TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-493-5p
miRNA Sequence: UUGUACAUGGUAGGCUUUCAUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX53232 3210 3000 2344 524 1472 23142 2722 --
NM_000091chr262850 2725 2130 1915 1145 482 11157 32481 1841 869 1805
NM_000138chr152594 324 1121 2707 467 21045 827
NM_000176chr573574 2777 1380 785 597 474 415 31022 821 59 12590 --
NM_000189chr241759 1462 873 865 1308 1897 22344 908
NM_000216chrX114087 3940 3850 3635 3471 3116 3039 2891 1271 1144 270 --31303 1291 1231 --
NM_000242chr1082516 2276 2172 2103 2031 1841 1029 729 1812 ----
NM_000248chr393029 3007 2046 1050 928 556 470 229 177 1218 ----
NM_000259chr1585811 4778 4736 4591 2545 2168 892 879 --22101 2088 11776
NM_000264chr973237 3187 2650 2440 1027 644 296 33149 385 372 1191 12907
NM_000318chr872431 2382 2315 352 196 103 85 12367 22670 2100 --
NM_000332chr667158 6463 5280 2253 870 647 --15066 12780
NM_000408chr253177 3168 3013 2826 2282 33448 2754 2261 ----
NM_000430chr1743266 1391 1072 182 --23681 904 1898
NM_000452chr1342060 822 222 134 --2227 206 --
NM_000459chr97879 827 746 193 120 114 106 ------
NM_000461chr384549 4206 4047 3993 3241 3038 1418 1400 13967 31282 649 547 --
NM_000462chr1561614 1415 1358 1230 1170 459 1593 1291 --
NM_000489chrX73100 2681 2341 2321 1247 1011 733 3651 588 92 12706 11309
NM_000503chr861902 1846 1401 1309 1210 467 11819 2718 697 --
NM_000527chr1962445 2400 2174 2136 848 840 12364 --12333
NM_000555chrX147855 6914 6728 6632 6580 6316 6051 5912 5881 5685 2324 1699 1547 262 15614 22818 1783 --
NM_000575chr23105 51 30 --2852 59 --
NM_000596chr71403 --4505 428 97 91 --
NM_000610chr1172958 2783 2339 754 468 314 85 12898 13002 --
NM_000618chr1296562 6285 6271 5608 4555 4078 2121 1939 325 ----1785
NM_000618chr1296562 6285 6271 5608 4555 4078 2121 1939 325 ----1785
NM_000633chr1865101 1759 1568 1224 799 79 14986 34305 3752 2029 14382
NM_000719chr12136649 6508 5872 5834 5357 4792 2546 2187 1691 1244 1226 1207 1122 24270 392 1869 --
NM_000724chr1061716 767 556 550 537 331 21807 49 11605 11293
NM_000793chr1465027 4296 3613 3550 3223 986 11835 44836 4378 1209 998 --
NM_000806chr531857 1351 376 --41960 1438 767 518 --
NM_000807chr4----5565 114 105 65 31 --
NM_000809chr479280 7430 7292 6616 2912 1912 1040 58597 8524 6732 1945 1740 48204 8068 2939 1920 --
NM_000810chr15------2482 135
NM_000813chr594519 4024 3434 1831 1799 1528 1388 1341 55 14833 23912 3424 --
NM_000814chr1583322 853 803 194 187 176 132 82 11560 11034 --
NM_000824chr43753 660 365 122 2207 199 --
NM_000831chr1104638 4603 4579 4554 2379 2366 2243 2223 2066 1940 14516 22251 1837 --
NM_000838chr632692 2431 347 12783 12644 21072 66
NM_000859chr531697 1542 1071 21682 1357 --11346
NM_000899chr1254315 4301 4218 515 327 1835 22981 1410 --
NM_000901chr431727 1691 709 ----1724
NM_000926chr11108731 8272 7438 7264 6681 6008 3303 1842 1726 1183 --17760 --
NM_000950chrX63529 897 747 456 278 266 --13301 --
NM_000959chr172940 2909 2719 2684 1556 1295 178 23946 1305 12963 --
NM_001001331chr372169 2120 1767 654 508 340 334 ------
NM_001001389chr1172958 2783 2339 754 468 314 85 12898 13002 --
NM_001001390chr1172958 2783 2339 754 468 314 85 12898 13002 --
NM_001001391chr1172958 2783 2339 754 468 314 85 12898 13002 --
NM_001001392chr1173004 2829 2385 800 514 360 131 12944 13048 --
NM_001001395chr1251841 1007 412 300 292 1944 2217 69 --
NM_001001396chr144480 4319 4026 1611 34133 3341 3294 23993 2823 24305 730
NM_001001481chr851391 853 714 305 149 1312 12591 --
NM_001001484chr1052397 2226 2069 2053 904 22248 673 22162 838 --
NM_001001664chr264080 3866 2964 2528 775 713 24008 1595 ----
NM_001001890chr2163516 3123 1525 892 824 772 11652 --23815 3768
NM_001001928chr22108241 7918 7454 7029 5980 5764 5476 2534 2055 458 --28311 8099 --
NM_001001995chrX31908 1366 143 --21357 1295 21751 107
NM_001002257chr273133 3059 2644 2181 1431 930 205 ----13485
NM_001002860chr1484720 4621 4503 3455 1715 442 305 136 --21720 419 --
NM_001003652chr18118620 8606 7894 7718 7434 5517 5325 2639 1696 318 307 1911 ----
NM_001003674chr1866678 6620 5895 5123 4995 321 --15071 16714
NM_001003675chr1866678 6620 5895 5123 4995 321 --15071 16714
NM_001003679chr152258 2113 1935 1544 37 ----11690
NM_001003681chr2231951 588 56 22103 1962 --1150
NM_001003712chr1263536 2698 2523 1029 688 298 1713 53931 3265 2498 1625 278 23398 3138
NM_001004106chr53885 825 254 1262 1269 --
NM_001004317chr674435 3383 2857 1671 1553 332 264 --1227 13774
NM_001004419chr1274556 3660 3365 3084 1646 832 429 23509 3328 13186 --
NM_001005473chr586566 4478 2400 2006 1987 1939 1554 734 --22362 1969 --
NM_001005474chr361365 1267 553 519 67 60 ----1591
NM_001007023chr1465027 4296 3613 3550 3223 986 11835 44836 4378 1209 998 --
NM_001007088chrX41283 1270 1263 1084 --1817 1834
NM_001007245chr72636 58 ----2206 143
NM_001007466chr665058 4903 4034 3993 1645 1356 54524 3537 3429 2054 1448 13556 --
NM_001008239chr1833307 1262 1051 2935 373 1487 13657
NM_001008707chr1451858 1786 1381 1353 344 1199 ----
NM_001008738chr582889 2632 2133 1109 575 567 265 146 12950 22906 2867 --
NM_001008925chr453471 3089 3065 2555 1088 --11365 13071
NM_001009899chr3116503 5808 5751 4869 4532 1208 1064 660 304 212 48 1111 277 65 16329
NM_001009960chr772824 2803 2205 784 432 250 82 --22724 2712 --
NM_001010891chr576649 4252 2644 901 796 542 257 15680 56120 5010 1846 1695 342 26843 2412
NM_001011513chr454036 3964 3729 1305 825 --34121 3455 3043 23988 3342
NM_001011666chr796555 5098 4848 4240 3996 3983 1056 845 283 16564 ----
NM_001012751chr1061618 1403 475 229 175 95 11310 11645 --
NM_001012755chrX44946 4828 3645 1731 34987 4844 1974 --14936
NM_001012761chr562681 2328 1953 1709 438 148 12044 3319 108 97 --
NM_001013031chr10113482 3227 2939 2862 2398 1172 1053 981 319 197 155 --13393 13260
NM_001013620chr12148345 7136 6069 5895 5882 5870 5510 5133 3271 2408 1765 1415 1292 671 --11438 1300
NM_001014380chr13105868 5411 5005 4967 4404 3940 3737 2171 1980 388 13894 15612 --
NM_001014797chr10148254 8212 8201 7212 7094 6486 5575 5440 5230 3180 1933 1452 612 305 15907 37560 605 361 --
NM_001014812chr151443 1187 --2366 301
NM_001015880chr102614 257 2520 430 --21695 583
NM_001017371chr221353 1104 --11255 31201 546 96
NM_001017415chr14788 671 583 25 --2761 507 --
NM_001017416chr14788 671 583 25 --2761 507 --
NM_001017969chr92490 150 --1575 1532
NM_001018065chr9125947 5312 4855 4432 4230 2355 2289 2242 919 901 739 697 13848 15018 --
NM_001018066chr9125947 5312 4855 4432 4230 2355 2289 2242 919 901 739 697 13848 15018 --
NM_001018067chr1115114 4902 4139 4108 3859 3264 1866 1456 526 335 217 24522 4444 14798 --
NM_001018068chr1115114 4902 4139 4108 3859 3264 1866 1456 526 335 217 24522 4444 14798 --
NM_001018069chr1115114 4902 4139 4108 3859 3264 1866 1456 526 335 217 24522 4444 14798 --
NM_001018074chr573574 2777 1380 785 597 474 415 31022 821 59 12590 --
NM_001018075chr573574 2777 1380 785 597 474 415 31022 821 59 12590 --
NM_001018076chr573574 2777 1380 785 597 474 415 31022 821 59 12590 --
NM_001018077chr573574 2777 1380 785 597 474 415 31022 821 59 12590 --
NM_001020658chr191543 1522 1421 1105 1067 1056 260 247 201 11591 1277 --
NM_001020658chr191543 1522 1421 1105 1067 1056 260 247 201 11591 1277 --
NM_001024094chr573574 2777 1380 785 597 474 415 31022 821 59 12590 --
NM_001024647chr12167691 7673 7360 7332 7204 6264 6138 2419 1686 1591 1256 1187 630 336 288 214 11334 --17349
NM_001025076chr1055777 3889 3769 1697 1382 21316 1180 24504 752 14138
NM_001025077chr1057135 5247 5127 5067 2740 22674 2538 25862 2110 35496 687 384
NM_001025079chr344064 3854 3189 896 1760 11280 13719
NM_001025108chr253890 3658 3556 3520 541 13698 44090 3419 3175 1101 23728 3623
NM_001025356chr1292983 2941 2849 2785 2206 2131 2085 1031 132 --12155 --
NM_001030007chr1683990 3232 2899 1477 1470 622 601 591 ------
NM_001030055chr1444586 3314 741 410 23876 682 33371 1896 1570 13151
NM_001031623chr62228 106 1363 1186 1177
NM_001031695chr2285226 4838 4398 3928 1332 857 231 182 15358 12099 --
NM_001031732chr463701 2600 2505 1359 1098 672 22480 754 ----
NM_001031812chr562045 2000 1769 824 784 666 31739 888 753 11503 --
NM_001032999chr20135339 5306 5289 4963 4929 4344 4216 1817 1017 1011 730 349 168 15313 ----
NM_001033117chr384249 3088 1783 478 414 368 356 135 13148 2394 384 --
NM_001033578chr832347 2038 139 --11590 2155 90
NM_001033925chr1062151 1779 1576 1532 1398 1355 ----1226
NM_001034954chr1093250 2766 2754 2744 2702 2460 2371 957 613 --12730 --
