TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-491-5p
miRNA Sequence: AGUGGGGAACCCUUCCAUGAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr8122487 2240 2079 1968 1770 1706 1607 906 673 553 536 431 32459 2250 71 --22348 1826
NM_000037chr8122487 2240 2079 1968 1770 1706 1607 906 673 553 536 431 32459 2250 71 --22348 1826
NM_000055chr3------1138
NM_000061chrX1107 ----141
NM_000088chr1771267 1246 493 421 407 398 32 11191 21130 869 1374
NM_000188chr104645 254 63 32 --2697 209 --
NM_000217chr1294940 4178 3790 3662 3601 3406 2032 318 32 --11961 --
NM_000278chr10112206 1804 1716 926 824 770 315 240 129 70 59 2149 50 21893 257 --
NM_000278chr10112206 1804 1716 926 824 770 315 240 129 70 59 2149 50 21893 257 --
NM_000298chr15652 94 70 56 43 --3687 192 132 1703
NM_000314chr1043273 2051 915 567 ----12452
NM_000345chr41162 1734 1305 --
NM_000346chr1721226 706 --11338 --
NM_000378chr11----3917 84 74 --
NM_000425chrX4716 608 553 61 1213 2447 139 --
NM_000430chr1763619 3487 3034 2704 788 70 --33434 3042 841 --
NM_000459chr9------1822
NM_000489chrX53304 2918 2905 1026 427 1284 --12257
NM_000503chr831470 1304 349 1615 11388 --
NM_000530chr17921 410 362 341 299 283 207 ----1825
NM_000555chrX137656 7567 6574 5821 4768 3087 2691 2576 2502 2165 1621 504 497 27598 2285 36980 6670 713 12781
NM_000610chr1152203 2118 1930 358 339 --2820 250 1748
NM_000612chr11173703 3641 3633 3617 3536 3176 2946 2745 2702 2532 2460 843 817 273 151 144 136 2375 332 2695 501 2878 285
NM_000615chr1131847 929 836 11169 22871 585 --
NM_000663chr164908 734 690 500 --22824 2389 --
NM_000719chr12246522 6471 6193 6023 5900 5781 5531 5267 5240 4703 4483 4460 4428 4337 4297 2508 2349 2114 2035 840 791 409 320 74 46451 6441 1389 335 45110 4449 2361 2243 26433 1856
NM_000721chr192332 2122 2085 1982 1741 1722 717 663 442 --1314 --
NM_000725chr1261007 942 358 286 206 185 2993 270 2643 333 --
NM_000759chr177808 789 774 761 627 330 235 --1299 --
NM_000767chr1971412 1406 1399 1138 1004 342 303 --21566 52 182
NM_000817chr221251 443 --1460 --
NM_000828chrX11489 --21368 729 --
NM_000836chr1910994 868 793 769 692 679 367 327 321 121 1349 4940 924 743 657 --
NM_000872chr1031085 489 312 --21079 558 --
NM_000924chr1291354 1299 1154 1135 867 427 370 321 80 --2978 170 --
NM_001001433chr2082829 2456 2389 980 864 699 155 71 --2853 547 --
NM_001001890chr2194088 3915 2901 2847 2718 1494 1419 759 30 ----1748
NM_001002296chr85933 459 203 83 22 --173 --
NM_001003398chr12199 --2110 89 1482
NM_001003652chr18158497 8041 7645 7499 6919 6846 6361 6327 5975 3456 2822 2228 760 748 74 16623 21675 449 --
NM_001003694chr32591 578 1253 1561 --
NM_001004419chr12104404 4317 4304 4071 4041 3598 3585 1621 1332 274 11786 34358 1802 1536 --
NM_001005271chr1781081 1038 859 739 343 304 87 40 2280 187 3199 180 96 --
NM_001005404chr1794267 3375 1340 1241 1223 1146 724 131 62 --11762 --
NM_001005505chr391661 645 538 500 385 233 104 31 25 31127 593 72 31592 80 58 --
NM_001006115chr3122781 2463 2387 2345 2135 918 834 723 627 417 394 209 --22659 37 11935
NM_001006641chr941618 1197 532 464 ------
NM_001007026chr124537 391 67 56 ----2529 444
NM_001007156chr1571688 1644 1271 739 667 393 172 --41886 1726 1701 1476 --
NM_001008220chr5183669 3655 3630 3237 2569 2542 1066 927 919 865 738 714 602 594 338 235 196 28 33450 295 160 4981 887 708 315 33789 2882 2520
NM_001008564chr1342220 1980 898 614 --1124 --
NM_001008660chr1121443 447 ----1456
NM_001008701chr19112947 2910 2854 2700 2505 1079 850 766 408 326 113 2640 139 62940 2869 2054 1087 892 203 1723
NM_001009813chr193394 130 94 150 ----
NM_001010854chr14121 --1545 --
NM_001010861chr161775 1037 858 821 208 156 ------
NM_001010971chr13318 299 217 ----1269
NM_001011713chr1411498 --11006 --
NM_001012267chr981925 1832 1632 1255 524 466 299 272 1315 --11458
NM_001012393chr11114091 3914 3475 3218 1724 1227 1017 486 309 297 40 24610 372 1961 24341 986
NM_001012426chr6243242 3183 3141 3025 2910 2511 2466 2115 1363 1116 1085 1061 975 967 745 720 685 679 549 508 436 315 249 61 2861 77 53293 2450 1180 496 185 32999 329 262
NM_001012755chrX184619 4577 4440 4393 4356 3404 3378 3230 3157 1712 1378 1266 1144 1009 988 939 774 138 34766 3494 2045 --1217
NM_001012977chrX81143 512 432 222 212 182 85 68 --1162 --
NM_001013693chr1112647 2641 2445 2250 2195 2158 1953 1879 1859 649 239 2626 122 22455 1975 11810
NM_001014342chr111442 11130 --11729
NM_001014809chr41308 2627 198 2765 759 --
NM_001014839chr17888 857 842 823 201 109 96 --1243 --
NM_001017395chr323448 420 12251 23143 28 13357
NM_001017523chr1251921 1758 1745 1649 132 ------
NM_001017995chr5164385 4306 4209 3915 3136 3055 1935 1830 1699 1665 1625 1221 698 649 558 318 34091 1153 929 43379 1675 761 87 14661
NM_001018108chr15102157 1930 1759 914 866 701 599 589 217 60 22188 1874 51903 1510 908 512 339 --
NM_001024226chr15911 844 797 752 467 ------
NM_001024401chr16112658 2551 2184 2113 1799 1096 1081 863 708 432 152 22524 1774 42634 1087 780 477 --
NM_001024460chr621165 269 1402 --11022
NM_001024807chr19----3349 320 221 --
NM_001024937chr1711775 719 638 610 569 548 291 253 220 202 186 128 1645 --
NM_001024948chr132855 2392 413 12223 ----
NM_001025076chr10115494 5217 5124 4423 4017 3925 3837 2012 1375 1331 1187 1151 24763 2259 24344 2415
NM_001025205chr34379 343 72 30 146 2393 298 --
NM_001029858chr693213 3184 2949 2846 2830 2601 2366 489 404 ----12999
NM_001029998chr441409 1318 1188 1129 --1578 --
NM_001030006chr1782335 2294 1829 1042 859 803 263 215 31799 1731 1653 22523 2168 --
NM_001030007chr16103795 3732 3692 3088 2952 2751 1286 808 190 32 32839 2668 269 3894 445 259 --
NM_001031679chr1253481 3284 2527 2497 1188 ----22734 1252
NM_001031689chr9------153
NM_001031690chr7103049 2839 2762 2341 2258 2071 1180 436 416 34 22853 1159 52928 2831 2063 1989 475 12089
NM_001031738chr22449 42 248 33 2207 119 --
NM_001032288chr2071286 1244 1235 619 580 401 284 --1570 --
NM_001032293chr171495 ----1122
NM_001033059chr63459 380 338 ----1361
NM_001033081chr13616 540 244 ----1724
NM_001033117chr3154703 4501 4283 4106 3699 3473 3465 1710 937 674 666 546 260 188 83 --44764 1604 1595 783 14334
NM_001033507chr131740 1569 615 21891 626 1315 --
