TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-496
miRNA Sequence: UGAGUAUUACAUGGCCAAUCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000092chr2144549 4415 4391 4189 4091 3375 1837 1794 1773 1225 818 506 223 175 --14303 23385 780
NM_000093chr91587 --12466 --
NM_000108chr741446 1182 683 77 --1157 1706
NM_000109chrX32651 2342 705 ----1130
NM_000115chr1372602 2060 1899 1692 856 475 123 22168 285 1724 1944
NM_000125chr674249 4061 4042 3851 3658 3373 1029 --23359 3327 13440
NM_000138chr1522615 390 12126 22312 508 --
NM_000141chr101526 1403 1578 --
NM_000163chr55287 265 217 196 179 --11882 --
NM_000176chr553583 3188 2897 1496 352 12623 23563 2413 --
NM_000176chr553583 3188 2897 1496 352 12623 23563 2413 --
NM_000214chr2051784 1497 1412 1176 72 --11252 --
NM_000216chrX94053 3929 3454 2739 1443 1184 960 735 251 --23764 565 11209
NM_000217chr1265368 1476 1037 616 339 101 --24916 125 --
NM_000222chr482013 1955 1858 1739 1669 1389 563 205 --11986 --
NM_000248chr352833 2445 1109 790 180 ------
NM_000259chr15156361 6309 6119 6002 5565 5556 5457 5447 5423 5112 1838 1780 1420 814 102 11623 34454 1512 153 25200 1367
NM_000264chr973003 1030 446 400 366 178 166 23354 2825 13022 12539
NM_000267chr17103373 3341 3245 2555 2475 2184 635 325 181 96 13044 12664 --
NM_000274chr102464 458 1217 1603 --
NM_000276chrX2643 24 --1180 --
NM_000280chr11135 ------
NM_000314chr10103149 3112 2921 2711 2575 2421 2148 1272 1086 1076 ----1520
NM_000332chr6187188 6978 6955 6924 6900 6481 5466 5442 5224 4839 4470 2436 2130 1564 1372 1178 1130 1004 --22785 2061 11477
NM_000338chr1571082 1016 780 767 736 413 66 1281 ----
NM_000346chr1721824 444 --2519 429 --
NM_000369chr1451693 1451 1312 389 312 ----11533
NM_000393chr292148 2079 1912 1640 1346 1308 763 212 169 1635 21406 1357 --
NM_000397chrX92349 2053 874 646 589 423 385 371 59 1711 12444 2674 50
NM_000399chr102976 815 --11201 --
NM_000408chr293315 3052 2859 2686 2566 2521 1315 1139 337 --32625 1152 562 --
NM_000428chr1452691 2491 2359 1774 221 --22504 1647 1760
NM_000437chr132218 604 575 1586 11417 --
NM_000439chr572416 2324 2140 2070 1910 1814 1603 --1613 32186 929 33
NM_000460chr32504 453 ----1211
NM_000461chr384397 4042 3699 1723 1491 1002 684 555 11255 2952 216 14154
NM_000489chrX93407 3032 2761 2454 2146 2114 1031 850 602 1378 2593 442 --
NM_000493chr61246 ------
NM_000596chr75573 406 124 60 36 --1559 --
NM_000615chr1142980 2973 2497 472 --23018 419 --
NM_000627chr24598 354 72 33 ------
NM_000676chr171409 --1354 --
NM_000684chr1031276 1113 1003 ------
NM_000719chr1276652 6232 4900 1611 1577 1523 385 ----34134 2494 1419
NM_000726chr221262 965 11166 --124
NM_000756chr8------1478
NM_000780chr851230 1136 1123 1108 1048 --11242 --
NM_000806chr581708 1600 1464 770 691 609 389 371 --21543 358 --
NM_000809chr4248960 8871 8120 7938 7774 7753 7372 7262 7037 6958 6493 5656 3642 3600 3438 2925 1938 1838 1752 1317 1215 901 789 604 49206 7216 6289 894 88693 8609 8370 3462 3407 3244 3169 82 --
