TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-493-3p
miRNA Sequence: UGAAGGUCUACUGUGUGCCAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr842442 2188 1745 788 ------
NM_000063chr6155 1267 ----
NM_000067chr83556 276 37 ------
NM_000084chrX66702 5948 5482 5294 781 659 11339 --15243
NM_000088chr1731116 127 45 ------
NM_000089chr74703 659 261 47 ------
NM_000090chr22927 358 1700 ----
NM_000092chr233943 2986 1484 ----14500
NM_000093chr932362 855 539 12000 --1423
NM_000109chrX2929 750 --12156 --
NM_000110chr1156 41061 811 450 33 ----
NM_000111chr7--1288 --127
NM_000115chr1352357 2233 1987 889 817 1617 ----
NM_000117chrX1286 ------
NM_000124chr10--124 ----
NM_000125chr673375 3361 1641 1565 1555 759 173 --1898 --
NM_000138chr1532518 2359 190 12391 12377 --
NM_000141chr1041400 1005 305 181 --11051 11156
NM_000142chr441578 1383 569 273 ------
NM_000161chr1471866 1850 1809 1537 615 203 189 ------
NM_000167chrX61322 675 657 336 249 99 1500 1645 --
NM_000168chr733298 3105 65 1781 ----
NM_000172chr31106 ------
NM_000176chr531394 1076 341 13238 21005 390 --
NM_000192chr121980 --1200 --
NM_000202chrX113855 3766 3295 3131 2670 2437 1154 990 724 305 171 1363 11435 --
NM_000208chr1994326 4117 3772 3550 3326 3173 3072 1701 1476 11339 --14229
NM_000210chr21422 ------
NM_000212chr1721896 1678 22340 2293 ----
NM_000214chr202521 470 ------
NM_000216chrX53871 3270 3146 3074 125 13592 ----
NM_000217chr1265381 4960 4175 3638 3346 2060 35204 4505 4292 23983 1752 --
NM_000222chr411679 --11380 1372
NM_000232chr451167 924 684 153 46 22609 202 ----
NM_000248chr342697 2690 585 260 ------
NM_000252chrX1145 1236 --155
NM_000259chr1585842 5438 5225 4672 4624 4205 2472 2076 1156 ----
NM_000264chr933079 2141 1262 1501 ----
NM_000267chr1763432 2372 2294 1120 500 373 ------
NM_000268chr2262584 2364 1254 977 639 126 ------
NM_000278chr101590 12235 1512 --
NM_000280chr11--1219 1180 --
NM_000284chrX41843 1334 464 300 129 11711 --
NM_000286chr171170 ------
NM_000291chrX187 2752 168 ----
NM_000297chr431627 1360 130 1241 11556 --
NM_000303chr1631109 1043 982 --11451 1972
NM_000314chr1073008 2587 1191 736 586 279 225 12915 167 --
NM_000321chr133453 349 76 1111 ----
NM_000332chr6155948 5799 5670 5021 4753 4618 2787 2588 2528 2427 2133 2104 1962 287 99 --36237 2867 2303 16600
NM_000333chr31979 --1390 --
NM_000337chr5115789 5427 5274 5220 4790 4777 1084 887 408 107 42 35062 1315 379 26465 474 --
NM_000338chr152937 330 ------
NM_000340chr321278 1058 1600 ----
NM_000345chr411048 ------
NM_000346chr1781962 1937 1810 1638 1587 754 375 292 --11494 --
NM_000351chrX73991 3756 3604 3059 2936 1415 230 23929 49 21315 515 --
NM_000368chr974691 3668 3583 3081 899 367 282 33804 1118 875 44311 3059 516 194 --
NM_000378chr1121203 884 --2952 110 --
NM_000391chr1141663 1307 1144 451 --1668 1566
NM_000393chr231678 809 263 ------
NM_000404chr31289 1168 ----
NM_000406chr473022 2927 2240 1040 871 487 281 1320 ----
NM_000408chr242907 1046 544 525 ------
NM_000411chr2122330 619 --23048 710 1350
NM_000421chr172343 308 ------
NM_000430chr17103430 3421 3094 2652 2611 1442 1269 1085 509 468 13252 ----
NM_000435chr192861 24 ------
NM_000439chr54811 598 511 124 ------
NM_000441chr711986 ------
NM_000447chr12185 96 ------
NM_000448chr1142220 2137 758 433 21054 672 1956 1559
NM_000449chr14472 452 300 225 --1174 --
NM_000461chr353939 3539 3419 1468 1294 34031 720 431 23462 3272 --
NM_000462chr15--21225 450 11775 --
NM_000474chr7--1457 ----
NM_000484chr211880 ------
NM_000486chr1253220 3077 2825 999 654 1884 22737 2509 --
NM_000489chrX63043 990 776 205 122 47 13417 ----
NM_000492chr731465 1325 1233 ------
NM_000503chr851810 1755 1447 548 493 ------
NM_000509chr42189 40 ------
NM_000516chr201113 1241 ----
NM_000522chr71868 11100 ----
NM_000523chr24833 182 163 59 2743 403 ----
NM_000525chr1121460 1030 --11227 --
NM_000538chr133574 389 298 --11349 --
NM_000544chr6_cox_hap163122 2210 1300 1198 1186 479 --22744 743 --
NM_000554chr1932876 1111 411 --11087 --
NM_000555chrX116707 6514 5899 5852 5519 5263 3157 2953 2404 2369 915 44988 2536 2385 2206 1277 --
NM_000575chr231012 886 406 ------
NM_000598chr73492 343 205 1440 ----
NM_000599chr274595 3926 3820 3357 3115 3085 1809 1408 --12893
NM_000602chr721177 161 ----1184
NM_000610chr1152926 2653 2604 332 261 22818 484 --1694
NM_000611chr11116837 5018 4768 2817 1900 1194 1165 1073 1001 646 163 14534 26462 2309 --
NM_000615chr1162999 2946 2801 2086 1016 749 2475 422 12898 --
NM_000618chr12126222 6162 5811 5623 5522 4023 2207 1905 1241 1064 802 227 35819 2320 510 25833 4943 --
NM_000618chr12126222 6162 5811 5623 5522 4023 2207 1905 1241 1064 802 227 35819 2320 510 25833 4943 --
NM_000633chr18135225 5041 4909 4772 4502 4339 3964 3941 3841 3434 2087 1398 1358 11638 23726 3417 14198
NM_000668chr431309 271 242 1321 --11352
NM_000719chr1296275 5925 5294 5244 5029 4930 4417 1748 844 16350 26561 4764 --
NM_000720chr31123 ------
NM_000724chr101595 --11697 --
NM_000725chr122864 257 ------
NM_000756chr81400 ------
NM_000788chr451473 1136 978 524 59 11455 ----
NM_000795chr1151117 914 892 733 309 --1319 --
NM_000801chr203781 717 706 ----1756
NM_000810chr152541 215 ------
NM_000811chr51213 ------
NM_000813chr554598 4446 2127 1737 368 23945 1934 ----
NM_000814chr1541470 1394 1116 147 --13912 --
NM_000826chr432487 259 183 ------
NM_000828chrX1767 11606 1134 --
NM_000829chr1141562 732 705 363 1751 ----
NM_000831chr1105265 3807 2282 1452 1007 971 907 772 552 428 --24420 204 --
NM_000833chr1641541 1121 555 170 11187 ----
NM_000834chr1231191 1053 415 ------
NM_000838chr672513 2245 1781 1755 1014 824 235 22212 592 --1977
NM_000840chr73354 168 106 1511 ----
NM_000844chr33992 945 733 --2398 241 --
NM_000859chr531587 1572 1531 --1363 --
NM_000860chr431688 1525 1488 31561 1301 65 ----
NM_000866chr331881 1305 1255 ------
NM_000870chr561473 1467 1319 1160 1126 382 --11336 11198
NM_000875chr15105465 5094 4992 4358 2675 2154 1295 606 516 239 35941 1322 504 26832 1392 25127 116
NM_000876chr621254 395 2943 113 ----
NM_000891chr1722697 826 22830 1235 --11111
NM_000899chr1243504 1633 146 29 13826 ----
NM_000926chr11248358 8345 8227 8111 7931 7667 7134 6676 5972 5929 5853 2479 2396 1661 1434 1377 1368 1155 1125 1090 967 843 703 491 89409 8854 8598 8185 2596 1941 1411 432 28465 8139 13168
NM_000933chr20----11140 --
NM_000945chr232057 1700 1307 ------
NM_000950chrX63336 3203 3156 2416 2215 56 ------
NM_000958chr51997 ------
NM_000965chr341271 1066 994 329 21202 40 ----
NM_001001132chr2131463 306 134 --1296 --
NM_001001323chr1232733 2315 1128 ------
NM_001001330chr102497 58 1130 ----
NM_001001331chr331834 1748 1733 1346 --12075
NM_001001389chr1152926 2653 2604 332 261 22818 484 --1694
NM_001001390chr1152926 2653 2604 332 261 22818 484 --1694
NM_001001391chr1152926 2653 2604 332 261 22818 484 --1694
NM_001001392chr1152972 2699 2650 378 307 22864 530 --1740
NM_001001395chr1262556 2384 2163 2149 1128 460 22765 695 ----
NM_001001396chr1123965 3879 3741 3316 3301 3068 2769 2711 1456 1312 1070 364 ------
NM_001001419chr584682 4301 3705 3460 3352 943 883 259 11022 21961 403 --
NM_001001420chr584682 4301 3705 3460 3352 943 883 259 11022 21961 403 --
NM_001001433chr2043132 2824 2118 130 --1223 --
NM_001001436chr162610 564 1871 ----
NM_001001481chr853147 3078 1296 1273 86 ----12672
NM_001001484chr1042392 861 492 145 --12481 --
NM_001001502chr51408 --1107 --
NM_001001549chr742367 2298 1144 774 32809 2744 940 ----
NM_001001550chr742367 2298 1144 774 32809 2744 940 ----
NM_001001555chr742367 2298 1144 774 32809 2744 940 ----
NM_001001556chr1531164 235 82 --2555 59 --
NM_001001557chr832177 1518 169 2766 733 ----
NM_001001664chr233647 3618 209 32590 510 221 1360 139
NM_001001701chr441926 1493 1485 633 2872 241 12235 --
NM_001001702chr521439 553 21659 1402 31643 1561 67 --
NM_001001787chr12481 183 ------
NM_001001790chr91351 ----1159
NM_001001852chr221752 --3285 133 75 --
NM_001001890chr2184245 3668 3602 3061 2851 2837 663 44 13842 ----
NM_001001936chr102338 43 1473 11163 --
NM_001001971chr10--128 ----
NM_001001995chrX1159 11391 ----
NM_001002233chr851695 1442 670 625 460 21560 46 ----
NM_001002257chr253522 2604 1111 1091 59 ------
NM_001002265chr105774 675 661 167 76 ------
NM_001002266chr105774 675 661 167 76 ------
NM_001002269chr92195 96 --1160 --
NM_001002295chr101317 ------
NM_001002814chr873942 3867 1442 903 670 625 460 21560 46 ----
NM_001002838chrX71689 1674 1538 1425 647 522 320 ----1493
NM_001002843chr151967 --1844 --
NM_001002860chr1474679 4047 3727 3317 2948 687 399 24392 3837 1550 13751
NM_001002906chrY1493 1459 ----
NM_001003652chr18158012 7473 7302 6895 6708 6602 5676 3216 2538 2339 2234 2176 1143 724 613 37082 1642 417 27400 1085 --
NM_001003665chr142765 1130 904 305 12538 23115 2231 178
NM_001003674chr1876181 5574 4919 2736 1628 827 342 25958 2636 ----
NM_001003675chr1876181 5574 4919 2736 1628 827 342 25958 2636 ----
NM_001003688chr42265 253 ------
NM_001003694chr31595 ------
NM_001003712chr1263098 2891 2748 1019 537 142 1160 ----
NM_001003792chr32765 437 ------
NM_001003793chr32765 437 ------
NM_001003794chr352965 2297 1881 999 566 --21196 439 --
NM_001003800chr963398 3133 2693 1138 794 295 43612 3573 2855 2724 32985 2438 860 --
NM_001003937chr241451 291 161 132 11540 1109 --
NM_001003940chr1593636 3492 3324 2978 2758 1172 1109 426 209 --23349 172 --
NM_001003942chr1593636 3492 3324 2978 2758 1172 1109 426 209 --23349 172 --
NM_001003943chr1593640 3496 3328 2982 2762 1176 1113 430 213 --23353 176 --
NM_001004023chr12217 49 ------
NM_001004065chr973636 3347 3133 2952 2930 1008 219 ------
NM_001004125chr93968 862 128 2782 462 ----
NM_001004196chr331092 496 145 ------
NM_001004317chr6113793 3614 3375 3307 2738 1347 1265 976 926 860 490 ----11281
NM_001004329chr1221510 448 1462 ----
NM_001004342chr1166052 6040 5845 5019 4330 4284 4192 2100 2042 1612 1430 791 629 599 448 368 15196 1274 14826
NM_001004346chr41988 3940 783 68 ----
NM_001004360chr231409 583 394 1434 11431 --
NM_001004419chr1244272 4158 1531 543 ----14298
NM_001004441chr531373 1364 24 ------
NM_001005158chr32133 28 ------
NM_001005159chr32133 28 ------
NM_001005266chr152241 183 ----1463
NM_001005267chr152241 183 ----1463
NM_001005268chr152241 183 ----1463
NM_001005269chr152241 183 ----1463
NM_001005271chr1771165 1064 455 407 272 194 91 ------
NM_001005273chr1771165 1064 455 407 272 194 91 ------
NM_001005375chrY41708 1570 1306 198 ----1408
NM_001005404chr1764429 4286 3582 2871 2798 109 --11583 --
NM_001005463chr1062187 2176 1721 1045 901 137 3660 592 99 ----
NM_001005473chr586494 5984 5176 4920 2598 2471 2198 362 35608 5324 4822 45136 4834 2432 82 --
NM_001005474chr361421 1235 1002 506 426 296 21198 263 ----
NM_001005476chr2----1185 --
NM_001005502chr12105119 4782 4672 4567 4097 2043 2028 1699 1228 93 13530 2382 117 --
NM_001005609chrX93344 3102 2468 1402 1217 1074 789 239 186 13431 1174 --
NM_001005732chr21----1628 1164
NM_001005733chr21----1585 1164
NM_001005781chr23521 486 457 ------
NM_001005782chr24970 935 906 254 --1326 1382
NM_001005845chr831810 1562 400 31307 1244 78 ----
NM_001006600chr552430 1682 1619 1506 540 ----12216
NM_001006605chr161126 1020 992 820 805 258 ------
NM_001006605chr161126 1020 992 820 805 258 ------
NM_001006610chr161787 ------
NM_001006618chr9195 ------
NM_001006636chr22920 54 ------
NM_001006657chr223237 1038 22337 640 32731 2083 936 --
NM_001006684chrX--1195 ----
NM_001006945chr12217 202 ------
NM_001006946chr261537 1383 1333 1293 654 556 --21821 231 --
NM_001007024chr1764215 3384 3192 3153 1536 1475 --21770 1744 --
NM_001007025chr1764215 3384 3192 3153 1536 1475 --21770 1744 --
NM_001007067chr82339 82 1222 2240 118 --
NM_001007068chr82339 82 1222 2240 118 --
NM_001007069chr82339 82 1222 2240 118 --
NM_001007070chr82339 82 1222 2240 118 --
NM_001007097chr943965 3863 1954 526 14790 21720 1266 --
NM_001007102chr631331 595 399 1390 ----
NM_001007214chr121630 116 ----11575
NM_001007237chr14812 531 469 440 --12458 --
NM_001007246chr2141725 1336 1291 1192 --11581 --
NM_001007257chr121546 1072 ------
NM_001007466chr684966 4602 3782 3444 1133 1104 286 54 --11324 --
NM_001007527chr52257 186 ------
NM_001007553chr121112 143 1381 ----
NM_001007565chr3----1267 --
NM_001008220chr523968 660 --1388 12495
NM_001008222chrX2558 21 ------
NM_001008239chr1873421 1310 1191 1016 564 298 275 ------
NM_001008393chr492869 2744 2280 1835 1810 999 732 664 356 1229 12471 --
NM_001008401chr1911510 --11268 --
NM_001008408chr795762 4923 4641 2105 2010 1884 1455 1272 24 1417 45589 5389 2267 531 12148
NM_001008529chr1731075 482 250 21134 431 11054 --
NM_001008539chr864456 4395 4232 3967 3576 559 ------
NM_001008541chr1031469 1448 635 --12121 12143
NM_001008541chr1031469 1448 635 --12121 12143
NM_001008564chr1341742 881 413 142 ------
NM_001008660chr1121210 1081 --1976 --
NM_001008701chr1962916 2837 2491 1894 844 599 ------
NM_001008707chr1421182 770 21288 353 ----
NM_001008726chr1431728 502 288 ------
NM_001008738chr542595 1797 734 188 12408 ----
NM_001008744chr1421499 572 11052 ----
NM_001008801chr1941690 1683 853 128 --127 --
NM_001008897chr61536 ------
NM_001008925chr442902 2400 1311 573 ------
NM_001009185chr5--1583 ----
NM_001009554chr484321 3971 3802 3615 1742 1393 558 293 --11501 --
NM_001009554chr484321 3971 3802 3615 1742 1393 558 293 --11501 --
NM_001009555chr431804 1244 1088 11723 21735 1265 --
NM_001009814chr13193 ------
NM_001009881chr11407 ------
NM_001009882chr11407 ------
NM_001009899chr3155725 5347 5197 5172 5046 4838 4716 4404 4390 4268 4208 4041 2038 331 130 26114 6023 25947 4017 --
NM_001009993chr253102 3019 2836 505 74 13522 195 --
NM_001010846chr193979 3490 3365 3308 3224 1768 1672 1612 1408 139 14078 --
NM_001010861chr142654 2641 447 371 1402 ----
NM_001010862chrX82782 2682 2115 2099 811 185 165 91 ------
NM_001010888chrX84101 3958 3872 1793 1574 1252 1025 813 --13199 13463
NM_001010891chr576236 5781 4984 2341 2144 1671 126 21576 756 14994 --
NM_001010895chr91705 11487 11975 --
NM_001010917chr1042003 663 636 48 --1271 11495
NM_001010924chr101194 ------
NM_001010942chr121176 --1109 --
NM_001010989chr162548 462 ------
NM_001010990chr162548 462 ------
NM_001011513chr454016 3869 3513 1611 340 23680 2535 12663 --
NM_001011515chr42387 40 ------
NM_001011516chr42387 40 ------
NM_001011553chr72753 221 1257 ----
NM_001011666chr776357 5994 5587 5051 1261 499 275 ------
NM_001011885chr151698 1458 11709 --
NM_001012393chr11115143 5003 4993 4130 3936 3930 1967 1802 1256 596 53 34446 3686 1058 ----
NM_001012398chr162245 32 1803 ----
NM_001012418chr664283 3975 3792 2883 793 307 14204 1808 --
NM_001012420chr1532887 873 212 ------
NM_001012423chr1532887 873 212 ------
NM_001012426chr653373 2862 2622 465 440 13160 21171 1002 --
NM_001012427chr653373 2862 2622 465 440 13160 21171 1002 --
NM_001012643chr191391 ------
NM_001012732chr431175 1049 145 ------
NM_001012751chr1041812 1583 1576 409 ----11745
NM_001012753chr1951002 786 348 212 25 6984 462 295 276 194 110 ----
NM_001012755chrX105073 4628 4444 4384 1637 1119 1006 328 247 43 31878 922 524 ----
NM_001012761chr562129 1871 780 570 457 399 22628 2315 --11094
NM_001012968chrX21820 1082 1405 ----
NM_001012980chrX1226 --177 --
NM_001012989chrX1581 1122 ----
NM_001013031chr1083217 2972 2485 1409 1017 645 464 105 ------
NM_001013398chr73492 343 205 1440 ----
NM_001013406chr721435 1177 1387 ----
NM_001013415chr411417 11539 2441 272 --
NM_001013438chr3--1263 11013 --
NM_001013439chr3--1109 1859 --
NM_001013635chr1231137 167 25 1906 ----
NM_001013690chr1292119 1838 1696 1579 1547 865 578 543 295 ------
NM_001013693chr132955 2735 233 --2873 427 2315 165
NM_001013693chr132955 2735 233 --2873 427 2315 165
NM_001013699chr12167 ------
NM_001013843chr152595 111 ------
NM_001014283chr1321944 476 11860 11808 --
NM_001014342chr12664 24 --11811 --
NM_001014380chr13135822 5730 4892 4764 4311 4099 3930 3665 3651 3609 2194 824 397 21888 493 11948 --
NM_001014431chr142958 797 --1781 --
NM_001014432chr142958 797 --1781 --
NM_001014434chr12636 88 ------
NM_001014449chr161241 ------
NM_001014451chr161241 ------
NM_001014797chr10127912 7369 7205 5583 3280 3021 2115 2099 1327 435 270 194 --32291 1046 818 --
NM_001014811chr111118 ------
NM_001014839chr13947 673 63 ------
NM_001014841chr13947 673 63 ------
NM_001015045chr432294 547 421 1634 1529 --
NM_001015053chr1721261 1048 ------
NM_001015508chr84698 303 190 155 ------
NM_001015877chrX52245 2012 1954 496 480 12668 --13130
NM_001015881chrX21191 513 21063 381 ----
NM_001015882chr93749 689 153 ------
NM_001017395chr363578 3138 2636 2486 2309 1232 --12479 12517
NM_001017405chr43827 743 63 1246 ----
NM_001017424chr141281 1211 209 176 ------
NM_001017425chr141281 1211 209 176 ------
NM_001017440chr7147957 7672 7164 5954 5060 3239 3051 2816 2647 2145 2129 1735 1346 1059 1309 32507 1168 1028 11177
NM_001017523chr1261735 1377 1317 388 302 36 11432 1161 --
NM_001017920chr22137 125 ------
NM_001017926chr811835 --1304 --
NM_001017973chr5162 ------
NM_001017974chr5162 ------
NM_001017999chr142272 1948 1887 677 ------
NM_001017999chr142272 1948 1887 677 ------
NM_001018000chr142272 1948 1887 677 ------
NM_001018000chr142272 1948 1887 677 ------
NM_001018001chr142272 1948 1887 677 ------
NM_001018038chr93590 569 107 ------
NM_001018056chr91123 --124 --
NM_001018065chr9126006 5602 5470 5366 5294 4726 3953 3936 3764 789 571 470 23819 1625 ----
NM_001018066chr9126006 5602 5470 5366 5294 4726 3953 3936 3764 789 571 470 23819 1625 ----
NM_001018067chr175026 4972 3515 3506 2106 1835 1674 21493 1170 --13278
NM_001018068chr175026 4972 3515 3506 2106 1835 1674 21493 1170 --13278
NM_001018069chr175026 4972 3515 3506 2106 1835 1674 21493 1170 --13278
NM_001018072chr1261735 1377 1317 388 302 36 11432 1161 --
NM_001018074chr531394 1076 341 13238 21005 390 --
NM_001018075chr531394 1076 341 13238 21005 390 --
NM_001018076chr531394 1076 341 13238 21005 390 --
NM_001018077chr531394 1076 341 13238 21005 390 --
NM_001018090chr1512167 --22513 55 1165
NM_001018091chr1512277 --22623 165 1275
NM_001018100chr151317 ------
NM_001018102chr1512167 --22513 55 1165
NM_001018108chr1562120 1918 1839 1550 1482 684 ------
NM_001018111chr793596 2518 1604 1498 1389 584 430 269 139 12529 21054 911 --
NM_001020658chr121674 1078 1335 ----
NM_001020658chr121674 1078 1335 ----
NM_001023567chr1532279 876 613 ------
NM_001024094chr531394 1076 341 13238 21005 390 --
NM_001024218chr142724 613 ------
NM_001024455chrX51750 1025 984 832 705 --12044 12466
NM_001024593chr104903 846 802 598 --1664 --
NM_001024647chr1276456 6078 5037 2327 1953 419 104 --12491 --
NM_001024649chr552887 2426 1920 1044 328 12315 22356 779 --
NM_001024688chr8----12122 --
NM_001024808chr1232489 979 622 1208 32723 2446 2319 --
NM_001024847chr342307 1669 1660 697 2946 818 ----
NM_001024947chr551116 1032 350 276 52 ------
NM_001024948chr132974 359 146 32924 2741 2342 13212 --
NM_001024956chr11105633 5506 5401 5265 5155 4648 2347 2334 2282 197 1346 ----
NM_001025068chr341441 1417 721 336 21593 1464 ----
NM_001025069chr341441 1417 721 336 21593 1464 ----
NM_001025076chr10106254 5225 4976 4403 4125 2471 1857 1473 676 579 25962 53 42440 2137 195 178 --
NM_001025077chr10107612 6583 6334 5761 5483 2831 2034 1937 966 279 27320 1411 41553 1536 1158 1125 --
NM_001025079chr383132 2646 1308 1234 1104 774 428 80 12902 ----
NM_001025105chr521388 340 ----11283
NM_001025108chr254062 3038 355 227 138 1497 13594 --
NM_001025201chr22542 135 ------
NM_001025266chr374883 1807 1644 1400 1244 222 53 ------
NM_001025580chrX73777 3478 2903 2709 2641 800 66 14302 23628 3165 11485
NM_001025595chr42600 559 ------
NM_001025596chr112154 148 --1166 --
NM_001025603chr14472 452 300 225 --1174 --
NM_001025616chr451888 1721 1204 599 535 ------
NM_001025777chr261609 1499 1029 512 173 121 --11602 --
NM_001029858chr663119 2860 2150 2130 2116 966 2998 338 22994 588 22564 2188
NM_001029859chr1162373 2326 1643 766 190 156 ------
NM_001029860chr8184 ------