NM_001034955chr1093250 2766 2754 2744 2702 2460 2371 957 613 --12730 --
NM_001034956chr1093250 2766 2754 2744 2702 2460 2371 957 613 --12730 --
NM_001034957chr1093250 2766 2754 2744 2702 2460 2371 957 613 --12730 --
NM_001037174chr262190 2183 2040 1928 1425 472 2809 34 ----
NM_001037954chr1153486 2261 1238 1008 705 --11278 11122
NM_001039585chr163197 3166 2976 2941 1552 435 24203 1562 13220 --
NM_001039590chrX63250 2494 1571 243 191 37 12714 --12751
NM_001039591chrX63250 2494 1571 243 191 37 12714 --12751
NM_001039618chr11115093 5049 3867 3795 2006 1994 1980 1035 588 529 466 34000 1241 664 14202 --
NM_001039649chr13------2236 105
NM_001039709chr20135339 5306 5289 4963 4929 4344 4216 1817 1017 1011 730 349 168 15313 ----
NM_001039840chrX35383 1380 234 15500 11819 25130 2072
NM_001040100chr331255 1074 826 ----1446
NM_001040142chr231592 810 706 1536 6826 798 790 782 776 122 --
NM_001040143chr231592 810 706 1536 6826 798 790 782 776 122 --
NM_001040214chr652341 2205 1971 1875 1852 1722 12011 11781
NM_001040284chr1685581 4409 2185 1963 817 810 503 451 135 --11420
NM_001040402chr452253 1160 329 278 257 43118 2936 641 287 12946 --
NM_001040429chr1322405 2361 1558 11260 21367 979
NM_001040712chr952908 1386 1275 577 378 22717 726 42835 2692 2319 931 12850
NM_001042355chr1643970 3607 1214 480 --45386 1846 1242 1155 --
NM_001042412chr1643970 3607 1214 480 --45386 1846 1242 1155 --
NM_001042481chr1452521 1900 888 479 24 --22351 207 --
NM_001042537chrX82313 2280 2043 1744 918 906 737 152 ------
NM_001042543chr441597 1281 507 82 1629 --11488
NM_001042555chr12104386 4112 3913 3320 3137 3072 1922 1185 924 211 43835 3751 3259 3239 31823 369 133 --
NM_001042599chr2127331 7005 6470 6375 5871 5436 4797 4756 2787 1627 432 149 27742 6218 --13009
NM_001042604chr374744 4655 3428 849 307 185 89 44806 3502 1758 1618 1200 13954
NM_001044385chr273722 3301 3157 951 649 545 63 --179 24048 2836
NM_001044722chr562045 2000 1769 824 784 666 31739 888 753 11503 --
NM_001044723chr562045 2000 1769 824 784 666 31739 888 753 11503 --
NM_001071775chr1331764 1700 262 11388 2520 321 179
NM_001099678chr3115831 5112 4610 2002 1890 1631 1556 1482 1049 718 412 34725 4700 1540 54434 2316 2275 1257 861 --
NM_001106chr369785 9183 9005 8888 7833 6379 18582 ----
NM_001113490chrX113563 3282 3173 2921 2712 2525 450 434 302 225 143 23119 379 33253 2820 1229 --
NM_001121chr1041680 1517 752 681 --11757 11874
NM_001128chr1683990 3232 2899 1477 1470 622 601 591 ------
NM_001148chr432169 1438 77 22224 1705 1554 22253 548
NM_001167chrX62298 1310 877 703 615 372 36714 6129 4775 45485 1414 678 128 --
NM_001173chr1444586 3314 741 410 23876 682 33371 1896 1570 13151
NM_001186chr2153240 2560 2381 1994 1041 ----12031
NM_001198chr672071 723 670 649 454 220 78 1503 21543 1506 12406
NM_001201chr483654 3530 3198 2761 2510 2429 1406 563 23340 2602 13699 13913
NM_001204chr2106875 6353 5969 5895 5636 2794 2521 1858 1834 324 27527 7498 --1513
NM_001233chr73781 621 561 ----12335
NM_001310chr1272569 1904 1175 868 836 570 75 ----12151
NM_001332chr541014 620 545 457 11092 31125 511 39 --
NM_001364chr1184677 4220 4212 4075 3560 1720 1647 806 --54653 4103 4094 1372 732 1136
NM_001412chrX93457 3309 3101 3032 2702 1444 781 393 378 --13449 --
NM_001432chr493820 3620 3540 2950 2852 1469 1075 768 123 13521 22410 185 1179
NM_001438chr163567 3550 3508 3492 2690 2255 ----13347
NM_001498chr65873 311 256 215 179 2325 77 1186 --
NM_001543chr534634 4061 1036 --23279 788 14840
NM_001550chr72636 58 ----2206 143
NM_001621chr763052 2677 2646 1955 1917 801 11071 32793 2306 586 --
NM_001621chr763052 2677 2646 1955 1917 801 11071 32793 2306 586 --
NM_001650chr1833834 3194 2844 12776 1101 13731
NM_001656chr531981 1740 1504 1632 --11746
NM_001683chr372169 2120 1767 654 508 340 334 ------
NM_001684chr144197 4036 3743 1328 33850 3058 3011 23710 2540 24022 447
NM_001690chr372454 2337 2241 352 306 103 57 12587 ----
NM_001742chr731781 728 599 --11825 11788
NM_001754chr2163516 3123 1525 892 824 772 11652 --23815 3768
NM_001777chr344064 3854 3189 896 1760 11280 13719
NM_001827chr9152 --144 189
NM_001830chrX43810 3428 1435 1293 23312 294 --23637 1134
NM_001858chr683865 3651 1913 1883 1695 1651 1549 1267 33893 1790 675 ----
NM_001918chr1108290 7824 3570 3183 2215 2201 1943 1301 1228 805 --28494 3401 --
NM_001949chr642911 2834 2640 2347 22708 2541 12630 22579 277
NM_001969chr1493779 3134 3002 2781 2597 2408 765 710 77 --33530 678 547 183
NM_001981chr131954 1907 1892 --22011 1988 --
NM_002009chr1552593 2273 2109 697 151 32741 831 258 ----
NM_002015chr13143217 3013 2765 2711 2663 2531 2158 1113 953 662 335 218 208 186 23255 712 23270 1059 12554
NM_002025chrX99067 8993 8096 7977 7937 6079 2627 2397 187 59174 9080 7201 1796 785 --18309
NM_002069chr741681 1333 290 278 1545 2515 283 --
NM_002082chr53848 788 217 1225 1232 --
NM_002092chr444995 4905 3904 1861 34011 1827 1593 34295 3084 1113 25104 967
NM_002126chr17114095 2729 2657 1584 1487 1455 1272 742 197 160 138 ----13440
NM_002128chr1372581 2227 1893 907 143 126 58 12449 --12370
NM_002158chr253449 2920 1433 894 417 33509 2758 1279 23059 1443 13519
NM_002203chr5113845 3777 3613 3461 3278 3169 2565 2540 1136 1076 452 13986 13817 --
NM_002210chr242920 2745 989 425 23587 679 32868 338 261 --
NM_002211chr102867 364 --1104 2131 122
NM_002214chr765595 5303 5223 848 694 123 12292 13836 14005
NM_002239chr251151 904 366 297 214 --2440 158 1243
NM_002240chr213630 621 525 ----1586
NM_002247chr1082171 2075 1902 1505 869 732 144 133 --1954 11986
NM_002268chr321292 67 21573 577 1683 11334
NM_002270chr564849 4798 4496 4179 1622 1223 25192 1190 13700 --
NM_002285chr253890 3658 3556 3520 541 13698 44090 3419 3175 1101 23728 3623
NM_002310chr5166574 6184 5179 4560 4370 3991 2566 1953 1715 1507 1382 1237 368 301 258 154 46419 4762 4059 606 ----
NM_002356chr682752 2659 2271 2076 2020 781 729 535 1818 --12794
NM_002397chr541721 842 287 95 2233 217 2683 422 --
NM_002581chr9115700 5074 5040 4980 4966 4204 3733 3537 1809 559 246 --14954 14171
NM_002594chr2041879 1869 1808 772 32089 1898 1819 11905 --
NM_002645chr1182777 2272 2257 2149 2018 958 780 103 22817 843 1734 23073 2550
NM_002655chr875040 5029 4958 4613 4152 2043 34 75104 5067 4553 3761 3314 408 112 25021 4622 14346
NM_002709chr2102913 2428 1212 1138 1051 755 720 259 169 67 12647 13451 --
NM_002719chr1472364 2295 2288 2172 1810 1498 627 22426 1793 12441 --
NM_002737chr1784436 4100 1853 1555 1546 1364 939 782 26616 6504 11006 --
NM_002745chr2274510 2934 2911 1400 1269 643 246 13763 33951 1648 781 --
NM_002837chr1284548 4331 3813 1784 1319 873 211 175 ----1112
NM_002838chr14839 435 259 185 2856 793 1456 --
NM_002839chr952908 1386 1275 577 378 22717 726 42835 2692 2319 931 12850
NM_002844chr62278 85 1425 2974 915 1524
NM_002858chr161348 1290 1116 469 223 198 ------
NM_002892chr1461484 1402 1328 1263 407 117 1301 ----
NM_002902chr151192 --1575 1600
NM_002912chr66806 800 748 265 156 64 2864 667 --1195
NM_002956chr1261265 1249 1207 440 389 77 ----21227 1056
NM_002959chr1114419 4214 4097 3904 3898 3874 3818 3146 1040 673 408 ------
NM_003010chr1762205 2167 2142 576 397 144 --12276 22252 110
NM_003011chr951683 1448 1040 458 393 ----11572
NM_003034chr1288136 6915 6001 5637 2680 2029 1120 985 37624 1455 1179 ----
NM_003045chr1374967 4744 4323 4148 3345 726 395 --34736 4037 3092 13951
NM_003108chr297129 6578 5321 5022 4539 1312 1282 1186 980 21430 731 26162 4991 15945
NM_003111chr221353 1104 --11255 31201 546 96
NM_003112chr762814 2450 2169 2151 2136 193 12006 33137 2720 942 --
NM_003128chr262672 2090 1147 902 706 378 1782 --1751
NM_003155chr852584 2350 764 758 75 --12695 --
NM_003199chr18105348 5253 4571 4277 3889 3741 1746 1647 1194 434 15186 35227 4545 267 1254
NM_003246chr1562041 1998 1985 1627 1424 799 ----12061
NM_003262chr3115054 4816 3442 3346 1991 971 917 733 613 269 120 ------
NM_003274chr2132636 1179 1035 1840 --11093
NM_003298chr3116136 4135 4104 4086 4018 3928 1724 1298 1247 593 356 --54124 4115 4079 4052 862 188
NM_003368chr14788 671 583 25 --2761 507 --
NM_003392chr374186 3828 3323 2895 1422 1352 1330 14293 13098 --
NM_003410chrX82984 2913 2736 2473 885 850 840 94 22703 114 13096 --
NM_003442chr113842 166 115 1208 --1620
NM_003453chr135761 744 611 287 119 --1735 1296
NM_003458chr353660 2775 1181 903 841 23882 1145 13586 11422
NM_003463chr693163 3156 2261 2213 2145 662 609 376 231 1814 ----
NM_003468chr274229 3780 3763 3302 2785 1416 255 --23939 3755 13100
NM_003471chr372269 1848 1587 856 334 245 164 1698 11770 11467