NM_001033677chr123351 155 71 1319 ----
NM_001034837chr5----1705 1266
NM_001034954chr1082397 2377 2360 2063 778 541 496 275 1518 ----
NM_001038493chr291392 1268 1216 624 607 461 320 210 116 --141 --
NM_001039141chr22102470 2382 2274 2251 960 817 806 564 539 410 22436 626 32243 795 92 --
NM_001039459chr72227 208 1452 ----
NM_001039570chr22114006 3981 3802 3789 3606 3533 3399 1737 1207 643 576 24000 3016 44389 4117 3348 3335 14440
NM_001039577chr1144490 4218 4158 4125 3725 3394 1759 1303 929 877 863 779 738 715 22776 834 53766 3528 3388 2758 80 12788
NM_001039577chr1144490 4218 4158 4125 3725 3394 1759 1303 929 877 863 779 738 715 22776 834 53766 3528 3388 2758 80 12788
NM_001039577chr1144490 4218 4158 4125 3725 3394 1759 1303 929 877 863 779 738 715 22776 834 53766 3528 3388 2758 80 12788
NM_001039590chrX63454 3222 3127 2647 1286 1070 13621 ----
NM_001039771chr144833 326 178 112 2863 390 1938 --
NM_001039888chr11694 1756 2797 652 --
NM_001040057chr7----1986 1547
NM_001040110chr731848 1386 1313 --21533 1477 --
NM_001040142chr2--22020 83 1985 --
NM_001040152chr795047 5038 3133 1107 772 651 477 458 335 3944 618 242 --264 43
NM_001040273chr1051890 369 173 41 22 --1314 --
NM_001040402chr422809 868 12598 1241 --
NM_001040712chr932739 1152 1122 --1432 --
NM_001042404chr121334 752 --11609 1505
NM_001042437chr23880 681 77 --1156 --
NM_001042486chr2061431 1240 1139 608 585 417 31569 1234 1145 31563 1125 428 --
NM_001042506chrX81115 512 432 222 212 182 85 68 --1162 --
NM_001042533chr31980 --12808 1501
NM_001042601chr342448 2324 2009 698 --1409 --
NM_001043318chr1483772 3453 1425 1415 891 743 282 33 23416 784 33357 1274 21 23716 3258
NM_001080418chr17583 548 468 446 229 174 107 --144 1605
NM_001095chr12141858 1841 1726 1672 1476 1353 1322 1215 776 664 545 505 468 369 1670 21522 709 299 77
NM_001116chr1692346 2167 972 934 783 596 386 209 100 12763 52194 2147 1034 799 379 --
NM_001119chr471499 1196 394 330 183 129 57 11382 --1244
NM_001121chr1021251 299 --1567 --
NM_001148chr432128 324 117 ----11816
NM_001191chr2091409 1154 1133 1047 447 382 297 49 32 21415 193 3948 575 489 1457
NM_001222chr1011783 --21458 401 11264
NM_001241chr2------1284
NM_001271chr1573069 2794 1279 368 308 242 213 --32880 2391 740 1686
NM_001273chr12294 25 --148 --
NM_001364chr11124718 4302 3782 3760 3712 3320 3071 2938 1921 1666 606 393 --64488 4178 3195 1551 923 297 14038
NM_001396chr2152647 1791 422 386 243 ------
NM_001400chr13484 457 320 1451 1337 --
NM_001402chr621664 28 1435 11908 --
NM_001408chr1141309 1231 1111 1104 413 405 394 363 246 214 202 170 91 45 11673 31290 299 98 --
NM_001417chr1241962 1784 501 302 --21220 39 --
NM_001419chr19104125 3707 3628 3616 3592 3580 3056 1885 1686 1455 31869 802 184 --1352
NM_001420chr19162933 2726 2670 2460 1157 1128 459 411 334 328 230 211 130 110 33 23 11107 12373 22834 2712
NM_001427chr722073 677 12080 31542 839 695 --
NM_001429chr223923 916 408 --1418 --
NM_001455chr683730 3582 3495 3254 3150 1461 829 139 --23446 910 --
NM_001493chrX6679 308 293 234 89 79 --1739 --
NM_001527chr633302 1849 1754 --44747 3983 3906 204 --
NM_001616chr293524 3461 2555 2537 1374 867 850 834 271 --33514 2979 1125 13452
NM_001627chr342365 2310 2287 833 ----11908
NM_001635chr73299 276 206 --1197 --
NM_001642chr115904 898 861 289 57 ------
NM_001677chr1--11032 123 --
NM_001678chr17141764 1743 1680 1628 1349 1275 1233 1207 1196 574 568 371 77 21 21674 129 1194 --
NM_001706chr32193 29 --1828 --
NM_001709chr1162667 2386 1975 1903 1842 783 1756 --1603
NM_001759chr12134857 4510 4120 4095 4027 3795 3717 3524 3437 1247 1186 1171 117 12058 11421 --
NM_001760chr63824 324 244 1695 --1153
NM_001810chr206773 713 683 635 555 183 --1227 --
NM_001924chr1------185
NM_001927chr24559 513 489 154 1113 4684 132 48 36 --
NM_001978chr871062 885 655 287 148 113 59 2814 180 1870 --
NM_002006chr445189 1680 1129 729 --15488 --
NM_002009chr1521807 773 ----1873
NM_002025chrX148787 8768 7965 7807 7390 5694 3406 2263 1893 1729 1432 1078 654 80 67716 6647 6017 3528 2224 477 36503 3657 765 1283
NM_002040chr2142270 2106 2071 299 ----1213
NM_002045chr3178 --3129 61 30 --
NM_002094chr16------1107
NM_002103chr198999 933 841 820 263 143 122 83 2973 112 123 --
NM_002126chr1773806 3782 3286 2800 1014 865 344 1997 33499 1083 793 --
NM_002128chr1321012 912 ----1884
NM_002147chr172948 700 1659 2362 72 1105
NM_002196chr206994 233 203 118 112 77 1172 1857 --
NM_002205chr1281017 946 846 771 402 187 122 47 ------
NM_002207chr34729 698 107 88 ------
NM_002267chr131292 1453 --129
NM_002270chr555516 4211 3442 243 145 --11382 1495
NM_002293chr172416 2074 1705 933 644 379 97 11739 ----
NM_002319chr78887 771 419 202 146 74 64 24 1817 2245 212 --
NM_002355chr1231193 572 31 11376 1880 1913
NM_002356chr6------1185
NM_002373chr15101335 1288 1280 979 549 505 498 490 358 22 --21314 167 --
NM_002382chr1471086 1054 1041 412 336 235 41 --1185 --
NM_002384chr1811002 ----1215
NM_002397chr511972 ----11541
NM_002398chr261189 433 228 192 164 135 1261 11055 --
NM_002399chr1541076 227 140 122 2264 134 21335 192 --
NM_002399chr1541076 227 140 122 2264 134 21335 192 --
NM_002401chr1772114 1993 1973 1903 1884 1846 290 21728 461 1882 --
NM_002430chr2272114 1939 1823 1720 1594 655 78 12310 22203 308 --
NM_002442chr12101598 1357 1344 1331 1169 559 344 224 194 147 21143 1106 21128 230 11731
NM_002473chr2261269 513 441 277 140 60 3488 402 69 21068 85 --
NM_002487chr152525 38 ------
NM_002499chr1541996 1656 1645 1639 12051 --1459
NM_002501chr19304130 4064 3938 3715 3658 3642 3534 3424 3376 3252 3228 3155 3050 3014 2974 2517 1233 1218 978 940 758 666 657 468 447 441 399 367 205 139 63693 3563 3387 3365 3064 476 11226 --
NM_002515chr1461628 1375 1363 702 608 47 --1800 --
NM_002524chr12848 134 --2911 197 --
NM_002581chr9135570 5328 4723 4027 3685 2271 1816 1537 1085 600 435 209 31 14332 1963 22156 99
NM_002587chr52389 78 1458 2430 152 --
NM_002588chr581705 1421 1398 1365 1325 647 222 41 --2592 365 --
NM_002595chr1211678 --2721 415 --
NM_002646chr162156 1883 1859 1809 1683 500 --32150 1379 801 --
NM_002651chr13652 89 48 1914 2636 561 1587
NM_002655chr823915 1339 1959 --11494
NM_002698chr19142805 2759 2717 2608 2381 1934 1199 644 396 225 208 193 167 113 --21036 997 --