NM_001029863chr621007 306 1105 12687 11306
NM_001029875chr522219 666 --11114 --
NM_001029998chr42912 298 ------
NM_001030006chr1722680 1809 1632 1695 --
NM_001030007chr16103804 3338 3155 3046 2481 1090 1006 854 650 155 1465 ----
NM_001031623chr671745 1407 684 480 472 149 34 ------
NM_001031677chr51422 ------
NM_001031679chr1242876 637 428 420 --13150 --
NM_001031680chr142059 1966 1699 436 150 ----
NM_001031684chr231095 412 402 1921 ----
NM_001031690chr782826 2773 2730 2707 2067 1115 737 25 12692 12037 --
NM_001031692chr7------1276
NM_001031695chr2275313 5073 5021 4077 3669 1219 459 --11641 --
NM_001031710chr71852 ------
NM_001031712chr61305 170 ----
NM_001031717chr31854 1105 ----
NM_001031723chr42487 24 ------
NM_001031732chr473150 1296 1282 1129 1093 656 341 13632 ----
NM_001031804chr16114187 3333 3262 1143 1104 945 828 801 776 553 407 13166 23517 3461 --
NM_001031812chr511689 2194 130 ----
NM_001032280chr62633 452 11547 ----
NM_001032282chr821181 486 1920 ----
NM_001032293chr174541 117 101 42 ------
NM_001032393chrX1775 ------
NM_001032394chr662680 2416 1075 746 597 533 2718 113 ----
NM_001032395chr662547 2283 942 613 464 400 1585 ----
NM_001033047chr45851 775 514 243 63 1885 12243 --
NM_001033049chr2122195 1974 --11785 --
NM_001033059chr661779 1642 1575 1420 463 267 ------
NM_001033085chr2171 ------
NM_001033087chr2021322 1016 33264 2435 2233 --22635 722
NM_001033117chr3114373 3867 3644 3399 3267 1687 1418 1268 577 97 61 --1689 11399
NM_001033503chr5190 ------
NM_001033506chr11--1331 ----
NM_001033507chr12420 259 ------
NM_001033518chr782618 2280 678 622 609 338 114 58 ------
NM_001033519chr782618 2280 678 622 609 338 114 58 ------
NM_001033520chr782618 2280 678 622 609 338 114 58 ------
NM_001033561chr173897 885 145 ------
NM_001033564chr621779 1692 197 ----
NM_001033576chr1752493 2290 2264 2023 1911 ------
NM_001033578chr862184 2166 2125 1687 383 277 ------
NM_001033602chr1332209 1937 928 1272 22736 906 --
NM_001033723chr862607 2568 2301 2095 1725 482 ------
NM_001033925chr1022041 1744 1128 ----
NM_001034025chr125962 913 861 328 77 ------
NM_001034837chr51115 --1149 --
NM_001034838chr51115 --1149 --
NM_001034845chr41261 ------
NM_001034850chr511457 21548 1211 ----
NM_001035chr11170 31217 886 827 --1329
NM_001035260chr10--21266 30 ----
NM_001035521chr24792 735 665 577 1811 185 1119
NM_001037132chr732270 1705 649 31881 1772 841 ----
NM_001037133chr732270 1705 649 31881 1772 841 ----
NM_001037164chr731908 1643 1287 31534 788 608 ----
NM_001037172chr321236 1083 ------
NM_001037174chr251892 1777 600 170 51 11502 ----
NM_001037317chr142654 2641 447 371 1402 ----
NM_001037332chr531830 1811 517 22565 2138 ----
NM_001037333chr531830 1811 517 22565 2138 ----
NM_001037334chr1841772 897 599 568 11658 ----
NM_001037339chr141865 1485 369 115 ------
NM_001037340chr141865 1485 369 115 ------
NM_001037341chr141865 1485 369 115 ------
NM_001037341chr141865 1485 369 115 ------
NM_001037533chr11208 ------
NM_001037535chrX21361 55 11198 ----
NM_001037536chrX21361 55 11198 ----
NM_001037540chrX21361 55 11198 ----
NM_001037631chr21432 1261 1982 --
NM_001037954chr1163188 2374 1025 873 635 280 12651 1857 --
NM_001038640chr152943 84 ------
NM_001038702chr562781 2510 2461 2406 960 217 1812 2614 207 --
NM_001038707chr142324 2240 645 613 11692 12170 --
NM_001038707chr142324 2240 645 613 11692 12170 --
NM_001039091chrX51018 940 392 257 121 1316 ----
NM_001039141chr2242140 2071 1107 272 ----11023
NM_001039348chr21912 --1311 --
NM_001039349chr21912 --1311 --
NM_001039459chr731138 879 741 1157 ----
NM_001039538chr242678 2558 337 298 22594 666 13061 --
NM_001039547chr3127750 6912 6843 6110 5817 5217 2842 2503 1497 1290 1214 224 16779 27008 1130 --
NM_001039570chr2284673 4474 4180 4112 3825 3410 3368 439 --14435 --
NM_001039571chr2284673 4474 4180 4112 3825 3410 3368 439 --14435 --
NM_001039590chrX63834 3350 1027 1017 61 47 23141 533 ----
NM_001039591chrX63834 3350 1027 1017 61 47 23141 533 ----
NM_001039618chr1154501 4444 4007 2057 563 184 ----
NM_001039690chr1652061 1892 821 698 253 ------
NM_001039693chr254107 2790 983 977 532 31255 619 453 13931 11524
NM_001039711chr121085 778 ------
NM_001039712chr121085 778 ------
NM_001039840chrX85629 5570 4256 3845 1672 1484 1057 986 56011 5874 5332 1726 1018 --1841
NM_001039937chr1393255 3102 2854 1082 855 768 605 74 37 54181 3561 2620 1072 317 33927 2649 163 --
NM_001039960chr1231488 1312 498 21728 1108 11530 --
NM_001040001chr642034 1687 1438 344 21407 1309 ----
NM_001040101chr441554 1376 375 53 ----1239
NM_001040110chr761736 1549 1408 720 120 96 ------
NM_001040113chr164877 812 790 150 1973 ----
NM_001040135chr72722 298 ------
NM_001040142chr211951 11619 ----
NM_001040143chr211951 11619 ----
NM_001040144chr1652061 1892 821 698 253 ------
NM_001040146chr1652061 1892 821 698 253 ------
NM_001040152chr774035 3218 2058 1652 1602 1437 93 23175 1248 --23484 1339
NM_001040153chr13----1897 --
NM_001040159chr431462 300 75 ------
NM_001040172chr561473 1467 1319 1160 1126 382 --11336 11198
NM_001040173chr561473 1467 1319 1160 1126 382 --11336 11198
NM_001040214chr631936 1585 499 --2286 36 --
NM_001040272chr922339 1852 1150 ----
NM_001040284chr16105978 5668 5573 5201 4689 4385 4172 1223 1047 919 13711 --14933
NM_001040409chr22939 382 --1990 --
NM_001040429chr1353263 2356 634 499 307 22957 2726 ----
NM_001040432chr31129 ------
NM_001040441chr164164 4156 3954 1276 292 108 1257 ----
NM_001040446chr532263 1106 344 22044 962 22064 132 --
NM_001040450chr1552304 876 709 334 159 1558 12497 --
NM_001040453chr1552304 876 709 334 159 1558 12497 --
NM_001040619chr121014 127 1350 ----
NM_001040633chr7----1213 --
NM_001040665chr774854 4814 4567 4271 4103 1823 1802 43956 3847 3411 3369 1855 --
NM_001040666chr73556 516 269 ------
NM_001040708chr8--1114 ----
NM_001040709chr171930 1608 816 775 537 424 365 --42437 969 643 70 22021 1876
NM_001040712chr923016 3007 ------
NM_001042355chr1674473 3350 3267 1852 1602 1256 521 24965 2019 24593 1204 --
NM_001042357chr1061462 1104 962 585 377 199 ------
NM_001042358chr1061462 1104 962 585 377 199 ------
NM_001042360chr1061462 1104 962 585 377 199 ------
NM_001042361chr1071493 1135 993 616 408 230 24 ------
NM_001042363chr1061462 1104 962 585 377 199 ------
NM_001042364chr1071493 1135 993 616 408 230 24 ------
NM_001042365chr1071493 1135 993 616 408 230 24 ------
NM_001042383chr372939 2629 2461 2402 955 365 236 ------
NM_001042387chr1071493 1135 993 616 408 230 24 ------
NM_001042388chr181210 --1105 --
NM_001042389chr1061462 1104 962 585 377 199 ------
NM_001042390chr1061462 1104 962 585 377 199 ------
NM_001042392chr1061462 1104 962 585 377 199 ------
NM_001042393chr1071493 1135 993 616 408 230 24 ------
NM_001042395chr1061462 1104 962 585 377 199 ------
NM_001042396chr1071493 1135 993 616 408 230 24 ------
NM_001042397chr1071493 1135 993 616 408 230 24 ------
NM_001042399chr122487 390 ------
NM_001042404chr141893 1448 1250 298 1757 1520 --
NM_001042406chr611238 2829 809 ----
NM_001042412chr1674473 3350 3267 1852 1602 1256 521 24965 2019 24593 1204 --
NM_001042413chr952579 2533 848 55 36 22604 1517 13189 --
NM_001042414chr131228 ------
NM_001042425chr62633 452 11547 ----
NM_001042453chrX4473 312 298 107 ------
NM_001042486chr2031489 437 84 1124 ----
NM_001042492chr1763432 2372 2294 1120 500 373 ------
NM_001042506chrX3892 521 453 11442 ----
NM_001042510chr851846 808 356 55 31 ------
NM_001042511chr851846 808 356 55 31 ------
NM_001042517chr132729 95 ------
NM_001042537chrX52299 1920 1830 665 539 21966 236 22023 1658 --
NM_001042543chr41573 21582 1542 ----
NM_001042555chr1274771 4608 3373 3109 1313 311 31 2846 561 ----
NM_001042599chr257599 7571 4776 1523 1304 57078 1292 993 857 584 --15452
NM_001042601chr332947 621 289 12183 ----
NM_001042603chr1264842 4657 4502 4266 457 53 --11393 1116
NM_001042604chr374648 4605 3809 1869 1581 789 48 11446 --13436
NM_001042631chr192513 441 ------
NM_001042632chr2042423 599 181 59 11653 ----
NM_001042633chr2042423 599 181 59 11653 ----
NM_001042669chr451888 1721 1204 599 535 ------
NM_001042681chr162144 2082 1933 915 103 62 1494 --12352
NM_001042682chr162144 2082 1933 915 103 62 1494 --12352
NM_001042682chr162144 2082 1933 915 103 62 1494 --12352
NM_001042683chr621566 28 21167 48 --1411
NM_001043318chr1464154 2669 1294 1278 1117 572 23401 1531 ----
NM_001043351chr162335 1806 395 297 212 98 ----21626 82
NM_001044305chr631677 1389 1082 ------
NM_001044385chr233282 3035 1330 1400 24011 3919 --
NM_001044722chr511689 2194 130 ----
NM_001044723chr511689 2194 130 ----
NM_001046chr562293 1897 867 665 337 105 32489 405 68 ----
NM_001068chr3172 ------
NM_001071775chr1331742 1522 1475 ------
NM_001078chr11669 ----1555
NM_001083620chr432485 258 183 ------
NM_001083621chr142920 1170 489 26 31701 1061 797 ----
NM_001087chr2--1252 1120 --
NM_001092chr1752427 2004 1733 387 359 ------
NM_001096chr171241 ------
NM_001099678chr395868 5681 5191 4275 2474 2251 1486 561 288 44097 1706 915 95 14179 --
NM_001100108chr1117761 7544 7097 6835 6046 3328 2206 1414 1263 1094 670 26534 6351 ----
NM_001106chr3229578 8832 8611 7990 7801 7415 7292 6840 6060 3447 3433 3073 2899 2865 2756 2429 1600 870 759 459 431 130 --23789 1193 --
NM_001113490chrX92688 2653 2446 2300 2233 1207 982 801 126 --12788 --
NM_001117chr1832478 2236 2003 11667 11839 --
NM_001121chr1021797 121 21613 159 21313 295 --
NM_001126chr1----153 --
NM_001128chr16103804 3338 3155 3046 2481 1090 1006 854 650 155 1465 ----
NM_001131chr65823 367 337 173 127 ------
NM_001140chr173221 186 129 ------
NM_001144chr161179 ------
NM_001149chr1011206 1222 ----
NM_001156chr102544 506 2446 253 ----
NM_001160chr1222306 573 1185 ----
NM_001167chrX166675 6407 5901 5448 4850 4706 2525 2309 2241 1939 1759 1246 1008 832 823 70 25994 4909 11172 --
NM_001198chr641875 1649 884 308 ------
NM_001200chr201120 1953 ----
NM_001201chr423748 3522 --11010 --
NM_001202chr141192 ------
NM_001204chr2217465 6744 6570 6453 5704 5392 4799 4788 2874 2530 2253 1867 1843 1548 1530 1417 1322 1271 1164 777 679 66285 6266 6128 5858 5755 1038 ----
NM_001206chr943010 1969 720 493 ------
NM_001222chr1041858 1409 369 48 32010 1504 1307 ----
NM_001241chr232437 879 742 32297 1714 836 ----
NM_001241chr232437 879 742 32297 1714 836 ----
NM_001248chr32957 912 186 1807 --
NM_001256chr1772487 2389 2171 1018 972 883 249 32123 771 136 --1428
NM_001257chr1641410 1183 212 185 --1260 --
NM_001259chr7156230 5985 5853 5496 4960 4632 2541 2083 1501 1355 1225 1080 1048 774 465 --24640 110 --
NM_001262chr12306 65 1356 1229 --
NM_001270chr531100 443 31 --1102 --
NM_001271chr1543116 2688 375 160 11068 --1330
NM_001273chr123113 98 52 --143 --
NM_001275chr14----1319 --
NM_001277chr1121035 906 ------
NM_001280chr193187 133 110 ------
NM_001282chr1722680 1809 1632 1695 --
NM_001284chr52502 450 ------
NM_001290chr44917 813 406 279 ----1217
NM_001299chr191482 ------
NM_001304chr1793738 3509 2731 2722 2486 1531 1459 1387 879 43713 1509 1267 195 12361 --
NM_001310chr1262387 1961 790 688 401 169 23028 182 ----
NM_001315chr65829 573 461 220 51 21916 730 ----
NM_001319chr193198 58 30 ------
NM_001329chr1011481 11658 11634 --
NM_001331chr1172062 2018 1764 821 463 315 146 21755 352 --11946
NM_001332chr51239 ------
NM_001343chr561075 465 319 303 174 50 --1576 --
NM_001344chr143247 240 190 ------
NM_001346chr342116 1154 667 295 --11039 --
NM_001351chr331769 1681 1280 ------
NM_001356chrX22027 877 ------
NM_001364chr11104363 3337 2930 2895 1918 1610 1415 1356 1214 390 --13217 --
NM_001386chr821599 348 22300 322 ----
NM_001389chr212439 63 ----1247
NM_001390chr1883243 3225 3088 2553 2425 1376 1184 415 --1880 11079
NM_001394chr81243 --1569 --
NM_001396chr2152710 973 955 836 830 2566 206 ----
NM_001399chrX93344 3102 2468 1402 1217 1074 789 239 186 13431 1174 --
NM_001400chr111321 ------
NM_001401chr951458 1343 1064 615 302 --11415 --
NM_001407chr351367 1100 418 231 213 ------
NM_001412chrX53141 3040 2595 1409 718 33780 3641 1377 ----
NM_001417chr1251977 1868 1448 398 125 --1116 --
NM_001419chr19123987 3882 3832 3612 3518 3212 3143 1756 1300 1237 1051 378 --24152 951 --
NM_001420chr1923138 2078 ------
NM_001421chrX11536 11268 11567 1200
NM_001426chr22542 297 ------
NM_001429chr223971 710 55 ------
NM_001431chr63956 804 162 ------
NM_001438chr141413 335 204 192 --2502 21 --
NM_001440chr862814 2660 1921 1869 527 79 ------
NM_001448chrX2150 79 21631 1498 --11357
NM_001460chr133472 1004 167 33262 3067 52 1148 --
NM_001463chr21333 ------
NM_001482chr152871 669 ------
NM_001491chr682409 2052 1800 1786 806 298 80 73 21025 960 ----
NM_001494chr101147 ------
NM_001497chr962736 2515 2213 2167 2082 421 --1581 12579
NM_001498chr621166 981 --1921 --
NM_001521chr24792 735 665 577 1811 185 1119
NM_001527chr654579 4117 3762 1233 285 11484 13151 --
NM_001530chr1441162 403 364 270 ------
NM_001542chr14812 531 469 440 --12458 --
NM_001543chr584215 3897 3019 2963 1945 1625 1193 646 23716 566 24824 3956 --
NM_001546chr631234 478 347 1179 --11328
NM_001560chrX22281 35 125 1953 --
NM_001604chr11--1219 1180 --
NM_001609chr10124407 3969 3592 3483 3345 3302 3169 3016 2917 1776 1570 153 ----13202
NM_001616chr243128 2916 2377 284 ------
NM_001621chr732495 1129 715 1936 ----
NM_001621chr732495 1129 715 1936 ----
NM_001622chr33303 277 84 --1362 --
NM_001634chr661779 1642 1575 1420 463 267 ------
NM_001635chr721090 310 31101 993 51 ----
NM_001650chr1833069 2891 262 ------
NM_001655chr1112076 2764 308 ----
NM_001656chr521314 612 1553 ----
NM_001659chr1242666 2389 2198 1068 21013 900 12229 --
NM_001660chr3--2756 277 ----
NM_001663chr1442424 1091 965 92 --2588 539 --
NM_001668chr172265 1948 1686 1483 682 637 255 ------
NM_001677chr121119 821 ------
NM_001681chr121691 ------
NM_001682chr1232447 2029 842 ----11061
NM_001683chr331834 1748 1733 1346 --12075
NM_001690chr352374 2094 1958 701 684 22568 1739 ----
NM_001693chr861292 1043 973 324 179 84 --11068 --
NM_001695chr843709 3374 937 719 33458 1699 449 1665 --
NM_001699chr1951793 1755 1224 79 71 21433 494 ----
NM_001701chr931442 1113 240 --21354 54 --
NM_001706chr31319 ------
NM_001709chr1142697 2240 1863 424 ------
NM_001717chr151125 ------
NM_001718chr621176 104 ------
NM_001731chr122745 186 ------
NM_001742chr71346 ------
NM_001746chr552887 2426 1920 1044 328 12315 22356 779 --
NM_001748chr12937 295 ------
NM_001753chr771557 1441 662 562 555 234 138 11454 ----
NM_001754chr2184245 3668 3602 3061 2851 2837 663 44 13842 ----
NM_001755chr1621729 623 22302 1590 1922 --
NM_001759chr1284972 3770 3218 1239 875 545 348 139 ------
NM_001777chr383132 2646 1308 1234 1104 774 428 80 12902 ----
NM_001781chr122274 101 1809 1851 --
NM_001788chr72753 221 1257 ----
NM_001792chr181256 ------
NM_001797chr162184 24 1572 ----
NM_001800chr19172 ------
NM_001806chr1962751 2348 1181 1010 724 21 11103 ----
NM_001822chr22542 135 ------
NM_001829chr41880 ------
NM_001830chrX83912 3517 3194 2907 2778 2678 1575 1098 1152 ----
NM_001833chr91107 ------
NM_001839chr11582 1785 ----
NM_001844chr122143 58 ------
NM_001851chr61294 2124 99 ----
NM_001858chr665115 4120 3142 953 905 369 ------
NM_001859chr933205 2732 24 13498 ----
NM_001873chr42500 135 ------
NM_001874chr12105119 4782 4672 4567 4097 2043 2028 1699 1228 93 13530 2382 117 --
NM_001884chr51500 ------
NM_001892chr521388 340 ----11283
NM_001894chr2241224 1018 953 829 1234 ----
NM_001903chr51791 ------
NM_001921chr431175 1049 145 ------
NM_001924chr12169 57 ------
NM_001931chr112506 255 --11292 --
NM_001938chr131883 1802 1747 ------
NM_001939chrX93586 3438 2769 2403 1102 738 488 262 81 3607 233 71 21129 639 --
NM_001942chr1831875 1394 288 11262 ----
NM_001945chr531098 346 304 1174 --1238
NM_001946chr123815 733 340 1913 ----
NM_001949chr673210 2747 810 617 425 398 91 ------
NM_001951chr84554 500 139 98 ------
NM_001955chr611098 1183 ----
NM_001977chr421402 373 21277 282 ----
NM_001980chr1282223 2153 1910 1535 877 596 258 120 --1740 --
NM_001981chr141778 1576 612 316 21877 223 ----
NM_001982chr121196 ----11224
NM_001993chr14877 746 354 249 ------
NM_001995chr44496 350 313 221 ----166
NM_001999chr51133 ------
NM_002006chr475492 5237 4799 3838 2185 1501 251 35323 4923 3580 24691 4152 --
NM_002009chr1522714 1868 22355 2056 ----
NM_002010chr13------1497
NM_002014chr12------1106
NM_002015chr1322322 2188 --12499 --
NM_002017chr1151328 1236 1168 120 73 ------
NM_002024chrX21653 879 21942 837 11784 --
NM_002025chrX108880 8494 8036 7411 6084 2745 2518 2068 1785 1126 67336 7049 5699 3254 2889 490 27227 626 --
NM_002026chr241031 900 727 427 ------
NM_002039chr42687 679 --1129 --
NM_002040chr2153035 956 930 162 88 22586 69 11009 12674
NM_002044chr1531164 235 82 --2555 59 --
NM_002045chr31345 ------
NM_002048chr931064 477 376 ------
NM_002051chr101317 ------
NM_002052chr811372 ------
NM_002054chr22420 406 127 ----
NM_002063chrX2968 870 --127 --
NM_002068chr193685 664 469 1547 ----
NM_002069chr721401 300 --1173 --
NM_002072chr92981 888 1690 ----
NM_002074chr131668 1562 138 ------
NM_002077chr942053 2006 1516 608 ------
NM_002078chr3------151
NM_002081chr231464 377 41 ------
NM_002087chr171304 ------
NM_002114chr61537 ------
NM_002126chr1743763 3259 2949 81 24138 558 ----
NM_002128chr1332279 2059 1597 31746 819 321 ----
NM_002137chr75948 714 705 535 365 12005 ----
NM_002139chrX1256 --1194 --
NM_002146chr1731450 1378 510 ------
NM_002148chr21159 1104 ----
NM_002156chr21435 125 ----
NM_002158chr293083 2965 2365 2319 1406 1359 1131 1116 727 32863 2701 1084 ----
NM_002167chr11417 --1437 --
NM_002192chr71449 ------
NM_002202chr51252 11076 ----
NM_002207chr3284 60 1757 ----
NM_002210chr292662 2186 1374 1273 1264 484 404 157 70 --12800 --
NM_002211chr101894 --2788 252 --
NM_002213chr32480 244 --1118 --
NM_002214chr774618 3666 2301 1866 1569 1040 182 25533 2218 ----
NM_002222chr321341 32 1469 ----
NM_002227chr111332 ------
NM_002228chr151228 1195 891 503 282 ------
NM_002232chr11990 11280 1429 11382
NM_002234chr123703 670 556 ------
NM_002247chr104916 906 642 79 ------
NM_002252chr21110 ------
NM_002254chr252272 2101 539 441 405 ------
NM_002264chr354844 1576 1295 1198 1158 33588 630 623 ----
NM_002267chr1332248 2094 2021 --12070 --
NM_002268chr321620 444 31360 629 379 ----
NM_002270chr5155345 5096 4808 4642 4364 3644 2173 1932 1724 1432 1398 1100 698 571 507 14593 ----
NM_002285chr254062 3038 355 227 138 1497 13594 --
NM_002293chr152389 1890 1109 715 246 12669 12655 --
NM_002317chr51359 ------
NM_002334chr1132080 1868 796 1140 12040 --
NM_002336chr1274880 4836 4390 4123 4049 3698 3157 31057 684 454 ----
NM_002349chr221234 129 --11595 --
NM_002351chrX2553 163 11543 ----
NM_002355chr1291416 1282 1234 1146 1108 945 907 164 144 --1933 --
NM_002356chr672295 2218 1819 862 761 345 250 11042 1905 --
NM_002372chr53551 219 47 1700 1574 --
NM_002374chr242678 2558 337 298 22594 666 13061 --
NM_002380chr81397 ------
NM_002382chr141426 ------
NM_002387chr553967 3768 1758 1475 398 24030 699 --14118
NM_002397chr542203 2139 835 375 ------
NM_002398chr211141 ----1453
NM_002399chr1521123 916 11359 1379 --
NM_002408chr141585 2571 326 ----
NM_002442chr1221361 488 ----11220
NM_002444chrX51773 1434 625 463 287 1672 --1681
NM_002467chr81157 ------
NM_002469chr121412 --123 --
NM_002480chr1231283 1237 973 1389 ----
NM_002481chr1167850 7584 7542 7268 6866 6285 5985 5352 4906 2961 2835 1254 988 914 573 76 21313 171 13074 --
NM_002485chr8----12122 --
NM_002489chr72437 291 ------
NM_002495chr5------1110
NM_002499chr1592411 2212 2083 2008 1793 1633 900 867 173 2410 348 ----
NM_002500chr22472 421 ------
NM_002501chr1923603 351 --21212 377 11141
NM_002515chr1421637 1620 ------
NM_002519chr1141327 1300 1230 1101 2433 106 ----
NM_002520chr51102 ------
NM_002522chr1772927 2523 2393 1321 1110 509 358 13061 21012 833 12574
NM_002527chr12------1103
NM_002538chr53523 74 55 ------
NM_002545chr11115143 5003 4993 4130 3936 3930 1967 1802 1256 596 53 34446 3686 1058 ----
NM_002547chrX53774 3705 1322 923 76 1131 1655 --