NM_003478chr1122814 363 23342 3253 32181 2148 1140 --
NM_003489chr2163389 3115 3010 3002 2901 2853 166 32937 2911 2709 12865
NM_003566chr1283166 3059 2918 2316 1308 1016 297 58 53418 3091 2592 2474 844 22372 386 1377
NM_003574chr18115699 5431 4744 4707 3836 3542 2245 1442 883 204 116 11583 15685 14204
NM_003583chr1283848 3751 3744 3705 3566 3218 2816 1393 ----11450
NM_003590chr273650 3055 2672 1408 1184 781 246 1737 13223 --
NM_003618chr241309 336 299 226 181 11153 1316
NM_003626chr1121191 329 11256 31326 468 262 1349
NM_003672chr191899 1806 1768 1754 1578 1512 1296 336 280 --41837 1779 1773 316 --
NM_003677chr1252053 1819 1531 1450 121 21986 309 8240 220 198 172 164 144 126 104 --
NM_003711chr53340 283 240 194 --1275
NM_003722chr341748 842 651 500 12567 1551 1347
NM_003749chr1342330 2321 2143 2027 --12128 22096 1779
NM_003759chr473418 3340 1704 1691 1322 1300 995 --24307 1709 11331
NM_003783chr131016 907 301 2446 218 31199 836 56 128
NM_003799chr18104511 4504 3011 2908 1555 1174 857 480 454 186 14538 1112 --
NM_003887chr282219 2170 1864 1655 1493 894 827 595 12229 12092 1601
NM_003895chr21102184 1987 1759 1370 506 497 470 209 159 139 --11417 184
NM_003902chr12293 254 1624 3857 307 237 1152
NM_003913chr684264 4181 4105 3673 965 755 513 411 --43201 3095 250 75 --
NM_003934chr941138 1056 1044 276 ----1223
NM_003972chr1071161 1145 1134 1087 943 358 324 11251 21171 1071 --
NM_003994chr1254315 4301 4218 515 327 1835 22981 1410 --
NM_004028chr1833834 3194 2844 12776 1101 13731
NM_004093chr1393056 2947 2876 2495 2386 2254 2019 283 224 22926 469 1932 12266
NM_004114chrX61234 1193 1123 913 494 199 1962 11172 --
NM_004133chr842345 1972 641 282 --1202 12594
NM_004136chr1573260 3216 2827 2269 689 670 369 --12284 --
NM_004171chr11169656 9064 8905 8813 8556 8122 8115 8017 7947 7908 6938 6692 6660 3749 2848 2626 48979 2582 1296 1214 28139 2933 --
NM_004241chr105769 710 282 245 68 1579 ----
NM_004272chr581838 1707 1698 1574 695 666 577 154 21370 422 31723 1585 239 --
NM_004274chr1452233 2102 852 642 434 ----3885 861 681
NM_004316chr123977 796 734 2777 328 --11141
NM_004338chr1866678 6620 5895 5123 4995 321 --15071 16714
NM_004342chr752012 746 692 535 349 --2701 144 12326
NM_004384chr562045 2000 1769 824 784 666 31739 888 753 11503 --
NM_004392chr1342317 1041 846 279 22533 2522 21732 807 1226
NM_004397chr1152934 2826 1232 979 730 1988 14240 --
NM_004415chr63640 575 544 1523 --1737
NM_004432chr952381 2315 1879 1858 1679 11816 12135 --
NM_004434chr1451858 1786 1381 1353 344 1199 ----
NM_004438chr252811 2638 2478 1148 269 --12188 23063 2509
NM_004459chr1742040 1667 1617 1320 --3829 583 575 --
NM_004500chr1442034 1460 493 278 ----11812
NM_004504chr251005 906 886 317 287 12084 1225 1158
NM_004505chr1762018 1960 1950 1911 782 664 21833 485 11877 --
NM_004523chr1041218 1203 576 82 ----11341
NM_004525chr261078 1072 1054 545 254 196 --1206 --
NM_004586chrX65381 5027 3516 3346 1789 1470 14763 2661 509 --
NM_004598chr563046 2849 2621 1216 875 639 --23139 663 12141
NM_004612chr9114377 4223 4065 3904 3506 3144 1243 842 578 463 197 --14115 11221
NM_004655chr1741091 1083 1044 341 ----11235
NM_004670chr102614 257 2520 430 --21695 583
NM_004685chr1361907 1861 1058 388 261 233 --2942 936 --
NM_004726chrX85782 5536 4804 3928 3721 1390 1344 1021 --45608 5450 2204 418 --
NM_004745chr8137012 6715 5694 2673 2149 2053 2001 1878 1625 1505 1297 902 55 16452 22489 907 16563
NM_004760chr722518 85 1289 --22345 2336
NM_004795chr1351770 1663 584 411 305 11366 11500 --
NM_004815chr133752 925 98 34732 1499 649 13131 13050
NM_004898chr422208 799 --42227 564 543 176 1672
NM_004904chr796555 5098 4848 4240 3996 3983 1056 845 283 16564 ----
NM_004948chr182466 214 --31287 437 324 1583
NM_004972chr921024 364 --1369 1393
NM_004999chr684485 4456 4194 3584 3516 610 601 468 ------
NM_005034chr82542 72 1498 --1221
NM_005036chr22108241 7918 7454 7029 5980 5764 5476 2534 2055 458 --28311 8099 --
NM_005054chr271784 1474 1249 1176 178 160 132 11626 ----
NM_005056chr1265479 4247 3716 3658 3600 2090 32238 149 140 14315 --
NM_005065chr1495306 5108 3902 3670 3392 1699 1594 380 342 --34493 3986 3696 --
NM_005093chr20135339 5306 5289 4963 4929 4344 4216 1817 1017 1011 730 349 168 15313 ----
NM_005095chr111564 21818 318 --2158 83
NM_005121chr1793488 3415 2831 2797 2626 2505 2477 1229 1209 23762 24 2748 661 1468
NM_005126chr352051 1527 822 74 41 11593 1812 --
NM_005156chr995315 5281 5111 4276 4152 4069 3731 1066 1054 11578 ----
NM_005160chr2286524 5653 5207 4509 1608 1015 781 455 26841 1077 25407 1822 1920
NM_005197chr14106187 5713 5679 5572 4904 3980 1749 1687 1351 810 ------
NM_005233chr342361 2303 2229 2146 22538 2250 --12464
NM_005235chr2127331 7005 6470 6375 5871 5436 4797 4756 2787 1627 432 149 27742 6218 --13009
NM_005339chr494255 3130 2647 1396 1172 1071 702 685 298 ------
NM_005359chr18116476 4847 1264 1237 1206 1081 985 655 533 465 263 1429 24131 344 --
NM_005385chr342691 2667 455 448 12653 --1275
NM_005400chr253043 2960 2912 1202 248 ----12884
NM_005436chr1064114 3953 3728 3637 3086 1492 21093 294 21320 234 --
NM_005475chr1223233 3221 13240 --13283
NM_005477chr1562594 922 719 628 575 538 --3581 556 550 --
NM_005477chr1562594 922 719 628 575 538 --3581 556 550 --
NM_005487chr2231951 588 56 22103 1962 --1150
NM_005497chr1776081 6002 5130 2081 1757 1557 355 --33793 755 302 --
NM_005509chr561859 1311 1180 643 580 361 --1585 123
NM_005596chr9126152 5275 4650 4602 4157 3990 3983 2015 1934 1713 1384 1045 11165 14837 --
NM_005613chr192160 1512 628 526 517 501 458 435 372 --1543 --
NM_005627chr64905 836 815 356 1822 ----
NM_005665chr144480 1699 1045 637 1374 34563 977 90 --
NM_005668chr5114581 4309 4045 4035 3967 3813 3632 3558 3542 3536 3019 12995 14069 21661 246
NM_005725chr162306 2283 2190 2043 702 125 --22288 2261 12034
NM_005746chr772730 1966 1912 972 677 619 54 2552 375 ----
NM_005759chr2114781 4183 4094 3985 2925 1219 1035 748 709 341 247 34393 1283 203 ----
NM_005813chr222455 969 12288 --12360
NM_005840chrX137136 6150 5387 4869 2934 2885 2638 2467 2185 2107 2067 2000 1958 13031 12946 37009 6975 1693
NM_005841chr441100 961 427 307 ----1973
NM_005859chr551539 976 966 608 366 11346 ----
NM_005880chr1611369 31521 363 160 --1124
NM_005885chr581203 1066 651 601 445 268 206 112 1583 2287 261 --
NM_005898chr1142541 2205 1986 51 22400 646 22286 843 --
NM_005901chr18118620 8606 7894 7718 7434 5517 5325 2639 1696 318 307 1911 ----
NM_005904chr1841327 1256 379 369 21343 1334 11514 --
NM_005909chr573416 3275 3082 2999 2615 1355 1277 14245 13007 1964
NM_005935chr485198 5109 5043 4974 4584 3595 1555 1363 --14668 15017
NM_005966chr222198 2145 ----2809 307
NM_006007chr973255 1420 1399 1367 1192 379 288 24160 1104 52758 1487 1277 867 201 13598
NM_006011chr1564202 4099 3777 3231 3215 2878 ----13879
NM_006033chr1892284 2230 2197 2127 1985 1778 866 844 741 --12293 11512
NM_006037chr254241 3706 1667 1488 1162 33683 1852 1721 --11145
NM_006047chr2073230 2818 2628 2488 547 515 497 ----12927
NM_006060chr763756 3726 3381 2768 1750 1651 --23429 1038 --
NM_006080chr792997 2831 2632 1966 1913 658 631 477 273 ------
NM_006095chr443292 2836 1274 810 33338 3151 173 24465 150 --
NM_006141chr1682644 2590 2124 1715 956 715 639 531 --147 --
NM_006154chr1572885 2196 2188 1791 942 887 339 22076 925 ----
NM_006158chr831319 436 231 --11705 31739 402 121
NM_006166chr1262609 2438 962 277 105 96 1238 11790 --
NM_006203chr534530 1422 611 14143 --1953
NM_006206chr462887 2648 2372 2245 1153 443 12579 22641 1045 --
NM_006237chr1322096 1829 11629 11528 1419
NM_006251chr572786 2780 2308 1097 952 286 206 12149 53308 1355 1301 1234 215 12759
NM_006252chr187051 6905 6358 5371 4613 1805 1497 1249 26952 549 15267 --
NM_006256chr192725 2624 2262 2009 1093 1040 989 951 517 --1970 1977
NM_006265chr831366 1236 563 31330 273 109 --11534
NM_006283chr854723 3754 3495 1703 527 34287 3282 1734 --14526
NM_006287chr272560 1926 1857 966 775 611 512 12350 11053 --
NM_006298chr6113185 3006 2965 2315 1242 859 680 640 537 235 76 11016 42306 2160 2146 958 --
NM_006300chr1972254 1948 1867 484 238 211 47 ----11961
NM_006315chr474163 4038 3641 3502 3423 3300 3284 32816 1818 1739 12918 --
NM_006359chrX82313 2280 2043 1744 918 906 737 152 ------
NM_006393chr1084381 4231 3309 3209 2821 287 110 38 --21594 978 --
NM_006420chr2073233 2523 1114 1006 936 675 370 12790 --43435 3359 2710 2411
NM_006434chr1093250 2766 2754 2744 2702 2460 2371 957 613 --12730 --
NM_006457chr454036 3964 3729 1305 825 --34121 3455 3043 23988 3342