NM_002699chr181142 518 417 386 347 297 279 21 --2956 431 --
NM_002730chr1991241 1232 1168 1114 424 402 390 228 124 --11270 1251
NM_002731chr132347 2190 918 --12963 --
NM_002745chr22114198 4173 4110 4012 2848 1763 1146 507 390 87 61 1916 11325 --
NM_002809chr17----183 2375 92
NM_002824chr126352 314 184 178 161 138 1446 ----
NM_002827chr20101330 1152 1145 1106 529 420 309 159 27 21 11397 21718 390 --
NM_002834chr1282995 2497 1604 1591 400 220 204 56 --13999 --
NM_002855chr11203437 3122 3081 3006 2685 2640 1410 1303 971 961 852 711 655 581 574 354 269 81 74 40 42691 2276 1211 363 1212 43317 2287 435 53
NM_002859chr12141820 1715 1558 1524 1339 1222 639 336 269 246 237 221 46 33 1316 21659 291 --
NM_002868chr12102314 2181 2162 1994 1956 749 421 320 208 87 22188 2014 31499 334 66 --
NM_002869chr1151776 1707 454 417 411 --11783 --
NM_002886chr375153 4603 1132 1120 609 271 162 --11094 --
NM_002906chr1142046 1953 777 89 ------
NM_002959chr194321 4150 3104 1592 897 560 503 339 91 1947 34175 4093 3063 2681 550
NM_003026chr961081 469 427 384 328 124 1157 ----
NM_003028chr9123692 3386 3332 3158 3072 2390 486 423 365 227 221 64 11498 33590 3455 1069 23210 410
NM_003029chr15418 279 241 198 58 ----1943
NM_003042chr361708 1612 606 542 254 243 --21716 648 11517
NM_003047chr1101349 1065 981 960 383 328 259 207 143 114 2989 35 1191 --
NM_003076chr1281408 1358 1335 1068 576 555 401 222 41173 1052 485 213 21325 190 11527
NM_003131chr681927 1898 1420 879 843 324 216 180 --11919 31972 510 333
NM_003137chr632096 907 280 1853 12003 1179
NM_003139chr113805 152 146 --1680 140
NM_003155chr882428 2010 2002 1802 1137 324 228 27 12088 32330 2096 193 11935
NM_003156chr1171226 1150 996 467 392 383 294 --21159 249 --
NM_003161chr1733161 2396 1159 --12445 --
NM_003165chr971596 1305 1281 694 405 198 133 3774 139 41 41509 600 158 35 --
NM_003173chrX81208 1098 479 229 202 119 109 61 11269 11050 --
NM_003179chrX71421 1385 1376 1236 1107 388 180 11229 41126 911 91 70 --
NM_003202chr56592 585 517 107 56 25 2162 151 31201 609 118 165
NM_003205chr1532192 1688 55 --1304 --
NM_003214chr641271 1200 519 338 --31235 1023 137 151
NM_003221chr6103867 3232 2881 2856 2679 2654 1592 1214 648 484 13446 53765 3470 3385 609 467 1529
NM_003286chr2031110 786 72 ----11100
NM_003339chr52609 362 --1629 --
NM_003344chr711583 ----1208
NM_003370chr194746 556 494 206 1287 2126 119 --
NM_003410chrX12433 22296 1231 12003 1403
NM_003412chr342068 1973 1098 1085 32174 113 102 22714 610 --
NM_003459chr25717 653 295 141 24 ------
NM_003482chr12172653 2495 2414 2402 2040 1997 1112 990 927 759 738 728 498 492 486 381 37 42047 666 455 365 1203 --
NM_003507chr232024 1637 1453 --127 --
NM_003590chr253147 1567 656 446 344 22551 1486 11503 --
NM_003607chr1103777 3274 2817 2785 1710 1149 1106 750 275 76 --24332 3691 23954 1293
NM_003615chr3----33702 2571 807 --
NM_003633chr542355 2167 552 370 22233 435 21760 1028 --
NM_003635chr102429 43 1202 --1162
NM_003637chr181535 1336 1218 1189 973 298 221 115 2437 364 1431 --
NM_003679chr133263 2252 761 --22417 533 1206
NM_003682chr113875 754 61 1826 1198 --
NM_003704chr41259 ----1450
NM_003741chr33334 137 131 ------
NM_003743chr232010 1602 1450 1564 21836 479 --
NM_003768chr171546 643 616 602 466 319 58 21522 329 1247 --
NM_003822chr142278 1172 1101 578 12557 22646 350 --
NM_003872chr222691 2367 22744 585 11027 --
NM_003901chr10102702 2304 1943 1898 1872 1715 891 738 567 422 --21841 978 --
NM_003934chr9------11309
NM_003936chr27764 758 473 271 264 239 30 --2991 777 --
NM_003939chr1083992 3281 2553 1531 1196 669 656 314 33432 3051 1397 12659 1906
NM_003947chr34417 315 243 65 1947 1168 1491
NM_003988chr10112283 1881 1793 1444 901 847 392 317 206 147 136 2226 127 21970 334 --
NM_004050chr1492556 2470 2372 2201 2071 2032 2006 875 536 11016 12563 --
NM_004055chr1172060 726 655 620 442 409 355 --82158 1447 556 418 235 104 55 35 --
NM_004080chr741198 290 276 256 --21487 1189 --
NM_004090chr1772725 2375 2269 2179 853 371 210 11261 32944 455 160 3627 581 483
NM_004093chr134548 535 260 31 2554 420 ----
NM_004161chr211161 11072 --1121
NM_004171chr11179098 9088 9038 8732 7773 7744 6611 6430 6295 6184 6132 3326 2332 1172 419 331 38 18859 29349 6263 29335 1007
NM_004187chrX51097 1041 412 367 242 ----21343 595
NM_004200chr11223018 2350 2341 2306 2294 2235 2151 2122 2106 1223 1185 1098 1083 1056 1028 983 836 462 389 342 178 56 32945 2752 186 62904 2588 2219 2068 1210 45 1995
NM_004263chr221413 199 1737 3728 505 467 --
NM_004274chr1463049 2935 2784 2761 410 304 ----1180
NM_004293chr942866 2796 2677 2451 --32990 2909 2439 13468
NM_004311chr1092911 2894 2839 2833 2694 2336 1017 850 671 --42750 900 606 152 --
NM_004349chr851316 1114 1041 65 59 ------
NM_004370chr641342 814 807 521 --1679 --
NM_004393chr342115 2053 1866 1802 11833 2948 793 --
NM_004430chr881001 946 903 637 384 222 157 112 --31073 625 23 --
NM_004440chr621898 1776 --11789 11728
NM_004441chr33819 524 164 1455 1391 --
NM_004443chr35534 265 232 166 147 2742 289 1528 1281
NM_004474chr161034 408 343 143 101 39 --1959 --
NM_004475chr1761181 480 401 354 281 202 168 11096 --
NM_004480chr141634 ----1288
NM_004494chr171175 986 957 452 346 325 28 --3974 137 101 2820 207
NM_004504chr233021 2829 2007 --32890 2762 58 11989
NM_004535chr2031727 285 163 21217 64 1705 --
NM_004575chr421474 254 --11021 11011
NM_004586chrX44455 4164 4056 3379 24358 1477 21366 674 --
NM_004612chr994881 4702 4343 3935 1698 1470 217 150 83 ----24554 4204
NM_004615chrX4753 272 174 158 1137 ----
NM_004630chr1151061 814 798 285 70 --2312 262 --
NM_004710chr175835 791 684 279 61 ------
NM_004745chr8166953 6674 6095 6036 5910 4827 4638 4283 2426 2401 1946 1688 1585 641 610 412 24259 1541 45729 726 627 125 22201 1682
NM_004774chr1722100 1158 22872 2236 --12326
NM_004776chr2082986 2382 2375 2361 1032 938 871 312 2466 289 22443 276 22069 378
NM_004779chr53883 225 75 11051 1219 1533
NM_004815chr194552 4540 3992 3693 3510 1979 1491 313 199 --24108 286 14890
NM_004822chr17173704 3679 3260 3186 3072 2895 2882 2509 2499 1416 1370 1254 531 271 180 174 105 43986 2667 1577 1290 2665 553 21539 1450
NM_004834chr233406 2747 2531 --1181 12895
NM_004841chr121125 55 1197 --2885 841