NM_002563chr33831 253 85 ------
NM_002576chr1131184 135 37 --1907 --
NM_002577chr384034 3693 2946 891 872 632 306 179 ------
NM_002581chr9105155 5088 4574 4444 4250 1656 1228 1195 816 604 ------
NM_002583chr122529 418 1388 ----
NM_002586chr631287 1161 393 ------
NM_002589chr41341 --150 --
NM_002590chr131229 ------
NM_002591chr201477 2584 25 ----
NM_002597chr11332 ------
NM_002599chr1141122 352 200 139 ------
NM_002600chr141865 1485 369 115 ------
NM_002605chr152400 152 11108 ----
NM_002623chr20196 ------
NM_002645chr1162783 2331 2002 376 288 195 22575 2396 11041 --
NM_002646chr151762 783 664 494 465 --1723 --
NM_002649chr741424 1154 676 439 --21442 622 --
NM_002655chr8114404 4254 3993 3737 3665 1516 1086 843 359 319 244 53654 3635 3237 3209 1344 ----
NM_002656chr621041 760 1424 ----
NM_002657chr20113739 3615 3182 3076 2473 2441 1366 850 824 506 399 12597 --13461
NM_002661chr161197 ------
NM_002667chr61181 1816 ----
NM_002668chrX1140 ------
NM_002687chr1441205 1186 1112 69 ------
NM_002697chr11265 ------
NM_002698chr1912531 ------
NM_002699chr11126 ------
NM_002707chr2--1365 ----
NM_002709chr253589 3533 860 554 142 43342 891 254 116 ----
NM_002710chr1231065 736 310 155 ----
NM_002713chr131013 289 87 11051 1261 --
NM_002716chr1153624 3302 2349 1413 25 196 13047 --
NM_002718chr382684 2567 2488 1849 663 530 237 95 1390 22383 618 --
NM_002719chr1431756 421 336 22271 308 ----
NM_002731chr13557 441 228 23180 2630 ----
NM_002734chr1731809 1746 222 ----1786
NM_002736chr761609 781 594 512 228 182 ------
NM_002737chr1776193 6085 5362 2015 1638 322 94 --32660 1990 1752 --
NM_002740chr362802 2321 2179 2029 523 124 --12155 --
NM_002742chr142722 715 ------
NM_002745chr2244370 3599 1653 487 11661 --14130
NM_002748chr15----1149 --
NM_002750chr10173 ------
NM_002764chrX3886 275 232 1663 1802 --
NM_002765chrX51018 940 392 257 121 1316 ----
NM_002787chr74654 269 167 83 ------
NM_002808chr31151 ------
NM_002816chr171275 ------
NM_002822chr1261807 1229 653 553 356 336 ------
NM_002825chr71542 ------
NM_002828chr181818 ------
NM_002834chr1231537 1394 139 13326 33056 1104 577 21466 45
NM_002835chr7--1272 ----
NM_002837chr1254386 3593 3272 1846 1739 21328 1202 ----
NM_002839chr923016 3007 ------
NM_002843chr1122900 1312 12118 ----
NM_002844chr651269 988 349 295 117 ------
NM_002847chr73366 282 69 ------
NM_002849chr1211072 2984 896 ----
NM_002851chr7--2717 119 ----
NM_002858chr121110 338 ------
NM_002865chr81119 ------
NM_002868chr12112291 2262 2232 2206 1844 1816 1651 922 601 262 248 ------
NM_002869chr11294 24 41697 1433 1426 663 ----
NM_002871chr161319 1285 453 354 93 64 ------
NM_002874chr932306 1838 588 ------
NM_002886chr354536 4025 3264 1451 1000 24748 1051 14974 --
NM_002890chr51264 1310 ----
NM_002892chr14--1396 ----
NM_002893chrX--1141 ----
NM_002894chr18--1161 195 --
NM_002895chr203963 275 76 134 ----
NM_002902chr151644 2463 451 ----
NM_002906chr1131759 1630 63 22427 2022 1922 --
NM_002911chr1921399 598 ----1517
NM_002912chr61216 183 ----
NM_002918chr1941119 884 762 745 ------
NM_002924chr11557 ------
NM_002938chr451659 1515 1334 1264 361 11353 --11402
NM_002956chr1221211 287 11165 --1144
NM_002959chr164459 4171 3679 3488 1644 1134 13857 33603 3204 326 --
NM_002968chr1611007 2884 833 ----
NM_002971chr33402 347 87 1117 ----
NM_002977chr263273 2375 1268 1202 1118 506 1690 ----
NM_002994chr421498 655 21588 458 ----
NM_002997chr261537 1383 1333 1293 654 556 --21821 231 --
NM_002998chr851932 1700 1496 357 79 11360 1699 --
NM_002999chr2081972 1327 1278 572 557 231 130 30 --1397 --
NM_003011chr931191 470 27 ------
NM_003016chr1771842 1785 1514 1343 1291 780 136 21472 1412 ----
NM_003017chr631373 1233 568 ------
NM_003026chr93950 463 135 1830 ----
NM_003027chr152113 30 ------
NM_003030chr331947 1744 1578 --1707 11531
NM_003031chr161787 ------
NM_003034chr1297922 7779 7224 7170 5902 5875 5611 2713 719 1154 --23190 3140
NM_003037chr1----126 --
NM_003042chr33398 264 83 --1227 --
NM_003043chr354102 3231 1564 1514 510 --1381 --
NM_003045chr1384915 4061 3766 3377 1553 421 409 334 24184 3330 1361 1751
NM_003046chr864456 4395 4232 3967 3576 559 ------
NM_003051chr141959 1618 1510 661 ------
NM_003068chr821069 273 ------
NM_003069chrX1557 1202 ----
NM_003071chr332103 1434 293 --21499 336 --
NM_003076chr1241638 1123 1115 441 ------
NM_003079chr175919 368 322 209 171 ------
NM_003081chr2011071 ------
NM_003085chr51408 --1107 --
NM_003095chr12----2310 278 --
NM_003106chr32834 315 ------
NM_003107chr642606 1673 892 208 ------
NM_003108chr2107337 6808 6625 6348 5702 5212 4870 2151 1306 1149 --16889 11025
NM_003112chr782867 2338 647 588 338 316 274 51 1262 ----
NM_003113chr22813 204 1313 ----
NM_003118chr53643 377 204 ------
NM_003128chr232630 495 37 1469 ----
NM_003129chr8160 ------
NM_003131chr632037 1754 1449 21588 1506 21946 344 --
NM_003133chr1121 ------
NM_003137chr692077 1856 1531 1416 641 483 272 210 115 22105 651 12084 --
NM_003142chr2149 ------
NM_003144chr632234 2225 656 1577 ----
NM_003146chr114414 268 260 33 1365 ----
NM_003155chr83916 616 602 ------
NM_003161chr1763250 1433 1391 1245 1141 248 ------
NM_003178chr34591 446 295 289 ----1473
NM_003184chr8--1861 121 --
NM_003185chr2051200 1131 964 462 24 11289 1240 --
NM_003188chr6144 ------
NM_003189chr163214 3099 2825 692 553 120 23036 487 13303 --
NM_003199chr18105634 5095 4999 4956 3814 3647 1639 1096 708 612 --1228 --
NM_003201chr1031002 261 108 ------
NM_003206chr61357 ------
NM_003216chr2273254 3176 2447 2407 1217 940 504 11192 ----
NM_003217chr1252038 1903 1750 583 198 21582 597 ----
NM_003220chr62633 452 11547 ----
NM_003221chr693871 3769 3537 3369 3336 3194 2800 625 546 33393 3187 2745 ----
NM_003222chr202928 405 1135 ----
NM_003234chr352450 1845 956 796 607 42125 1676 1502 509 21823 434 --
NM_003236chr232614 2362 549 12913 1105 1149
NM_003239chr1431045 773 114 --1249 --
NM_003242chr342307 1669 1660 697 2946 818 ----
NM_003246chr1531971 219 56 ------
NM_003247chr631432 247 116 1169 ----
NM_003253chr2151610 1572 1452 1342 222 11243 ----
NM_003255chr1732166 2135 1637 12274 12566 --
NM_003257chr1531051 1011 84 ------
NM_003262chr375058 4624 4047 1165 943 878 273 23815 1727 ----
NM_003270chrX51126 790 446 378 255 2872 37 ----
NM_003274chr2162975 2878 2451 2046 1845 1188 12703 --195
NM_003288chr201599 ------
NM_003290chr193402 289 94 ------
NM_003298chr3125917 5586 4961 4818 4500 4436 4145 2187 1218 1044 1024 422 15189 25259 3944 --
NM_003305chr4--2126 111 ----
NM_003317chr141101 ------
NM_003320chr1144464 3255 1499 1015 24101 4080 23567 97 --
NM_003336chrX31066 969 127 11008 ----
NM_003337chr541662 1438 1407 434 11133 ----
NM_003338chr103790 780 598 31919 1890 262 ----
NM_003339chr541491 648 642 109 ------
NM_003342chr1743106 2759 848 539 1238 --12988
NM_003344chr721558 161 ------
NM_003347chr2231517 382 135 22107 295 ----
NM_003348chr1221502 1146 1122 --11065
NM_003352chr24970 935 906 254 --1326 1382
NM_003360chr42279 232 ------
NM_003369chr1142399 580 274 133 1557 1682 --
NM_003383chr91123 --124 --
NM_003390chr112124 88 1408 1917 --
NM_003392chr343512 3185 1018 234 --13415 --
NM_003403chr142805 42 ------
NM_003404chr2021631 818 1767 1110 --
NM_003407chr191508 ------
NM_003409chr181156 ------
NM_003410chrX52284 2067 824 141 38 22647 2406 ----
NM_003411chrY61641 1581 1348 1326 664 35 1592 11821 --
NM_003412chr342362 1113 982 175 12719 11248 --
NM_003413chrX--11681 11785 --
NM_003417chr19139678 9058 8587 8138 7584 6867 6858 6041 3885 2098 1431 1233 421 26783 140 12105 --
NM_003418chr3----1161 --
NM_003430chr19--1250 ----
NM_003452chr91650 ------
NM_003453chr132568 62 ------
NM_003457chr174541 117 101 42 ------
NM_003458chr353941 3778 3371 2905 2601 1297 33194 2458 252 --
NM_003462chr151787 1714 1396 650 405 --1440 11612
NM_003468chr274205 3827 3026 1352 1255 302 222 191 ----
NM_003471chr331879 692 655 3913 517 304 ----
NM_003473chr102859 167 ------
NM_003478chr1142830 2716 2542 96 1625 --1384
NM_003482chr1232559 2234 1116 ------
NM_003483chr1252386 2087 537 195 44 21861 106 12773 --
NM_003488chr17--11010 ----
NM_003489chr2132949 1050 29 23193 1295 22215 1114 --
NM_003506chr841327 1273 948 263 ------
NM_003566chr1232495 1121 487 2932 897 ----
NM_003574chr1885654 5373 5316 4062 1976 1955 1212 484 ------
NM_003580chr82465 138 ------
NM_003582chr12217 49 ------
NM_003583chr1233458 2946 1254 22977 206 ----
NM_003590chr231046 595 572 32461 1240 1068 12706 12972
NM_003597chr282259 2190 2180 923 546 537 441 322 11449 ----
NM_003603chr452034 1489 1429 1401 714 21610 582 ----
NM_003607chr164373 3860 3726 3670 3234 963 162 1203 --
NM_003615chr343393 2825 2486 970 33447 1142 623 ----
NM_003617chr184815 3807 3157 3105 3098 1235 669 82 43080 997 567 239 21049 191 --
NM_003628chr2----1185 --
NM_003629chr153469 3211 2770 1393 943 22858 565 ----
NM_003633chr562156 1867 1700 634 626 579 --1325 --
NM_003637chr14416 390 357 138 --11495 --
NM_003642chr2171 ------
NM_003648chr241848 1709 235 221 --12636 --
NM_003663chr353429 2751 2497 1368 905 21383 490 ----
NM_003664chr52353 180 ------
NM_003670chr321390 211 1424 ----
NM_003671chr963314 2940 2374 2336 1068 458 1492 12921 1347
NM_003672chr121922 109 21420 148 ----
NM_003677chr122781 68 --1418 --
NM_003679chr122910 2803 1538 23448 2534 --
NM_003680chr12500 248 ------
NM_003701chr134944 832 271 145 ------
NM_003705chr2--1846 ----
NM_003713chr161704 1289 1253 568 467 314 --21303 154 --
NM_003716chr3------1169
NM_003718chr73545 168 46 2453 215 ----
NM_003722chr372673 2477 2200 1839 599 296 81 2197 73 ----
NM_003728chr41504 ------
NM_003743chr221461 210 22045 1910 ----
NM_003749chr133833 682 554 1814 1304 --
NM_003750chr10--1311 ----
NM_003754chr111139 ------
NM_003759chr454241 3507 3230 3070 477 34026 2658 364 ----
NM_003761chr2----1304 --
NM_003763chr2043132 2824 2118 130 --1223 --
NM_003766chr171170 ------
NM_003774chr1243334 2585 1219 600 --12862 12725
NM_003783chr111136 ------
NM_003794chr311051 2961 851 ----
NM_003816chr821424 1176 ------
NM_003822chr152512 2484 2194 1168 821 1785 11204 --
NM_003825chr1531306 190 66 1429 ----
NM_003831chr1821459 1297 1694 ----
NM_003842chr852030 702 696 398 44 --41911 1833 1715 30 --
NM_003850chr131209 1441 ----
NM_003861chr1492850 2508 2324 2140 1803 1096 1049 803 590 --1365 1536
NM_003872chr252489 2089 2058 1223 389 ------
NM_003873chr1022293 75 --11832 --
NM_003884chr33745 506 430 ------
NM_003885chr1731076 857 112 22154 505 ----
NM_003887chr251512 904 791 548 444 1472 --1375
NM_003888chr1541673 1441 1066 339 --21458 361 --
NM_003893chr101336 ------
NM_003895chr2121577 867 41407 761 334 114 1643 --
NM_003899chr1362427 2102 1744 1670 852 304 12332 ----
NM_003902chr15722 631 531 91 53 2581 313 ----
NM_003913chr6114211 3647 3422 1675 1635 1368 1147 1104 1050 803 647 1749 ----
NM_003919chr72247 220 ------
NM_003921chr141723 1699 1589 59 ------
NM_003927chr182742 21 11051 132 --
NM_003934chr9188 ------
NM_003939chr1094055 3632 2720 2694 1509 1380 818 684 632 --33316 2780 2586 --
NM_003941chr762303 1978 1710 1667 432 56 ----12443
NM_003947chr311355 ------
NM_003949chr1751925 1597 675 614 80 --1448 1483
NM_003953chr172462 1856 1104 952 473 382 263 12257 --12856
NM_003955chr171368 1361 ----
NM_003958chr683891 3648 3619 2985 2779 1127 509 158 ------
NM_003966chr5197689 7258 7215 7171 7100 6997 6302 5846 4750 4744 2802 2702 2259 1569 1227 887 745 496 387 36215 5713 355 12634 22513 2232
NM_003971chr17--2529 523 ----
NM_003980chr621048 387 11103 --11004
NM_003983chr16104392 4249 3687 3452 3286 3223 2713 1446 883 425 ------
NM_003987chr101590 12235 1512 --
NM_003988chr101667 12312 1589 --
NM_003989chr101526 12171 1448 --
NM_003990chr101526 12171 1448 --
NM_003994chr1243504 1633 146 29 13826 ----
NM_003995chr91214 ------
NM_004004chr132418 114 1296 ----
NM_004006chrX2929 750 --12156 --
NM_004007chrX2929 750 --12156 --
NM_004009chrX2929 750 --12156 --
NM_004010chrX2929 750 --12156 --
NM_004011chrX2929 750 --12156 --
NM_004012chrX2929 750 --12156 --
NM_004013chrX2929 750 --12156 --
NM_004014chrX2929 750 --12156 --
NM_004015chrX2929 750 --12156 --
NM_004016chrX2843 664 --12070 --
NM_004017chrX2929 750 --12156 --
NM_004018chrX2843 664 --12070 --
NM_004020chrX2929 750 --12156 --
NM_004021chrX2843 664 --12070 --
NM_004022chrX2843 664 --12070 --
NM_004023chrX2843 664 --12070 --
NM_004028chr1833069 2891 262 ------
NM_004034chr102544 506 2446 253 ----
NM_004035chr1764976 4873 4265 3877 3201 285 13591 14866 --
NM_004036chr23645 629 104 1130 2607 75 --
NM_004040chr21979 ------
NM_004050chr1432720 2497 738 ----12080
NM_004061chr52572 558 ------
NM_004075chr121531 ------
NM_004081chrY41708 1570 1306 198 ----1408
NM_004083chr12147 --1211 --
NM_004087chr31395 11448 --1552
NM_004089chrX21191 513 21063 381 ----
NM_004090chr1783018 2818 2671 1216 747 639 489 155 11369 11228 13126
NM_004093chr1332817 2720 184 ------
NM_004096chr1032014 1442 693 --21360 295 --
NM_004098chr101489 ------
NM_004099chr971969 1963 1895 1481 1326 384 23 12121 ----
NM_004100chr641071 742 518 404 12030 1377 2960 536
NM_004103chr83729 677 114 ------
NM_004105chr21912 --1311 --
NM_004109chr1142384 2104 575 275 ------
NM_004114chrX----1154 11057
NM_004116chr22407 395 1314 ----
NM_004117chr642124 1558 1483 354 3383 363 291 ----
NM_004124chr1443172 831 518 242 1169 ----
NM_004126chr7----1112 --
NM_004133chr842713 2290 1077 53 1185 1628 --
NM_004134chr52610 455 ----1577
NM_004136chr1553003 2905 331 165 24 --1467 --
NM_004157chr34891 563 45 23 ------
NM_004161chr251315 988 404 215 156 ----11263
NM_004169chr172701 140 ------
NM_004171chr11118342 7831 7358 6759 6025 3309 3164 2489 1725 1110 555 39429 2894 843 --13378
NM_004187chrX31239 1005 148 ------
NM_004193chr101529 --1188 --
NM_004199chr5162 ------
NM_004225chr821025 588 11157 11004 --
NM_004229chrX31516 667 91 21550 68 ----
NM_004232chr1841140 702 674 662 21461 72 ----
NM_004237chr51903 ------
NM_004241chr102812 81 ------
NM_004263chr231634 1164 335 1270 41721 1402 500 180 --
NM_004267chr31496 ------
NM_004272chr521243 135 ------
NM_004274chr1442221 1190 314 157 11155 --12703
NM_004281chr103489 434 78 ------
NM_004290chr521009 48 --11031 --
NM_004293chr973870 3516 3374 2931 1289 623 555 12982 22333 1391 --
NM_004302chr1222315 188 --12304 --
NM_004311chr1042356 2134 731 281 ------
NM_004316chr12139 ------
NM_004319chr172966 2762 2464 2420 2306 723 566 43126 2071 979 762 12534 --
NM_004327chr2232080 979 82 22494 964 ----
NM_004329chr1041190 439 397 147 ----1418
NM_004330chr154775 305 137 122 11176 ----
NM_004338chr1876181 5574 4919 2736 1628 827 342 25958 2636 ----
NM_004342chr742025 1731 1699 251 ------
NM_004343chr19--195 ----
NM_004350chr142059 1966 1699 436 150 ----
NM_004352chr161427 ------
NM_004354chr43543 246 122 1285 ----
NM_004370chr621826 643 ------
NM_004371chr141488 959 176 81 ------
NM_004380chr1641994 723 378 21 --145 --
NM_004384chr511689 2194 130 ----
NM_004385chr51716 ------
NM_004392chr1341844 1633 992 582 12433 12099 --
NM_004393chr341826 1575 202 193 --12084 1472
NM_004395chr51167 ------
NM_004397chr1133074 1266 186 23611 1642 13480 --
NM_004399chr122662 363 --2852 744 --
NM_004415chr62692 177 ------
NM_004423chr342356 2065 465 343 --1838 --
NM_004427chr161205 1195 1137 1036 404 171 ------
NM_004430chr852448 1991 974 205 163 ------
NM_004432chr942090 2049 840 254 11769 1274 --
NM_004433chr191853 1190 721 687 668 404 310 233 57 ------
NM_004434chr1421182 770 21288 353 ----
NM_004436chr14665 216 202 194 ------
NM_004438chr232455 2137 717 ----11006
NM_004440chr64522 449 357 298 --1482 159
NM_004443chr3292 77 --2255 62 --
NM_004446chr12169 64 ------
NM_004454chr342237 1778 862 693 ------
NM_004457chr221093 579 ------
NM_004458chrX42571 2250 2099 1795 ------
NM_004459chr1721968 1543 ------
NM_004463chrX--1121 ----
NM_004464chr463326 2732 1229 787 737 316 1885 ----
NM_004469chrX1137 --1437 --
NM_004481chr142660 2158 756 88 12125 ----
NM_004482chr22897 669 ------
NM_004485chr153789 2786 2695 1734 1254 13978 --139
NM_004491chr19104342 4158 3930 1570 1345 653 452 363 123 63 ------
NM_004492chr154239 227 74 33 1173 ----
NM_004496chr1431358 1100 149 ------
NM_004498chr151348 1254 ----
NM_004499chr54435 362 351 94 ------
NM_004500chr1431750 1520 1259 199 1623 --
NM_004501chr153174 3066 2708 1548 276 145 --12954
NM_004504chr282822 2712 2533 2243 734 676 183 90 ----12633
NM_004505chr1721858 668 1206 ----
NM_004506chr61134 ------
NM_004514chr1742562 1066 847 141 --32661 2084 1164 1496
NM_004516chr194803 420 379 315 ------
NM_004519chr82215 44 ------
NM_004520chr51555 ------
NM_004525chr231314 1166 1089 ----1375
NM_004529chr931412 550 528 21454 151 ----
NM_004540chr21184 --1687 --
NM_004571chr2163088 2645 2635 1309 1158 26 ------
NM_004576chr5195 ------
NM_004580chr1551508 1360 626 585 380 --151 --
NM_004583chr171181 --1241 --
NM_004584chr112333 33 --1224 1645
NM_004586chrX75214 4451 3849 3668 3588 1844 1105 24800 3464 15135 --
NM_004588chr1163903 3606 1536 1025 833 435 --13176 --
NM_004592chr121240 ------
NM_004593chr33859 122 113 ------
NM_004595chrX2379 41 ----1327
NM_004612chr994431 4041 3239 1829 1678 1627 1169 487 455 2621 244 ----
NM_004615chrX1178 ----1894
NM_004634chr31595 ------
NM_004645chr172729 186 1119 ----
NM_004650chrX41843 1580 1246 348 --1464 --
NM_004654chrY21427 61 ------
NM_004655chr1731281 1132 989 11005 1147 --
NM_004660chrY1314 --11573 --
NM_004664chr121312 --1219 --
NM_004671chr181245 1268 ----
NM_004673chr111191 --11141 --
NM_004677chrY1493 1459 ----
NM_004684chr4127 ------
NM_004685chr1322717 316 2998 393 --12738
NM_004686chr821715 307 ------
NM_004687chr1721951 1371 11471 21555 51 --
NM_004690chr62652 607 ------
NM_004694chr17--1105 ----
NM_004696chr12836 793 ------
NM_004703chr1742484 2468 2258 563 ----2744 202
NM_004709chrX11339 ------
NM_004719chr1262722 2563 1108 1078 733 407 --1766 11883
NM_004725chr103356 275 173 --11073 --
NM_004726chrX105616 5515 5046 4850 4659 4090 3557 2222 49 34 35093 398 373 1139 --
NM_004730chr511349 3578 373 333 ----
NM_004731chr1241424 1324 1201 37 --1293 --
NM_004736chr1181 1522 1779 --
NM_004737chr2251194 984 814 452 157 41217 1168 1162 998 --174
NM_004738chr2082485 2033 1850 1777 979 313 237 185 --22338 2048 --
NM_004739chr111591 --1477 --
NM_004742chr341318 698 619 170 ------
NM_004744chr433516 3349 187 11033 12972 --
NM_004745chr856681 6166 5733 2079 943 16067 16254 --
NM_004747chr104642 456 305 265 ------
NM_004748chr1553263 2706 1284 866 614 54083 3164 1324 1153 589 ----
NM_004755chr142358 67 138 ----
NM_004760chr742429 2382 309 246 12135 ----
NM_004764chr122203 44 ------
NM_004768chr111174 1964 --1920
NM_004772chr541534 1291 1043 387 ----2574 252
NM_004775chr1821974 429 32394 960 420 ----
NM_004776chr2082892 2710 2637 2567 2390 2096 524 387 32921 2282 170 --2830 405
NM_004779chr541076 289 135 71 ------
NM_004781chr151380 708 388 359 50 11607 21197 243 --
NM_004781chr151380 708 388 359 50 11607 21197 243 --
NM_004787chr41143 ------
NM_004788chr1122097 1693 21877 536 12203 --
NM_004796chr1411923 --1345 --
NM_004798chr2083524 3409 2977 926 688 302 281 43 23547 1110 13531 12763
NM_004801chr261565 1442 1392 626 136 78 21074 482 ----
NM_004805chr22391 57 ------
NM_004808chr1042836 2512 1039 638 22389 1332 ----
NM_004815chr164671 3469 3103 3056 1567 440 14324 1281 --
NM_004824chr611380 ------
NM_004831chr193809 750 327 1394 ----
NM_004834chr263194 3043 2200 1323 1075 304 12158 ----
NM_004840chrX32431 2357 516 2349 34 --11995
NM_004841chr11289 2858 852 --163
NM_004855chr15------1206
NM_004856chr151569 ----1490
NM_004857chr1444044 3705 3136 1543 13564 --11777
NM_004859chr1743037 2515 2508 2221 1108 ----
NM_004863chr1475300 4592 3336 3319 1405 437 57 23356 208 ----
NM_004865chr6141 ------
NM_004866chr584651 3920 3878 1928 1616 1268 42 29 21989 1472 ----
NM_004867chrX2481 58 ------
NM_004869chr1821256 1125 --11711 --
NM_004871chr1764215 3384 3192 3153 1536 1475 --21770 1744 --
NM_004884chr1531721 1255 410 ------
NM_004887chr5160 1869 ----