NM_006482chr1283848 3751 3744 3705 3566 3218 2816 1393 ----11450
NM_006504chr1062890 2787 2585 2415 189 109 12717 12772 --
NM_006526chr2052072 1577 631 523 129 1845 21621 863 11914
NM_006529chr451739 1588 1272 498 73 1620 --11479
NM_006538chr254014 3542 3330 2865 2733 34139 3487 2700 12633 --
NM_006544chr1485832 5699 5598 4792 4778 4758 3819 1732 46107 4785 2402 1916 35923 5750 4317 --
NM_006557chr911653 1312 --31706 1380 425
NM_006561chr1055777 3889 3769 1697 1382 21316 1180 24504 752 14138
NM_006572chr1773215 3179 2573 2528 874 773 551 11141 22674 1130 --
NM_006595chr1131411 759 196 ----1715
NM_006599chr1678245 8094 5851 5487 1719 1617 706 26948 1549 47256 6528 6125 564 16171
NM_006614chr383633 3004 2883 2701 2602 1380 984 898 11072 11192 --
NM_006646chr1333026 2892 2256 1108 --13048
NM_006654chr12104386 4112 3913 3320 3137 3072 1922 1185 924 211 43835 3751 3259 3239 31823 369 133 --
NM_006717chr983186 2934 2750 1107 454 420 385 45 1918 --23417 2516
NM_006722chr393029 3007 2046 1050 928 556 470 229 177 1218 ----
NM_006729chrX95331 4905 4257 3956 2004 1119 1098 143 74 --11415 11568
NM_006734chr651580 1509 510 298 232 --31489 588 458 --
NM_006738chr1554490 2996 1346 624 420 1690 33645 2946 705 14511
NM_006750chr1668032 7262 7187 2849 2569 856 27690 1629 37965 6181 2608 --
NM_006766chr872687 2235 1849 1659 1082 964 363 ----22464 1820
NM_006775chr692806 2782 2751 2703 2663 2396 868 818 442 ------
NM_006777chrX41870 1857 891 432 12865 --1903
NM_006805chr51630 --11432 21601 484
NM_006813chr65276 243 194 184 176 ------
NM_006827chr1473192 3132 2820 2079 1359 1099 952 23235 2302 11190 --
NM_006852chr1762822 2198 2189 2180 1059 303 --12154 --
NM_006895chr232051 1549 443 21905 1664 --1834
NM_006922chr252585 2113 1041 999 646 32220 1829 277 12429 --
NM_006924chr1784288 4245 4088 3472 1157 943 796 39 --11299 --
NM_006962chrX41283 1270 1263 1084 --1817 1834
NM_006996chr141878 1595 568 303 --2494 101 11810
NM_007005chr931502 469 270 11310 11250 1487
NM_007006chr1673360 2247 2157 1362 1085 840 786 1233 --13468
NM_007007chr1284376 4266 3626 3289 2958 1784 1656 874 14571 23264 1164 21507 293
NM_007038chr2185762 5229 4395 4160 4111 2373 1591 943 33994 2021 1911 45780 5106 1462 169 14371
NM_007050chr2077983 7806 7123 5976 1129 975 346 16569 15771 12110
NM_007054chr573943 797 723 450 331 294 243 1193 23962 3709 13920
NM_007084chr1331390 43 34 --41348 126 115 52 --
NM_007114chr342879 2857 697 324 2656 181 1474 --
NM_007125chrY5964 920 897 433 226 11327 --1932
NM_007187chr1371052 1003 769 688 266 120 22 ------
NM_007200chr1554490 2996 1346 624 420 1690 33645 2946 705 14511
NM_007249chr1399078 8374 8275 8005 6972 6251 2034 1484 296 49349 7681 7447 6490 39068 7488 3049 --
NM_007345chr1852116 1955 1598 914 500 --11490 12292
NM_012081chr563450 2802 2369 769 660 547 --1569 1393
NM_012096chr363768 3504 1067 612 209 202 13573 12761 23746 495
NM_012097chr262190 2183 2040 1928 1425 472 2809 34 ----
NM_012115chr63507 483 441 2573 559 --2602 457
NM_012120chr632572 1983 498 --22299 284 11066
NM_012129chr762535 2440 2380 1680 697 333 31995 1745 59 ----
NM_012156chr2043418 1040 929 922 --1945 --
NM_012214chr2106203 6197 5293 4581 3881 1749 768 486 284 64 13944 ----
NM_012234chr373419 2699 2336 453 294 251 202 13465 23674 310 --
NM_012249chr242766 875 606 525 --32365 692 674 --
NM_012252chr755353 5309 4391 4218 319 --24530 3597 1516
NM_012287chr3134336 3529 3506 3349 3044 2927 1090 1065 1057 1050 784 640 620 23307 960 24500 50 24381 630
NM_012294chr763919 3704 3577 3553 608 308 33563 2968 669 13938 --
NM_012297chr461802 1786 940 837 615 475 1394 --11012
NM_012399chr2271664 618 265 218 200 193 186 --1273 --
NM_013230chrY41731 1713 1333 644 --1449 1237
NM_013231chr14104206 4083 3940 3193 2993 2831 264 147 117 64 1275 12776 --
NM_013255chr7148864 8361 7709 7105 6840 6213 3054 2792 2475 2394 2239 1216 542 519 15535 48846 7272 3468 1450 16369
NM_013257chr832347 2038 139 --11590 2155 90
NM_013261chr453695 3500 1245 323 302 1121 23749 1117 --
NM_013269chr1274483 3587 3292 3011 1573 759 356 23436 3255 13113 --
NM_013281chr2071514 1339 1317 1293 1089 124 118 ------
NM_013374chr363150 1102 987 777 100 69 21145 126 1561 --
NM_013381chr126722 642 350 278 264 79 22200 936 3708 687 681 22210 736
NM_013396chr2121368 463 2375 31 --1218
NM_013423chrX1843 --1485 2832 362
NM_013427chrX1843 --1485 2832 362
NM_013437chr831391 1259 28 ----1441
NM_013444chrX51145 932 913 864 31 ----11101
NM_013448chr142250 215 2753 76 --1737
NM_013943chr183250 2961 2777 1128 877 531 437 326 ------
NM_013989chr1465027 4296 3613 3550 3223 986 11835 44836 4378 1209 998 --
NM_014011chr232331 2141 1701 12435 32397 769 47 12075
NM_014021chr1112857 2808 2547 2309 1257 951 764 609 495 485 195 --2387 240 12250
NM_014023chr1072700 2618 2524 2370 387 201 121 --2211 161 --
NM_014048chr1695241 5216 5182 5176 3344 1703 899 813 790 --1770 --
NM_014112chr894842 1701 1560 1506 1322 1092 748 648 269 --44576 3775 3722 1118 11328
NM_014141chr744901 4720 4561 2030 --15281 1858
NM_014154chr331028 487 344 21563 400 --1649
NM_014155chr1197352 7304 7293 6638 6082 5245 2989 693 330 35981 5203 708 27060 2054 --
NM_014181chr252550 2089 1826 1808 550 11087 --1608
NM_014243chr462107 1974 1421 1341 487 303 11853 22036 1651 11769
NM_014250chr2231951 588 56 22103 1962 --1150
NM_014253chrX92366 2286 2197 2165 1888 892 680 658 95 ------
NM_014309chr2285216 4828 4388 3918 1322 847 221 172 15348 12089 --
NM_014319chr1261808 711 692 685 576 392 21906 1346 31656 723 553 1585
NM_014333chr1182690 2524 2503 2466 2453 2277 722 345 --12763 12610
NM_014350chr51365 11104 1396 1355
NM_014421chr422025 1732 11854 1236 12111
NM_014423chr5175440 5425 5189 5001 4379 4078 4039 3987 3745 3533 3509 3460 1376 1322 1237 1195 647 15603 15355 11928
NM_014445chr332353 1994 901 ----21749 368
NM_014458chr151064 452 184 69 24 ----11408
NM_014615chr1673548 3430 3261 791 686 342 114 --21247 672 --
NM_014674chr343911 3086 3052 3024 23144 129 11525 13855
NM_014676chr191543 1522 1421 1105 1067 1056 260 247 201 11591 1277 --
NM_014682chr882325 2261 2226 1870 1819 1596 1444 75 --32145 1485 1461 --
NM_014683chr1762025 1333 850 682 409 275 11567 21574 863 --
NM_014701chr1553130 2923 1226 1069 751 ----23067 2981
NM_014702chr673470 3083 1383 464 368 345 253 12780 33171 399 291 1244
NM_014707chr731847 430 422 11975 2737 112 --
NM_014721chr6137032 6937 6897 6803 6523 5080 4842 4737 2679 1769 1006 784 464 37008 5771 2275 --17097
NM_014739chr683879 3725 3275 3099 3016 2971 1605 436 ------
NM_014743chr463134 2940 2562 2093 1161 260 22867 2772 32894 1230 532 --
NM_014746chr254335 4146 3708 679 105 24104 3991 24136 565 14239
NM_014755chr2124026 3867 3150 3137 2857 2592 1634 1606 923 562 450 77 --44246 4057 3129 338 33883 2985 674
NM_014766chr773547 2792 2511 2431 440 214 201 23755 2726 23615 3445 --
NM_014781chr841277 974 293 132 1864 11239 1445
NM_014829chr552228 1745 921 76 44 --11617 1808
NM_014850chr384249 3088 1783 478 414 368 356 135 13148 2394 384 --
NM_014859chr1721169 31 11234 21307 1225 11426
NM_014877chr17137783 7759 6489 5807 5706 5672 5457 1964 1180 1092 581 443 340 27384 297 37071 2819 2808 1437
NM_014903chr1262371 2246 2228 1900 1617 620 22080 545 12437 --
NM_014904chr1083939 3374 2879 2718 2567 2528 501 493 33999 3983 1281 1470 --
NM_014912chr1073460 3095 2750 2616 2495 2452 98 12977 --12954
NM_014920chr683449 3301 3142 3068 2897 788 454 264 1206 22467 86 --
NM_014923chr1362019 1845 1539 863 817 49 22088 825 22336 1698 --
NM_014932chr351956 1686 1660 1389 163 --21405 619 --
NM_014934chr1383757 3333 2804 1510 1370 916 881 394 --13444 --
NM_014946chr253119 2376 783 314 128 22948 1176 11154 --
NM_014947chr162941 2909 2893 2769 801 47 --12300 1371
NM_014962chr2052754 2235 2226 1089 269 42896 2024 915 439 1159 --
NM_014982chr14105272 4947 3431 2087 1952 1828 1580 1406 884 725 --1482 14552
NM_014988chr432179 2117 641 --22834 1853 22021 1973
NM_014991chr453203 3174 3044 2675 1061 22878 2700 32990 2562 419 12807
NM_014992chr144653 234 156 147 --1172 --
NM_015000chr1242699 1090 750 733 22961 2568 ----
NM_015024chr851270 1047 1028 1004 25 1326 2576 335 --
NM_015025chr252037 1698 512 259 202 52674 2527 1948 1904 1751 11915 12299
NM_015026chr1273655 3181 2983 1839 1743 701 327 43806 1566 527 505 1299 --
NM_015032chr1382696 2524 2174 1118 886 776 305 221 22531 2458 ----
NM_015046chr982769 2606 2582 2483 2458 2427 1785 317 --1309 11889
NM_015074chr164907 4200 3685 3261 3021 345 --24784 3626 14922
NM_015076chr6124274 4245 4035 3721 1532 1166 1159 942 815 647 405 148 13892 13471 --
