TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-492
miRNA Sequence: AGGACCUGCGGGACAAGAUUCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1585627 4636 4481 2488 2117 1664 1110 1005 13992 22480 1379 --
NM_000368chr934604 3996 130 24684 1000 11070 1564
NM_000555chrX65890 5458 5371 5006 2185 1409 --1906 --
NM_000875chr1545103 1642 1039 804 --34323 2176 755 11328
NM_001001664chr223055 1186 13712 --153
NM_001008408chr764856 4302 4122 2183 1086 426 --65803 5776 1777 1757 1499 97 --
NM_001017368chr1731129 298 122 12456 --12107
NM_001017396chr221562 1432 --2806 674 1688
NM_001100108chr188035 7075 7027 6985 6739 6467 2036 1511 12698 1901 --
NM_001695chr853065 2894 1034 765 276 13752 1210 --
NM_001699chr1961838 1601 1438 1181 384 302 11567 1149 11575
NM_002137chr742072 1847 578 80 ----1785
NM_002359chr1773541 3128 2795 1489 672 373 25 34000 3960 652 43299 3003 2679 1665 --
NM_003292chr121665 227 --11764 1521
NM_003392chr343011 1101 478 388 13048 1929 13860
NM_003473chr102177 114 ----1124
NM_003615chr3------23072 864
NM_004774chr1711945 --194 12560
NM_005156chr91954 1329 --24282 908
NM_005907chr61101 ----1515
NM_006080chr722022 277 ----12317
NM_006750chr1687629 7438 7342 7200 2620 2136 1698 480 46820 6210 2055 1493 ----
NM_007011chr1546328 5765 2732 2639 26318 1733 31738 640 73 21699 1038
NM_007137chrX35382 1944 356 25131 4179 --157
NM_007159chr311239 ----11344
NM_007249chr1398832 7295 6613 5928 2239 2009 1730 1393 522 --12055 17743
NM_013374chr3--23139 1245 --12910
NM_014421chr421861 447 181 11803 --
NM_014661chr1052840 2633 1520 839 537 --2512 129 2446 238
NM_014810chr121482 270 13449 12943 12826
NM_014877chr1797239 7021 6934 6295 5542 5256 4959 1523 1463 12781 16545 17404
NM_015074chr143773 1759 1491 371 ----13620
NM_015435chr821206 85 11078 --11352
NM_017813chr855377 4108 3814 3677 802 ----1588
NM_020348chr1072714 2100 1972 1962 919 490 343 21860 1843 1820 --
NM_020443chr165324 5086 2664 2313 1939 1500 --36214 2757 152 15829
NM_020772chr1758414 7838 2862 2220 1465 11358 --11838
NM_021116chr7118889 8388 7686 5956 5862 3287 2156 1434 1241 325 315 33134 2283 1194 1696 --
NM_022048chr1565079 4839 4280 1834 1558 971 1885 2578 216 11453
NM_030806chr1128833 7480 7446 7055 6476 6208 5699 3563 2391 1871 1417 623 --38519 8242 3154 29377 3363
NM_032102chr11------2553 479
NM_033224chr767542 5155 5145 589 490 289 --17940 21205 551
NM_101395chr2142973 2685 2658 107 125 23404 559 12325
NM_139321chr2014174 --12600 2309 236
NM_144778chr13----1446 1575
NM_173468chr425360 775 11230 25073 666 --
NM_181809chr122863 1404 --33724 3098 2893 1640