NM_004888chr931118 386 292 1979 ----
NM_004891chr2122 ------
NM_004897chr102923 909 ------
NM_004898chr432915 2301 647 1510 ----
NM_004902chr20------1818
NM_004904chr776357 5994 5587 5051 1261 499 275 ------
NM_004905chr11604 1185 --1641
NM_004907chr194964 682 292 238 2711 188 ----
NM_004912chr721435 1177 1387 ----
NM_004915chr211565 --1181 --
NM_004924chr1911001 1759 ----
NM_004926chr1431504 673 514 ----11280
NM_004932chr531339 529 151 ------
NM_004937chr1792022 1968 1656 731 521 481 369 322 171 ------
NM_004947chr332431 1998 844 ------
NM_004952chr14923 880 301 222 --1689 1950
NM_004956chr763713 3494 2873 1329 1053 886 24472 826 ----
NM_004958chr12165 98 --1710 --
NM_004972chr91289 1150 ----
NM_004976chr1175120 5026 4133 3686 1762 909 634 ------
NM_004983chr11287 ----1245
NM_004984chr12--135 ----
NM_004985chr1233930 3107 1019 23275 1724 1414 --
NM_004987chr21326 ------
NM_004992chrX67404 5870 1687 1425 944 339 38274 5198 2029 12432 --
NM_004992chrX67404 5870 1687 1425 944 339 38274 5198 2029 12432 --
NM_004993chr145458 437 305 109 35 --1179 1959
NM_004999chr644271 4253 1268 956 24358 3793 --11124
NM_005006chr21247 1297 ----
NM_005010chr732270 1705 649 31881 1772 841 ----
NM_005011chr761736 1549 1408 720 120 96 ------
NM_005023chr511538 1376 ----
NM_005032chrX2719 112 ------
NM_005045chr73885 742 152 ------
NM_005056chr1275086 4901 4746 4510 701 297 229 --11637 1360
NM_005065chr14114702 4599 4092 4079 3852 2027 1642 1599 969 658 79 44839 1966 1438 235 ----
NM_005066chr11693 1616 ----
NM_005068chr611483 ------
NM_005077chr92364 337 ------
NM_005087chr3--1109 1859 --
NM_005095chr131452 662 345 1229 11551 1614
NM_005096chrX81249 1094 1010 928 855 414 166 141 ------
NM_005109chr352542 1967 1784 974 511 ------
NM_005116chr2074352 4336 3924 2897 1569 1370 682 34255 3586 3122 --13300
NM_005121chr17113862 3543 3064 3015 2734 1520 1492 1180 529 254 80 ------
NM_005124chr61960 ------
NM_005126chr321586 274 11661 --1102
NM_005128chr211701 ------
NM_005134chr181210 --1105 --
NM_005141chr41122 ------
NM_005151chr1841772 897 599 568 11658 ----
NM_005156chr984771 4582 4551 4383 4073 2134 810 507 34779 231 54 24096 3367 11462
NM_005159chr153804 75 26 22239 772 11719 --
NM_005163chr142958 797 --1781 --
NM_005168chr23583 458 157 11146 ----
NM_005171chr1231048 867 380 21008 247 ----
NM_005180chr1021216 235 157 ----
NM_005184chr19----11226 --
NM_005188chr11187687 7532 7006 6722 6181 6023 5786 5583 5548 5220 2459 2305 2257 1823 1620 1288 908 601 16248 36807 2901 1045 --
NM_005189chr1762517 2392 1831 1811 1722 624 32168 691 444 ----
NM_005197chr14115838 5384 5070 4919 4080 2451 2329 2160 1926 1582 982 34483 2060 1639 24171 2236 --
NM_005201chr321178 800 1298 ----
NM_005207chr2283547 3080 3057 2354 2318 1162 1010 643 1821 ----
NM_005214chr21395 1224 1945 --
NM_005219chr531502 582 447 21258 572 1351 --
NM_005220chr1761449 1127 971 424 356 314 ------
NM_005222chr74297 268 252 228 1847 ----
NM_005225chr201394 ----1868
NM_005229chrX31164 928 313 --21244 396 --
NM_005230chr12--1547 ----
NM_005235chr257599 7571 4776 1523 1304 57078 1292 993 857 584 --15452
NM_005238chr1122824 2432 23014 121 2249 39 --
NM_005239chr2172030 2002 1610 1542 1495 795 134 ------
NM_005240chr12630 275 --1559 --
NM_005241chr331313 295 133 ------
NM_005243chr221228 ------
NM_005245chr4130 --1655 --
NM_005252chr143487 117 83 ------
NM_005263chr12959 193 --21195 105 --
NM_005274chr11133 ------
NM_005277chr43759 343 200 2433 75 ----
NM_005292chr13--1125 ----
NM_005296chrX1288 2803 298 ----
NM_005308chr101399 ------
NM_005311chr742367 2298 1144 774 32809 2744 940 ----
NM_005312chr962657 2578 2139 532 411 70 --21025 310 --
NM_005324chr1721896 67 ------
NM_005328chr81711 1757 ----
NM_005329chr1642065 933 733 532 ------
NM_005337chr122297 76 --139 1346
NM_005339chr463727 3601 3535 3255 3088 1163 ------
NM_005346chr62254 59 ------
NM_005349chr43634 498 432 ------
NM_005359chr18176521 6194 6023 5935 5315 5243 5233 5035 4836 4829 4481 1949 1814 1794 1393 1201 1054 --15214 --
NM_005373chr13375 233 155 ----11669
NM_005375chr61772 ------
NM_005378chr21169 198 ----
NM_005382chr81382 ------
NM_005386chr202725 695 1682 ----
NM_005387chr11----1629 --
NM_005397chr793596 2518 1604 1498 1389 584 430 269 139 12529 21054 911 --
NM_005399chr163992 2837 2764 1751 1097 646 14269 ----
NM_005400chr282774 2647 2358 2315 2139 2106 724 22 ------
NM_005402chr711728 --11742 --
NM_005406chr1811125 1362 --21075 356
NM_005409chr431097 366 109 ----1130
NM_005413chr21341 ------
NM_005435chr73455 224 202 --2108 85 --
NM_005436chr1083832 3327 2601 1518 654 553 257 200 1228 23243 474 14064
NM_005439chr124494 374 178 155 ------
NM_005442chr34537 431 222 103 ------
NM_005443chr42393 26 --1418 --
NM_005445chr101295 ------
NM_005455chr121611 1595 ------
NM_005460chr51585 ------
NM_005461chr201188 11439 ----
NM_005465chr171403 813 408 344 288 146 102 135 11868 11654
NM_005466chr143492 415 97 ------
NM_005474chr1721261 1048 ------
NM_005475chr1242983 2873 2494 80 --1376 --
NM_005476chr94346 296 164 116 --126 1340
NM_005493chr62779 307 ----1716
NM_005494chr71162 ----1100
NM_005497chr1736132 1386 603 1102 --13845
NM_005501chr1741167 435 199 97 --1171 --
NM_005502chr912396 22377 2110 150 --
NM_005509chr511215 1483 ----
NM_005517chr13934 282 224 --1458 1525
NM_005522chr741390 1252 345 237 1198 1297 --
NM_005524chr32324 98 ------
NM_005542chr731429 1263 1211 ------
NM_005544chr221048 117 1275 ----
NM_005561chr13185 ------
NM_005563chr11670 --122 --
NM_005568chr17--152 ----
NM_005574chr112506 63 1627 --1134
NM_005578chr354964 4831 3195 211 201 21215 1086 ----
NM_005593chr122504 192 ------
NM_005595chr12302 129 ------
NM_005596chr974930 4912 4783 4365 1799 1783 87 36138 4552 1678 25046 419 --
NM_005599chr131309 525 327 ------
NM_005603chr182185 70 --12049 --
NM_005610chr1187 ------
NM_005614chr721080 696 ------
NM_005625chr82339 82 1222 2240 118 --
NM_005629chrX--1871 ----
NM_005630chr331254 138 41 31970 1935 1902 21337 719 --
NM_005638chrX41457 1417 1297 679 ----1623
NM_005644chr1------1407
NM_005647chrX83156 3053 2878 886 865 587 543 526 22479 165 22906 598 --
NM_005655chr821181 486 1920 ----
NM_005665chr174407 3859 3696 3619 3400 1608 559 11807 --23361 1427
NM_005667chr21285 ------
NM_005668chr584371 4345 3062 3024 1294 665 379 195 14099 ----
NM_005676chrX1155 ------
NM_005715chr672732 2616 2590 2574 2412 1002 801 42722 2079 1792 720 11965 --
NM_005721chr21909 ------
NM_005724chr15--1558 1174 --
NM_005725chr11860 1807 11778 --
NM_005730chr1253668 681 641 492 419 22919 1127 22936 44 --
NM_005737chr242807 2690 2370 786 --21831 253 --
NM_005738chr731908 1643 1287 31534 788 608 ----
NM_005746chr732334 525 259 11763 12224 1460
NM_005748chr1233431 2865 547 ------
NM_005754chr541106 803 488 237 ----1187
NM_005756chrX31554 305 61 1296 ----
NM_005759chr284167 3674 3625 3245 1733 906 323 184 24291 4128 24313 3589 --
NM_005779chr553643 2742 2342 1264 1127 33540 2959 92 --1943
NM_005780chr131843 178 --1745
NM_005786chr1841099 972 961 119 --1830 1212
NM_005795chr232118 489 99 1125 --12006
NM_005797chr1121565 1356 11804 ----
NM_005813chr252554 687 630 584 501 ------
NM_005822chr62665 410 1942 11693 --
NM_005826chr11536 ------
NM_005828chr17134748 4398 4277 4236 4149 3963 3879 3796 3527 1141 720 635 573 --34973 4585 3728 --
NM_005832chr341419 1292 1101 251 ------
NM_005839chr11864 1824 ----
NM_005840chrX117294 6499 6046 5070 4697 2708 2096 1574 1501 1347 441 35699 4646 2141 25152 1294 --
NM_005842chr13--1580 ----
NM_005843chr221830 722 31735 256 32 ----
NM_005852chr1771165 1064 455 407 272 194 91 ------
NM_005871chr102422 49 --1278 --
NM_005875chr3197 ------
NM_005876chr21730 --1698 1151
NM_005882chr43827 743 63 1246 ----
NM_005885chr531186 473 381 --2177 27 --
NM_005895chr1253232 1447 1065 997 459 --21592 1217 --
NM_005896chr24807 544 202 181 ------
NM_005898chr1183163 3083 2792 2434 2127 801 765 344 13156 ----
NM_005900chr42265 253 ------
NM_005901chr18158012 7473 7302 6895 6708 6602 5676 3216 2538 2339 2234 2176 1143 724 613 37082 1642 417 27400 1085 --
NM_005902chr1563082 3021 2864 1272 1233 536 44436 4350 4340 1473 14458 --
NM_005903chr584682 4301 3705 3460 3352 943 883 259 11022 21961 403 --
NM_005906chr651467 1396 1383 1132 449 ----11240
NM_005907chr611409 --1489 --
NM_005909chr573518 2923 2827 2709 1668 1290 70 --13165 11718
NM_005910chr1763674 3424 3167 2605 993 838 --13044 --
NM_005920chr153316 2753 2511 1265 345 --22714 1300 --
NM_005922chr61102 1405 1314 --
NM_005923chr6121 --158 --
NM_005924chr7--11062 ----
NM_005935chr4105208 5182 4563 3919 3556 1869 1195 561 439 226 23351 1222 --11123
NM_005937chr1774099 3857 3383 1472 1345 1042 501 23838 1320 23597 673 --
NM_005941chr832813 858 251 14117 3891 790 127 --
NM_005944chr331092 496 145 ------
NM_005955chr1144891 4836 4716 4339 4100 4063 4055 3870 3654 3500 3351 884 757 123 24372 4290 35167 2164 1163 --
NM_005962chr1031469 1448 635 --12121 12143
NM_005962chr1031469 1448 635 --12121 12143
NM_005963chr17181 ------
NM_005964chr1721324 997 ------
NM_005968chr191235 ------
NM_005977chr132345 319 1976 ----
NM_005986chr1382247 2228 1103 1034 949 375 251 172 ------
NM_006007chr934520 1698 665 23120 2904 1514 --
NM_006011chr15104155 3665 2796 1683 1208 1197 1165 1140 357 322 23848 3411 ----
NM_006015chr121354 282 1828 ----
NM_006016chr642144 862 291 108 ------
NM_006023chr102201 167 ------
NM_006032chr14----1206 --
NM_006036chr252391 1818 1726 577 98 ------
NM_006037chr294838 4218 4145 3696 3573 3491 3139 1682 67 31881 1475 1430 --23112 584
NM_006039chr17--11129 ----
NM_006042chr171478 ------
NM_006047chr2033425 948 721 1520 --134
NM_006048chr131190 1067 969 1883 ----
NM_006054chr1141504 1007 485 449 11065 11435 --
NM_006055chr222883 2804 42760 2522 645 607 1888 --
NM_006060chr754429 3530 3123 237 66 1834 33884 1362 891 --
NM_006070chr3----1267 --
NM_006079chr62298 100 1590 ----
NM_006080chr742749 2510 2456 169 ----12198
NM_006091chr1541624 1362 632 362 11182 11761 --
NM_006095chr474452 4029 3667 1521 713 707 472 33586 1402 1279 1634 --
NM_006106chr1173439 3352 3020 2970 2585 2371 590 31334 867 543 22894 2503 --
NM_006107chr171351 --1469 --
NM_006135chr141440 1210 1092 561 ------
NM_006136chr74919 539 461 232 ------
NM_006141chr1632600 2409 307 ------
NM_006143chr12193 ------
NM_006145chr19----263 36 11079
NM_006147chr11183 --1405 --
NM_006148chr1752901 2676 2627 959 155 --1873 --
NM_006159chr12--1133 ----
NM_006161chr53248 233 25 ------
NM_006166chr1232429 1722 894 1825 1970 --
NM_006178chr1741486 1375 613 230 1115 1403 168
NM_006194chr141206 ------
NM_006197chr812240 21635 865 ----
NM_006203chr565234 5127 1982 1968 1930 131 34542 4109 210 14838 --
NM_006206chr462939 2708 2531 2479 2084 404 ------
NM_006224chr1742521 1614 977 127 1317 22321 443 11571
NM_006241chr362400 2251 1929 1524 860 853 32360 2228 648 ----
NM_006243chr12760 193 ----11043
NM_006246chr142517 109 ------
NM_006251chr553193 3132 2713 2563 452 --12386 2400 324
NM_006252chr1107193 6426 6388 6173 5681 2678 2512 1630 906 789 1693 15919 11112
NM_006258chr1031360 592 281 ------
NM_006265chr821076 466 1593 ----
NM_006267chr261779 1693 1593 1538 577 169 ------
NM_006275chr2062482 2453 1641 837 818 40 ------
NM_006277chr21177 ------
NM_006282chr2073390 3264 1785 1517 724 351 115 12970 ----
NM_006283chr8104413 4369 4209 3675 3172 3039 1564 1127 1017 320 ------
NM_006292chr111175 ------
NM_006298chr633215 2726 1134 1648 ----
NM_006306chrX95182 4808 2206 1721 1569 983 872 763 80 1523 1892 --
NM_006310chr1731171 881 270 ----1871
NM_006311chr171113 --1342 --
NM_006313chr1221743 34 1608 ----
NM_006321chr31226 31839 715 318 ----
NM_006330chr831025 172 61 ------
NM_006334chr9----1312 --
NM_006345chr42894 34 1425 ----
NM_006350chr52329 42 ------
NM_006352chr131761 531 253 --11878 --
NM_006357chr23442 435 44 ------
NM_006359chrX52299 1920 1830 665 539 21966 236 22023 1658 --
NM_006364chr141357 11031 ----
NM_006366chr631189 399 370 1486 ----
NM_006367chr13713 697 89 21067 140 1195 --
NM_006375chrX31743 535 318 ------
NM_006378chr941338 1274 574 459 1992 11070 --
NM_006379chr741825 1490 723 259 11999 1616 --
NM_006380chr1773800 3559 3116 2920 2728 651 29 --24277 3053 --
NM_006393chr1063379 3275 1378 1160 534 300 ------
NM_006420chr2052783 2483 2222 907 759 ------
NM_006421chr821190 837 ------
NM_006449chr211645 ------
NM_006451chr521076 758 ------
NM_006457chr454016 3869 3513 1611 340 23680 2535 12663 --
NM_006459chr1061999 1543 747 721 567 544 1478 1528 --
NM_006460chr1731438 1419 38 1601 193 11723
NM_006464chr273059 1789 1676 1603 1541 1382 834 14536 22940 679 --
NM_006482chr1233458 2946 1254 22977 206 ----
NM_006489chr1421637 1620 ------
NM_006504chr1082846 2472 2355 2306 2188 1103 403 92 32937 2042 296 12054 --
NM_006527chr41148 ------
NM_006529chr41564 21573 1533 ----
NM_006534chr2042338 2084 1133 1017 1449 --1982
NM_006538chr233164 3025 164 44207 1669 677 322 1557 --
NM_006539chr16--1447 ----
NM_006540chr811435 11359 ----
NM_006544chr1495356 5243 4484 4464 4250 1405 783 538 159 25496 4915 25076 450 --
NM_006546chr1786233 5684 5169 5111 4306 4211 417 399 1724 ----
NM_006547chr7----11390 --
NM_006557chr921300 376 --21389 485 11472
NM_006558chr81322 ------
NM_006559chr11287 ------
NM_006560chr112154 148 --1166 --
NM_006561chr10106254 5225 4976 4403 4125 2471 1857 1473 676 579 25962 53 42440 2137 195 178 --
NM_006565chr161883 1816 --1981
NM_006572chr1792661 2615 1368 882 839 631 405 308 152 33171 2843 532 ----
NM_006574chr31284 ------
NM_006577chr241226 854 404 227 ------
NM_006587chr441111 241 217 23 21295 183 153 --
NM_006593chr24661 615 230 173 1831 --1212
NM_006595chr1141858 1852 1350 188 1159 ----
NM_006599chr1678050 7179 5980 5711 5134 3222 53 1198 11700 --
NM_006601chr1211023 ----1244
NM_006609chr252584 2052 964 556 55 1743 ----
NM_006614chr3113673 3542 2848 2729 2559 2253 1066 844 408 158 43 42870 2375 818 77 ----
NM_006618chr131453 1442 304 ------
NM_006621chr142061 797 332 286 ------
NM_006622chr51182 ------
NM_006624chr1041681 693 642 312 2800 299 11315 --
NM_006628chr15124349 4321 3982 3944 3498 1703 1330 1021 968 651 518 400 ------
NM_006633chr51545 ------
NM_006636chr22939 382 --1990 --
NM_006644chr132566 481 1199 ----
NM_006646chr1342360 1061 993 101 ----11110
NM_006650chr523968 660 --1388 12495
NM_006654chr1274771 4608 3373 3109 1313 311 31 2846 561 ----
NM_006675chr1273337 3157 2385 1136 948 779 621 --11303 --
NM_006680chr111118 ------
NM_006699chr162539 2502 2306 1968 1063 371 --22579 2119 --
NM_006703chr6158 1463 ----
NM_006706chr52741 706 ------
NM_006710chr21995 131 ----
NM_006717chr962530 2144 1076 1055 671 293 1784 --11128
NM_006718chr621041 760 1424 ----
NM_006722chr342697 2690 585 260 ------
NM_006724chr61102 1405 1314 --
NM_006726chr42913 161 ------
NM_006729chrX105372 5358 4139 4064 3523 2145 2014 1921 1864 1837 14463 15024 --
NM_006731chr9155554 5525 5370 4943 4804 3878 3781 2308 2209 2000 1622 1551 1458 798 499 55781 5742 4305 2330 996 ----
NM_006734chr6------123
NM_006738chr1594234 4209 3867 3745 3225 3062 1535 1180 879 13056 13270 11433
NM_006742chr1681892 1545 1335 1291 1277 754 613 333 21509 147 --31915 657 309
NM_006746chrX21361 55 11198 ----
NM_006750chr16118089 7851 7584 7043 6482 5187 3158 2926 672 166 108 28099 7209 27889 4947 --
NM_006756chr841089 1016 158 123 ------
NM_006761chr171101 ------
NM_006763chr132132 1740 744 11575 ----
NM_006766chr872645 2300 2263 1794 460 303 53 22672 1914 31755 161 85 --
NM_006772chr611444 1381 123 --
NM_006775chr663101 2583 2498 2054 2008 472 23120 1001 ----
NM_006777chrX72884 2870 2177 1975 939 677 652 ------
NM_006783chr131283 1733 --1112
NM_006791chr15------1641
NM_006793chr10125 --1167 --
NM_006794chr2260 23 ------
NM_006805chr551628 1082 600 274 102 ------
NM_006806chr211318 ------
NM_006807chr172356 232 11117 1265 1328
NM_006815chr1231141 1016 895 1530 --11276
NM_006823chr81177 11040 ----
NM_006826chr221083 42 --1185 --
NM_006827chr142902 466 12566 ----
NM_006838chr1271777 1666 1647 609 552 396 197 130 --11633
NM_006851chr1282748 2724 2267 1952 933 644 453 220 42949 1890 496 321 12441 --
NM_006852chr1782453 2375 2206 2107 2012 1140 1121 204 --32678 2630 1965 --
NM_006854chr721980 1336 12022 ----
NM_006874chr431126 820 94 ------
NM_006884chr331947 1744 1578 --1707 11531
NM_006885chr1643863 1091 1064 927 34135 1147 734 1820 --
NM_006888chr14112444 2322 2252 1397 1384 1308 1193 1036 736 349 145 12837 12559 --
NM_006892chr2021189 1030 ------
NM_006892chr2021189 1030 ------
NM_006908chr761462 1191 323 255 107 43 --1382 --
NM_006913chr6------1307
NM_006914chr91598 1618 ----
NM_006915chrX52343 1618 848 403 347 --12239 --
NM_006918chr11105633 5506 5401 5265 5155 4648 2347 2334 2282 197 1346 ----
NM_006920chr231526 685 198 11495 ----
NM_006922chr252334 1790 1678 864 838 22249 309 ----
NM_006924chr1752954 1347 1034 987 533 ----23678 3438
NM_006939chr1441149 1056 913 434 1897 ----
NM_006947chr451663 1357 430 286 149 --21278 483 --
NM_006950chrX2736 686 ----1875
NM_006951chr10----122 --
NM_006981chr962827 2534 2392 2151 778 738 --1137 --
NM_006983chr1122 ------
NM_006990chr172479 2208 1789 400 358 51 25 1722 ----
NM_006991chr32992 860 ------
NM_006996chr121260 230 11529 ----
NM_007005chr921570 565 1205 ----
NM_007006chr1662817 587 566 253 207 130 1882 ----
NM_007008chr21126 ----1582
NM_007010chr1761449 1295 1255 648 460 329 ------
NM_007011chr1576670 6303 5785 5296 4247 2075 418 46762 6553 5803 2061 11887 --
NM_007013chr81245 11003 ----
NM_007023chr221078 262 31102 896 797 ----
NM_007030chr544147 3468 960 377 --1511 --
NM_007032chr2242140 2071 1107 272 ----11023
NM_007033chr152062 2009 1491 923 371 1869 ----
NM_007034chr11672 1335 ----
NM_007036chr53821 360 75 ------
NM_007038chr21146066 5576 5406 5391 5167 4868 4287 2336 1848 1622 906 719 639 195 15898 ----
NM_007040chr193810 273 250 --1217 --
NM_007042chr392524 2364 2201 1667 793 781 333 285 148 21762 212 --1262
NM_007043chr1251709 1688 1677 1328 1305 ------
NM_007050chr20177047 6803 6415 5802 2885 2247 1776 1612 1525 1449 1345 1000 907 631 529 277 162 17716 26615 2821 --
NM_007054chr553264 2870 1568 638 548 ------
NM_007068chr22----1426 --
NM_007084chr1331098 1001 355 21455 1317 11484 --
NM_007096chr91107 ------
NM_007106chr1312834 21877 1721 ----
NM_007107chr322306 2190 ----1929
NM_007111chr133873 789 559 ------
NM_007124chr621881 1599 11619 ----
NM_007125chrY31299 363 116 ------
NM_007137chrX74527 4269 3840 3625 3508 793 273 21778 444 1814 15239
NM_007144chr1741325 948 928 86 ------
NM_007146chr1752027 1918 1774 712 528 ------
NM_007150chrX32116 763 575 ------
NM_007157chrX22253 155 32501 2180 1993 ----
NM_007158chr121112 143 1381 ----
NM_007159chr32685 192 --11083 --
NM_007166chr1121210 1081 --1976 --
NM_007170chr11913 --2600 187 2666 40
NM_007172chr2232513 2290 1251 22598 156 --11307
NM_007175chr833102 89 42 23360 3050 2504 250 --
NM_007190chr10126 --187 --
NM_007191chr122495 57 ------
NM_007192chr1421060 290 --1439 --
NM_007200chr1594234 4209 3867 3745 3225 3062 1535 1180 879 13056 13270 11433
NM_007202chr171770 ------
NM_007203chr973636 3347 3133 2952 2930 1008 219 ------
NM_007207chr12804 792 1659 ----
NM_007212chr12408 92 21452 466 ----
NM_007214chr62357 202 11327 ----
NM_007222chr811835 --1304 --
NM_007225chr1711007 ------
NM_007229chr222327 287 ------
NM_007236chr1562464 1976 1538 740 372 252 1596 22103 948 --
NM_007242chr161241 ------
NM_007245chr162908 789 ------
NM_007246chr41967 147 --11016
NM_007249chr13149462 9288 7878 7727 7278 6977 6949 6801 6668 3215 2502 1883 1537 894 39330 8899 8417 31745 1027 375 27755 3174
NM_007257chr842682 2077 1179 729 --1109 146
NM_007270chr761552 1381 1119 1089 282 222 ------
NM_007283chr352965 2297 1881 999 566 --21196 439 --
NM_007286chr531719 1487 745 1452 --1651
NM_007292chr1764976 4873 4265 3877 3201 285 13591 14866 --
NM_007325chrX1767 11606 1134 --
NM_007331chr441968 1850 1723 653 22541 771 11038 --
NM_007347chr1531126 880 778 22189 183 ----