NM_015092chr1634637 961 896 24510 376 31237 938 873 24490 3469
NM_015093chr631630 641 249 1602 31399 709 609 --
NM_015115chr452253 1160 329 278 257 43118 2936 641 287 12946 --
NM_015137chr872313 2191 1964 994 918 877 746 2723 351 ----
NM_015156chr1463779 3242 2968 1192 1120 403 12646 --13744
NM_015192chr2073006 2797 2477 1017 693 565 224 12316 32897 2458 1010 --
NM_015200chr4--12453 3746 579 191 1537
NM_015206chr1523733 3501 ----23846 3671
NM_015208chr1853766 2602 682 537 472 22936 573 12962 23096 600
NM_015215chr183061 2224 2154 1183 1174 1164 1128 1018 1374 11205 1828
NM_015225chr932467 208 184 13169 23005 2489 1934
NM_015247chr1643970 3607 1214 480 --45386 1846 1242 1155 --
NM_015265chr242181 703 526 406 --32655 418 412 --
NM_015271chr474178 4027 3974 3763 2802 1150 836 --34066 3825 1124 11690
NM_015278chr693453 3420 3220 3098 2907 2140 456 315 50 ----11074
NM_015288chr593712 3684 3672 3633 3505 3102 2895 2884 1545 ----12865
NM_015296chr1341100 962 852 843 --2989 809 1975
NM_015310chr8148135 6737 6632 6308 5235 5070 2173 1922 1670 802 319 266 156 136 16268 58384 8209 7606 2155 548 28404 2933
NM_015313chr1174676 3810 3749 3678 1475 648 340 14228 23603 277 --
NM_015315chr543299 2549 1159 1005 --21052 145 13485
NM_015317chr282795 2351 1761 1131 1124 690 260 167 11822 2677 430 12805
NM_015335chr1242406 2126 1660 362 32150 2082 1772 32372 1615 1029 12215
NM_015336chr1231787 572 333 --41663 763 481 467 --
NM_015358chr2131180 1134 50 3978 522 340 21054 1019 --
NM_015375chr175026 4996 4913 3086 3075 1015 321 25033 1849 11021 11283
NM_015385chr1093250 2766 2754 2744 2702 2460 2371 957 613 --12730 --
NM_015387chr282113 1375 528 177 82 54 48 23 --21488 1441 --
NM_015429chr34911 879 381 275 --1458 199
NM_015436chr453290 2908 2884 2374 907 --11184 12890
NM_015455chr583952 3794 3726 2629 1339 996 977 459 13979 21501 833 --
NM_015477chr153870 841 791 --1800 1916
NM_015541chr331386 216 99 1184 --11351
NM_015554chr15102794 2709 2541 1064 834 562 449 428 96 39 --12821 --
NM_015555chr62228 106 1363 1186 1177
NM_015569chr184816 4226 4065 3298 3247 3115 997 244 23083 1700 54561 4555 3291 3265 3236 11793
NM_015570chr741420 515 384 168 1466 21671 136 --
NM_015575chr253687 3422 2684 1232 906 23671 918 13552 --
NM_015576chr372863 2115 1170 1150 823 553 99 22470 991 32916 2512 2096 12906
NM_015640chr1115114 4902 4139 4108 3859 3264 1866 1456 526 335 217 24522 4444 14798 --
NM_015879chr18158575 8556 8496 7652 7531 6864 6672 5572 5525 2114 1599 1281 1155 1033 581 ----13272
NM_015886chr895673 4886 4849 4491 4014 1724 1022 363 233 34424 914 136 2348 54 --
NM_015906chr133799 3616 839 34404 4145 3172 14008 13389
NM_016009chr174880 4774 4741 4528 3926 873 835 11632 --11975
NM_016018chr872726 2542 1779 711 624 486 352 --22317 263 --
NM_016021chr672966 2938 2042 1969 837 821 489 --32923 2357 414 --
NM_016076chr173119 2691 1143 1007 823 784 378 --13033 --
NM_016083chr6103858 3768 3413 3267 2808 1377 930 553 466 431 13757 1914 --
NM_016100chr201278 ----2422 407
NM_016107chr541383 1333 1247 199 2949 880 1151 --
NM_016131chr242119 1963 402 237 32205 372 336 2569 201 --
NM_016205chr451434 1208 924 503 38 31280 372 179 21303 292 --
NM_016206chr379002 8674 5490 2428 1764 1286 455 38483 5512 236 47723 5707 721 391 15787
NM_016217chr643666 3193 1296 219 --11304 1936
NM_016224chr631669 711 462 ----21601 1581
NM_016248chr1363696 3572 2571 842 253 163 12827 22782 2625 13086
NM_016255chr63891 643 47 22404 2094 --1792
NM_016260chr297619 7408 7389 7368 6884 5095 2389 1785 914 47443 6241 5766 5107 35986 2697 1526 --
NM_016275chr362292 1793 1019 783 600 226 12437 --12446
NM_016315chr22595 45 11565 --1482
NM_016322chr982538 1191 1060 995 762 697 349 87 22208 983 --1658
NM_016374chr151465 1266 1231 1165 345 41581 1048 484 434 ----
NM_016374chr151465 1266 1231 1165 345 41581 1048 484 434 ----
NM_016396chr1542710 2606 1926 630 11063 32950 1993 254 --
NM_016422chr1142897 2740 2703 1963 22962 638 22861 2685 --
NM_016442chr552320 1848 1443 820 178 22222 618 12054 2471 202
NM_016513chr683449 3301 3142 3068 2897 788 454 264 1206 22467 86 --
NM_016530chr1564054 3943 2849 2796 2688 383 13128 13636 --
NM_016531chr483709 3622 3370 3088 832 804 362 333 24149 3474 33011 3005 93 --
NM_016548chr921632 92 1624 1107 1650
NM_016603chr552232 2156 1756 1725 66 11554 21819 1688 --
NM_016620chr131145 482 412 1428 --11082
NM_016824chr1041680 1517 752 681 --11757 11874
NM_016953chr295747 5702 5642 5318 4792 4469 4264 3852 374 15613 23903 2071 15907
NM_017415chr584532 4459 4074 2935 1763 1338 1245 571 ----11786
NM_017420chr1463753 3557 3501 3096 984 254 --53640 3062 2676 697 338 --
NM_017447chr2184389 4026 3355 3297 1310 1235 1141 484 11712 ----
NM_017519chr6--2494 203 11354 21027 1011
NM_017610chr1561894 1736 820 510 423 182 --1164 1440
NM_017626chr1031787 477 91 --1483 11719
NM_017628chr465194 4038 1558 1403 222 184 1682 13712 1306
NM_017633chr683412 3346 2919 2875 2826 2812 1045 158 31025 971 115 11077 --
NM_017637chr9159225 9172 8170 8075 6991 3602 2965 2716 2535 1925 1803 1481 126 117 83 69456 8469 6697 2814 928 332 38104 7411 6201 13259
NM_017643chr1762981 2882 2441 2047 580 73 33093 2909 2403 1271 --
NM_017644chr364483 4098 3411 1559 339 243 11325 1356 14827
NM_017650chr7155892 5813 5729 5629 5358 5139 4934 4721 4202 4116 3908 3901 2289 1359 1045 15289 35558 4757 2184 --
NM_017658chr1494521 4497 4015 3646 3378 1256 683 301 278 --13735 --
NM_017742chr1861913 1844 1329 1213 592 217 1305 11557 --
NM_017769chr1452930 2414 2374 2009 638 --13059 11086
NM_017813chr865464 4955 3793 1264 1073 999 35637 3834 2280 45103 4102 1487 1465 --
NM_017831chr1814761 1319 11361 1106
NM_017848chrX64443 3113 1040 1028 940 924 ------
NM_017919chr985599 5472 4480 3956 3871 3694 2250 220 14532 --1796
NM_017925chr941330 1202 765 737 --11364 11793
NM_017944chr1172948 2617 968 835 826 208 192 1389 1325 1232
NM_017958chr233026 2593 1989 32047 242 48 22096 23 --
NM_018036chr1454420 4131 3570 1220 960 44400 4184 3447 661 ----
NM_018048chr1241587 714 633 27 11994 1727 --
NM_018051chr72337 119 182 2110 97 --
NM_018061chr171739 1261 525 471 383 262 79 1323 1253 1484
NM_018084chr272867 2654 2519 1282 852 843 486 --22931 2779 --
NM_018086chr261878 1795 733 683 648 406 --11899 11677
NM_018155chr383279 3173 2390 2345 2220 1371 1174 552 32272 1381 1314 23407 3388 13136
NM_018157chr1272369 1215 1164 1155 885 749 690 1525 11169 --
NM_018247chr662340 1004 533 402 373 362 1494 31181 1160 35 --
NM_018287chr1071317 1294 951 836 821 352 71 11228 11079 --
NM_018299chr851391 853 714 305 149 1312 12591 --
NM_018313chr382631 2139 1686 688 668 510 263 121 21780 1032 ----
NM_018328chr24372 323 62 55 2439 424 --1388
NM_018351chr1274743 4639 3265 2884 915 782 296 183 ----
NM_018374chr743675 3420 1318 744 14379 --1724
NM_018394chr351378 1164 595 139 35 11027 --2636 503
NM_018490chr1151590 1557 1385 1376 216 11613 11696 --
NM_018555chr1972236 2229 2084 2036 1493 618 230 1747 31482 660 623 --
NM_018557chr231391 1267 661 21447 28 21499 671 136
NM_018638chr12115643 5261 5220 5063 4974 4163 3895 2258 2067 1505 1143 ----11423
NM_018640chr1251841 1007 412 300 292 1944 2217 69 --
NM_018682chr75600 174 91 62 50 1106 1502 --
NM_018710chr821369 923 --11315 21343 112
NM_018718chr772291 2070 2025 633 598 274 116 22321 1633 ----
NM_018841chr163850 3056 575 479 459 427 21579 614 12404 --
NM_018898chr542258 2251 2183 1555 11792 --11933
NM_018899chr542258 2251 2183 1555 11792 --11933
NM_018900chr542258 2251 2183 1555 11792 --11933
NM_018901chr542258 2251 2183 1555 11792 --11933
NM_018902chr542258 2251 2183 1555 11792 --11933
NM_018903chr542258 2251 2183 1555 11792 --11933
NM_018904chr542258 2251 2183 1555 11792 --11933
NM_018905chr542258 2251 2183 1555 11792 --11933
NM_018906chr542258 2251 2183 1555 11792 --11933
NM_018907chr542258 2251 2183 1555 11792 --11933
NM_018908chr542258 2251 2183 1555 11792 --11933
NM_018909chr542258 2251 2183 1555 11792 --11933
NM_018910chr542258 2251 2183 1555 11792 --11933
NM_018911chr542258 2251 2183 1555 11792 --11933
NM_018945chr653600 2241 1438 714 586 1861 32316 787 173 --
NM_018976chr1282880 2786 2532 2452 2417 2399 1109 351 12570 12377 --
NM_019001chr374744 4655 3428 849 307 185 89 44806 3502 1758 1618 1200 13954
NM_019018chr56631 570 563 543 530 477 ------
NM_019050chr462019 1871 442 242 234 227 ------
NM_019063chr271892 1808 1798 1704 1692 457 262 1671 1729 12041
NM_019072chr584206 3868 3390 3063 788 446 297 145 --1654 --
NM_019556chrX51441 1337 1209 1111 331 11452 --1131