NM_004850chr221193 1133 --1523 --
NM_004852chr182514252 13276 12642 12476 12175 11200 11185 10963 10924 10555 9423 9306 9163 4209 3885 3745 3590 3422 3399 3374 3206 3091 1495 1106 357 313130 12837 5610 512325 10880 9405 9329 4887 13455
NM_004859chr1742498 2192 1156 530 --21943 612 --
NM_004860chr173389 202 30 163 1236 --
NM_004884chr1551639 1469 624 403 107 21608 517 1662 1577
NM_004922chr103793 774 761 1742 1969 --
NM_004935chr7------1194
NM_004947chr372097 2088 1796 928 691 673 85 1748 22592 2003 --
NM_004952chr14906 390 167 72 1743 1725 --
NM_004961chrX71515 305 174 128 122 42 34 --11167 --
NM_004978chr161286 1274 1220 1195 410 361 11226 3653 225 183 --
NM_004992chrX228505 7888 7798 7742 7692 7363 6672 6177 5183 3099 3082 2964 2816 2570 1790 1695 1399 1353 551 451 442 346 35532 2648 578 67785 6538 6010 1539 1155 1003 15284
NM_005022chr171167 ----260 35
NM_005027chr1981176 979 288 251 227 175 169 104 1257 ----
NM_005045chr72722 52 1710 --1157
NM_005073chr131598 1582 1824 --
NM_005095chr122049 897 2595 144 11793 --
NM_005168chr251523 1377 1197 1120 434 --1369 --
NM_005207chr2223413 1331 --12748 13530
NM_005229chrX61232 944 810 358 339 56 1173 21213 347 --
NM_005238chr1142871 2807 1211 722 12895 12964 --
NM_005271chr103980 445 299 --21122 24 --
NM_005276chr12101750 1725 1662 1497 1258 708 607 255 237 85 ------
NM_005297chr222851 322 --2881 733 --
NM_005342chrX62853 2694 2657 2180 939 910 --1270 --
NM_005413chr25391 374 168 108 44 ------
NM_005430chr125931 855 669 168 144 --2805 117 --
NM_005438chr114432 249 117 62 2582 92 ----
NM_005439chr125401 391 125 89 83 --1174 1500
NM_005458chr952427 1802 1671 1624 865 1629 31707 952 466 --
NM_005529chr15924 752 738 298 287 2404 163 21070 774 --
NM_005539chr1041366 1056 366 182 2174 134 ----
NM_005587chr151376 2345 53 ----
NM_005596chr976123 6052 5901 4961 4477 4139 4026 --22531 2204 1852
NM_005678chr154861 765 741 720 ------
NM_005700chr11------1361
NM_005704chr131011 766 233 --21032 405 --
NM_005715chr642062 775 654 270 1276 --1124
NM_005730chr12153361 3216 3099 2960 2612 2513 2317 1426 1358 898 656 508 425 327 97 --53500 2596 2374 920 686 149
NM_005737chr282810 2719 2658 1838 467 424 418 233 --1386 --
NM_005748chr1253441 3362 3174 2439 1104 --13145 --
NM_005768chr124663 624 522 251 --1546 --
NM_005789chr1772167 1897 1804 1474 536 520 210 2490 220 31922 1579 1422 2712 444
NM_005796chr162331 50 --163 --
NM_005811chr125398 119 90 63 37 129 ----
NM_005853chr16------1169
NM_005866chr92669 580 1335 2355 344 --
NM_005880chr1611008 1346 --11593
NM_005883chr19192945 2870 2803 2793 2548 2476 2455 2422 2390 2384 2377 1141 966 800 613 170 143 125 63 22047 90 22220 1969 --
NM_005898chr1151976 1230 1193 419 304 --1254 --
NM_005911chr251224 580 547 193 22 1927 1346 --
NM_005920chr1163666 3604 3198 3148 3076 2615 1502 1261 1240 1191 1155 1124 837 389 241 97 13673 63598 3511 3287 2734 2515 874 13159
NM_005933chr11103037 2953 2410 1970 759 518 462 381 365 273 --22709 507 22916 345
NM_005955chr195113 4362 4353 2180 2038 1935 1929 1592 908 --1119 14247
NM_005967chr126525 458 216 74 68 60 2566 282 1126 --
NM_006015chr13356 236 191 --1214 1900
NM_006037chr274367 4138 3337 3282 1467 1023 89 31416 442 210 11600 13005
NM_006040chr1671305 1246 1215 1079 979 575 456 1552 1186 --
NM_006080chr712142 --12806 11921
NM_006091chr1591565 1553 1278 672 608 520 483 191 127 21723 1687 51753 1674 1410 637 571 --
NM_006106chr1111171 ----13276
NM_006133chr1192362 2240 2230 2165 2015 1558 909 885 577 32326 2171 206 2783 158 11659
NM_006136chr71370 11187 21176 471 --
NM_006191chr126951 620 334 204 140 128 --287 50 --
NM_006197chr8----31768 249 142 --
NM_006201chrX101101 1060 894 868 812 750 450 340 311 156 2288 55 ----
NM_006206chr452822 2449 2359 916 123 ----12741
NM_006235chr1131683 195 177 ----1686
NM_006241chr3----12394 1623
NM_006243chr11662 1828 --1773
NM_006245chr65764 669 353 267 180 --2278 79 21023 976
NM_006255chr143240 82 56 --1769 --
NM_006282chr2054651 4126 3428 1899 32 21420 929 44326 1230 755 404 1107
NM_006321chr341660 1632 1525 115 12124 ----
NM_006328chr114591 576 257 139 --1584 --
NM_006380chr1763643 3282 2909 1696 1633 145 --14188 --
NM_006389chr1191285 1274 1267 950 900 415 225 218 45 --5549 542 239 32 22 --
NM_006421chr821209 283 --1798 --
NM_006458chr113384 155 149 1392 3347 285 264 --
NM_006494chr193679 642 40 132 1649 1130
NM_006521chrX91349 1255 1077 917 283 194 142 80 68 --41294 1225 512 33 --
NM_006546chr17226247 6226 5913 5906 5780 5614 5551 5539 4526 4354 4126 2647 2493 1692 1236 1021 875 600 427 286 278 67 45799 5070 4316 4278 55516 5107 2187 769 750 --
NM_006558chr81318 --137 --
NM_006593chr23756 67 25 156 1747 183
NM_006599chr1697479 6261 5732 5503 5143 2562 2506 1769 1763 16304 37418 7186 1045 11234
NM_006621chr151420 1345 1324 610 604 --1212 --
NM_006624chr1041551 1389 578 96 ------
NM_006690chr20122054 2013 1989 1451 955 931 894 578 473 467 404 347 --42073 1911 245 54 --
NM_006691chr113934 459 270 --1232 --
NM_006699chr132166 557 456 --1579 --
NM_006717chr943066 2290 485 311 --12280 11166
NM_006742chr16132011 1792 1764 1724 1462 1412 1350 810 787 715 565 458 339 21499 427 31592 1438 164 --
NM_006761chr173730 716 630 --272 49 --
NM_006772chr6151714 1685 1564 1438 1422 1223 1086 445 437 352 346 206 147 108 46 11329 61702 1654 1584 1410 593 301 1680
NM_006802chr151153 981 943 780 46 --2376 291 --
NM_006805chr5181 2214 90 ----
NM_006807chr171362 ----1343
NM_006814chr2021018 272 --62435 402 266 182 144 66 --
NM_006823chr8148 2871 333 1184 --
NM_006856chr1241151 775 295 26 --2767 372 --
NM_006885chr1693444 1678 1129 1107 971 729 360 304 157 ----11230
NM_006899chr201303 1227 --144
NM_006943chr2093059 2902 2372 1005 672 489 205 195 96 1166 2980 225 --
NM_006950chrX12898 689 678 635 596 298 224 205 143 134 112 80 1267 1732 --
NM_006982chr12------1215
NM_006990chr162542 2493 2150 1966 1955 503 --21667 190 --
NM_007011chr15216008 5661 5361 5077 5040 5000 4962 4956 4916 4883 4744 4412 4405 4169 2680 839 831 492 305 208 57 36200 4585 108 55071 5034 4994 4877 581 --
NM_007040chr196925 912 391 244 80 47 --2299 237 1726
NM_007050chr20237426 7420 7401 7161 7147 6212 6080 5506 5311 5076 3232 2825 2771 2735 2697 2529 1683 1675 1410 1036 620 564 542 37669 7600 1592 35606 5114 5083 37760 3139 571