NM_007350chr1274458 4186 3976 1336 836 234 219 2512 494 23317 957 --
NM_007358chr11433 11500 ----
NM_007361chr141151 ------
NM_007372chr173853 844 574 ------
NM_007373chr101323 11114 ----
NM_007374chr142547 370 ------
NM_007375chr152651 2376 1879 1781 1010 22542 524 ----
NM_012074chr143820 470 48 ------
NM_012081chr553132 2845 2661 2382 2327 23014 1225 ----
NM_012082chr82703 24 ------
NM_012089chr12171 33 ------
NM_012092chr231369 588 115 11781 ----
NM_012095chr10103419 3368 2717 2668 2540 868 665 407 400 187 1878 ----
NM_012096chr353626 2981 1421 584 178 12575 ----
NM_012097chr251892 1777 600 170 51 11502 ----
NM_012099chr1911112 1187 ----
NM_012102chr162144 2082 1933 915 103 62 1494 --12352
NM_012104chr1183538 3398 3338 2686 1219 1189 1031 296 11335 ----
NM_012104chr1183538 3398 3338 2686 1219 1189 1031 296 11335 ----
NM_012110chr4----126 --
NM_012120chr672631 2452 2410 2132 2047 959 200 ------
NM_012121chr1731203 129 43 --171 --
NM_012134chr121227 180 1729 ----
NM_012137chr152740 2589 911 553 517 ------
NM_012141chr1393255 3102 2854 1082 855 768 605 74 37 54181 3561 2620 1072 317 33927 2649 163 --
NM_012156chr2073169 2483 2433 1269 654 628 620 ----168
NM_012157chr32980 619 1173 ----
NM_012158chr1311396 21210 116 11462 --
NM_012164chr9156434 6020 5801 5677 5522 5438 5382 2872 2270 2191 2165 2038 1189 445 30 47489 6459 6028 2578 ----
NM_012175chr112631 273 ------
NM_012176chr5--1224 ----
NM_012183chr11164 1423 ----
NM_012193chr11155190 4897 4687 4441 3990 3899 3886 3667 1590 1551 1203 1084 821 522 191 --14751 15252
NM_012197chr951228 1108 361 55 45 21205 28 ----
NM_012199chr1114339 4076 3952 2920 1771 1679 1458 1052 823 814 780 21121 1006 14010 --
NM_012207chr101866 1273 156 --
NM_012214chr2125735 5342 5281 4857 4737 4590 4194 3938 2406 2051 1975 1222 26354 4506 ----
NM_012215chr101373 11555 1258 --
NM_012219chr363204 2875 2673 2511 1141 1081 ------
NM_012223chr23955 426 173 123 ----
NM_012224chr41415 --1125 --
NM_012234chr343191 3026 2662 91 11143 ----
NM_012238chr1041783 1704 1236 264 1237 ----
NM_012242chr103616 131 57 1819 --168
NM_012244chr1441623 1366 342 129 --11314 --
NM_012249chr262996 2439 2327 1006 925 797 --179 --
NM_012250chr1131105 85 48 11146 --1507
NM_012252chr785130 4781 3716 2118 1857 1620 1139 395 1408 ----
NM_012257chr71830 ------
NM_012259chr611414 ------
NM_012262chr1114284 4210 4007 3855 3674 3304 3179 2022 1548 1248 56 23759 395 ----
NM_012281chr742014 1809 799 228 --12434 --
NM_012287chr334489 3580 3379 22961 841 ----
NM_012288chr6105066 4271 4078 3949 3756 3667 2225 1313 860 304 --13725 11906
NM_012290chr231381 683 593 ------
NM_012297chr441975 900 545 320 ------
NM_012300chr562441 2217 2153 2119 2099 204 1726 12177 --
NM_012301chr731877 1660 793 ------
NM_012302chr121022 302 ------
NM_012308chr1132438 2124 1717 21040 322 138 --
NM_012309chr1154220 3367 3330 3179 440 24815 4683 11854 --
NM_012316chr173556 2038 1639 1081 858 331 202 55225 4922 3935 1370 1355 13477 24151 807
NM_012318chr431294 1208 468 1516 ----
NM_012322chr7176 ------
NM_012325chr2041565 1556 510 501 ------
NM_012328chr711260 1384 ----
NM_012329chr1751055 390 357 272 110 ------
NM_012330chr1041589 1532 1396 65 1215 --11597
NM_012338chr72971 253 1488 ----
NM_012343chr511112 ------
NM_012347chr662951 2402 1940 1030 612 560 11171 --12227
NM_012383chr92456 163 ------
NM_012402chr113492 234 205 ----1857
NM_012405chr173554 3004 2360 1344 854 440 23 12434 ----
NM_012408chr20--196 1268 --
NM_012416chr93244 196 182 ------
NM_012417chr173602 229 68 --1118 --
NM_012420chr1041646 1498 461 345 ------
NM_012425chr104526 152 104 37 --32683 688 27 --
NM_012434chr651689 1404 385 324 68 ------
NM_012443chr103778 626 249 1119 ----
NM_012444chr203327 187 127 ------
NM_012446chr51126 ------
NM_012448chr1772550 2157 1601 1008 539 376 134 31925 37 22 1943 --
NM_012463chr1221559 1548 31343 1290 100 --162
NM_012464chr482360 2228 1917 993 613 515 436 380 --11137 --
NM_012465chr101789 12261 12272 --
NM_012471chrX41897 1873 1574 288 1183 ----
NM_012479chr72533 411 11942 21749 106 --
NM_012486chr12185 96 ------
NM_013229chr1222306 573 1185 ----
NM_013230chrY41499 585 125 42 --1623 --
NM_013233chr2--11133 ----
NM_013249chr111164 149 ----
NM_013255chr7138707 8654 8200 6847 5898 5861 2117 1159 1105 788 742 229 126 21627 1434 ----
NM_013257chr862184 2166 2125 1687 383 277 ------
NM_013261chr463668 3375 2969 2623 2300 1172 13139 1915 --
NM_013262chr641489 1190 569 331 ------
NM_013269chr1244199 4085 1458 470 ----14225
NM_013272chr151146 ------
NM_013279chr1141613 1599 685 419 --2543 227 --
NM_013283chr53734 302 116 --1366 --
NM_013286chr353635 2358 930 823 305 1724 ----
NM_013314chr10142 ------
NM_013336chr361617 1471 459 300 292 94 ------
NM_013346chrX131 ------
NM_013351chr172731 504 ------
NM_013354chr851236 490 213 169 97 ------
NM_013357chr81201 --1745 --
NM_013358chr141730 684 671 370 ------
NM_013361chr192703 249 2504 182 ----
NM_013367chr4178 ------
NM_013372chr1543002 2213 1035 325 12415 12820 --
NM_013377chr123603 197 180 ------
NM_013390chr971599 1498 1459 1422 1386 256 174 1606 ----
NM_013396chr213269 148 60 ------
NM_013401chr112724 650 ------
NM_013433chr1961909 1874 1624 1307 661 139 11751 1532 --
NM_013438chr931603 411 254 ------
NM_013444chrX2920 208 31053 390 93 ----
NM_013446chr751274 1025 1013 309 161 ------
NM_013448chr142620 282 ------
NM_013449chr1272715 2490 2457 1888 708 128 46 12269 1819 --
NM_013450chr221276 460 --1106 --
NM_013986chr221228 ------
NM_013995chrX52531 2416 2155 880 175 11967 1516 --
NM_014005chr532408 1130 25 3954 467 361 --1925
NM_014011chr22479 408 12344 ----
NM_014016chr341645 1310 610 453 ------
NM_014021chr121316 836 ----12865
NM_014028chr653337 2346 633 396 318 --12991 --
NM_014048chr1695234 3728 3568 2026 1707 1569 741 658 551 34093 932 287 1216 --
NM_014057chr961493 1046 997 646 580 372 21576 350 ----
NM_014071chr203383 73 44 ------
NM_014089chr1341742 881 413 142 ------
NM_014106chr1562183 1892 1171 1074 798 40 22628 912 --11156
NM_014109chr831055 944 140 ------
NM_014110chr131013 289 87 11051 1261 --
NM_014112chr824306 1339 15466 ----
NM_014117chr1652437 1819 763 289 92 22200 1774 ----
NM_014141chr754235 4085 1476 1178 180 ------
NM_014153chr161246 ------
NM_014155chr11127438 7363 7008 6740 5628 5487 2946 2891 2361 1801 414 53 1877 37165 6305 615 --
NM_014157chr1674050 3316 2907 2842 1269 1165 542 13886 1275 --
NM_014166chr132942 818 --1158 --
NM_014171chr2143 ------
NM_014181chr252856 2790 2658 750 448 ------
NM_014190chr421748 686 288 50 ----
NM_014191chr1221031 844 ------
NM_014216chr1411605 ------
NM_014217chr141281 1211 209 176 ------
NM_014231chr1262003 1901 1870 1545 1367 619 ------
NM_014233chr1751673 1524 715 115 66 1494 ----
NM_014243chr43764 317 151 --12059 11433
NM_014245chr3151 2303 178 ----
NM_014248chr22----154 --
NM_014253chrX22104 1861 21593 278 ----
NM_014264chr41216 ----155
NM_014265chr83778 193 144 ------
NM_014267chr111922 1807 185 --
NM_014268chr1841443 1175 1121 1022 11382 ----
NM_014271chrX2620 218 ------
NM_014278chr4----1441 --
NM_014280chr14595 588 260 29 --1201 --
NM_014283chr151267 552 353 134 31 ------
NM_014284chr13947 673 63 ------
NM_014286chr962590 2556 2403 1227 382 99 12202 22531 1282 --
NM_014288chr12291 253 ------
NM_014289chrX41255 1204 1073 1046 21424 1284 ----
NM_014290chr91178 ------
NM_014294chr81489 21487 215 ----
NM_014300chr151465 ------
NM_014305chr13----1123 --
NM_014309chr2275303 5063 5011 4067 3659 1209 449 --11631 --
NM_014313chr141220 1200 1006 74 1221 ----
NM_014319chr121260 ------
NM_014325chr1212061 --11929 --
NM_014331chr477109 6362 5993 5631 5183 3140 2394 2878 331 --27434 5430
NM_014332chrX1374 ------
NM_014335chr1551116 1100 915 259 51 ----1108
NM_014350chr53426 301 114 2863 380 ----
NM_014352chr1161117 1013 962 269 248 67 2539 90 ----
NM_014363chr132890 30 ------
NM_014372chr162087 1939 1884 369 248 55 ------
NM_014376chr531830 1811 517 22565 2138 ----
NM_014382chr331147 287 147 11128 ----
NM_014386chr5150 ------
NM_014392chr441554 1376 375 53 ----1239
NM_014399chr75990 732 266 49 39 1675 ----
NM_014405chr1782256 2137 1893 1706 1589 607 299 209 --22128 381 11791
NM_014410chr181385 ------
NM_014415chr321186 275 ----11500
NM_014417chr19--1595 187 --
NM_014421chr442089 1626 630 517 --1309 --
NM_014423chr595567 4449 4383 3640 3496 1806 1335 1151 779 34917 1839 1436 --24504 2187
NM_014429chr32213 21 ------
NM_014431chr1021410 99 ----11545
NM_014445chr321998 1509 1537 1118 --
NM_014447chr42600 559 ------
NM_014452chr651090 981 820 378 309 11195 ----
NM_014456chr101254 11882 ----
NM_014458chr131337 1118 56 21075 949 ----
NM_014469chr112339 113 ------
NM_014488chr11--2563 527 1102 --
NM_014491chr751042 962 920 890 748 ----149
NM_014494chr1662307 2043 1908 1876 1639 744 --12300 --
NM_014498chr32324 116 ------
NM_014506chr961698 1627 1152 1040 116 56 ------
NM_014515chr121864 ------
NM_014517chr361625 1264 1231 680 528 373 --1134 --
NM_014521chr231874 1687 1631 --1377 --
NM_014547chr151196 ------
NM_014547chr151196 ------
NM_014554chr1292292 2026 2014 1642 825 526 376 70 24 --21921 562 11777
NM_014569chr741477 1041 465 28 21490 217 ----
NM_014572chr1321787 1245 11725 --1216
NM_014577chr222283 253 ------
NM_014584chr14--11104 11264 --
NM_014592chr51115 --1149 --
NM_014603chr1731643 1287 1137 11366 ----
NM_014606chr441256 462 172 116 ------
NM_014607chr251789 1394 778 532 512 21675 838 ----
NM_014612chr951412 1219 1154 959 121 11110 ----
NM_014613chr562379 1904 1200 1123 302 277 22789 866 22165 1965 --
NM_014614chr221258 991 ------
NM_014615chr1653653 2788 2735 1276 525 23035 2545 23314 2918 --
NM_014616chr333517 3057 827 ------
NM_014618chr9125 1136 ----
NM_014620chr12--1658 ----
NM_014630chr1583852 3798 3274 3199 2925 2809 2457 897 21210 369 21106 1039 --
NM_014636chr983450 3038 2862 1726 1699 1350 1291 1090 --14176 --
NM_014647chr1611750 ------
NM_014655chr152078 1846 1722 1618 149 11562 11953 --
NM_014660chr7------2984 934
NM_014665chr852525 841 711 358 60 1928 --187
NM_014666chr51356 ------
NM_014667chr341950 1647 893 746 --12348 --
NM_014670chr241626 1286 251 83 --1295 --
NM_014674chr363930 3320 3156 2653 1064 37 12783 ----
NM_014675chr11462 ------
NM_014676chr121674 1078 1335 ----
NM_014677chr82891 547 21329 325 ----
NM_014679chr114988 965 936 553 ------
NM_014682chr82546 217 ------
NM_014683chr1741715 760 576 521 1543 --12000
NM_014685chr162548 462 ------
NM_014689chr2139 ------
NM_014690chr782826 2773 2730 2707 2067 1115 737 25 12692 12037 --
NM_014701chr1563236 1299 999 960 265 57 33263 2128 587 ----
NM_014705chr731862 1623 267 ------
NM_014707chr732271 1968 1795 ------
NM_014709chr21636 1184 ----
NM_014711chr164706 664 478 49 ------
NM_014715chr114953 740 601 194 1858 ----
NM_014720chr1041481 237 112 62 ------
NM_014721chr61878 46446 6408 2969 793 ----
NM_014729chr822167 374 ------
NM_014730chr1274848 4529 1434 1290 1050 996 234 1597 ----
NM_014730chr1274848 4529 1434 1290 1050 996 234 1597 ----
NM_014733chr541460 679 202 146 ------
NM_014735chrX22047 30 31976 1735 1554 ----
NM_014739chr673777 3335 2853 2661 1402 1370 1090 ----13307
NM_014741chr1161938 1832 1696 521 242 223 1807 ----
NM_014742chr2011723 ------
NM_014743chr453145 2039 836 816 346 --1648 --
NM_014746chr284413 3436 2790 2701 1546 1261 1175 593 14020 1330 --
NM_014747chr194849 4651 4436 4389 4127 4114 3975 3731 2228 --25554 697 --
NM_014751chr821842 189 2491 143 ----
NM_014752chr112279 36 --1536 --
NM_014755chr2114120 3827 3804 3650 3610 3365 2873 1330 1102 473 428 1167 21666 1511 13763
NM_014757chr572361 2083 2020 1642 1633 929 838 --11571 --
NM_014764chr12--2141 46 1353 --
NM_014765chr122551 717 21951 1049 ----
NM_014774chr1103069 2529 2389 2287 2134 863 431 303 228 124 ----11226
NM_014779chr351068 841 791 343 118 ------
NM_014783chr1551109 538 532 261 255 ------
NM_014791chr9----1253 --
NM_014795chr231274 1236 480 ------
NM_014800chr731138 879 741 1157 ----
NM_014802chr124968 710 266 72 ------
NM_014810chr183411 3400 3154 3049 1382 249 104 50 23271 873 ----
NM_014812chr141893 1448 1250 298 1757 1520 --
NM_014819chr541770 1549 736 143 ------
NM_014820chr321840 1787 ------
NM_014822chr42481 119 ------
NM_014824chr1121527 79 11692 ----
NM_014826chr164373 3860 3726 3670 3234 963 162 1203 --
NM_014828chr1411681 1209 ----
NM_014829chr552341 2315 759 713 303 1364 --11768
NM_014830chr1243347 1555 1320 1124 --22776 789 --
NM_014832chr1311875 12066 ----
NM_014835chr2031780 480 434 1567 12318 --
NM_014838chr2222834 622 12143 11141 --
NM_014839chr131819 1600 1589 ------
NM_014848chr1582704 2377 2177 2013 1823 1755 861 122 1996 ----
NM_014850chr3114373 3867 3644 3399 3267 1687 1418 1268 577 97 61 --1689 11399
NM_014857chr1--288 37 ----
NM_014859chr174562 390 246 220 1269 2522 233 --
NM_014860chr262551 2431 2408 898 596 534 21641 705 ----
NM_014862chr15104224 3928 3782 2985 1419 1314 1262 1152 1131 1009 --11105 13042
NM_014864chr1154051 3652 3619 3603 1494 1437 1398 1240 1161 1031 740 712 616 213 127 --13897 --
NM_014870chr142920 1170 489 26 31701 1061 797 ----
NM_014873chr134809 3300 3264 14540 24664 46 --
NM_014874chr12380 175 1224 ----
NM_014876chr2242218 1877 1724 378 11658 ----
NM_014877chr17107551 6801 5040 4796 1705 1480 1438 1420 1335 499 26400 3090 --15429
NM_014880chr282256 2087 2065 2042 713 704 320 194 ------
NM_014883chr432294 547 421 1634 1529 --
NM_014885chr4--175 ----
NM_014892chr62132 29 ------
NM_014897chr1753098 2691 2526 982 250 ------
NM_014899chr543177 2756 1043 830 23075 2564 ----
NM_014902chr2031489 437 84 1124 ----
NM_014903chr1222001 30 --1314 --
NM_014904chr1053911 2818 1631 1336 698 1306 1175 --
NM_014905chr21574 ------
NM_014906chr1773747 3569 3153 3063 2941 1000 496 ------
NM_014909chr1473940 3865 3270 3139 2864 2856 991 23911 616 ----
NM_014912chr1093408 3099 2878 2602 2184 1357 654 600 242 ----13289
NM_014916chr7------1530
NM_014918chr152400 187 11152 ----
NM_014920chr633120 1478 50 --23482 510 --
NM_014921chr1962916 2837 2491 1894 844 599 ------
NM_014923chr1351712 1621 804 282 266 12319 ----
NM_014926chr35949 293 245 236 114 ------
NM_014932chr351769 1606 1573 1462 484 --11374 --
NM_014934chr1373944 3791 3701 3146 1203 1094 1044 22427 539 ----
NM_014936chr621099 918 1481 ----
NM_014945chr561888 1757 1298 482 461 175 ------
NM_014946chr282734 2289 1917 1239 955 623 207 105 --12599 160
NM_014947chr142669 2543 843 40 12485 ----
NM_014950chr14--2322 43 ----
NM_014951chr1032458 2344 472 11679 1968 22055 1691
NM_014953chr1373990 3446 3318 3027 2719 1291 1261 64208 3093 1019 911 365 22 ----
NM_014961chr491816 1749 1687 1620 747 611 286 138 122 ------
NM_014962chr2042873 2037 1036 147 ------
NM_014964chr1792227 2162 1916 1792 600 443 352 254 173 ------
NM_014974chr1071722 1547 535 521 263 217 27 1232 1603 --
NM_014977chr141495 ------
NM_014978chr104232 99 38 30 11315 1279 --
NM_014982chr1475231 4749 3683 3283 3274 2162 2107 11911 ----
NM_014988chr432319 814 585 12740 ----
NM_014989chr641668 1284 833 732 ------
NM_014991chr4103097 2970 2797 2625 2317 2291 2077 860 443 239 22011 1126 1699 --
NM_014992chr141250 ------
NM_014996chr32390 204 ------
NM_014997chr752281 2252 1124 177 112 ----12146
NM_015000chr1272627 2611 2605 2164 1176 1100 459 1661 --1716
NM_015001chr13795 378 33 ------
NM_015002chr12243 25 32198 1965 1805 ----
NM_015008chr363578 3138 2636 2486 2309 1232 --12479 12517
NM_015009chr31295 1313 ----
NM_015012chr11163 ------
NM_015015chr193816 339 307 ------
NM_015020chr1653569 3349 2433 1304 931 1954 11084 13312
NM_015025chr272029 1975 1056 886 824 586 482 --12424 --
NM_015026chr1294539 4463 4426 4270 4133 1457 1285 1217 922 1639 ----
NM_015027chr1621779 224 21798 1297 ----
NM_015032chr1352764 701 389 132 22 1564 --12689
NM_015033chr933308 810 33 23152 1267 --12183
NM_015039chr183413 3115 2860 2790 1520 974 791 436 --21037 193 --
NM_015042chr1554259 3716 3172 1079 686 13860 13679 --
NM_015045chr1042177 2064 1538 1423 12282 ----
NM_015049chr263257 2903 2739 2199 1155 625 12627 123 --
NM_015052chr731026 1008 168 1187 ----
NM_015054chr12188 ------
NM_015055chr1172883 2408 2156 2030 572 487 475 ------
NM_015056chr2162606 2439 2364 879 755 79 164 21044 930 --
NM_015059chr1583513 3340 3287 2945 2736 1493 1483 1476 64011 3896 2485 1202 1041 909 12428 --
NM_015064chr1263334 2836 1035 921 574 447 12528 22893 2648 --
NM_015068chr752887 910 504 454 289 21096 100 --1191
NM_015069chr16----1242 --
NM_015071chr586547 5879 4840 4146 2175 1882 1475 1390 1327 26358 4489 --
NM_015073chr1961722 1466 798 728 608 24 11830 ----
NM_015074chr1144731 4715 4624 4596 4378 3566 3536 1992 1386 1021 757 522 420 31 13016 ----
NM_015076chr694556 3124 2823 2800 1683 1005 634 455 315 2771 282 23522 3095 --
NM_015079chr1522164 982 12446 --13212
NM_015080chr1111012 ------
NM_015082chr552565 2042 1029 480 383 21880 343 ----
NM_015087chr1342577 2088 2049 193 1131 ----
NM_015090chr1116003 5964 5791 4663 2184 1796 1625 1151 625 383 332 21551 100 25084 4740 26111 5419
NM_015091chr142546 61 ----1720
NM_015092chr1674467 4132 3813 3474 2852 1873 1054 ------
NM_015093chr641716 510 316 21 11612 ----
NM_015094chr2244697 4135 3878 3601 13518 23219 1155 --
NM_015097chr32659 303 --11886 --
NM_015100chr141763 1676 746 259 1704 11908 --
NM_015101chr172886 2589 2443 2294 2144 2135 1859 --42672 2554 2540 1883 --
NM_015107chrX82334 1878 1834 1515 636 399 206 45 22222 184 ----
NM_015125chr191486 ------
NM_015132chr711572 11314 161 --
NM_015138chr1542499 2133 435 56 ------
NM_015143chr441376 1293 82 32 ------
NM_015149chr152180 2024 1750 656 322 11420 1528 1631
NM_015151chr2121031 332 ------
NM_015156chr1473689 3629 3426 2478 2461 1079 855 2725 541 1443 --
NM_015158chr92567 295 ------
NM_015170chr841636 897 614 315 11581 --21825 330
NM_015173chr461720 1703 1391 641 519 48 11237 --11126
NM_015176chr141686 1553 1130 325 --1464 --
NM_015180chr141763 ------
NM_015185chrX52885 2830 2228 619 527 11187 165 --
NM_015187chr41267 ------
NM_015192chr202428 91 22582 472 ----
NM_015199chr332085 1899 616 --13003 --
NM_015200chr42923 251 11742 11981 --
NM_015206chr1553808 2997 2976 2608 514 --1612 1592
NM_015208chr1831515 1503 177 13069 ----
NM_015209chr142272 1948 1887 677 ------
NM_015213chr11--1197 159 --
NM_015215chr12745 255 2821 207 ----
NM_015216chr53625 428 337 ------
NM_015225chr942336 766 188 90 52097 1201 927 457 326 1251 --
NM_015226chr1631367 918 693 12962 33198 1357 588 --
NM_015231chr11--2953 316 ----
NM_015233chr1332209 1937 928 1272 22736 906 --
NM_015235chr1051985 1874 1787 1686 778 11439 ----
NM_015247chr1674473 3350 3267 1852 1602 1256 521 24965 2019 24593 1204 --
NM_015250chr921700 1435 21914 1875 21287 740 --
NM_015252chr21977 ------
NM_015256chr5--1583 ----
NM_015265chr242463 2389 2021 468 1313 ----
NM_015267chr1231723 539 44 ------
NM_015269chr11407 ------
NM_015271chr463715 1626 759 616 446 120 24253 187 11372 13963
NM_015272chr1631691 513 243 11665 ----
NM_015275chr1231530 862 345 1182 ----
NM_015277chr18174 2472 130 11679 --
NM_015278chr653214 2938 2406 1320 1094 1663 ----
NM_015282chr232768 2663 555 12970 22034 61 --
NM_015284chr162083 2073 1866 1719 1351 398 32135 1989 573 12153 --
NM_015285chr1852082 1728 800 677 583 22321 978 ----
NM_015288chr583477 3388 3227 2715 2506 2457 1433 1150 --13356 --
NM_015291chr183470 2411 2380 2163 1310 1142 781 37 22396 1176 ----
NM_015293chr63537 92 86 ------
NM_015296chr1311140 154 2501 278 --
NM_015299chr1483727 3364 2885 2640 1567 1433 559 166 1729 ----
NM_015305chr1441974 1386 1197 370 1395 2383 153 --
NM_015308chr113859 767 108 ------
NM_015310chr8127372 6480 6367 6005 5981 5495 3224 1230 1172 1148 222 59 17779 ----
NM_015313chr1194074 3969 3891 3814 3786 3539 3470 1906 1779 14115 21457 430 --
NM_015314chr762444 2012 1900 1649 796 161 11789 ----
NM_015315chr542332 994 581 124 12514 1744 --
NM_015316chr1421018 201 1258 ----
NM_015317chr262608 2516 1941 1905 472 128 32528 1146 94 ----
NM_015321chr19114906 4415 4370 4304 3861 3518 1779 1231 1162 736 435 13690 14085 --
