --23925 414 1297
NM_172070chr292106 2004 1864 1807 833 503 404 308 171 11397 ----
NM_172071chr177267 6515 1836 1801 1097 72 54 --32147 415 406 12712
NM_173083chr111188 --11145 21293 324
NM_173469chr151155 ----11333
NM_173517chr71358 ----1341
NM_173576chr1041579 555 540 291 ----1227
NM_173602chr1232549 610 259 ----13693
NM_174909chr5------2705 170
NM_174916chr1522418 2335 --22381 2160 --
NM_175736chr1247790 6918 5428 5422 --17775 16187
NM_175921chr573836 3424 3257 2673 2634 2616 649 ----1115
NM_176814chr71444 ----11244
NM_178523chr19159 ------
NM_178539chr1232026 650 191 154 11322 11758
NM_178826chr124599 581 298 107 --1732 --
NM_181291chr14------1681
NM_181354chr841455 1399 1262 226 ------
NM_181782chr652155 737 580 369 140 --21764 766 --
NM_181784chr232468 2449 542 ------
NM_182485chr4113400 3180 3016 1439 881 768 755 739 473 300 46 1843 --22966 1330
NM_182527chr2232196 2188 519 --11901 12240
NM_182529chr7------188
NM_182559chr12------1286
NM_182700chr741990 1675 1375 344 ----11952
NM_182765chr1041871 1851 744 167 --31990 1759 793 --
NM_182944chr14----1395 --
NM_182975chr1--1154 11121 1821
NM_194247chr264413 3059 2970 1677 1354 1213 ------
NM_194279chr14------1349
NM_194285chr1143424 3394 676 125 1157 ----
NM_194314chr165616 5378 5157 3516 2053 190 15563 ----
NM_194317chr262650 2441 2307 2114 1070 373 --32273 316 66 12429
NM_198256chr22528 449 --1460 1414
NM_198273chr552978 2406 1218 799 286 --23053 2304 --
NM_198281chr412111 --22838 338 131
NM_198465chrX2512 43 12446 12735 1175
NM_198468chr644603 3835 3533 1731 13650 23904 89 1155
NM_198485chr321757 1050 ----12084
NM_198503chr131927 1797 1787 1767 11590 --
NM_198513chr83616 459 253 --11881 --
NM_198581chr2137530 7494 6916 6689 6371 6361 5976 5526 5417 1451 783 684 609 17002 14808 --
NM_198859chr364183 3728 3548 2000 938 507 --13758 14959
NM_198904chr521684 581 21742 856 12018 1737
NM_199000chr732113 1493 711 --1900 --
NM_199131chr1011185 --1190 22694 1469
NM_199320chr442352 1919 1877 945 ----12765
NM_199461chr1033165 2797 305 --21460 779 --
NM_203390chr81754 11451 31745 1172 390 1652
NM_203406chr552683 2583 1816 1790 942 --1548 --
NM_206853chr663777 2907 2702 1633 580 207 --13070 11319
NM_206854chr6135038 4168 3963 3710 3270 1841 1468 1081 718 554 326 147 129 --14331 1399
NM_207303chr1064093 2975 1504 1366 269 23 --21493 1335 --
NM_213589chr2114172 3829 3481 1373 1163 700 419 211 187 179 152 35180 4024 301 11742 35310 3940 681
NM_214711chr483723 3717 3705 3689 3399 3300 3049 2768 --23728 3314 --