NM_007052chrX2505 392 1399 --1512
NM_007067chr1771572 1324 1281 1073 605 325 309 ----11537
NM_007068chr222771 68 ----1102
NM_007144chr17101129 1057 1051 963 841 827 812 474 372 90 1907 3487 101 41 --
NM_007162chr65590 491 379 128 73 2475 452 1513 --
NM_007174chr1292304 1966 1857 1556 808 700 631 157 27 11529 2951 788 --
NM_007207chr1134 1200 1800 --
NM_007212chr121752 910 --1833 1260
NM_007221chr12310 159 --1357 1409
NM_007236chr1531583 80 74 --1257 --
NM_007245chr168885 843 772 622 608 380 367 182 2672 28 2734 172 --
NM_007245chr168885 843 772 622 608 380 367 182 2672 28 2734 172 --
NM_007249chr13199408 8972 8947 8017 7966 7947 7274 7035 6960 6863 6671 6022 5824 1733 1385 1324 808 174 111 21802 1522 36630 2823 1622 17552
NM_007365chr1132053 1976 1955 1918 1710 1633 1599 1425 731 303 189 98 44 2711 58 42047 1401 658 590 --
NM_007373chr1011783 ----11158
NM_007375chr131763 1085 397 ------
NM_012081chr562650 2276 1466 623 290 203 --2696 195 --
NM_012090chr1------1864
NM_012104chr1183368 3359 3226 2383 1522 1392 689 321 12797 43468 2454 1451 118 --
NM_012134chr1111742 1730 1595 1585 1231 751 369 205 113 84 51 1344 11242 1657
NM_012137chr172744 2651 2379 2262 1095 627 163 ------
NM_012199chr1143600 3131 3070 1828 1608 1307 1100 940 659 620 255 224 217 22 --23832 1649 14492
NM_012301chr721457 144 --1321 --
NM_012326chr24747 272 58 38 165 2778 765 --
NM_012384chr20132127 2032 2022 1995 1986 1711 1682 1510 973 910 619 413 210 ----1516
NM_012405chr163515 1313 530 492 368 174 21397 381 22577 1364 --
NM_012464chr422231 1173 22911 296 --12365
NM_012471chrX51641 1389 376 154 87 1687 1429 --
NM_013260chr1761152 557 475 464 456 103 --21241 965 --
NM_013449chr12112263 2135 2090 1132 1123 1103 866 845 566 196 42 1148 52995 835 704 559 317 1751
NM_014112chr854979 4765 4328 1224 1167 --14817 --
NM_014157chr16103935 3259 3108 2945 2489 794 630 548 116 107 --21437 556 23181 280
NM_014231chr1231959 640 119 --21694 86 22031 1607
NM_014232chr17121638 1346 1237 1216 1180 1037 547 445 425 387 91 64 21603 1499 1417 --
NM_014280chr12617 78 ----1270
NM_014289chrX61279 1259 1067 1028 490 448 1316 --1144
NM_014299chr1971390 841 714 663 322 123 53 ----21596 582
NM_014368chr971902 1862 784 778 673 498 270 2376 40 11963 --
NM_014423chr534586 4349 328 --24784 1661 137
NM_014431chr1051331 587 115 39 25 11639 21599 424 --
NM_014494chr164958 332 318 135 --21913 1851 --
NM_014496chrX------1245
NM_014554chr124580 311 301 231 ----12020
NM_014614chr22407 184 ----1591
NM_014665chr8143397 3360 2740 2471 2444 2325 1234 1050 832 766 655 489 439 173 53327 2910 2566 2277 892 43518 2584 707 468 --
NM_014706chr1221113 58 1975 ----
NM_014726chr1791330 1233 1139 1073 988 534 396 213 121 11119 --1982
NM_014730chr12185243 5232 5216 5205 5051 4223 3601 3542 2047 1904 1512 1184 1130 907 829 688 592 291 ------
NM_014731chr2051803 1610 1358 1253 56 21483 97 21547 152 188
NM_014742chr2091647 1491 1455 1195 1188 1093 706 578 400 31527 1464 1099 2486 388 --
NM_014754chr84793 714 376 75 ----1162
NM_014755chr282831 1551 1437 1289 1239 766 212 49 34128 3843 3052 --170
NM_014757chr571847 1836 1813 1722 1646 620 373 1316 31910 1638 834 12309
NM_014766chr773782 2833 1270 1197 842 628 579 43212 2847 1285 1226 141 21278 796
NM_014770chr12111292 998 968 491 290 226 186 149 132 106 26 1950 21025 32 11105
NM_014772chr18143559 3513 3232 2991 2967 2957 2934 2874 2621 1279 1130 592 585 312 42602 1087 622 187 72806 2261 907 609 532 296 275 --
NM_014786chr1141052 420 306 63 --1380 2965 856
NM_014824chr1151531 517 504 332 157 --11440 --
NM_014838chr2241866 791 625 129 --32656 813 149 --
NM_014847chr13505 130 111 --1171 --
NM_014849chr171265 1219 930 894 271 112 99 2993 843 61175 980 347 234 227 106 --
NM_014877chr1796121 5545 2557 2293 2051 1616 959 910 602 27132 2081 15587 --
NM_014912chr10------1933
NM_014913chr1821138 1005 --2290 80 11185
NM_014924chr1442240 1100 985 52 1620 13143 13118
NM_014925chr122750 240 2787 646 1766 --
NM_014945chr582009 1911 1474 1291 1226 701 600 444 ------
NM_014952chr1541984 1769 713 425 --12029 --
NM_014962chr2022544 276 --3953 896 878 --
NM_014977chr142435 219 --181 2472 122
NM_014991chr43575 537 276 12174 2662 292 --
NM_015025chr222171 1810 --12200 11692
NM_015027chr1651706 1241 533 380 230 ----11787
NM_015033chr9102200 2159 1250 1039 529 297 240 222 142 113 12145 32224 803 257 22137 64
NM_015052chr72852 495 ----1273
NM_015063chr195417 407 299 209 170 11256 126 11273
NM_015074chr173678 3387 3176 1973 1680 328 23 14371 2376 159 24680 864
NM_015075chrX231988 1774 1752 1731 1599 1553 859 812 782 742 736 428 380 369 362 338 331 323 109 91 83 47 41 42060 831 824 552 32105 2075 587 --
NM_015076chr694360 3923 3134 2819 1390 1384 1078 715 202 --12962 13916
NM_015090chr1205921 5912 5871 5851 5845 5805 5724 5694 5679 5436 4828 4676 4643 2507 1695 1421 1375 1367 1304 751 25211 5202 44308 1561 1489 965 --
NM_015092chr1643196 2848 641 399 13823 2661 651 13913
NM_015099chr173696 484 284 2232 161 1147 --
NM_015107chrX152173 2166 1800 1592 1496 586 485 465 458 440 321 153 49 38 24 1920 31651 211 179 --
NM_015111chr583834 3670 2886 2562 2525 1475 1185 1121 21527 590 21040 949 1785
NM_015147chr2------1231
NM_015176chr121602 1311 11175 ----
NM_015210chr185817 455 125 67 51 2134 116 ----
NM_015215chr112796 22512 2205 1738 --
NM_015286chr1521623 1000 --1262 12483
NM_015299chr14113794 3723 3555 3532 3447 3192 3095 1344 754 724 305 13359 33750 3304 3295 --
NM_015305chr1461724 1472 1423 599 195 157 11413 1141 1767
NM_015310chr897960 6990 6588 5476 3308 3003 1826 1448 828 27433 835 27792 2961 --
NM_015313chr1174417 4095 3433 3328 3244 747 220 23315 1403 44800 3544 3475 234 12948
NM_015315chr583152 1318 1203 990 834 673 449 213 22133 659 3644 561 382 11336
NM_015326chr192785 2711 2690 2531 2483 2080 1100 666 135 --22301 186 --
NM_015327chr161304 1215 1192 487 282 88 --1377 --
NM_015328chr782704 1023 755 477 422 360 298 94 1675 32736 284 57 --
NM_015335chr1241916 519 510 273 11973 --1114
NM_015347chr1221114 554 --22844 2070 --
NM_015349chr692260 1226 651 442 248 110 52 39 21 11015 ----
NM_015355chr1721533 1292 --11765 --