NM_015322chr15152 ------
NM_015326chr142808 2479 869 63 ------
NM_015335chr1262571 2385 1732 1677 640 453 ----1232
NM_015336chr1222364 2091 ------
NM_015338chr2051867 714 564 122 62 --11374 --
NM_015339chr2051000 842 818 405 190 ------
NM_015344chr872054 1991 1893 1764 1709 1453 864 ------
NM_015345chr642776 2515 2220 496 22690 2447 --12154
NM_015347chr1262539 2472 2130 1873 1043 730 42665 2492 2171 680 ----
NM_015349chr652811 2798 2007 1101 124 32875 2160 1044 ----
NM_015358chr2131098 862 416 ------
NM_015365chrX73777 3478 2903 2709 2641 800 66 14302 23628 3165 11485
NM_015367chr2221563 1044 11262 ----
NM_015378chr132499 1955 1945 --1410 --
NM_015381chr2251966 1760 1380 154 36 1463 ----
NM_015382chr142703 34 ----1297
NM_015387chr231923 1619 458 1735 ----
NM_015397chr951928 1718 1655 467 443 11830 1391 --
NM_015409chr123844 259 44 --42780 2330 2261 396 12609
NM_015419chrX4816 434 214 142 1308 ----
NM_015429chr321073 21 1449 11057 --
NM_015435chr821023 166 ------
NM_015447chr9----1139 --
NM_015449chr12695 512 1295 ----
NM_015455chr553891 3865 3661 1138 656 23051 2928 1603 1118
NM_015460chr341968 1532 328 320 11383 ----
NM_015461chr18--179 ----
NM_015464chr72921 874 1418 1157 1960
NM_015465chr53739 531 184 ------
NM_015475chr22403 377 ------
NM_015477chr15--1338 ----
NM_015483chr71746 1810 ----
NM_015496chr81302 ------
NM_015497chr1541113 457 297 125 ------
NM_015507chrX3400 191 26 ------
NM_015509chr1271537 1384 1353 1222 1148 242 50 ------
NM_015511chr2061116 896 860 841 432 227 ------
NM_015520chr31666 1724 --161
NM_015525chr621176 736 1857 ----
NM_015532chr1512167 --22513 55 1165
NM_015535chr233496 1486 220 12762 32966 2584 995 --
NM_015542chr103502 248 216 11223 11246 1867
NM_015550chr7133508 3417 3106 3004 2982 2507 2378 1227 1147 1034 927 612 51 --13135 --
NM_015554chr1552800 1989 1153 412 149 --12525 --
NM_015555chr671745 1407 684 480 472 149 34 ------
NM_015559chr1821080 872 1197 ----
NM_015564chr563068 2819 2575 2544 1183 1155 2481 289 --11060
NM_015565chr2121626 203 --2653 117 1898
NM_015567chr131217 ------
NM_015568chr2084224 4165 4156 3648 2942 2821 1466 259 23000 2984 ----
NM_015569chr184704 4596 3551 2997 2950 1887 202 173 34726 1877 149 ----
NM_015570chr731829 1367 194 11804 11728 --
NM_015571chr631991 935 762 131 --149
NM_015575chr243272 3026 1387 60 ----11106
NM_015576chr322257 2193 32578 2200 2170 ----
NM_015577chr5--11286 11599 --
NM_015578chr1921593 1368 ------
NM_015601chr101218 21032 360 1939 --
NM_015602chr141822 1786 334 55 ------
NM_015605chr1071493 1135 993 616 408 230 24 ------
NM_015609chr152574 2316 1050 766 156 12429 22488 1921 --
NM_015610chr782618 2280 678 622 609 338 114 58 ------
NM_015630chr221130 1051 11028 ----
NM_015635chr951898 1568 1448 707 136 ------
NM_015640chr175026 4972 3515 3506 2106 1835 1674 21493 1170 --13278
NM_015646chr121176 --1109 --
NM_015652chr102636 49 ------
NM_015657chr2--2307 89 ----
NM_015670chr17------1348
NM_015678chr1321197 306 ------
NM_015686chrX62220 2138 1989 1675 969 963 --12319 --
NM_015691chrX42845 2221 984 386 12346 ----
NM_015695chr652021 1836 1790 1449 503 1843 21765 736 --
NM_015726chr12572 106 11320 1447 --
NM_015833chr2122195 1974 --11785 --
NM_015866chr121546 1072 ------
NM_015874chr43634 498 432 ------
NM_015878chr841867 1820 1776 1681 ------
NM_015879chr18138455 8324 7968 7236 6176 5933 5500 3228 2808 2763 2406 1091 456 37161 2844 67 12340 --
NM_015885chr111726 ----1124
NM_015888chr163272 3027 591 290 165 72 --1745 12711
NM_015902chr81800 ------
NM_015906chr124179 3032 34094 1354 1168 ----
NM_015912chr822094 1748 ------
NM_015948chr62474 61 ------
NM_015955chr22501 126 ------
NM_015975chrX41679 1227 276 82 ------
NM_015981chr553126 2483 1980 1178 981 ----12142
NM_015982chr171136 ------
NM_015986chr1731209 911 510 --11382 --
NM_015995chr1575429 4991 3966 3606 2152 1490 53 1688 34332 1346 1085 22194 651
NM_015999chr11172 1149 ----
NM_016003chr782618 2280 678 622 609 338 114 58 ------
NM_016009chr174733 4253 3756 421 134 83 37 34926 4211 3764 14725 --
NM_016018chr832352 2069 1849 1906 ----
NM_016019chr71393 ------
NM_016021chr683047 2994 2737 1945 1892 513 298 272 33010 1128 972 ----
NM_016025chr1631406 806 508 11700 ----
NM_016032chrX2558 21 ------
NM_016045chr2031852 1718 340 ------
NM_016047chr2155 ------
NM_016057chr1221149 1040 11281 ----
NM_016061chr21141 ------
NM_016071chr72207 94 --127 --
NM_016072chr1232195 1826 1748 ------
NM_016073chr152800 786 ------
NM_016076chr142606 929 877 704 43160 3076 2069 344 ----
NM_016083chr673740 3580 2791 832 771 509 269 33522 2575 346 33341 3094 856 11315
NM_016090chr112913 184 ------
NM_016096chr851846 808 356 55 31 ------
NM_016103chr5190 ------
NM_016107chr51856 1327 11047 --
NM_016120chrX2490 338 ------
NM_016121chr11259 2397 362 --1993
NM_016122chr122487 390 ------
NM_016127chr82565 57 --1544 --
NM_016131chr272159 2141 1834 1593 1473 707 169 ------
NM_016132chr1533102 2796 666 1943 ----
NM_016133chr231547 1408 1148 1211 11257 --
NM_016141chr3------1778
NM_016147chr1151192 1161 1080 943 150 ------
NM_016152chr341271 1066 994 329 21202 40 ----
NM_016169chr1083206 2634 2508 2417 1247 886 878 606 11026 ----
NM_016172chr92407 148 193 ----
NM_016203chr7----1213 --
NM_016205chr421037 1009 1123 1115 --
NM_016206chr3178594 8465 8417 8380 7110 6810 6331 5672 5528 3506 3357 3099 2340 2158 1913 1646 148 67895 7218 6359 6075 3084 835 27244 6924 16851
NM_016221chr532331 688 86 --12224 --
NM_016224chr641711 818 415 372 ------
NM_016226chr122375 129 --2478 332 --
NM_016227chr151267 552 353 134 31 ------
NM_016231chr1721679 170 ------
NM_016235chr1621516 477 11420 ----
NM_016247chr31454 ------
NM_016248chr1393992 3807 3718 3683 3293 3115 1452 1149 483 32914 2664 202 ----
NM_016250chr142134 128 ----1161
NM_016255chr652788 2244 970 278 258 32700 2644 2129 ----
NM_016257chr173465 3061 1367 1058 1036 677 159 12595 ----
NM_016258chr1184 --1560 168
NM_016260chr2107332 6525 6061 2864 2551 2460 671 397 100 78 55870 5864 5132 853 759 26160 2994 15293
NM_016262chr6125 --154 --
NM_016271chr1852155 1737 1575 1552 1477 21775 805 ----
NM_016272chr2232823 2487 2420 --2525 107 --
NM_016275chr352727 2610 1987 1814 711 11859 ----
NM_016279chr5--1345 --1335
NM_016281chr121964 21034 203 ----
NM_016284chr161268 --197 --
NM_016287chr142061 1851 1424 513 --1232 --
NM_016289chr22435 212 21634 421 ----
NM_016297chr231060 1045 897 1562 12976 1662
NM_016301chr121415 ------
NM_016306chr3121 ------
NM_016322chr953135 3060 2926 577 234 23171 1115 22638 34 12592
NM_016329chr32133 28 ------
NM_016351chr71510 ------
NM_016353chr81268 42188 2033 1628 461 ----
NM_016356chr642725 2576 1795 546 1456 12700 --
NM_016374chr121149 1091 --1248 --
NM_016374chr121149 1091 --1248 --
NM_016376chr1753372 3063 2717 619 463 12727 13460 12897
NM_016395chr1541252 492 125 64 ------
NM_016396chr1542773 480 354 164 22111 2006 ----
NM_016403chr112755 56 ------
NM_016418chr2262644 2424 1314 1037 699 186 --145 --
NM_016422chr1142772 2480 2429 2384 11951 1673 --
NM_016424chr1751856 1789 1492 1475 766 --11974 --
NM_016427chr18--1101 ----
NM_016436chr2041958 1071 923 377 1610 ----
NM_016442chr511505 2921 570 1722 --
NM_016448chr181871 1380 1319 1232 1199 1171 358 293 ------
NM_016467chr221365 1294 ------
NM_016485chr622034 1730 2616 66 --11635
NM_016507chr1742079 2043 1166 739 12161 11279 --
NM_016513chr633120 1478 50 --23482 510 --
NM_016519chr4268 25 ------
NM_016520chr93780 315 32 ------
NM_016522chr1111479 --21140 422 --
NM_016529chr1341276 1008 126 25 ----11064
NM_016530chr1533812 3767 1021 11435 12649 --
NM_016531chr433626 645 553 11268 ----
NM_016542chrX4473 312 298 107 ------
NM_016544chr253516 2800 917 714 448 --149 --
NM_016545chr11798 --1336 --
NM_016559chr311462 11157 ----
NM_016570chr122461 50 ------
NM_016574chr1151117 914 892 733 309 --1319 --
NM_016577chr344378 969 434 380 11732 13015 --
NM_016578chr111112 ------
NM_016586chr141343 1155 ----
NM_016591chr53969 910 235 ------
NM_016603chr532238 568 541 2392 229 ----
NM_016604chr541260 1069 325 248 ------
NM_016605chr54792 700 521 139 12129 ----
NM_016607chrX21643 1308 ------
NM_016622chr251958 1786 687 603 168 ----1631
NM_016623chr81528 1563 ----
NM_016628chr102677 91 ------
NM_016631chr21--1350 ----
NM_016644chr5171 ------
NM_016818chr211565 --1181 --
NM_016824chr1021797 121 21613 159 21313 295 --
NM_016834chr1763674 3424 3167 2605 993 838 --13044 --
NM_016835chr1763674 3424 3167 2605 993 838 --13044 --
NM_016841chr1763674 3424 3167 2605 993 838 --13044 --
NM_016929chr6114319 4035 3792 3480 3308 2848 2822 1842 1761 335 228 21504 424 33355 1222 977 14459
NM_016931chr11158 ------
NM_016950chr431462 300 75 ------
NM_016952chr11114038 3680 3336 3155 2948 1380 853 822 501 436 85 ------
NM_017412chr841399 962 943 449 1335 ----
NM_017413chrX42513 852 251 227 22506 339 21808 350 --
NM_017415chr564080 3548 1313 589 250 70 13596 ----
NM_017420chr1443183 3084 1003 130 ------
NM_017423chr4--11699 1491 1398
NM_017426chr42196 41 --159 --
NM_017437chr1431609 1489 332 --135 --
NM_017440chr124590 561 420 247 ------
NM_017447chr2134254 4112 3831 1895 ----
NM_017450chr1731022 427 48 ------
NM_017488chr21250 --21302 1225 --
NM_017489chr821201 1155 11243 ----
NM_017519chr62349 295 ------
NM_017526chr1--1115 ----
NM_017546chr23876 549 152 ------
NM_017551chr1052017 750 613 323 238 22671 2390 ----
NM_017580chr10--2443 334 ----
NM_017582chr141535 1264 272 54 ------
NM_017583chr1121234 678 11414 ----
NM_017593chr4299 40 ------
NM_017594chr933209 2909 2217 1652 ----
NM_017599chr1271914 1829 1703 1473 1380 621 183 21657 663 ----
NM_017610chr15--21333 405 ----
NM_017628chr494599 3884 3265 1967 1785 1729 1383 757 620 54061 1956 1191 1091 385 11979 --
NM_017629chr161761 676 495 474 287 276 ------
NM_017632chr4157 1316 ----
NM_017634chr821871 172 ----11517
NM_017635chr1151472 535 444 285 204 ------
NM_017637chr998894 8847 8216 7212 7106 6803 5958 1662 240 1499 13156 15781
NM_017643chr1782967 2530 2505 2451 2278 1921 1252 399 ------
NM_017644chr3104861 4200 4080 1118 719 588 471 302 247 231 23265 1167 ----
NM_017658chr1494525 3941 3165 3130 2880 1364 893 563 235 --11162 --
NM_017661chr151967 --1844 --
NM_017664chr131121 ------
NM_017666chrX52029 1365 875 711 589 1278 --1576
NM_017667chr71169 ------
NM_017672chr151284 ------
NM_017686chr11768 11085 ----
NM_017693chr133527 347 109 ------
NM_017694chr242033 2025 444 194 12009 --21631 245
NM_017709chr1103580 3568 3403 3338 3016 2917 2873 1692 1570 1233 --1699 --
NM_017719chr351903 1727 1597 483 123 --1377 --
NM_017728chr1762897 2376 2015 1141 291 165 ------
NM_017730chr31611 1173 --156
NM_017737chr111683 31633 1450 751 11921 --
NM_017742chr1841963 1863 1570 557 2421 240 1342 --
NM_017745chrX1647 ------
NM_017747chr52287 48 ------
NM_017749chr112289 203 ------
NM_017753chr93777 664 41 ------
NM_017762chr1542407 659 523 448 12017 ----
NM_017768chr13659 615 112 1299 ----
NM_017769chr1452658 2553 2529 2080 73 11047 ----
NM_017772chr621209 142 21378 34 11117 --
NM_017779chr152606 2574 2473 2225 1981 22169 1671 ----
NM_017780chr83830 756 738 ------
NM_017787chr1032830 2327 1816 ----41032 833 92 82
NM_017798chr20139 ------
NM_017799chr1431784 1601 1394 11807 ----
NM_017810chr162118 90 ------
NM_017811chr982994 2772 2292 1968 1134 746 694 602 --1966 1176
NM_017813chr8125662 5240 4940 4903 3925 3774 3656 2256 1754 1629 1616 1531 44596 954 347 332 15346 --
NM_017848chrX124320 4187 3771 3588 3292 3281 2965 1693 1671 1645 1267 654 --13790 --
NM_017857chr111274 --1238 --
NM_017880chr21311 ------
NM_017893chr101535 11170 ----
NM_017902chr10125605 5311 5180 4991 4335 2150 1825 1571 1016 699 632 224 25503 2137 --14369
NM_017911chr2231179 223 40 11354 ----
NM_017919chr9135169 3921 2270 1837 1558 1170 1096 819 722 596 533 369 78 15444 35019 1583 51 --
NM_017921chr174828 659 482 360 12093 11709 --
NM_017922chr142593 421 ----1655
NM_017925chr921819 1277 11808 ----
NM_017982chr1150 ----1989
NM_017987chr1062048 1500 887 710 279 125 ------
NM_017988chr121329 2815 594 ----
NM_017994chr742387 1983 517 425 11034 ----
NM_018027chr10--23277 2203 ----
NM_018045chr153022 2372 617 385 112 12929 1339 --
NM_018061chr131445 443 430 1583 ----
NM_018078chr42935 122 --2260 247 --
NM_018084chr252791 2612 2282 1262 140 31233 1063 185 ----
NM_018085chr1118124 7848 7042 5465 3229 2200 2039 951 241 83 70 12662 27614 691 15972
NM_018092chr1661663 1470 1299 1156 1096 112 ------
NM_018097chr152195 161 ------
NM_018107chr143727 720 283 2392 385 ----
NM_018121chr1012642 --1217 --
NM_018126chr421577 611 --1576 11215
NM_018131chr102807 113 ------
NM_018133chr352085 1963 1947 1435 483 1430 ----
NM_018139chr14121 ------
NM_018155chr383440 3142 3061 2513 2480 1222 395 172 ----12185
NM_018156chr132499 1955 1945 --1410 --
NM_018178chr12182 162 11998 --12058
NM_018179chr12144 ------
NM_018181chr1831645 1304 134 11763 ----
NM_018184chr322085 1496 1469 ----
NM_018191chr134833 551 524 369 --1230 --
NM_018195chr1121457 549 --11774 --
NM_018196chrX21044 255 ------
NM_018200chr151355 22568 302 ----
NM_018206chr161169 2716 162 ----
NM_018207chr161510 1504 655 313 291 210 ------
NM_018211chr161458 1433 1407 628 443 406 ------
NM_018214chr62430 115 --1269 --
NM_018216chr11216 ------
NM_018222chr1131525 1344 1178 1413 ----
NM_018243chr463365 3129 2973 1514 1018 781 23864 647 ----
NM_018246chr862791 2023 2005 1068 298 161 2394 112 32561 61 26 --
NM_018247chr621921 426 ----1811
NM_018254chr1--11862 --11900
NM_018266chr331085 312 175 1996 ----
NM_018269chr2176 2852 198 ----
NM_018287chr1021059 356 1393 ----
NM_018290chr451020 975 949 942 875 ----1156
NM_018293chr342766 803 327 96 ------
NM_018299chr853147 3078 1296 1273 86 ----12672
NM_018302chr451970 1932 1704 1522 647 21981 905 ----
NM_018312chr1121976 268 1133 11599 --
NM_018313chr342422 2248 532 194 32197 1737 1069 ----
NM_018314chr111519 ------
NM_018315chr411417 11539 2441 272 --
NM_018319chr1421499 572 11052 ----
NM_018327chr2031886 433 33 --11261 --
NM_018330chr102513 426 ------
NM_018348chr162338 87 ----1910
NM_018351chr1264231 4044 3658 3584 3572 1713 14198 ----
NM_018360chrX149 ------
NM_018364chr193926 3837 3463 3052 1219 1193 1153 584 231 12986 23654 2627 --
NM_018367chr1162216 772 762 701 370 331 1742 22100 123 --
NM_018372chr12217 202 ------
NM_018373chr14114832 4312 2534 2445 1883 1634 1030 614 418 320 251 --24586 396 --
NM_018374chr751692 433 418 199 87 24170 1570 --1702
NM_018375chr1431931 1534 1325 ------
NM_018381chr193719 650 92 --3906 606 323 --
NM_018383chr241899 694 443 255 ------
NM_018387chr91494 ------
NM_018403chr363663 3539 2690 1055 710 570 43735 2774 757 334 --13903
NM_018409chr432265 734 721 13291 ----
NM_018424chr941682 1577 1265 673 21522 33 ----
NM_018425chr1052040 1736 1034 891 556 2420 104 12314 --
NM_018427chr162493 454 ------
NM_018433chr2293 70 ------
NM_018439chr1841008 798 503 458 --22174 2038 1811
NM_018440chr8208473 8170 7948 7523 6674 6651 6444 5806 5618 3191 3049 2515 2190 1931 1800 1642 1556 1273 504 429 ----15343
NM_018444chr852173 924 386 310 152 12130 ----
NM_018448chr121843 ------
NM_018462chr34561 348 228 143 2725 74 --1790
NM_018469chr1721211 398 --1427 --
NM_018471chr22170 158 ------
NM_018477chr143995 793 158 ------
NM_018482chr852240 2234 2213 2204 2102 2174 55 ----
NM_018509chr1731448 1438 1370 --11388 --
NM_018557chr241540 1482 1374 254 11227 21115 1089 --
NM_018566chr155112 3883 2051 1730 1551 11609 23441 1369 --
NM_018569chr42378 199 1302 ----
NM_018571chr22601 41 ------
NM_018638chr1283739 3542 2178 1938 1488 1297 1138 440 24711 4213 ----
NM_018639chr1221213 165 ------
NM_018640chr1262556 2384 2163 2149 1128 460 22765 695 ----
NM_018650chr1--21701 848 --1475
NM_018652chr152943 84 ------
NM_018658chr1732249 802 755 1274 1782 --
NM_018660chr882932 2909 2756 2570 2425 2374 2235 866 ------
NM_018682chr73633 269 100 ----1662
NM_018683chr2021569 441 --31673 1519 375 --
NM_018689chr1551738 581 570 457 240 12288 ----
NM_018691chr541186 1176 1024 442 1150 ----
NM_018695chr552430 1682 1619 1506 540 ----12216
NM_018698chrX2253 137 11353 ----
NM_018710chr82487 127 11374 ----
NM_018712chr1141462 1296 466 278 ------
NM_018834chr53937 705 65 1399 1891 --
NM_018841chr183603 3384 3083 1454 1403 1080 1025 272 32688 559 76 ----
NM_018846chr71852 ------
NM_018890chr761462 1191 323 255 107 43 --1382 --
NM_018898chr522191 878 --1563 --
NM_018899chr522191 878 --1563 --
NM_018900chr522191 878 --1563 --
NM_018901chr522191 878 --1563 --
NM_018902chr522191 878 --1563 --
NM_018903chr522191 878 --1563 --
NM_018904chr522191 878 --1563 --
NM_018905chr522191 878 --1563 --
NM_018906chr522191 878 --1563 --
NM_018907chr522191 878 --1563 --
NM_018908chr522191 878 --1563 --
NM_018909chr522191 878 --1563 --
NM_018910chr522191 878 --1563 --
NM_018911chr522191 878 --1563 --
NM_018945chr6103321 1333 1037 987 964 662 627 480 133 96 ------
NM_018951chr71168 ------
NM_018970chr762804 2467 1166 636 422 42 ------
NM_018976chr1222008 1960 --12756 --
NM_018979chr1242609 2439 1874 1780 11607 ----
NM_018999chr1074736 4544 4418 3691 3264 3049 150 ------
NM_019000chr511457 21548 1211 ----
NM_019001chr374648 4605 3809 1869 1581 789 48 11446 --13436
NM_019002chr22363 104 ------
NM_019004chr722203 76 22308 1545 ----
NM_019008chr22113581 3032 2835 2792 2775 2662 1061 917 884 570 403 13517 ----
NM_019022chr1893211 2863 2469 1950 1138 1088 849 234 84 --32890 2009 657 11244
NM_019027chr442636 2565 1882 1013 2377 237 ----
NM_019035chr431995 1637 511 ------
NM_019036chr611238 2829 809 ----
NM_019050chr431561 765 534 12232 ----
NM_019053chr1041006 834 428 54 ------
NM_019063chr232024 1482 550 2888 741 ----
NM_019071chr72143 60 ------
NM_019074chr151185 --2974 49 1283
NM_019080chr1331404 1099 599 ------
NM_019083chr141581 1217 1148 349 21204 550 ----
NM_019084chr1022144 633 1793 ----
NM_019087chr581752 1553 1308 1233 1227 367 242 35 ------
NM_019094chr1263833 3747 3404 3030 2858 1061 13134 1962 --
NM_019096chr63856 805 145 ------
NM_019102chr7----170 --
NM_019102chr7----170 --
NM_019106chr2253427 1114 889 735 74 --12868 --
NM_019114chr972534 2006 1897 467 327 153 40 ------
NM_019116chr1683560 3455 3011 2956 2594 2326 1215 997 1164 ----
NM_019555chr371806 1205 654 510 415 368 144 1265 ----
NM_019557chr14701 686 660 60 148 199 --
NM_019590chr1021132 516 ------
NM_019592chr95882 276 168 131 119 ------
NM_019593chr2063046 2834 2344 2300 2143 1942 --12019 --
NM_019595chr21177 ------
NM_019596chr2162330 1912 1131 902 801 307 ------
NM_019597chrX1775 ------
NM_019600chr151630 ------
NM_019610chr142060 265 197 113 --21882 341 --
NM_019842chr61140 1343 ----
NM_019859chr1011445 ------
NM_019891chr131117 1088 483 --11144 --
NM_019903chr1021797 121 21613 159 21313 295 --
NM_020066chr12363 218 --1663 144
NM_020116chr431191 1169 83 11130 ----
NM_020120chr261609 1499 1029 512 173 121 --11602 --
NM_020122chr2115998 5757 5074 2378 2004 1310 1054 1000 735 538 409 12044 --24078 1237
NM_020123chr103528 394 257 ------
NM_020133chr6106168 6062 5596 5295 5078 2290 1755 1122 1051 792 12560 15207 14301
NM_020141chr132424 797 344 --22160 1766 --
NM_020144chr761986 1755 1737 491 159 123 ------
NM_020150chr1041428 860 828 635 ------
NM_020156chr71128 ------
NM_020168chr1531327 1289 972 ------
NM_020177chr53886 727 526 11184 ----
NM_020178chr173985 475 400 ------
NM_020199chr531218 940 47 ------
NM_020200chr102419 282 2262 96 ----
NM_020204chr12636 88 ------
NM_020205chr152809 2240 1205 1165 1008 ----12501
NM_020228chr111220 --22361 1693 --
NM_020239chr142324 2240 645 613 11692 12170 --
NM_020240chr562781 2510 2461 2406 960 217 1812 2614 207 --
NM_020245chr674872 4508 3688 3350 1039 1010 192 --11230 --
NM_020307chr31374 ------
NM_020336chr20103766 2929 2865 2715 2560 1092 698 482 247 166 ----12914
NM_020337chr443041 2312 762 171 1526 ----
NM_020338chr1042904 2831 735 384 --21392 357 --
NM_020341chr201160 --21607 1265 --
NM_020342chr22385 264 11955 ----
NM_020346chr11--31361 1226 1165 ----