NM_019593chr2093100 2643 2262 1096 1041 963 783 705 486 --11087 1680
NM_019843chr224459 399 360 187 1346 2333 319 --
NM_019903chr1041680 1517 752 681 --11757 11874
NM_020122chr2116063 5551 5529 4640 2348 2236 2170 2000 1227 942 123 --25016 1155 --
NM_020245chr664964 4809 3940 3899 1551 1262 54430 3443 3335 1960 1354 13462 --
NM_020338chr1093632 3614 3486 3285 3267 3020 2856 1246 813 13383 11235 13498
NM_020390chr364778 4595 4144 3088 1841 1258 --23081 1553 1185
NM_020466chr633722 3325 1093 --34418 669 103 --
NM_020640chr341861 1523 644 489 139 127 --
NM_020647chr862193 2048 1762 763 633 368 --22301 2106 12295
NM_020718chr1696352 6282 5039 4872 4765 4513 4030 1471 290 --1732 --
NM_020727chr2163189 3167 2955 2764 1396 272 13280 1785 11304
NM_020732chr6--2494 203 11354 21027 1011
NM_020734chr1262969 2751 1356 1308 1106 774 22672 340 42703 1314 915 729 --
NM_020742chrX62202 2061 1017 747 560 546 1571 22348 631 12728
NM_020766chrX74374 3513 3340 1212 454 279 126 13797 14397 --
NM_020772chr17158672 8067 7825 7806 7778 6445 6104 5383 3133 2567 1943 1451 1343 1310 948 36997 3195 872 16457 22034 1926
NM_020774chr1876214 4554 4168 1114 840 141 35 13889 56074 5660 1708 1213 941 14507
NM_020783chr1862160 2145 1775 1561 895 786 1889 11780 21579 491
NM_020792chr372825 2568 2383 1867 1815 1759 1030 11835 12229 11788
NM_020794chr14601 375 224 194 ----1122
NM_020800chr361391 1207 549 350 228 176 1442 21492 922 1450
NM_020801chr552675 2336 1616 746 575 ----12294
NM_020802chr1173332 3301 2923 2266 1131 1118 37 1569 ----
NM_020825chr1633838 2550 378 1113 12721 23670 2429
NM_020841chr1263536 2698 2523 1029 688 298 1713 53931 3265 2498 1625 278 23398 3138
NM_020844chr8117719 7527 7442 7122 7081 6985 6940 6436 4776 2777 1921 1431 47263 2680 2616 306 26946 6819
NM_020856chr193598 452 151 21465 144 1589 --
NM_020940chr1092570 2554 2496 1976 1092 1078 800 663 43 22508 176 22586 2578 --
NM_020948chr193579 3518 2961 2621 2557 759 585 340 317 1742 --13693
NM_020977chr432169 1438 77 22224 1705 1554 22253 548
NM_021007chr231592 810 706 1536 6826 798 790 782 776 122 --
NM_021038chr393299 3237 2459 680 611 587 381 213 88 32485 2380 965 11344 --
NM_021072chr552508 2495 2477 2458 2360 --22369 322 --
NM_021116chr768235 7794 6148 6008 773 224 17985 39029 3160 1141 23474 3461
NM_021140chrX41108 942 807 239 --2947 881 1983
NM_021148chr741749 979 348 53 1141 --11853
NM_021229chr1231041 901 493 1511 --142
NM_021252chr1061840 1533 1293 690 228 57 --21383 671 --
NM_021255chr1483976 3464 2694 2602 1442 1413 998 493 ------
NM_021629chr385067 4898 4633 4373 1571 1542 358 260 13881 31676 1553 297 --
NM_021648chr662731 2639 2464 2430 440 285 --11811 12405
NM_021813chr6115104 4912 4562 4532 4430 3860 2118 1342 930 835 425 55778 5462 5117 4548 2089 ----
NM_021905chr692034 1909 1863 1854 1843 1830 1683 1639 1573 ----11769
NM_021911chr594519 4024 3434 1831 1799 1528 1388 1341 55 14833 23912 3424 --
NM_021912chr1583322 853 803 194 187 176 132 82 11560 11034 --
NM_021960chr162209 2168 1902 857 698 682 1472 12652 --
NM_021961chr1197279 7235 6712 6003 5581 1210 897 397 33 26887 5968 54873 1634 1296 263 53 --
NM_021964chr3126514 5851 5143 4865 4602 4535 4414 1996 1845 743 322 87 --55122 4478 1403 861 780 --
NM_021977chr673876 3565 2489 1276 394 367 85 2682 125 43733 2827 2613 1527 --
NM_022048chr1565983 5653 2362 2332 2014 544 --15412 25858 5768
NM_022114chr184734 4656 4391 4253 4115 2955 1589 1412 1677 ----
NM_022133chr83331 324 274 --11366 1124
NM_022166chr16106300 6262 5896 5481 4815 4703 4097 2488 2053 2024 ------
NM_022351chr863781 3118 2715 1424 1336 100 --11125 23821 2636
NM_022456chr12167691 7673 7360 7332 7204 6264 6138 2419 1686 1591 1256 1187 630 336 288 214 11334 --17349
NM_022459chr1396132 6105 5728 5014 4741 4637 4356 1625 137 34475 1567 1555 1844 1275
NM_022474chr14122813 2485 2371 2359 2276 2078 1028 944 900 812 337 176 ------
NM_022763chr353180 1961 803 576 423 2737 642 23127 2584 --
NM_022781chr993337 3228 3164 2477 2171 593 516 326 248 1456 23345 50 1557
NM_022841chr1572595 2553 2270 1919 1693 233 47 --32244 2136 889 --
NM_022893chr262974 2555 2345 1210 634 371 21942 323 1512 11049
NM_022912chr293000 2930 2894 2874 2504 2460 2009 634 169 12402 2509 400 --
NM_023000chr1461484 1402 1328 1263 407 117 1301 ----
NM_023001chr1461484 1402 1328 1263 407 117 1301 ----
NM_024007chr563064 2316 2147 2134 2054 1987 12745 22695 2571 --
NM_024345chr965728 5721 5054 4850 4823 735 --24672 4266 --
NM_024524chr383168 2996 2973 2942 2885 2326 2308 980 2633 524 ----
NM_024665chr384473 4210 3633 3503 317 147 73 41 12884 2959 423 --
NM_024680chr111552 1201 159 1421
NM_024700chr131174 1069 369 --31074 883 754 --
NM_024704chr2051090 1040 977 922 739 --21029 999 --
NM_024721chr862381 1816 1680 1641 1057 337 1536 --12118
NM_024744chr262608 1998 1842 1706 580 380 1204 22693 401 --
NM_024900chr461794 1683 1464 566 146 86 --1581 1155
NM_024900chr461794 1683 1464 566 146 86 --1581 1155
NM_024947chr3139103 8595 8574 7351 6985 6790 3789 3710 3463 1824 1743 645 482 13675 36831 3588 1377 19219
NM_024953chr1262693 2584 2194 2180 1900 181 ----12551
NM_024989chr2157495 7479 6819 6574 6542 6496 5921 5460 5098 5053 3077 2667 2085 1392 270 47934 6373 5849 301 37940 5838 2687 1975
NM_024991chr1093250 2766 2754 2744 2702 2460 2371 957 613 --12730 --
NM_025054chr873823 2608 1670 1340 1171 890 98 23532 599 13611 13095
NM_025154chr751245 1213 1154 35 25 11454 11326 --
NM_025160chr144167 4062 2767 721 ----23524 2674
NM_025208chr1131757 489 281 ----1794
NM_025222chr3102989 2950 1974 1112 949 856 472 145 139 29 1828 1321 --
NM_030621chr1433717 1418 427 12765 1836 1175
NM_030627chr523076 2792 11251 --23400 907
NM_030647chr776073 5908 4451 1383 1182 299 102 16306 21713 592 --
NM_030650chr253945 3790 3414 3319 1659 22634 1322 1687 2312 220
NM_030664chr1052397 2226 2069 2053 904 22248 673 22162 838 --
NM_030816chr163647 3080 2883 1304 1152 185 --1509 11243
NM_030920chr121603 752 42102 1872 1666 42 12042 176
NM_031314chr1442034 1460 493 278 ----11812
NM_031362chr262776 2651 2056 1841 1071 408 11083 32407 1767 795 1731
NM_031365chr262912 2787 2192 1977 544 45 --32543 1903 931 1867
NM_031366chr262912 2787 2192 1977 544 45 --32543 1903 931 1867
NM_031371chr151465 1266 1231 1165 345 41581 1048 484 434 ----
NM_031371chr151465 1266 1231 1165 345 41581 1048 484 434 ----
NM_031411chr542258 2251 2183 1555 11792 --11933
NM_031418chr1122691 132 12631 42580 1990 1063 356 1112
NM_031419chr361365 1267 553 519 67 60 ----1591
NM_031431chr1341797 1764 1580 21 --11530 1314
NM_031461chr862113 877 826 724 315 85 165 11595 --
NM_031849chr542258 2251 2183 1555 11792 --11933
NM_031857chr542258 2251 2183 1555 11792 --11933
NM_031860chr542258 2251 2183 1555 11792 --11933
NM_032012chr995121 4716 3632 2101 1614 1189 828 519 409 ----14599
NM_032116chr13105868 5411 5005 4967 4404 3940 3737 2171 1980 388 13894 15612 --
NM_032186chr131145 482 412 1428 --11082
NM_032189chr1384759 3630 3483 3348 3106 3082 1861 31 11486 23560 3188 13207
NM_032208chr252762 2442 1114 591 458 23632 705 --12927
NM_032217chr461445 1351 1140 992 488 100 ----1389
NM_032228chr1153426 3307 2940 2829 979 21095 313 11244 270 54
NM_032246chr1511152 11027 11121 1984
NM_032295chr751268 1137 1066 962 79 ----11313
NM_032325chr1132012 1979 541 --22023 1987 12005
NM_032352chr1451259 1130 1088 243 76 --31409 1368 483 --
NM_032373chr10105797 5679 5004 4787 3783 2232 1506 844 829 675 55838 5828 1563 542 241 24276 1057 14799
NM_032410chr841217 426 228 214 1252 --1882
NM_032433chr1941522 1393 555 249 --11568 187
NM_032440chr1042441 2405 926 136 21013 30 3678 188 152 --
NM_032445chr1562590 2518 2408 1683 518 417 22611 2484 12401 11946
NM_032446chr573539 2903 2692 1107 1016 696 399 --13603 --
NM_032457chr4103883 3825 3083 3054 2758 2451 935 746 459 37 31326 336 182 11476 --
NM_032505chr352458 1985 509 494 480 21744 747 ----
NM_032521chr20113214 3161 3038 2693 2313 2080 2056 2049 1162 343 50 23247 2659 ----
NM_032632chr1452023 1934 496 487 379 --11460 11705
NM_032682chr373385 3234 3010 593 382 230 100 23145 2445 12541 --
NM_032810chr103394 387 258 --21093 405 --
NM_032859chr1373643 3450 3301 926 689 225 42 --41269 767 601 523 --
NM_032869chr881775 1517 803 699 418 411 335 96 --21740 381 21703 300
NM_032873chr1164217 4187 1784 1380 1007 921 24203 962 11071 --
NM_032968chrX114058 3933 3850 3768 3503 3029 2803 2796 662 627 238 --53938 1436 1419 279 40 31603 654 311
NM_032969chrX114058 3933 3850 3768 3503 3029 2803 2796 662 627 238 --53938 1436 1419 279 40 31603 654 311