NM_015455chr542959 2592 1357 1080 --1935 --
NM_015481chr12111061 1018 934 896 883 846 805 754 211 120 94 --2420 35 --
NM_015488chr261235 685 543 410 273 265 3442 209 128 21431 304 3642 528 36
NM_015526chr19111451 1130 1004 966 502 267 246 240 192 148 91 21333 1118 3467 374 37 1315
NM_015609chr1152923 2708 2668 2505 2468 2172 2095 2013 1133 873 825 739 720 427 165 --42604 1087 896 199 --
NM_015686chrX162373 2348 2207 2198 2168 2095 2006 1870 1805 1001 793 605 516 406 151 27 22523 412 --1461
NM_015872chr1121793 1779 1726 1472 1239 1161 722 684 376 321 269 186 --21712 1210 --
NM_015904chr22286 242 1700 --1204
NM_015906chr133379 793 762 13649 11323 1749
NM_015982chr174357 322 100 75 ------
NM_016022chr15881 745 381 119 31 --1234 --
NM_016120chrX31223 437 152 ----1352
NM_016132chr1563431 3336 850 660 307 122 1568 --1884
NM_016151chr166369 165 108 81 74 54 --1253 --
NM_016234chr104923 288 197 173 ----1741
NM_016250chr143511 244 38 1788 ----
NM_016519chr42385 44 ----158
NM_016525chr93770 713 315 --2607 263 --
NM_016530chr1553107 1025 747 613 316 --12500 --
NM_016577chr3164385 4374 4095 4033 3990 3745 3357 2969 1761 1469 1247 692 528 514 446 25 11565 11356 --
NM_016598chr34917 466 447 419 21072 981 11080 1170
NM_016620chr111419 ----1367
NM_017409chr126618 591 517 504 313 277 1610 145 --
NM_017410chr1291068 504 422 203 197 189 178 170 24 --11115 1957
NM_017415chr5124564 4525 4211 3615 3390 2779 1731 1273 1256 1012 953 238 --33807 1588 971 --
NM_017420chr1443016 2702 606 80 12557 12534 --
NM_017450chr1771199 950 500 293 217 125 76 11189 --11072
NM_017514chrX9762 722 378 359 336 276 239 216 86 ------
NM_017519chr64953 450 312 123 ------
NM_017542chr161855 1627 1367 700 272 57 ----2485 193
NM_017575chr1791541 1515 1150 1144 1024 589 568 507 367 ----1169
NM_017590chr22132119 2107 2084 1652 942 699 666 463 413 373 240 234 208 12287 32179 362 153 --
NM_017596chr1194632 4322 3727 3403 3382 3086 2974 1784 1764 1747 1738 1423 1042 949 511 499 379 358 341 64426 4194 3307 1645 1618 560 54086 3511 3462 979 67 1729
NM_017600chr125467 444 170 109 57 2487 148 1455 --
NM_017634chr81550 --21275 67 --
NM_017636chr192291 115 283 35 --1310
NM_017637chr9158923 8768 8239 8140 7998 7953 7402 7141 6375 6182 2628 2449 2158 1655 372 38871 8719 2141 26851 3544 11577
NM_017643chr1752417 1897 815 493 455 ------
NM_017686chr13310 49 31 11030 1115 --
NM_017744chr151566 850 779 614 79 185 1991 11542
NM_017754chr6124824 4741 4668 4652 4339 4313 3383 1165 950 921 865 437 13918 34476 4394 1466 --
NM_017799chr14------11832
NM_017811chr962627 2079 969 639 541 286 1200 33163 2893 2875 11980
NM_017848chrX84496 4163 3759 3346 3127 1132 765 107 11337 14456 --
NM_017893chr10121387 1330 1324 1290 1236 1157 531 525 223 174 100 70 11336 11484 2947 183
NM_017907chr113393 75 54 --1327 --
NM_018061chr131190 96 65 ----1573
NM_018110chr164931 487 286 280 --1301 1947
NM_018207chr1101663 1622 1499 1350 1317 1224 1209 1104 568 257 1537 2287 165 --
NM_018362chr113956 751 390 ------
NM_018364chr123637 3243 ----21249 796
NM_018375chr1421370 81 --1438 1777
NM_018381chr194884 680 616 342 --2876 715 --
NM_018383chr221742 1337 ----1297
NM_018449chr95727 712 617 554 289 --3789 266 249 --
NM_018489chr18749 651 619 433 421 340 310 220 2349 316 1607 --
NM_018602chr1531278 1216 26 ------
NM_018718chr751987 784 515 147 64 ----22121 1687
NM_018898chr552169 874 620 293 286 --1212 --
NM_018976chr1242217 1899 940 784 --12804 --
NM_019004chr751832 1803 1727 455 363 --12333 --
NM_019032chr16667 650 642 583 507 84 --1693 --
NM_019087chr511465 1419 --1248
NM_019096chr641008 865 852 808 --2833 318 138
NM_019106chr22103372 3115 3003 2433 2201 1373 1066 616 428 321 23159 96 73209 3032 2994 2805 2563 1318 686 12117
NM_019106chr22103372 3115 3003 2433 2201 1373 1066 616 428 321 23159 96 73209 3032 2994 2805 2563 1318 686 12117
NM_019116chr1673409 2602 2548 1061 846 799 564 --12305 --
NM_019845chr23175 69 33 --2715 315 --
NM_019885chr2142442 2264 1910 1816 973 935 693 686 642 554 529 435 168 148 32480 765 110 2544 221 --
NM_020063chr11191 2264 232 1200 138
NM_020145chr95524 246 236 174 117 2532 24 --1574
NM_020150chr1072145 2055 1612 681 201 98 64 11852 --1176
NM_020182chr20113454 3448 3190 3177 2638 2469 2287 2224 1035 965 124 23127 1061 43520 2306 1432 854 --
NM_020205chr193382 2888 2558 2426 2420 2356 809 733 562 --22591 79 --
NM_020309chr1981091 1032 822 796 358 343 159 132 --1237 --
NM_020310chr17192518 2505 2482 2257 2034 1878 1796 1122 857 850 843 790 705 566 434 350 340 110 56 178 22227 289 --
NM_020336chr2073522 3514 2933 1016 773 765 380 --11344 1602
NM_020338chr10132910 2827 2419 2407 1430 1399 1336 1045 762 368 221 139 48 53463 633 228 100 30 13184 --
NM_020429chr762776 2522 2147 1120 213 180 12118 22944 2038 --
NM_020440chr1113188 3144 2946 2877 2871 2317 2304 908 524 285 237 --32489 713 198 --
NM_020526chr181803 1749 1524 1375 1336 719 568 262 21152 579 21657 1273 31700 1444 1140
NM_020640chr311631 ----1106
NM_020647chr81301 --12251 --
NM_020699chr1214933 4914 4858 4746 4127 4115 3901 3791 3763 3412 3406 3346 1862 1806 1329 1001 950 872 635 414 26 11052 53879 3824 3367 1671 1319 44985 3398 1826 1753
NM_020708chr2091658 990 976 945 789 204 181 126 71 12045 2778 368 1557
NM_020717chrX124038 3807 3562 3505 3290 1622 1363 1236 1144 617 489 148 --31546 1086 1031 1250
NM_020752chr1032867 1887 78 --22342 1979 --
NM_020760chr241449 1240 391 305 11535 ----
NM_020772chr1788366 7037 6525 5396 3437 2725 2444 485 --27947 2647 23456 2868
NM_020791chr171516 --183 --
NM_020796chr542763 2544 323 316 42686 330 247 240 12777 12924
NM_020814chr241132 986 918 903 --11445 1204
NM_020850chr16133198 3042 2834 2454 2197 2042 1320 1028 865 858 729 178 35 23168 2513 42929 2840 2756 2394 --
NM_020898chr124747 556 539 121 1759 1723 1654
NM_020899chr179723 586 537 499 428 322 266 172 54 --12369 21846 624
NM_020956chr19204758 4456 4445 3497 3278 3107 1619 1541 1296 1282 1112 1012 689 585 557 549 500 366 142 104 23189 2925 3651 306 165 1374
NM_021079chr17123071 2891 2837 2671 2540 2222 1261 1182 1176 426 237 63 ----32807 2708 2416
NM_021117chr1172028 2009 1961 1629 1538 801 374 22284 665 32001 1434 397 --
NM_021148chr731666 1545 955 --12295 --