NM_020357chr31271 21109 653 ----
NM_020384chrX41696 1589 704 129 ------
NM_020390chr344464 3201 1738 742 34838 454 89 11600 --
NM_020405chr1774142 3481 1547 665 321 74 29 23161 871 ----
NM_020416chr442012 876 832 349 12134 12253 163
NM_020420chrY41708 1570 1306 198 ----1408
NM_020429chr773143 2816 1984 1943 753 711 164 22301 1900 22754 2233 --
NM_020431chr1422721 107 ------
NM_020440chr153267 2902 2765 2247 207 33070 382 265 33209 2933 1179 --
NM_020443chr1136462 5130 5106 4425 2692 2519 2451 2004 1465 1447 1280 253 168 35248 2077 746 26916 1700 --
NM_020445chr72722 298 ------
NM_020449chrX1760 1687 ----
NM_020455chr662680 2416 1075 746 597 533 2718 113 ----
NM_020456chr1321694 739 ------
NM_020466chr654674 4163 3312 1307 1199 13164 ----
NM_020474chr1841404 799 330 180 ----11543
NM_020475chr842379 2125 1682 725 ------
NM_020476chr842379 2125 1682 725 ------
NM_020477chr842379 2125 1682 725 ------
NM_020478chr842442 2188 1745 788 ------
NM_020480chr842379 2125 1682 725 ------
NM_020532chr21126 ----1582
NM_020546chr531192 326 58 12722 ----
NM_020630chr102115 93 1600 ----
NM_020640chr312069 ------
NM_020644chr112750 237 1761 --1333
NM_020647chr842211 1790 1571 867 ------
NM_020673chr20157498 7409 7278 6534 5802 5696 5356 4763 2218 1721 1099 677 639 378 244 --47595 6547 6398 1901 12097
NM_020689chr2031255 559 249 --1510 --
NM_020693chr112507 383 ------
NM_020697chr82260 206 ------
NM_020699chr164407 4317 4157 1747 408 264 --25138 1870 13451
NM_020703chr14596 582 514 467 ------
NM_020715chr1452264 2154 1698 913 436 ------
NM_020717chrX104954 4022 3155 1391 1100 859 688 613 227 61 23993 300 ----
NM_020718chr16116110 5835 5464 5391 4852 1979 1355 1053 882 711 517 34603 4154 4048 24539 321 --
NM_020732chr62349 295 ------
NM_020734chr1293078 3052 2962 2838 2546 1298 1205 881 41 22678 178 ----
NM_020739chr1553263 2706 1284 866 614 54083 3164 1324 1153 589 ----
NM_020742chrX21909 611 22503 1029 --12620
NM_020747chr52846 379 ------
NM_020752chr1051994 1974 769 305 194 1982 12244 --
NM_020761chr1731970 1651 1367 ------
NM_020762chr123928 113 83 --1797 --
NM_020766chrX114230 4129 4003 3920 3533 3473 3376 3203 1565 1268 231 1397 ----
NM_020768chr592908 2152 2038 1079 993 915 717 478 308 ------
NM_020771chr611403 11431 11051 --
NM_020772chr17138145 6737 6596 6054 5924 5771 5609 2795 2705 2368 757 500 28 38072 7593 5309 38533 7892 995 188
NM_020773chr462669 2159 1720 1708 997 136 12634 22447 2038 --
NM_020774chr1885526 2050 1980 1239 1051 606 244 51 15666 12291 --
NM_020775chr12143 47 ------
NM_020779chr223237 1038 22337 640 32731 2083 936 --
NM_020783chr1852113 1621 790 731 101 1406 ----
NM_020791chr1711231 11253 ----
NM_020792chr342672 2666 2184 648 3947 457 319 22658 570 1376
NM_020794chr11540 ------
NM_020796chr532037 537 233 22269 215 22162 1123 --
NM_020805chr1851758 1704 1500 578 478 ------
NM_020806chr142724 613 ------
NM_020807chr1631718 373 268 ----11332
NM_020808chr1----1262 --
NM_020809chr1131632 540 288 --11414 --
NM_020810chr1443478 3131 1346 995 --33373 3307 735 --
NM_020813chr1932928 2823 2021 1112 12259 --
NM_020818chr141373 ------
NM_020819chr631025 172 110 ------
NM_020830chr262005 1291 987 784 648 340 --2491 388 --
NM_020839chr331063 318 290 31335 1223 1045 21014 40 --
NM_020841chr1263098 2891 2748 1019 537 142 1160 ----
NM_020850chr1682925 2764 2751 2490 977 910 256 128 12250 --11079
NM_020854chr1831534 1224 448 1622 ----
NM_020856chr1931459 1291 335 162 ----
NM_020859chr431290 740 636 13331 2356 182 --
NM_020860chr42389 75 ------
NM_020861chr621198 49 --2346 195 --
NM_020868chr231409 583 394 1434 11431 --
NM_020871chrX32456 1746 990 ------
NM_020872chr371575 1491 1162 659 579 234 110 --11620 --
NM_020873chr3299 84 ------
NM_020897chr131190 1021 467 21080 367 ----
NM_020899chr174912 720 582 191 --21017 608 --
NM_020909chr254200 4029 2648 1363 224 --11496 --
NM_020918chr1043451 1142 519 142 12240 22914 166 --
NM_020921chr1483038 2951 2890 2467 1372 1294 1069 575 --43675 2608 2428 1234 --
NM_020922chrX71689 1674 1538 1425 647 522 320 ----1493
NM_020925chr1--1563 ----
NM_020935chr274679 4517 4117 3897 3535 510 63 ------
NM_020940chr1092485 2368 2195 2026 1920 1179 816 566 318 ------
NM_020943chr2--1197 ----
NM_020947chr1662124 1942 1573 1523 1491 763 --1331 --
NM_020948chr173600 3539 3378 3341 327 249 22 ------
NM_020958chr143380 247 238 ------
NM_020975chr1031700 615 583 ------
NM_020987chr1011206 1222 ----
NM_020993chr1232489 979 622 1208 32723 2446 2319 --
NM_021007chr211951 11619 ----
NM_021013chr17177 ------
NM_021019chr121141 --153 --
NM_021020chr893328 2696 2682 2582 2526 2502 1066 289 152 11083 1746 --
NM_021033chr1322971 2572 11166 ----
NM_021038chr363359 3272 2497 2444 2323 2279 33215 3166 2930 --12949
NM_021069chr452034 1489 1429 1401 714 21610 582 ----
NM_021072chr54684 633 422 62 ------
NM_021076chr222527 420 1545 ----
NM_021079chr1753249 3067 3047 2933 1067 --32801 924 662 22589 2484
NM_021083chrX43311 2559 622 261 22538 2326 ----
NM_021090chr22124911 4862 4516 4008 3829 3480 3455 3422 1239 1218 232 194 2757 217 1992 --
NM_021097chr222136 1910 ------
NM_021101chr372455 2273 1991 1013 950 192 79 --21734 787 12341
NM_021116chr7149074 8925 8247 7696 7250 6840 3234 2744 2067 2060 2037 1956 1917 1487 17620 26179 6106 27849 347
NM_021117chr1141908 1463 1455 743 11688 11490 1285
NM_021132chr1021129 389 ------
NM_021133chr151232 1152 642 324 76 11161 ----
NM_021140chrX2874 124 --131 --
NM_021145chr71152 --1444 21062 453
NM_021156chr2031114 1104 314 ------
NM_021159chr441486 1323 1141 189 --1612 --
NM_021161chr14193 ------
NM_021167chr732783 2223 985 ------
NM_021174chr82719 661 --1305 --
NM_021176chr231891 1363 397 1529 1154 11339
NM_021183chrX3974 522 190 ----1175
NM_021190chr121135 477 11102 ----
NM_021191chr1272483 1961 1840 723 324 169 83 ------
NM_021194chr1129 ------
NM_021201chr1111499 11640 3655 518 66 --
NM_021202chr2052959 2862 2185 2096 1138 1382 --11245
NM_021213chr1751027 974 296 258 134 ----1497
NM_021215chr2052325 2190 730 233 75 --12288 --
NM_021222chr14938 520 339 185 11319 ----
NM_021229chr1261182 1084 865 804 431 325 ------
NM_021237chr31228 ------
NM_021238chr1221658 141 ------
NM_021239chr14160 ------
NM_021249chr1441496 1134 362 37 1338 ----
NM_021252chr1031741 1333 88 1233 ----
NM_021253chr641392 1366 951 909 11292 ----
NM_021255chr14123614 3570 3516 3018 3009 1408 1396 1024 518 329 76 26 24110 1228 ----
NM_021260chr1441426 988 196 133 ----11203
NM_021574chr2232080 979 82 22494 964 ----
NM_021614chr5132 ------
NM_021629chr345034 3929 3818 188 24113 1076 1794 --
NM_021633chr121309 276 ------
NM_021638chr4104110 3803 3733 3466 1566 1439 1153 596 504 210 44531 4517 3066 1536 23375 3363 --
NM_021643chr211329 1144 11782 --
NM_021644chr101866 1273 156 --
NM_021647chr484321 3971 3802 3615 1742 1393 558 293 --11501 --
NM_021648chr652529 1942 761 684 553 1138 1241 22268 197
NM_021722chr71469 ------
NM_021723chr71510 ------
NM_021784chr20181 ------
NM_021813chr685704 5253 3579 2307 1958 1841 1093 506 34775 1463 189 --14849
NM_021814chr631317 1052 663 1588 ----
NM_021818chr1441201 1083 997 337 1212 ----
NM_021905chr652064 1867 1834 1485 470 ------
NM_021911chr554598 4446 2127 1737 368 23945 1934 ----
NM_021912chr1541470 1394 1116 147 --13912 --
NM_021913chr1951793 1755 1224 79 71 21433 494 ----
NM_021914chr1452076 1823 619 223 28 ------
NM_021931chr201198 11151 --11002
NM_021935chr31116 ------
NM_021940chr631677 1389 1082 ------
NM_021952chr11128 ------
NM_021956chr6--11572 ----
NM_021960chr152778 2388 542 266 28 ----12041
NM_021961chr11127520 7425 7149 6975 6651 6443 4982 2748 2475 1476 576 141 17071 35401 2637 1426 --
NM_021962chr1752427 2004 1733 387 359 ------
NM_021964chr3106631 6482 6132 4960 4287 4047 2356 2269 1320 515 34028 662 206 25066 289 12300
NM_021967chr531200 980 910 --1895 --
NM_021970chr41511 134 ----
NM_021998chrX31314 135 112 ------
NM_022048chr15156190 6108 6021 6000 5699 5052 4922 4145 2083 1570 1302 1006 743 565 489 --11439 --
NM_022051chr11174 ------
NM_022058chr211627 31792 821 205 11497 1104
NM_022063chr1061791 1406 1104 423 347 166 ------
NM_022073chr1421475 25 11255 1656 1184
NM_022079chr101218 21032 360 1939 --
NM_022085chr641603 447 419 132 1534 21032 261 --
NM_022130chr531483 1199 90 --1181 2408 286
NM_022131chr351370 1332 1046 328 227 --1115 --
NM_022133chr821684 1439 --1562 --
NM_022138chr641271 521 286 226 --11505 11291
NM_022140chr531881 1808 1585 22181 718 1457 --
NM_022143chr7182 ------
NM_022166chr16106138 5473 5129 3962 2138 2101 1829 1110 1056 324 15611 1886 --
NM_022170chr731761 1671 511 21609 1106 ----
NM_022340chr353667 3071 1331 287 23 ------
NM_022351chr833273 1331 255 ------
NM_022373chr72857 89 ------
NM_022443chr31117 ------
NM_022454chr81352 1799 ----
NM_022455chr51113 ------
NM_022456chr1276456 6078 5037 2327 1953 419 104 --12491 --
NM_022458chr763159 3021 663 598 188 171 ------
NM_022459chr1345220 5042 4603 1658 26087 1399 35766 2367 2239 24188 475
NM_022465chr1242454 1122 226 199 --32647 1021 375 12878
NM_022474chr1482738 2628 2117 1127 713 648 505 283 ------
NM_022475chr42667 569 1524 ----
NM_022476chr162245 32 1803 ----
NM_022484chr711247 21226 253 ----
NM_022491chr1273560 2893 2353 2289 1382 448 268 23280 240 1535 --
NM_022496chr122428 84 ------
NM_022566chr152417 138 ------
NM_022576chr11332 ------
NM_022648chr283320 2936 2852 1839 1801 1734 1226 97 --23695 1846 --
NM_022650chr51264 1310 ----
NM_022652chr123815 733 340 1913 ----
NM_022658chr121168 ------
NM_022726chr631664 1140 257 ------
NM_022731chr11224 ------
NM_022735chr131891 1836 316 ------
NM_022739chr172436 270 ------
NM_022753chr142033 390 358 142 ------
NM_022758chr673084 2854 1178 1045 652 635 50 12600 ----
NM_022763chr31156 1290 32701 2418 2145 --
NM_022768chr1----196 --
NM_022776chr31354 --1192 --
NM_022780chr211701 21350 1151 ----
NM_022781chr962999 2433 737 708 315 222 1384 22654 122 --
NM_022802chr1011481 11658 11634 --
NM_022817chr222237 2129 ----172
NM_022818chr1621625 459 ----1295
NM_022826chr22961 195 ------
NM_022828chr541391 1384 1163 327 1143 --167
NM_022831chr121852 1661 21347 338 ----
NM_022834chr15951 778 703 635 108 ------
NM_022841chr1542519 1969 667 286 --1525 --
NM_022843chr1321014 44 11213 --153
NM_022844chr164877 812 790 150 1973 ----
NM_022845chr1621683 577 22256 1544 1876 --
NM_022875chr51513 ------
NM_022877chr51513 ------
NM_022893chr253007 2888 2349 1205 661 12686 ----
NM_022894chr211419 31310 285 118 ----
NM_022898chr1484515 3873 3162 1673 1214 964 720 501 --23387 1617 --
NM_022902chr51308 ------
NM_022913chr5----1238 --
NM_022965chr441578 1383 569 273 ------
NM_022970chr1041400 1005 305 181 --11051 11156
NM_022977chrX42571 2250 2099 1795 ------
NM_022978chr531200 980 910 --1895 --
NM_023000chr14--1396 ----
NM_023001chr14--1396 ----
NM_023011chr131173 1338 ----
NM_023016chr22573 156 22749 2617 ----
NM_023037chr1331145 721 325 ----184
NM_023067chr331040 877 233 --1384 1918
NM_023071chr1241018 345 202 60 --1279 --
NM_023079chr1741787 651 509 275 21723 250 ----
NM_023929chr822598 782 ------
NM_023943chr3185 ------
NM_024007chr573029 3022 2660 2033 1001 154 99 13158 ----
NM_024034chr202981 670 ----1747
NM_024045chr101183 ------
NM_024052chr1742863 2443 1991 1095 22416 2249 ----
NM_024076chr1932234 961 59 --1849 11819
NM_024077chr93605 213 58 ------
NM_024104chr193670 106 31 ----1808
NM_024165chr6--148 ----
NM_024294chr673084 2854 1178 1045 652 635 50 12600 ----
NM_024295chr81478 ------
NM_024296chr1153 ------
NM_024345chr995195 5043 4753 4745 3821 2343 512 146 90 15917 ----
NM_024408chr163529 2563 1369 1207 650 37 --1531 --
NM_024411chr202550 47 ------
NM_024416chr961493 1046 997 646 580 372 21576 350 ----
NM_024423chr1872823 2803 1504 1353 719 157 151 11227 14135 --
NM_024424chr1121203 884 --2952 110 --
NM_024425chr1121203 884 --2952 110 --
NM_024426chr1121203 884 --2952 110 --
NM_024429chr7----1213 --
NM_024501chr21700 ----1484
NM_024511chr472988 2851 2178 1305 895 669 379 23006 1177 --2926 766
NM_024513chr343655 2767 1204 151 22801 977 1992 --
NM_024520chr22188 30 ----184
NM_024524chr363200 3050 2534 1241 772 681 2274 219 ----
NM_024529chr171174 898 862 341 193 103 91 ------
NM_024546chr132182 67 ------
NM_024548chr3--31716 303 52 ----
NM_024554chr131247 1092 511 1700 ----
NM_024569chr172539 1933 1181 1029 550 459 340 12334 --12933
NM_024581chr62238 52 ------
NM_024582chr4--21027 311 ----
NM_024586chr13670 99 68 --1138 --
NM_024590chr451628 1576 792 479 439 ------
NM_024595chr13941 409 165 1281 ----
NM_024596chr895033 4960 3426 1777 1264 697 640 531 205 13405 1166 --
NM_024607chr874086 3806 3115 2810 900 819 450 54357 3718 3348 1334 801 13927 --
NM_024613chr841860 540 532 170 21852 1450 ----
NM_024624chr221579 1138 11405 ----
NM_024626chr151589 1580 1500 1463 1442 21282 205 ----
NM_024630chr61697 --186 --
NM_024631chr112644 492 --1596 --
NM_024632chr5----1186 --
NM_024639chr662586 2025 1108 861 719 83 1379 ----
NM_024641chr642637 2035 895 547 32629 2514 1173 ----
NM_024657chrX2668 36 1120 ----
NM_024659chr22920 54 ------
NM_024665chr384303 3204 3105 1699 1307 917 696 552 ----13096
NM_024686chr12358 224 ------
NM_024689chrX51825 1730 738 199 62 21137 132 ----
NM_024692chr231304 577 114 --1400 --
NM_024702chr172606 50 190 ----
NM_024713chr1531654 1054 254 11350 ----
NM_024719chr13--176 ----
NM_024721chr85937 742 545 481 66 ------
NM_024744chr232394 2299 169 ------
NM_024749chr151885 919 665 292 244 167 ----
NM_024753chr21626 156 ----
NM_024755chr152595 111 ------
NM_024757chr94984 936 284 185 ------
NM_024761chr984919 4547 4430 4355 1288 1030 483 176 14564 12021 --
NM_024763chr111023 ------
NM_024769chr11--1728 1818 --
NM_024770chr285641 5020 4287 4221 2509 1653 1124 915 16011 --15446
NM_024772chr12407 372 ------
NM_024779chr1251581 1558 1494 348 288 11161 11148 --
NM_024831chr83595 582 167 ------
NM_024834chr1041999 1653 616 172 --21816 1465 --
NM_024841chr1172416 947 647 544 404 287 240 --21601 802 --
NM_024857chr17------176
NM_024859chrX21097 804 ------
NM_024874chr111327 ----11227
NM_024896chr931674 817 274 ------
NM_024915chr852595 795 572 489 262 1505 1962 --
NM_024920chr42487 24 ------
NM_024930chr542675 2225 874 584 ----12234
NM_024944chr212407 335 ------
NM_024947chr399475 8114 7613 7419 7281 6878 2288 2079 1410 39318 3594 3458 --18991
NM_024948chr102810 29 ------
NM_024953chr1241062 543 127 55 ------
NM_024960chr20132 ----156
NM_024969chr21121 1847 ----
NM_024989chr2127896 7632 6742 6525 6310 5998 5775 5396 5048 3194 2992 546 28126 7100 24967 2053 --
NM_025004chr111634 ------
NM_025054chr812979 43183 2958 1613 1048 1236 --
NM_025074chr452720 2230 884 835 381 12735 ----
NM_025076chr22559 90 ------
NM_025077chr11199 ------
NM_025082chr16121 ------
NM_025106chr161751 1670 1656 1532 1442 700 ------
NM_025107chr632254 438 415 ------
NM_025134chr1662538 2011 1954 1809 768 150 1907 --11569
NM_025140chr122485 70 ------
NM_025146chr361907 1705 784 579 170 21 51790 1784 489 478 162 ----
NM_025147chr24960 806 308 37 11107 ----
NM_025151chr851695 1442 670 625 460 21560 46 ----
NM_025154chr731448 1059 381 ------
NM_025160chr143923 3686 920 502 ------
NM_025179chr154519 3409 1590 1358 1102 --34138 3730 1428 14558
NM_025180chr372939 2629 2461 2402 955 365 236 ------
NM_025184chrX2325 267 ------
NM_025191chr153083 3010 649 375 181 1472 1797 --
NM_025195chr851710 1558 655 644 164 11342 11819 --
NM_025208chr1152054 1771 1761 1573 888 32476 2378 42 ----
NM_025222chr342021 1931 926 577 21092 308 21050 127 --
NM_025235chr1051677 1450 699 547 279 22210 1502 ----
NM_025237chr1751318 1121 1055 1020 273 --1138 --
NM_025238chr151495 1255 11506 --
NM_030579chr1663668 3642 3579 2295 1376 280 --22521 1123 --
NM_030583chr81397 ------
NM_030594chr1541096 919 550 129 ------
NM_030621chr1493525 3516 3458 2973 1482 984 900 705 229 44210 2786 1093 680 ----
NM_030623chr251639 1365 1236 1123 498 1521 11077 --
NM_030625chr1042006 979 628 474 22231 93 ----
NM_030627chr523428 3334 ------
NM_030629chr1641855 1545 239 217 11933 ----
NM_030631chr141780 --1530 --
NM_030634chr152334 1789 701 526 470 21774 796 ----
NM_030647chr7145821 5551 5521 5397 5276 4833 4791 4542 4290 1988 1208 774 708 234 35645 4046 2399 24252 1016 --
NM_030648chr464816 4638 4390 4368 3658 483 --21484 136 11645
NM_030650chr253872 3703 3544 3222 293 23100 22 --11217
NM_030653chr122662 363 --2852 744 --
NM_030660chr145458 437 305 109 35 --1179 1959
NM_030661chr741367 649 281 49 ------
NM_030664chr1042392 861 492 145 --12481 --
NM_030670chr1241971 1892 264 198 ------
NM_030671chr1241971 1892 264 198 ------
NM_030674chr1252330 2125 1240 807 410 34587 2083 890 15336 11739
NM_030752chr61536 ------
NM_030758chr2241444 903 371 149 ------
NM_030762chr1221232 432 11703 ----
NM_030763chrX1897 3602 134 43 ----
NM_030767chr952102 1124 889 585 375 32718 2053 965 22729 495 --
NM_030780chr831128 376 177 21244 1074 ----
NM_030784chr61380 ------
NM_030785chr19122 ------
NM_030791chr1431415 1272 570 21702 1336 ----
NM_030795chr8123 ------
NM_030797chr23251 245 196 ------
NM_030799chr53350 276 52 11920 ----
NM_030806chr1179169 8868 8463 7939 7432 7218 6318 3420 2991 2506 2216 1971 1813 1479 986 954 214 36630 2335 1375 59441 8068 7962 7277 1996 26815 5811
NM_030810chr641603 447 419 132 1534 21032 261 --
NM_030816chr123433 732 23286 2340 ----
NM_030820chr6--1784 --1377
NM_030885chr352291 2167 1682 1553 47 179 31795 738 375 --
NM_030912chr103939 90 34 1612 ----
NM_030918chr1104987 4002 3977 3531 3445 1525 1307 1281 739 690 --14272 13746
NM_030920chr12790 467 --11849 --
NM_030939chr61785 ------
NM_030962chr1131568 1391 1058 11514 1479 --
NM_030964chr553356 2345 495 343 106 1465 12817 --
NM_030981chr112282 37 --1258 --
NM_031203chr191235 ------
NM_031217chr11--1132 1449 --
NM_031243chr75948 714 705 535 365 12005 ----
NM_031266chr54435 362 351 94 ------
NM_031267chr73545 168 46 2453 215 ----
NM_031271chr821246 1089 21603 583 ----
NM_031283chr23320 171 78 ------
NM_031291chr41553 ------
NM_031305chr451888 1721 1204 599 535 ------
NM_031314chr1431750 1520 1259 199 1623 --
NM_031371chr121149 1091 --1248 --
NM_031371chr121149 1091 --1248 --
NM_031372chr441399 1253 500 469 --1111 --
NM_031407chrX3357 205 147 ------
NM_031411chr522191 878 --1563 --
NM_031417chr1972498 2446 2064 620 589 547 485 1321 22092 230 12813
NM_031419chr361421 1235 1002 506 426 296 21198 263 ----
NM_031426chr972635 2248 2035 785 419 53 27 --12230 --
NM_031427chr1475902 5132 4745 4586 4487 2231 291 11969 22021 572 --
NM_031431chr1331670 611 545 21805 726 11228 --
NM_031435chr1253441 3308 854 506 405 22122 962 33294 2664 2424 --
NM_031442chrX12341 1547 ----
NM_031445chr212687 21204 1147 --23339 1120
NM_031453chr1052426 1902 1774 803 58 1516 ----
NM_031461chr851992 1683 1666 872 622 11822 ----
NM_031468chr7147957 7672 7164 5954 5060 3239 3051 2816 2647 2145 2129 1735 1346 1059 1309 32507 1168 1028 11177
NM_031469chr654081 3391 1409 398 275 13591 ----
NM_031479chr122896 161 ------
NM_031483chr2023448 3277 ------
NM_031492chr111170 ------
NM_031844chr153174 3066 2708 1548 276 145 --12954
NM_031845chr242678 2558 337 298 22594 666 13061 --
NM_031847chr242678 2558 337 298 22594 666 13061 --
NM_031849chr522191 878 --1563 --
NM_031857chr522191 878 --1563 --
NM_031860chr522191 878 --1563 --
NM_031866chr1041053 943 844 721 1777 ----
NM_031892chrX4949 846 646 179 ------
NM_031992chr731761 1671 511 21609 1106 ----
NM_032012chr9104673 4300 3938 3623 3566 3220 1902 1172 498 133 --13306 13325
NM_032015chr111631 ------
NM_032042chr532574 1036 843 32764 2148 1858 12507 --
NM_032047chr342305 2155 1930 611 21697 63 ----
NM_032051chr222526 182 ------
NM_032052chr2221418 261 --1958 --
NM_032102chr1172923 2717 1077 823 766 347 132 22903 414 ----
NM_032116chr13135822 5730 4892 4764 4311 4099 3930 3665 3651 3609 2194 824 397 21888 493 11948 --
NM_032121chrX32662 2193 220 --12316 --
NM_032144chr211282 21553 515 1446 --
NM_032153chr312682 32203 815 121 2685 238 --