NM_032973chrY114050 3925 3842 3760 3499 3024 2798 2791 662 627 238 --53930 1436 1419 279 40 31602 654 311
NM_033020chr133799 3616 839 34404 4145 3172 14008 13389
NM_033132chr1372288 2212 2203 2071 1575 247 161 ----12108
NM_033135chr1131757 489 281 ----1794
NM_033138chr752012 746 692 535 349 --2701 144 12326
NM_033139chr752012 746 692 535 349 --2701 144 12326
NM_033140chr752012 746 692 535 349 --2701 144 12326
NM_033157chr752012 746 692 535 349 --2701 144 12326
NM_033181chr6103858 3768 3413 3267 2808 1377 930 553 466 431 13757 1914 --
NM_033224chr778018 6739 5745 3110 2379 1874 1841 16573 --27370 2369
NM_033225chr873089 3046 2912 2517 2220 2185 736 33173 2405 2151 ----
NM_033285chr8154350 4244 4160 3828 3659 3228 3136 2843 2713 551 445 410 209 63 50 --169 13758
NM_033389chr1774398 4040 2968 1171 913 823 167 11325 54852 3680 2979 2961 1186 --
NM_033425chr1153486 2261 1238 1008 705 --11278 11122
NM_033427chr75338 323 315 309 156 --3612 343 331 --
NM_033430chr473660 3613 3592 1179 276 190 82 34131 4094 1603 23951 1104 --
NM_033437chr473660 3613 3592 1179 276 190 82 34131 4094 1603 23951 1104 --
NM_033495chrX4975 967 674 209 ----1369
NM_033505chr2106077 5996 5501 5164 4415 2342 2225 1942 1848 1731 --26055 229 16523
NM_033551chr543299 2549 1159 1005 --21052 145 13485
NM_033642chrX61234 1193 1123 913 494 199 1962 11172 --
NM_052851chr1372166 515 381 362 334 273 70 --32357 350 339 11564
NM_052864chr482161 2100 1994 1976 1637 1386 849 58 --1754 --
NM_052885chr1284843 4793 4671 4658 3784 3767 1756 859 --14611 44230 3913 1470 377
NM_052896chr152517 2320 2288 1605 961 --11667 12418
NM_052918chr10113681 3426 3138 3061 2597 1371 1252 1180 518 396 354 --13592 13459
NM_052932chr1132279 1712 1647 11837 1128 12316
NM_053016chr998013 7900 6050 5965 5478 5428 5399 2771 574 ------
NM_053053chr15973 747 202 100 93 --2983 938 --
NM_080546chr951545 211 109 87 64 22284 420 3123 117 95 --
NM_080759chr1342317 1041 846 279 22533 2522 21732 807 1226
NM_080760chr1342317 1041 846 279 22533 2522 21732 807 1226
NM_080867chr1464923 4515 3077 1394 959 244 14900 ----
NM_080921chr14839 435 259 185 2856 793 1456 --
NM_130391chr952908 1386 1275 577 378 22717 726 42835 2692 2319 931 12850
NM_130392chr952908 1386 1275 577 378 22717 726 42835 2692 2319 931 12850
NM_130393chr952908 1386 1275 577 378 22717 726 42835 2692 2319 931 12850
NM_130435chr1062890 2787 2585 2415 189 109 12717 12772 --
NM_130809chr553105 2539 1154 534 324 1775 2447 298 --
NM_130838chr1561614 1415 1358 1230 1170 459 1593 1291 --
NM_130839chr1561614 1415 1358 1230 1170 459 1593 1291 --
NM_130847chr1195849 5735 4719 3690 1938 1284 315 293 283 14591 15706 --
NM_133170chr2077983 7806 7123 5976 1129 975 346 16569 15771 12110
NM_133265chrX113563 3282 3173 2921 2712 2525 450 434 302 225 143 23119 379 33253 2820 1229 --
NM_133370chr463701 2600 2505 1359 1098 672 22480 754 ----
NM_133372chr582889 2632 2133 1109 575 567 265 146 12950 22906 2867 --
NM_133468chr752284 568 490 218 129 1263 1196 1923
NM_133493chr654633 3624 1577 1427 803 1139 1157 --
NM_133496chr184577 3465 3437 3396 1077 658 641 621 21031 56 11057 --
NM_133646chr245191 4206 1672 847 25410 75 13442 12241
NM_138270chrX73100 2681 2341 2321 1247 1011 733 3651 588 92 12706 11309
NM_138423chr1562262 1639 851 607 329 151 --31890 266 160 --
NM_138426chr772386 2337 2242 2199 1743 896 811 --21698 549 12182
NM_138444chr1374957 4122 3800 3591 3497 1977 399 14884 11822 --
NM_138459chr693573 3241 3105 2766 2590 2563 205 176 92 11361 1192 --
NM_138473chr1245012 3360 1324 1085 35141 1031 990 --13829
NM_138494chr772824 2803 2205 784 432 250 82 --22724 2712 --
NM_138554chr982590 2495 2437 2422 2414 2393 2193 2000 --11705 --
NM_138621chr254014 3542 3330 2865 2733 34139 3487 2700 12633 --
NM_138713chr1678245 8094 5851 5487 1719 1617 706 26948 1549 47256 6528 6125 564 16171
NM_138714chr1678245 8094 5851 5487 1719 1617 706 26948 1549 47256 6528 6125 564 16171
NM_138731chr1464213 3324 3181 3119 2727 685 --14079 1571
NM_138771chr751142 596 550 456 159 21039 278 ----
NM_144571chr496983 6398 6011 5447 5416 2318 154 144 49 36753 5094 2286 36946 5797 2630 --
NM_144578chr1474905 4645 3558 1482 1460 1100 698 24455 1080 3765 179 50 --
NM_144599chr15145363 4948 4450 4244 4084 3960 3586 3477 1980 1715 1133 962 707 422 14546 --2778 467
NM_144632chr261880 1806 1745 641 581 535 1747 --1703
NM_144664chr1152539 2423 770 729 616 12244 22513 786 --
NM_144710chr221386 436 1360 --1384
NM_144767chr1554490 2996 1346 624 420 1690 33645 2946 705 14511
NM_144778chr1331853 1759 65 22385 976 --32754 2299 2287
NM_144949chr232331 2141 1701 12435 32397 769 47 12075
NM_145055chr1833307 1262 1051 2935 373 1487 13657
NM_145259chr2107052 7033 6283 4484 2753 2317 1852 1493 1053 563 15033 26837 6630 --
NM_145263chr432252 1688 240 --11604 11611
NM_145307chr1064656 4414 4246 3888 1611 604 33588 1278 216 ----
NM_145693chr272512 2266 2232 2188 2042 1944 1003 --42376 1609 1603 406 --
NM_145735chr1342759 2623 2446 1810 --22835 2734 --
NM_145808chr783006 2849 2835 2771 2545 2295 2109 1190 --13091 --
NM_152261chr1262370 2281 2267 799 639 413 12208 22272 2215 1344
NM_152330chr1452521 1900 888 479 24 --22351 207 --
NM_152332chr1462783 2051 1869 1781 469 136 ----12064
NM_152352chr1843024 3000 595 585 ----12527
NM_152374chr171094 432 391 328 199 190 118 31706 519 24 3350 296 37 1166
NM_152388chr273722 3301 3157 951 649 545 63 --179 24048 2836
NM_152594chr1562275 2151 1733 1576 727 308 --11651 1493
NM_152622chr563495 3436 2398 2315 1166 31 32977 2956 664 22762 128 12383
NM_152624chr577442 5940 2261 1577 1108 852 303 --21062 580 36305 2896 2635
NM_152754chr763494 2465 1179 1143 587 64 1332 13834 1798
NM_152756chr554370 4297 1245 1188 116 54289 4214 4148 2972 1375 11634 --
NM_152774chr762750 2675 2645 2349 730 669 --32209 1056 756 --
NM_152787chrX73416 3312 3243 2728 2410 881 689 13886 22601 264 --
NM_152793chr793422 1974 1938 1781 1429 1352 738 429 344 --13539 13472
NM_152836chr83331 324 274 --11366 1124
NM_152837chr83331 324 274 --11366 1124
NM_152838chr2073230 2818 2628 2488 547 515 497 ----12927
NM_153188chr564849 4798 4496 4179 1622 1223 25192 1190 13700 --
NM_153207chr12114073 4033 3867 3745 3326 3175 2533 1291 1134 394 215 22864 2839 22933 1172 --
NM_153235chr641840 935 813 468 --42160 548 498 482 --
NM_153261chr1641254 1046 319 264 21481 132 11598 --
NM_153262chr163184 3056 2556 2418 2411 547 --22463 2457 12746
NM_153456chr1396214 6082 5943 4880 4596 4119 3900 1360 1276 16204 11043 --
NM_153607chr593031 3001 2832 2634 2550 2158 2146 992 448 2797 572 22639 745 --
NM_153634chr1271550 1540 1505 1361 354 291 126 --11131 --
NM_153689chr221882 933 1581 1917 22360 154
NM_170606chr751660 1630 1617 1558 533 21786 1725 ----
NM_170665chr12104382 4287 3922 3890 2841 1637 1164 756 672 398 1296 54195 1045 1018 266 211 14047
NM_170709chr832347 2038 139 --11590 2155 90
NM_170710chr4123184 3115 3099 2830 2815 2794 2781 2774 2440 2061 1985 440 2787 352 13189 12240
NM_172058chr861902 1846 1401 1309 1210 467 11819 2718 697 --
NM_172059chr861902 1846 1401 1309 1210 467 11819 2718 697 --
NM_172060chr861902 1846 1401 1309 1210 467 11819 2718 697 --
NM_172071chr167265 5783 2889 2748 1994 1801 32711 415 406 2547 137 --
NM_172159chr372269 1848 1587 856 334 245 164 1698 11770 11467
NM_172160chr372269 1848 1587 856 334 245 164 1698 11770 11467
NM_173214chr1678245 8094 5851 5487 1719 1617 706 26948 1549 47256 6528 6125 564 16171
NM_173468chr485481 5356 5296 5034 3853 2214 930 719 35739 4358 4280 35994 2204 897 --
NM_173475chr1621746 1376 --21333 1310 11443
NM_173531chr1983187 2519 2487 1487 1427 1190 934 605 1403 ----
NM_173582chr1186267 6036 5996 4697 2307 1794 624 353 ------
NM_173602chr1241356 610 284 213 --1562 13692
NM_173642chr1118270 8019 3623 3211 3162 3129 2019 1975 1341 927 347 32103 1858 1760 27235 379 16181
NM_173822chr252017 1586 1357 722 350 2511 59 12023 1280
NM_175623chr12167691 7673 7360 7332 7204 6264 6138 2419 1686 1591 1256 1187 630 336 288 214 11334 --17349
NM_175624chr12167786 7768 7455 7427 7299 6359 6233 2514 1781 1686 1351 1282 725 431 383 309 11429 --17444
NM_175625chr12167786 7768 7455 7427 7299 6359 6233 2514 1781 1686 1351 1282 725 431 383 309 11429 --17444
NM_175736chr1287857 7678 7565 6995 5246 838 808 406 17775 27790 6918 --
NM_175854chr1352779 2108 1826 346 285 22131 1890 1700 --
NM_175861chr1275625 5216 4342 4184 1861 962 633 21781 1277 45937 5861 4040 1801 --
NM_175863chr6--2494 203 11354 21027 1011
NM_175876chr162752 2712 2114 1799 1764 26 --12734 12028