NM_021155chr19102935 2601 2379 2267 2106 2051 1031 689 478 41 1499 21858 1130 32407 1888 1174
NM_021192chr2233 22 --2131 53 --
NM_021237chr31300 ----1135
NM_021637chrX2911 866 ----2546 176
NM_021809chr2052072 1930 1675 276 206 --22351 2101 12286
NM_021813chr6135418 4663 4334 4232 4126 4093 3589 1685 1679 1548 1469 1098 687 --11089 --
NM_021914chr1432002 445 48 21630 815 1808 --
NM_021946chrX91336 1186 1173 1056 1006 941 933 71 54 --21310 1223 --
NM_022048chr15206127 5643 5545 5055 4529 4257 4229 4223 1784 1690 1646 1623 1176 1079 692 377 362 275 236 23 --45172 4353 2353 1030 25043 2218
NM_022060chr1461222 1010 870 445 435 130 2929 169 41175 1141 376 87 --
NM_022130chr541435 551 346 306 --1247 195
NM_022169chr1161273 1232 1222 357 255 217 1134 4543 396 247 197 --
NM_022574chr792018 1937 1931 1846 1791 1618 810 567 120 --32135 2124 1488 21640 86
NM_022719chr2293870 3229 3092 2867 2470 747 694 570 279 11361 23068 1480 22641 293
NM_022726chr631731 1588 231 --1516 --
NM_022733chr171108 1053 834 225 160 78 65 1204 21045 845 --
NM_022821chr11395 2401 318 2179 79 2345 144
NM_022824chr521702 178 --11830 --
NM_023079chr1751288 519 486 60 28 --21718 673 2530 310
NM_024293chr22792 646 ----1265
NM_024297chr17168 --3381 177 159 --
NM_024345chr966099 4245 3942 1877 1397 182 25005 1230 55039 4568 4356 492 306 --
NM_024408chr143020 2276 1022 506 13362 1927 --
NM_024423chr1852796 2768 1626 694 103 23836 1402 33815 1455 75 --
NM_024675chr16------1228
NM_024779chr1221062 1023 21548 609 21169 227 11287
NM_024811chr1171667 1647 1635 1516 375 283 88 31561 190 153 31811 1641 54 --
NM_024887chr1102105 1568 1429 1347 1320 719 572 358 213 52 11712 1537 --
NM_024953chr1282463 2289 1926 1120 279 265 107 58 1514 1647 12534
NM_025135chr184206 180 142 130 ----1374
NM_025160chr143128 759 471 236 13381 34024 3312 3302 13082
NM_025164chr1172226 1937 1828 1815 1405 448 241 --31715 1696 104 1132
NM_025182chr96917 713 280 222 180 113 1390 3924 425 418 --
NM_025248chr17193192 3040 2997 2961 2898 2249 2154 2122 2078 1101 610 550 389 383 156 145 98 41 24 13029 22761 77 --
NM_030576chr17122500 2469 2454 2208 1929 1024 968 676 663 390 363 319 22605 2216 2400 255 12538
NM_030621chr1464250 2594 1603 916 411 389 --2949 238 11110
NM_030629chr1691558 1346 1229 645 628 618 440 185 90 21461 1240 31278 1218 492 --
NM_030647chr786044 5026 4922 4701 3916 1984 1495 704 --21745 724 23842 1993
NM_030661chr751635 1503 1245 1139 41 1133 2588 286 --
NM_030796chr752005 1918 876 404 251 ----1126
NM_030802chr174920 290 253 62 --1201 --
NM_030806chr1249270 9210 9185 9095 9003 8897 8650 8633 8605 8570 8429 8361 6439 6342 6253 6234 6097 3458 3261 2092 1946 1636 329 137 26675 1432 88351 8327 7753 3272 2549 879 729 439 --
NM_030809chr1241827 709 522 192 11757 11743 1618
NM_030914chr93673 635 602 2788 641 1858 --
NM_030920chr132061 1720 229 ----190
NM_030981chr1191123 1061 818 791 392 326 320 187 41 1275 2845 132 --
NM_031208chr161789 ----1736
NM_031483chr2033543 3328 2803 --12363 --
NM_031911chr441734 980 602 92 --11728 --
NM_032017chr181993 1525 1427 1361 1337 849 344 328 --31518 1454 675 1380
NM_032193chr11122067 1984 1968 1888 1830 1818 1762 1328 504 497 323 258 1800 31933 828 159 --
NM_032246chr152124 69 1356 157 --
NM_032420chr53616 238 74 --2670 81 --
NM_032452chr1461290 1151 553 490 345 335 --2230 218 --
NM_032595chr17111362 1349 1005 998 550 477 235 129 121 76 67 --21334 1121 11580
NM_032804chr1061644 954 742 732 350 43 11818 2357 314 1810
NM_032818chr972462 2419 2284 2238 1652 1028 853 22497 1776 21744 914 --
NM_032840chr1271027 769 403 306 265 128 74 --21159 979 --
NM_032900chr1083738 3535 3338 3303 2678 785 577 160 43276 3199 3125 1456 ----
NM_032906chr41575 ----1193
NM_033133chr17173735 3592 3563 3528 3491 3241 2657 2610 2393 1516 1299 1112 1046 815 695 545 298 21333 385 1799 13722
NM_033141chr1481853 1534 1405 620 406 343 266 104 1274 11845 --
NM_033201chr166811 356 215 90 65 42 --2413 296 --
NM_033224chr7137549 6850 6313 5975 5699 5549 5417 1673 1541 1199 435 78 29 21680 1271 32939 976 244 11116
NM_033315chr1782081 2075 2041 1933 1638 744 355 343 11685 32128 1650 668 11817
NM_033396chr114388 366 121 88 1401 123 --
NM_033449chr5112154 2146 1848 1814 1495 1426 347 186 152 123 42 --1324 --
NM_033540chr321115 831 --11007 --
NM_052840chr1551524 1463 1445 584 483 11469 11639 --
NM_052848chr19162053 1943 1878 1763 1608 1559 1548 833 691 583 565 290 204 171 165 31 1111 3365 284 37 --
NM_052851chr1342088 1663 489 368 --2497 207 1459
NM_052874chr166657 158 130 124 62 39 ----1188
NM_052876chr19182614 2424 2359 2353 2060 1999 1881 1861 1669 1030 917 891 467 441 387 343 257 93 1897 32596 2274 158 2881 284
NM_052897chr125858 687 296 206 195 1146 2266 115 --
NM_052907chr1264045 3848 3627 3435 1701 632 23735 288 ----
NM_052910chr1371627 1456 1404 1375 1369 1357 565 --31732 98 53 --
NM_052917chr253072 3009 2618 2610 2389 --1167 1818
NM_052918chr1072606 2592 2583 2346 1186 1142 1065 12776 31306 899 183 --
NM_057175chr4--11037 1264 --
NM_058243chr191856 2555 222 1718 1290
NM_080607chr206878 406 351 173 103 34 ------
NM_080616chr203712 686 73 ----1512
NM_080625chr2061113 1089 955 437 425 163 --1124 --
NM_080738chr151749 1318 571 474 128 --1416 --
NM_101395chr2193315 2459 1090 1054 911 625 359 284 196 --1503 --
NM_130783chr1151921 1297 694 235 34 11983 4852 593 341 78 --
NM_133264chr17133407 3393 3241 3228 3057 2712 2553 1373 1166 755 590 109 24 33955 2972 1445 33723 2858 2527 --
NM_133457chr771313 1121 1071 938 226 220 155 --21494 387 --
NM_133496chr153791 3268 3234 2984 2852 --13285 1445
NM_133498chr192283 74 --261 53 --
NM_133499chrX13968 759 748 705 666 368 294 275 213 204 182 150 78 1337 1802 --
NM_134268chr1761134 1128 1116 1110 843 125 --1955 1364
NM_138357chr1041587 1356 392 358 --11552 --
NM_138375chr185831 341 300 273 203 1891 21099 862 --
NM_138385chr45420 406 184 103 91 ------
NM_138468chr2106071 5359 5313 5030 2047 1845 1289 875 735 646 11141 14899 25692 4722
NM_138471chr113498 461 383 --1411 --
NM_138473chr12135031 4998 4991 4533 4495 4302 4232 4073 3891 3739 1601 708 538 13999 21237 597 14255
NM_138635chr752727 2392 2312 480 342 12800 11028 13035
NM_138795chr141450 301 285 193 31228 1145 1115 3224 102 65 --