NM_032182chr1051447 1213 545 527 171 1430 ----
NM_032192chr172530 167 ------
NM_032195chr211500 ------
NM_032199chr1083717 3579 3191 2755 2651 1509 477 268 13295 ----
NM_032207chr1961253 794 391 361 355 93 1859 ----
NM_032208chr263516 3170 1435 1082 416 384 12569 1937 33556 448 104
NM_032217chr43911 266 136 1493 ----
NM_032221chr2011915 21618 1242 ----
NM_032228chr1153270 2167 1113 1041 918 --13189 --
NM_032239chr431408 1178 36 --1497 --
NM_032256chr122736 250 ------
NM_032281chr1923138 2078 ------
NM_032291chr111343 1546 --1137
NM_032299chr11131 ------
NM_032312chr2------1884
NM_032316chr362495 2447 2013 1994 1798 30 --22050 1655 --
NM_032320chr11--1325 ----
NM_032321chr292979 2751 2718 2412 2139 1133 1074 731 617 ----12369
NM_032364chr1211003 ----1755
NM_032373chr1095583 3753 3592 2015 1523 1373 1036 901 776 ------
NM_032379chr11293 57 ------
NM_032408chr73860 387 95 1263 ----
NM_032410chr831279 1271 141 1838 ----
NM_032412chr51237 1123 ----
NM_032434chr221317 1062 11404 1116 --
NM_032435chr121656 68 1277 ----
NM_032438chr631331 595 399 1390 ----
NM_032440chr1062672 2202 727 540 534 214 1691 ----
NM_032446chr543894 2473 1037 569 23828 84 ----
NM_032457chr463658 2813 2554 1383 245 149 13652 ----
NM_032458chrX52575 2342 2284 826 810 12998 --13460
NM_032466chr831232 110 79 ------
NM_032468chr831232 110 79 ------
NM_032491chr122305 85 ----1909
NM_032499chr153562 532 62 ------
NM_032505chr392813 2469 2363 2113 1781 969 653 415 368 ------
NM_032509chr832396 701 388 21703 571 --11835
NM_032521chr2052651 2177 1978 936 214 12520 ----
NM_032523chr21493 ----1146
NM_032539chrX3735 547 119 ------
NM_032547chr441326 873 215 87 ------
NM_032550chr102338 43 1473 11163 --
NM_032552chr951872 1530 732 391 43 21310 287 ----
NM_032557chr41731 1317 ----
NM_032558chr92568 442 11205 ----
NM_032569chr1641770 503 427 127 11859 ----
NM_032574chr21108 ----1258
NM_032582chr1721870 683 1218 ----
NM_032590chr1241073 242 184 52 --11053 --
NM_032632chr1421880 1589 21331 760 11864 --
NM_032663chr12111808 1681 1615 1609 768 561 466 372 344 111 103 --11343 --
NM_032664chr871425 1396 579 546 303 235 38 ------
NM_032682chr383485 3132 2473 1197 1157 784 536 328 12730 ----
NM_032689chr1931491 1120 350 --11162 --
NM_032737chr1941759 635 209 27 11684 --12618
NM_032765chr53903 719 182 ------
NM_032772chr10--1202 ----
NM_032784chr6--1199 ----
NM_032788chr221217 1166 3584 418 334 --1501
NM_032793chr11277 ------
NM_032800chr161941 1772 745 297 259 82 --22228 968 --
NM_032802chr15270 57 1196 ----
NM_032804chr1052527 1943 817 728 301 1785 ----
NM_032812chr10--170 ----
NM_032826chr765000 3773 3373 2117 428 403 21565 130 ----
NM_032828chr1974930 4709 4682 4526 1860 1391 80 14504 --1431
NM_032833chr1--1313 1289 --
NM_032836chr1931014 771 308 --1649 --
NM_032837chr1772097 1649 1356 759 709 357 23 ----1377
NM_032842chr731307 444 184 11060 ----
NM_032859chr1353962 2491 1517 953 353 31532 236 211 ----
NM_032883chr202740 221 ------
NM_032900chr1062739 2723 2648 2602 1548 191 1828 13557 --
NM_032924chr73287 105 30 --11094 --
NM_032943chr11293 57 ------
NM_032949chr131229 ------
NM_032971chrY132 ------
NM_032972chrY132 ------
NM_032973chrY73797 3747 3595 3541 3285 2665 2635 1402 ----
NM_032975chr1883243 3225 3088 2553 2425 1376 1184 415 --1880 11079
NM_032980chr1883243 3225 3088 2553 2425 1376 1184 415 --1880 11079
NM_032998chr121085 778 ------
NM_033012chr134944 832 271 145 ------
NM_033014chr961493 1046 997 646 580 372 21576 350 ----
NM_033020chr124179 3032 34094 1354 1168 ----
NM_033058chr85809 788 352 340 79 1694 ----
NM_033071chr63537 92 86 ------
NM_033082chr12121 ------
NM_033083chr343206 2217 1168 737 1324 12337 12720
NM_033087chr931192 140 101 ------
NM_033089chr204489 339 136 101 ------
NM_033121chr1231187 499 250 11202 11755 --
NM_033127chr12609 45 ------
NM_033128chr71807 --1571 --
NM_033129chr2072066 1798 1329 1319 632 363 240 2581 262 ----
NM_033132chr1321953 659 12019 ----
NM_033133chr1743173 3068 1138 699 13341 13716 --
NM_033135chr1152054 1771 1761 1573 888 32476 2378 42 ----
NM_033138chr742025 1731 1699 251 ------
NM_033139chr742025 1731 1699 251 ------
NM_033140chr742025 1731 1699 251 ------
NM_033143chr483657 3063 1560 1118 1068 647 347 207 11216 ----
NM_033150chr122143 58 ------
NM_033157chr742025 1731 1699 251 ------
NM_033181chr673740 3580 2791 832 771 509 269 33522 2575 346 33341 3094 856 11315
NM_033211chr521634 1381 21513 374 ----
NM_033224chr788036 7198 6674 5734 5526 1929 1648 519 37528 7217 1160 --12993
NM_033225chr831171 1109 496 --12905 2312 116
NM_033238chr1552802 2747 2672 2218 472 1885 1627 --
NM_033255chr131425 ----128
NM_033261chr101143 1166 ----
NM_033281chr54931 782 752 349 197 ----
NM_033285chr864169 3046 2884 1318 1278 1107 23262 1549 23514 528 11711
NM_033290chrX63456 2990 2695 635 612 399 23551 332 --11172
NM_033296chr41731 1882 ----
NM_033331chr963314 2940 2374 2336 1068 458 1492 12921 1347
NM_033360chr1254051 3228 2807 1140 22 23396 1845 1535 --
NM_033364chr321347 585 --11567 --
NM_033389chr1744760 4634 4004 3231 2495 268 2959 25 --
NM_033393chr452790 2453 1843 1063 639 12671 1370 --
NM_033394chr221149 291 ------
NM_033402chr82140 90 ------
NM_033407chr11612 ------
NM_033425chr1163188 2374 1025 873 635 280 12651 1857 --
NM_033429chr1552993 769 461 311 184 ------
NM_033430chr454008 3883 3474 3282 784 1687 11507 --
NM_033437chr454008 3883 3474 3282 784 1687 11507 --
NM_033480chr662951 2402 1940 1030 612 560 11171 --12227
NM_033481chr662951 2402 1940 1030 612 560 11171 --12227
NM_033503chr1593636 3492 3324 2978 2758 1172 1109 426 209 --23349 172 --
NM_033505chr286274 5630 5353 4323 2217 1937 1843 605 22515 459 11594 --
NM_033512chr862673 1208 295 277 114 72 21132 708 12295 --
NM_033540chr31356 --1999 --
NM_033551chr542332 994 581 124 12514 1744 --
NM_033624chr12243 25 32198 1965 1805 ----
NM_033631chr162583 2416 1404 881 709 213 11302 ----
NM_033632chr411417 11539 2441 272 --
NM_033637chr1094055 3632 2720 2694 1509 1380 818 684 632 --33316 2780 2586 --
NM_033642chrX----1154 11057
NM_033644chr562441 2217 2153 2119 2099 204 1726 12177 --
NM_033645chr562441 2217 2153 2119 2099 204 1726 12177 --
NM_033656chr2174720 4603 4571 4371 4123 1926 1518 32397 568 321 ----
NM_044472chr1--2738 682 ----
NM_052832chr822670 1874 32889 1175 1007 12115 2958 705
NM_052834chr1852082 1728 800 677 583 22321 978 ----
NM_052845chr1243182 1190 1023 160 33239 1217 760 ----
NM_052851chr1352152 1959 1705 185 176 ------
NM_052867chr1331015 984 544 ----11198
NM_052879chr1253767 3296 1218 653 485 23202 2694 ----
NM_052885chr12103897 3653 1526 1086 912 900 849 753 253 168 24286 937 13699 --
NM_052896chr132555 2471 109 ------
NM_052897chr12----1597 --
NM_052900chr841683 1418 532 115 11175 ----
NM_052904chr641460 1428 363 210 11334 ----
NM_052905chr221314 1182 ------
NM_052907chr1274202 3852 3576 1189 1062 739 37 130 1370 --
NM_052910chr1331390 1379 634 ------
NM_052913chr6--1984 11084 --
NM_052918chr1073416 3171 2684 1216 844 663 304 ------
NM_052923chr62280 90 ------
NM_052927chr552123 1783 1378 733 602 32241 2143 2078 ----
NM_052937chr822149 898 ------
NM_052950chr1351964 1459 1373 462 389 ------
NM_052954chr2131630 725 40 21922 1532 ----
NM_052978chr1421929 1262 ------
NM_053016chr9137187 6265 6223 6158 5608 5136 2933 2340 1339 1188 503 432 227 47802 6534 2591 2308 26905 5034 --
NM_053023chr1153064 2685 2514 2092 39 1459 ----
NM_053025chr351686 1623 1432 1338 1157 11096 ----
NM_053026chr351686 1623 1432 1338 1157 11096 ----
NM_053027chr351686 1623 1432 1338 1157 11096 ----
NM_053028chr351686 1623 1432 1338 1157 11096 ----
NM_053031chr351686 1623 1432 1338 1157 11096 ----
NM_053032chr351686 1623 1432 1338 1157 11096 ----
NM_053035chr72207 94 --127 --
NM_053043chr795762 4923 4641 2105 2010 1884 1455 1272 24 1417 45589 5389 2267 531 12148
NM_053046chr192466 104 --1171 --
NM_053056chr1122922 1131 11022 ----
NM_053064chr1422216 76 --1369 --
NM_053067chr91254 ------
NM_053274chr1144 ------
NM_054016chr111688 31968 1716 328 --1459
NM_054016chr111688 31968 1716 328 --1459
NM_054016chr111688 31968 1716 328 --1459
NM_054027chr52832 125 ----11961
NM_054033chr22536 524 1443 ----
NM_054111chr62714 254 1117 ----
NM_057096chr7----191 --
NM_057158chr81243 --1569 --
NM_057159chr951458 1343 1064 615 302 --11415 --
NM_057175chr442255 945 739 31 1122 21695 1637 --
NM_057180chr122375 129 --2478 332 --
NM_057749chr811338 ------
NM_058172chr471719 1371 1204 1180 689 440 148 ------
NM_058240chr1431523 1051 207 --11426 --
NM_058241chr232337 779 642 32197 1614 736 ----
NM_058241chr232337 779 642 32197 1614 736 ----
NM_058243chr19125 --151 --
NM_078469chr101570 ------
NM_078470chr1062629 2492 2143 1019 387 90 --11934 --
NM_078485chr61294 2124 99 ----
NM_078626chr12306 65 1356 1229 --
NM_079421chr19172 ------
NM_080388chr13634 455 22 1490 1123 --
NM_080425chr201113 1241 ----
NM_080426chr201113 1241 ----
NM_080546chr93753 432 183 ----21991 1570
NM_080599chr103502 248 216 11223 11246 1867
NM_080645chr621826 643 ------
NM_080654chr1141125 978 847 81 --1181 --
NM_080664chr142198 162 197 ----
NM_080666chr1431728 502 288 ------
NM_080672chr20171 ------
NM_080676chr2021322 1016 33264 2435 2233 --22635 722
NM_080682chr11669 ----1555
NM_080717chr121980 --1200 --
NM_080725chr2051989 1675 625 220 158 2686 30 ----
NM_080732chr192466 104 --1171 --
NM_080737chrX31208 390 341 --11235 --
NM_080759chr1341844 1633 992 582 12433 12099 --
NM_080760chr1341844 1633 992 582 12433 12099 --
NM_080764chr2252736 2692 2431 527 129 ------
NM_080867chr1474874 4373 3649 3094 1819 1319 539 21124 772 14611 --
NM_080872chr853769 3536 3247 1432 646 21193 106 ----
NM_080881chr51167 ------
NM_080916chr22155 82 --145 --
NM_080928chr71308 ------
NM_100264chr102677 91 ------
NM_100486chr102677 91 ------
NM_130387chr331157 497 87 ------
NM_130391chr923016 3007 ------
NM_130392chr923016 3007 ------
NM_130393chr923016 3007 ------
NM_130435chr1082846 2472 2355 2306 2188 1103 403 92 32937 2042 296 12054 --
NM_130436chr2152710 973 955 836 830 2566 206 ----
NM_130438chr2153287 2215 361 291 52 21143 783 ----
NM_130439chr1031469 1448 635 --12121 12143
NM_130439chr1031469 1448 635 --12121 12143
NM_130442chr731138 879 741 1157 ----
NM_130469chr141696 ------
NM_130781chr51422 ------
NM_130798chr1531306 190 66 1429 ----
NM_130808chr31417 ------
NM_130811chr2011071 ------
NM_130838chr15--21225 450 11775 --
NM_130839chr15--21225 450 11775 --
NM_130846chr1211072 2984 896 ----
NM_130850chr141192 ------
NM_130851chr141192 ------
NM_133170chr20177047 6803 6415 5802 2885 2247 1776 1612 1525 1449 1345 1000 907 631 529 277 162 17716 26615 2821 --
NM_133264chr1772862 2519 1270 1163 1082 920 287 13827 21301 42 --
NM_133265chrX92688 2653 2446 2300 2233 1207 982 801 126 --12788 --
NM_133329chr22557 44 11561 ----
NM_133334chr4106335 4871 4855 4537 4469 4217 2394 2386 2106 367 12261 ----
NM_133370chr473150 1296 1282 1129 1093 656 341 13632 ----
NM_133372chr542595 1797 734 188 12408 ----
NM_133433chr51265 ------
NM_133445chr943265 1217 868 288 23781 2868 138 --
NM_133477chr452779 2247 953 828 597 ------
NM_133493chr654338 3710 1267 1220 184 --11833 --
NM_133496chr184356 3894 3432 2849 1310 794 204 26 11130 13744 --
NM_133499chrX2806 756 ----1945
NM_133510chr141293 ------
NM_133625chr371092 1083 1044 539 471 290 98 ------
NM_133634chr2151869 1564 694 681 134 --11497 --
NM_133642chr2251194 984 814 452 157 41217 1168 1162 998 --174
NM_133646chr295091 4908 4604 4356 3552 1970 1394 337 276 1900 --11800
NM_133650chr63537 92 86 ------
NM_138270chrX63043 990 776 205 122 47 13417 ----
NM_138286chr1923656 1172 2356 28 1932 --
NM_138290chr7--1255 176 --
NM_138316chr1041317 1303 1237 155 21347 1189 ----
NM_138317chr14193 ------
NM_138318chr14193 ------
NM_138326chr2--128 ----
NM_138333chr932475 1893 1810 11789 121 12187
NM_138348chr5136492 6431 6275 5641 5606 5363 2522 2434 2104 1207 580 453 259 14060 1424 26223 224
NM_138357chr1041841 1329 637 318 1112 ----
NM_138375chr184857 487 151 105 --1337 --
NM_138376chr14----1118 --
NM_138391chr13961 624 306 ------
NM_138394chr2--137 ----
NM_138423chr152202 73 ------
NM_138426chr762084 1962 1909 1886 143 80 11941 ----
NM_138444chr1364430 3274 3048 421 152 82 11453 1970 --
NM_138457chr653373 2862 2622 465 440 13160 21171 1002 --
NM_138458chr22344 329 1733 ----
NM_138459chr612673 2567 543 ----
NM_138468chr296370 5775 5561 5319 5275 1891 1015 732 30 26320 4100 ----
NM_138471chr111548 ------
NM_138473chr12115133 5112 5088 5063 4070 3638 3499 1142 906 808 733 24508 3468 11638 13439
NM_138479chr142076 1383 374 303 11692 21393 482 --
NM_138555chr151569 ----1490
NM_138558chr131013 289 87 11051 1261 --
NM_138576chr1484515 3873 3162 1673 1214 964 720 501 --23387 1617 --
NM_138621chr233164 3025 164 44207 1669 677 322 1557 --
NM_138638chr1452076 1823 619 223 28 ------
NM_138689chr111205 ------
NM_138713chr1678050 7179 5980 5711 5134 3222 53 1198 11700 --
NM_138714chr1678050 7179 5980 5711 5134 3222 53 1198 11700 --
NM_138731chr1453572 3358 3212 2576 216 32836 1076 345 ----
NM_138732chr1111012 ------
NM_138734chr1111012 ------
NM_138735chr261547 1424 1374 626 136 78 21074 482 ----
NM_138771chr7--11460 ----
NM_138775chr11180 ------
NM_138782chr522048 848 ------
NM_138806chr32911 743 ------
NM_138819chrX2418 81 1120 2150 27 --
NM_138931chr31319 ------
NM_138959chr1126308 5875 5670 5022 4802 4757 2306 2259 1642 1457 1436 213 65722 2327 2056 1697 865 505 16420 --
NM_138967chr1572253 1722 1540 929 781 626 181 21585 463 ----
NM_138970chr1411923 --1345 --
NM_138971chr1183538 3398 3338 2686 1219 1189 1031 296 11335 ----
NM_138971chr1183538 3398 3338 2686 1219 1189 1031 296 11335 ----
NM_138972chr1183538 3398 3338 2686 1219 1189 1031 296 11335 ----
NM_138972chr1183538 3398 3338 2686 1219 1189 1031 296 11335 ----
NM_138973chr1183538 3398 3338 2686 1219 1189 1031 296 11335 ----
NM_138973chr1183538 3398 3338 2686 1219 1189 1031 296 11335 ----
NM_139012chr65829 573 461 220 51 21916 730 ----
NM_139014chr65909 653 541 300 131 21996 810 ----
NM_139035chrX1557 1202 ----
NM_139046chr10173 ------
NM_139071chr1241638 1123 1115 441 ------
NM_139076chr42218 207 ------
NM_139126chr61766 ------
NM_139131chr11----1629 --
NM_139135chr121354 282 1828 ----
NM_139136chr12----11031 --
NM_139167chr82473 151 ------
NM_139168chr531451 217 140 ------
NM_139169chr1051923 664 561 278 182 ------
NM_139199chr52262 23 ------
NM_139207chr1231409 721 316 ------
NM_139242chr153462 315 80 11267 --1399
NM_139244chr61952 2990 329 ----
NM_139245chr341850 1737 733 674 ----142
NM_139265chr1531197 1183 80 1749 ----
NM_139280chr1721255 229 11412 1211 --
NM_139283chr1222255 154 11763 1979 1237
NM_139316chr721090 310 31101 993 51 ----
NM_139319chr1211310 21439 472 11791 --
NM_139321chr2063680 3586 3335 802 525 196 --12935 --
NM_139323chr2021631 818 1767 1110 --
NM_144498chr2031780 480 434 1567 12318 --
NM_144563chr21317 ------
NM_144563chr21317 ------
NM_144567chr162746 2672 2328 2018 710 297 ------
NM_144571chr4116072 4802 2144 2106 1626 950 846 467 429 336 139 25028 4639 1242 --
NM_144574chr14139 ------
NM_144578chr1485242 5206 4029 3427 3399 1649 1430 391 14507 ----
NM_144582chr282416 2316 2208 2158 1016 825 535 515 ------
NM_144590chr1041908 769 450 69 32383 881 58 --12757
NM_144595chr13----1897 --
NM_144600chr162618 579 11688 ----
NM_144609chr1711282 21391 240 ----
NM_144628chr2082809 2793 2684 2444 2376 1102 938 864 23044 2218 12649 --
NM_144632chr21973 21517 909 ----
NM_144633chr331203 315 245 11393 ----
NM_144642chr3143 1254 ----
NM_144643chr41479 ------
NM_144658chrX----137 --
NM_144664chr1132210 1882 722 ----11774
NM_144665chr11----142 --
NM_144721chr442644 1940 504 150 21859 367 12110 --
NM_144726chr531182 993 985 1408 ----
NM_144728chr12804 792 1659 ----
NM_144729chr12804 792 1659 ----
NM_144732chr193810 273 250 --1217 --
NM_144767chr1594234 4209 3867 3745 3225 3062 1535 1180 879 13056 13270 11433
NM_144775chr17124136 3882 3839 3510 3503 3485 3113 1752 999 683 596 261 24561 652 1925 --
NM_144778chr1321030 794 ------
NM_144949chr22479 408 12344 ----
NM_144963chr862172 1094 1081 951 706 31 1789 1659 --
NM_144967chrX2335 272 --2406 300 --
NM_144977chr12442 249 ------
NM_144982chr121823 ------
NM_145021chr105774 675 661 167 76 ------
NM_145049chr52755 357 ------
NM_145055chr1873421 1310 1191 1016 564 298 275 ------
NM_145056chr192266 82 ------
NM_145102chr741477 1041 465 28 21490 217 ----
NM_145112chr141426 ------
NM_145117chr11112852 2832 2775 2599 2585 2339 1256 1152 1146 878 220 12070 ----
NM_145178chr103440 361 232 1142 ----
NM_145203chr131339 ------
NM_145206chr1042415 701 582 254 ------
NM_145239chr162131 28 1423 ----
NM_145251chr1411418 ------
NM_145259chr276558 6064 5701 4892 1269 777 470 56981 5829 2492 1794 1259 --16403
NM_145268chr7189 ------
NM_145303chr61382 ------
NM_145306chr102421 51 --1513 --
NM_145307chr1084651 4556 3792 3676 3073 1877 1292 756 34436 3486 658 1540 --
NM_145313chr1021373 158 ------
NM_145320chr7133508 3417 3106 3004 2982 2507 2378 1227 1147 1034 927 612 51 --13135 --
NM_145321chr7133508 3417 3106 3004 2982 2507 2378 1227 1147 1034 927 612 51 --13135 --
NM_145322chr7133508 3417 3106 3004 2982 2507 2378 1227 1147 1034 927 612 51 --13135 --
NM_145331chr6144 ------
NM_145332chr61192 1660 ----
NM_145333chr61192 1660 ----
NM_145341chr101254 11882 ----
NM_145349chr1742255 1626 1401 215 ------
NM_145351chr1762747 2118 1893 707 434 34 ------
NM_145649chr682409 2052 1800 1786 806 298 80 73 21025 960 ----
NM_145655chr682409 2052 1800 1786 806 298 80 73 21025 960 ----
NM_145686chr263194 3043 2200 1323 1075 304 12158 ----
NM_145687chr263194 3043 2200 1323 1075 304 12158 ----
NM_145714chr161373 ------
NM_145733chr2211216 ------
NM_145735chr1362640 2513 2413 1998 557 404 1717 12241 --
NM_145739chr21493 ----1146
NM_145756chr181429 21371 367 ----
NM_145800chrX21015 674 ------
NM_145802chrX2964 623 ------
NM_145808chr772721 2648 2156 1927 918 550 459 32001 1995 785 22176 309 --
NM_145891chr1631410 1342 23 ------
NM_145892chr1631410 1342 23 ------
NM_145893chr1631532 1464 145 ------
NM_147150chr973636 3347 3133 2952 2930 1008 219 ------
NM_147188chr153958 512 283 --1406 --
NM_147223chr221644 393 22228 2093 11557 --
NM_147233chr221461 210 22045 1910 ----
NM_148174chr841867 1820 1776 1681 ------
NM_148414chr162456 337 ------
NM_148415chr162396 277 ------
NM_148416chr161373 ------
NM_148898chr751042 962 920 890 748 ----149
NM_148899chr751042 962 920 890 748 ----149
NM_148904chr13670 99 68 --1138 --
NM_148905chr13670 99 68 --1138 --
NM_148906chr13670 99 68 --1138 --
NM_148907chr13670 99 68 --1138 --
NM_148908chr13670 99 68 --1138 --
NM_148909chr13670 99 68 --1138 --
NM_148918chr172701 140 ------
NM_148921chr1792227 2162 1916 1792 600 443 352 254 173 ------
NM_148957chr1352677 2054 1683 966 89 --1890 --
NM_148977chr1041317 1303 1237 155 21347 1189 ----
NM_148978chr1041317 1303 1237 155 21347 1189 ----
NM_152221chr2241224 1018 953 829 1234 ----
NM_152230chr10--172 ----
NM_152233chr1441496 1134 362 37 1338 ----
NM_152261chr1231716 406 103 1971 --1327
NM_152271chr811108 1163 ----
NM_152275chr272129 2119 2070 1784 1500 887 522 ------
NM_152278chrX2405 71 ------
NM_152280chr173203 3070 3012 2984 2317 2257 1312 ------
NM_152282chr321236 1083 ------
NM_152300chr1761449 1295 1255 648 460 329 ------
NM_152305chr321648 263 2797 678 ----
NM_152344chr1721238 375 21508 1308 1321 --
NM_152355chr193210 140 121 2229 50 ----
NM_152363chr191205 1932 ----
NM_152387chr22373 77 31067 1001 984 --1166
NM_152388chr233282 3035 1330 1400 24011 3919 --
NM_152390chr21159 ------
NM_152400chr421584 1566 ------
NM_152414chr82309 162 ------
NM_152418chr83749 655 600 --1526 --
NM_152424chrX54375 1770 1342 753 728 22942 469 14293 14259
NM_152437chr1272135 1670 1592 875 663 326 181 22435 579 ----
NM_152446chr142990 331 1929 ----
NM_152450chr155837 525 513 456 269 ------
NM_152451chr151317 ------
NM_152470chr1874146 3573 3254 2658 1197 567 82 12748 12793 --
NM_152519chr231892 1492 756 ---