NM_176824chr461060 883 546 375 319 85 ----11050
NM_176895chr53340 283 240 194 --1275
NM_177438chr1433717 1418 427 12765 1836 1175
NM_177452chr1461572 507 343 279 118 103 21531 476 12370 11682
NM_177937chr921632 92 1624 1107 1650
NM_177974chr1562262 1639 851 607 329 151 --31890 266 160 --
NM_177985chr262190 2183 2040 1928 1425 472 2809 34 ----
NM_177996chr2043418 1040 929 922 --1945 --
NM_178006chr1372166 515 381 362 334 273 70 --32357 350 339 11564
NM_178007chr1372166 515 381 362 334 273 70 --32357 350 339 11564
NM_178011chr1062050 1162 1069 998 308 205 22483 297 21204 354 --
NM_178140chr532698 1022 510 12097 1650 31028 644 164
NM_178151chrX147855 6914 6728 6632 6580 6316 6051 5912 5881 5685 2324 1699 1547 262 15614 22818 1783 --
NM_178152chrX147855 6914 6728 6632 6580 6316 6051 5912 5881 5685 2324 1699 1547 262 15614 22818 1783 --
NM_178153chrX147855 6914 6728 6632 6580 6316 6051 5912 5881 5685 2324 1699 1547 262 15614 22818 1783 --
NM_178584chr221386 436 1360 --1384
NM_178585chr453203 3174 3044 2675 1061 22878 2700 32990 2562 419 12807
NM_178586chr1472364 2295 2288 2172 1810 1498 627 22426 1793 12441 --
NM_180989chr1332431 2077 467 12253 --11952
NM_181265chr4123184 3115 3099 2830 2815 2794 2781 2774 2440 2061 1985 440 2787 352 13189 12240
NM_181332chrX62202 2061 1017 747 560 546 1571 22348 631 12728
NM_181358chr164068 3928 3172 1456 1361 1079 12753 23856 1268 --
NM_181443chr2052754 2235 2226 1089 269 42896 2024 915 439 1159 --
NM_181481chr1866678 6620 5895 5123 4995 321 --15071 16714
NM_181482chr1866678 6620 5895 5123 4995 321 --15071 16714
NM_181483chr1866678 6620 5895 5123 4995 321 --15071 16714
NM_181504chr5103910 3861 3843 3795 3483 1294 1030 853 582 464 --73887 3873 3041 3035 3027 960 713 --
NM_181521chr1677054 6006 5794 5693 4582 2717 2690 11490 25885 2383 --
NM_181523chr5103910 3861 3843 3795 3483 1294 1030 853 582 464 --73887 3873 3041 3035 3027 960 713 --
NM_181524chr5103910 3861 3843 3795 3483 1294 1030 853 582 464 --73887 3873 3041 3035 3027 960 713 --
NM_181527chr201278 ----2422 407
NM_181528chr201333 ----2477 462
NM_181705chr585708 5648 5211 4721 3618 1158 1051 526 --14736 15233
NM_181714chr621449 328 ----21904 1563
NM_181723chr862104 2091 1837 899 575 307 1625 1689 --
NM_181782chr611963 1766 4743 737 580 390 11764
NM_181783chr1271990 1827 1779 596 581 356 183 --2651 175 --
NM_182485chr473400 2559 2446 2403 2301 755 473 42965 2474 1033 927 11064 12942
NM_182515chr1996090 5990 5804 4353 4338 2318 1499 323 186 16351 16505 --
NM_182551chr273133 3059 2644 2181 1431 930 205 ----13485
NM_182641chr1742040 1667 1617 1320 --3829 583 575 --
NM_182646chr473400 2559 2446 2403 2301 755 473 42965 2474 1033 927 11064 12942
NM_182648chr142250 215 2753 76 --1737
NM_182762chr7115864 5740 4888 4417 4396 4335 2275 1231 1176 1122 267 --34506 4478 2334 --
NM_182763chr162198 2157 1891 846 687 671 1461 12641 --
NM_182765chr1051871 1864 775 648 362 32317 793 683 --31990 1759 921
NM_182767chr1282142 1999 1873 1855 1302 646 552 190 12081 12100 --
NM_182898chr796555 5098 4848 4240 3996 3983 1056 845 283 16564 ----
NM_182899chr796555 5098 4848 4240 3996 3983 1056 845 283 16564 ----
NM_182907chr672071 723 670 649 454 220 78 1503 21543 1506 12406
NM_182931chr75600 174 91 62 50 1106 1502 --
NM_182972chr142544 2418 187 60 31946 807 126 ----
NM_183004chr1493779 3134 3002 2781 2597 2408 765 710 77 --33530 678 547 183
NM_194291chr892510 2454 1918 669 336 292 205 124 40 ------
NM_194314chr185616 5610 5378 5203 5118 4492 2048 1366 --25137 2053 --
NM_194317chr282740 2663 2650 2453 2270 2245 1825 604 --1373 --
NM_194328chr993337 3228 3164 2477 2171 593 516 326 248 1456 23345 50 1557
NM_194329chr993337 3228 3164 2477 2171 593 516 326 248 1456 23345 50 1557
NM_194330chr993337 3228 3164 2477 2171 593 516 326 248 1456 23345 50 1557
NM_194332chr993337 3228 3164 2477 2171 593 516 326 248 1456 23345 50 1557
NM_194434chr18115699 5431 4744 4707 3836 3542 2245 1442 883 204 116 11583 15685 14204
NM_197968chr135761 744 611 287 119 --1735 1296
NM_198158chr393029 3007 2046 1050 928 556 470 229 177 1218 ----
NM_198159chr393029 3007 2046 1050 928 556 470 229 177 1218 ----
NM_198177chr393029 3007 2046 1050 928 556 470 229 177 1218 ----
NM_198178chr393029 3007 2046 1050 928 556 470 229 177 1218 ----
NM_198212chr73743 583 523 ----12297
NM_198240chr1261265 1249 1207 440 389 77 ----21227 1056
NM_198268chr164068 3928 3172 1456 1361 1079 12753 23856 1268 --
NM_198269chr164068 3928 3172 1456 1361 1079 12753 23856 1268 --
NM_198273chr583027 2421 2412 1218 713 606 502 266 23053 2304 22976 39 --
NM_198281chr473175 2429 2132 2111 1116 871 326 2338 30 ----
NM_198391chr2071514 1339 1317 1293 1089 124 118 ------
NM_198400chr1572885 2196 2188 1791 942 887 339 22076 925 ----
NM_198465chrX32931 2895 779 1215 22700 43 2705 174
NM_198581chr277530 6916 6371 6356 2808 755 609 --26361 373 --
NM_198715chr196277 6240 5837 5449 4361 4021 3903 1079 160 24899 1966 55539 2477 2431 2334 26 26312 491
NM_198793chr344060 3850 3185 892 1756 11276 13715
NM_198889chr461445 1351 1140 992 488 100 ----1389
NM_198900chr1287857 7678 7565 6995 5246 838 808 406 17775 27790 6918 --
NM_198968chr1383757 3333 2804 1510 1370 916 881 394 --13444 --
NM_198990chr793233 3102 2909 2831 2651 2644 2121 649 377 ----12364
NM_199320chr472950 2713 2693 2537 2499 1877 1151 22643 2138 ----
NM_199320chr472950 2713 2693 2537 2499 1877 1151 22643 2138 ----
NM_199324chr463758 3456 2366 1302 1038 643 --1458 13701
NM_199327chr441100 961 427 307 ----1973
NM_199421chr1464923 4515 3077 1394 959 244 14900 ----
NM_199436chr253119 2376 783 314 128 22948 1176 11154 --
NM_199454chr184734 4656 4391 4253 4115 2955 1589 1412 1677 ----
NM_199462chr175026 4996 4913 3086 3075 1015 321 25033 1849 11021 11283
NM_199482chr282113 1375 528 177 82 54 48 23 --21488 1441 --
NM_201269chr131145 482 412 1428 --11082
NM_201570chr1061716 767 556 550 537 331 21807 49 11605 11293
NM_201571chr1061716 767 556 550 537 331 21807 49 11605 11293
NM_201572chr1061716 767 556 550 537 331 21807 49 11605 11293
NM_201590chr1061716 767 556 550 537 331 21807 49 11605 11293
NM_201593chr1061716 767 556 550 537 331 21807 49 11605 11293
NM_201596chr1061716 767 556 550 537 331 21807 49 11605 11293
NM_201597chr1061716 767 556 550 537 331 21807 49 11605 11293
NM_203282chr1951740 1623 1616 1472 529 ----1313
NM_203406chr562851 2525 2360 1816 947 533 1548 1983 --
NM_203446chr2172994 2797 2569 2180 1019 969 949 --12227 1894
NM_203451chr1351560 1509 662 640 494 22355 200 11873 11743
NM_203459chr121671 1658 --22495 383 1986
NM_203504chr461802 1786 940 837 615 475 1394 --11012
NM_203505chr461802 1786 940 837 615 475 1394 --11012
NM_206594chr163567 3550 3508 3492 2690 2255 ----13347
NM_206595chr163567 3550 3508 3492 2690 2255 ----13347
NM_206853chr663900 1633 1251 1051 232 207 23070 1318 13777 --
NM_206854chr695161 3568 3307 1493 1468 718 372 324 129 34331 398 77 15038 --
NM_206855chr6146126 4533 4272 4096 3859 2458 2433 1683 1337 1289 1094 559 545 221 35296 1363 1042 16003 --
NM_206866chr2153240 2560 2381 1994 1041 ----12031
NM_206876chr2102913 2428 1212 1138 1051 755 720 259 169 67 12647 13451 --
NM_206907chr572786 2780 2308 1097 952 286 206 12149 53308 1355 1301 1234 215 12759
NM_206909chr8148135 6737 6632 6308 5235 5070 2173 1922 1670 802 319 266 156 136 16268 58384 8209 7606 2155 548 28404 2933
NM_207015chr382285 2133 1815 1784 1746 1688 749 279 --12371 --
NM_207043chr162020 1971 1940 1853 1711 819 1752 11688 --
NM_207044chr162020 1971 1940 1853 1711 819 1752 11688 --
NM_207047chr162020 1971 1940 1853 1711 819 1752 11688 --
NM_207113chr751417 1286 1215 1111 228 ----11462
NM_207292chr393299 3237 2459 680 611 587 381 213 88 32485 2380 965 11344 --
NM_207293chr393299 3237 2459 680 611 587 381 213 88 32485 2380 965 11344 --
NM_207294chr393299 3237 2459 680 611 587 381 213 88 32485 2380 965 11344 --
NM_207295chr393299 3237 2459 680 611 587 381 213 88 32485 2380 965 11344 --
NM_207296chr393299 3237 2459 680 611 587 381 213 88 32485 2380 965 11344 --
NM_207297chr393324 3262 2484 705 636 612 406 238 113 32510 2405 990 11369 --
NM_207303chr1094091 4005 1517 1431 1366 968 514 378 23 1621 24081 269 11335
NM_207304chr1321740 1646 22272 863 --32641 2186 2174
NM_207506chr85890 396 378 220 131 1197 21366 203 --
NM_207517chr1571928 1780 1741 1394 1313 207 88 ------
NM_213589chr2205333 5315 5208 3975 3692 3481 3432 2204 1362 1163 1140 970 760 677 458 211 198 179 168 143 25353 3939 34979 187 156 --
NM_213654chr331028 487 344 21563 400 --1649