NM_138962chr174300 125 116 101 --1132 --
NM_139076chr421177 1171 ----11491
NM_144635chr341034 465 387 205 1100 1396 --
NM_144778chr133728 328 86 --12539 --
NM_144973chr12114908 4796 4282 3763 3393 1406 1318 952 408 115 45 --23972 131 --
NM_144982chr123320 265 150 ----1136
NM_145008chr115595 347 269 136 91 --149 --
NM_145185chr1951954 1781 380 180 158 125 2189 62 --
NM_145203chr131914 ----162
NM_145206chr1082586 2331 2294 1024 842 721 705 120 --13315 1876
NM_145244chr431341 1246 86 --21670 612 --
NM_145799chrX93041 3010 2922 2355 2051 904 671 508 497 2735 304 1357 12097
NM_145808chr742744 1081 1047 320 151 12423 --
NM_147128chr741565 596 430 363 ----11284
NM_147189chr822297 1853 --21821 92 --
NM_147202chr9222210 2181 2146 2127 2000 1043 881 850 771 765 754 718 618 581 536 501 374 290 284 267 102 76 32382 1773 111 1212 --
NM_152247chr221242 1122 1306 1605
NM_152253chr22143940 3847 3628 2794 1490 1482 1470 1202 1011 902 760 622 382 301 13508 23692 2760 13991
NM_152263chr192244 1353 949 603 429 240 161 107 65 --11506 --
NM_152296chr194137 128 116 34 --1232 --
NM_152344chr1721150 1003 --1298 --
NM_152345chr1791112 979 949 876 831 387 340 248 183 1887 2841 456 --
NM_152399chr411156 1302 ----
NM_152424chrX134606 4190 4127 4011 3940 3690 3330 3140 3100 2995 2867 1668 1660 11654 64649 3967 3824 3654 601 154 --
NM_152450chr1531957 571 242 --21667 413 --
NM_152470chr18143612 3490 3406 3033 2731 2668 1460 1440 1232 1085 895 191 50 28 22986 1593 1210 --
NM_152493chr131273 118 23 21095 1019 1270 --
NM_152520chr24998 404 240 99 --2818 228 --
NM_152622chr532690 326 262 --2317 284 --
NM_152688chr6125 ----158
NM_152716chr11101450 1437 1416 1406 1400 1201 1091 328 320 104 2481 401 1173 11037
NM_152749chr741146 1018 890 751 --1260 --
NM_152754chr723566 94 --22582 894 --
NM_152787chrX53608 1588 455 443 396 11576 13761 --
NM_152860chr12111344 1054 1032 1024 994 436 406 324 172 91 21 --11373 --
NM_152896chr91839 ----1130
NM_153252chrX------1166
NM_153350chr16151491 1298 1240 1121 1113 1099 1093 612 504 437 377 223 188 157 105 --3626 425 403 11507
NM_153487chr6204714 4632 4592 4510 4460 4349 4315 4273 3996 3911 3765 3725 3325 3053 3013 1248 1139 690 561 79 2933 773 54765 4746 4720 1068 762 --
NM_153619chr1591259 1206 1198 1095 1030 828 786 774 492 --2862 471 --
NM_153685chr1291074 916 909 888 307 266 152 145 58 1196 1225 1375
NM_153756chr181889 1868 1704 1545 1437 775 607 199 --11488 --
NM_170707chr14952 928 732 381 1281 2922 53 --
NM_171998chrX1976 --22467 2146 12105
NM_172070chr22899 624 ----12036
NM_172127chr431542 1505 1383 --11999 --
NM_172240chr1221346 535 ----1277
NM_173468chr443715 2347 361 31 --32108 1707 674 --
NM_173475chr1641706 1569 677 574 --21580 1295 11546
NM_173478chr171833 ----1801
NM_173485chr20--152 1187 1285
NM_173491chr5--11463 --11448
NM_173510chr2252475 1978 970 932 889 --1119 12399
NM_173595chr12305240 5204 5132 5081 4968 4876 4487 4331 4316 4239 4126 3746 3725 3696 3639 3618 3435 3215 2130 2066 1756 1636 1230 1044 1033 730 671 376 278 24 44279 2008 1520 703 74775 4692 4215 3652 3246 720 574 35172 1453 447
NM_173602chr1253400 3146 3127 2502 804 --1378 --
NM_173683chr81300 --1340 --
NM_173822chr241792 834 597 359 178 1589 1755
NM_173825chr342731 2112 710 400 --1512 32979 2924 355
NM_175061chr751760 1657 1523 1470 1462 --134 --
NM_175063chr199882 872 474 433 348 340 232 185 34 1777 11131 --
NM_175736chr12307850 7625 7293 7156 6672 6664 6598 6103 5958 5386 5347 5255 4964 4864 3139 3014 2775 2753 2699 2474 2390 2261 1982 1928 1810 1684 1672 1113 678 311 56241 5827 4787 1592 1380 36345 5333 2146 --
NM_175747chr64822 816 158 132 --1267 --
NM_175767chr531898 482 230 ----1650
NM_175856chr5------1654
NM_175921chr554129 3685 1546 1148 138 33874 3095 2947 --11638
NM_176871chr893021 2983 2698 2435 2398 1228 839 579 490 22976 1255 23355 2495 12168
NM_177551chr12--1808 1761 1342
NM_178013chr1472554 2380 1004 783 537 446 154 5932 809 599 251 115 42114 994 587 236 2797 518
NM_178026chr205526 419 162 49 35 --1490 --
NM_178126chr1782234 1811 1747 1569 882 347 245 174 --32244 2026 51 --
NM_178140chr562145 2021 1694 1092 247 121 ----22563 2377
NM_178554chr3113605 3359 3302 2282 2260 1412 899 659 650 137 51 31350 906 871 23139 2504 13106
NM_178842chr1562047 1426 791 383 344 125 3539 84 73 11462 2507 245
NM_181077chr1511754 ----11469
NM_181358chr133559 1414 198 13015 ----
NM_181491chr9103053 2808 2778 2707 2602 2534 1943 1040 785 605 42679 2557 1083 281 --1196
NM_181671chr173708 186 90 --172 1158
NM_181715chr1398 42 35 --1342 --
NM_181844chr1771865 1376 314 301 284 71 23 --21857 393 1211
NM_182526chr14122787 2337 2251 2014 1977 842 819 767 755 661 461 78 --42761 2595 892 629 --
NM_182527chr2291958 1865 1665 1434 765 749 599 226 219 153 3237 163 146 --
NM_182547chr71313 ----156
NM_182557chr11122044 1935 1726 1661 1606 1507 1454 799 772 528 435 248 1736 ----
NM_182970chr20174168 3790 3653 3614 3419 3155 3145 2694 2613 1709 1658 1535 1167 515 389 307 25 33932 3515 109 33559 2682 158 --
NM_183059chr18976 621 409 403 302 260 167 126 --190 11159
NM_197956chr981994 1650 1638 802 724 558 489 194 --1503 --
NM_198147chr173451 189 114 1789 1228 --
NM_198485chr351940 1637 1611 463 457 --21797 825 --
NM_198513chr82215 145 --134 1589
NM_198859chr3104522 4373 4303 4210 3957 3796 3366 1055 727 258 24916 3579 11517 --
NM_198935chr206982 921 723 581 405 266 11186 12186 --
NM_198993chr1751723 1579 1507 1231 498 11591 1559 1402
NM_199141chr197723 715 692 638 362 181 63 1615 2898 169 --
NM_199320chr43925 794 339 ----12168
NM_199334chr173455 401 167 3378 136 90 ----
NM_201263chr141912 1606 1502 698 --21491 27 --
NM_201521chr62161 38 254 45 285 65 --
NM_203303chrX3225 34 27 1201 ----
NM_203394chr1221926 1780 12376 1134 --
NM_203446chr2142585 709 382 267 --1134 --
NM_203463chr284689 4476 4047 3667 3491 1900 1688 1649 13264 24210 303 14536
NM_205848chr182441 2415 1971 1827 1773 899 778 495 32510 2308 507 22791 753 --
NM_207306chr164496 3938 3784 3586 3531 111 14155 14462 --
NM_207647chr952452 2017 1780 1740 1710 --22203 829 --
NM_212464chr1551955 1721 808 795 259 11671 1645 --
NM_212551chr16754 349 343 206 126 109 --2915 420 --
NM_213609chr31785 ----1835