NM_000814chr1573879 3333 3294 2615 1516 354 51 13097 21641 737 --
NM_000826chr4112550 1999 1874 1791 1624 822 754 708 557 394 60 ----12211
NM_000844chr33989 835 787 --11112 --
NM_000859chr521396 246 --31717 1084 512 --
NM_000860chr461325 1244 440 405 349 314 152 1271 1265
NM_000866chr341663 684 630 230 --11341 --
NM_000875chr1577052 6951 6914 4520 2705 1664 1418 11241 ----
NM_000899chr12124392 4074 4010 3674 2997 2916 2819 918 873 690 359 95 21141 626 14062 24033 3546
NM_000901chr422344 861 --1440 --
NM_000933chr2021421 1100 ------
NM_000945chr252097 1850 1838 390 329 1633 180 --
NM_000961chr2043317 3164 2519 292 --43182 3092 2778 2730 --
NM_001001395chr1262507 1854 1733 1716 536 309 --12212 11118
NM_001001433chr2021226 229 --21041 695 --
NM_001001436chr164900 787 607 279 1665 ----
NM_001001481chr853113 2541 2216 2160 1356 12678 11024 12946
NM_001001483chr114402 333 308 298 ------
NM_001001521chr21230 ------
NM_001001664chr2134098 3726 3504 3467 3446 3213 3067 2759 2607 1262 1134 341 325 23437 1034 1248 13530
NM_001001701chr451433 1422 932 812 740 --21890 775 --
NM_001001890chr2184015 3640 3623 3549 1664 850 349 332 --13140 --
NM_001001924chr822113 1593 11634 11693 12123
NM_001001995chrX81836 1781 1715 1429 720 610 253 193 11299 11857 --
NM_001002800chr33897 442 91 --1160 --
NM_001002838chrX51333 398 277 265 247 ----11600
NM_001002843chr1561296 1179 1156 829 526 324 --11265 --
NM_001002860chr1484472 4397 4070 4062 3933 3716 1367 382 13658 1513 --
NM_001002909chr1742098 1394 887 830 11811 --11933
NM_001003407chr1025094 1717 15113 ----
NM_001003652chr18238511 8481 8020 7737 7253 6981 6227 6097 6089 5984 5619 5553 3004 2929 2268 2097 1751 1670 1401 1393 1069 813 172 38193 7705 2432 36827 1639 202 --
NM_001003674chr18137050 6718 6681 6603 6280 5209 5056 4911 4510 4367 1562 1125 605 11035 36978 5319 1578 25388 1598
NM_001003688chr451165 1149 1037 828 459 --1107 --
NM_001003712chr12123278 2928 2802 2700 2662 1609 1253 1246 1219 652 376 300 1680 23614 97 12776
NM_001004065chr983878 3859 3719 2842 2816 1576 1476 1144 13223 --1742
NM_001004317chr6114452 4008 3512 3503 3347 1616 1519 1286 1088 510 208 ------
NM_001004360chr261900 1707 1492 747 71 34 ----1485
NM_001004419chr1243114 1142 260 236 23414 187 ----
NM_001005377chr191230 1288 --1268
NM_001005386chr262408 1630 907 665 311 35 --22477 2283 --
NM_001005463chr1062616 975 932 688 460 125 2421 415 21767 711 --
NM_001005473chr5216521 6228 6102 5557 5321 5221 5165 4425 4259 2595 2484 2172 2136 1868 1568 1130 861 768 579 188 170 --35743 4316 493 11850
NM_001005739chr23600 349 333 --2733 324 1692
NM_001005781chr22561 395 ----1531
NM_001005845chr821386 1373 --21678 437 --
NM_001006636chr23895 881 803 --1849 --
NM_001006639chrX196 --1539 --
NM_001007102chr6----21192 387 11113
NM_001007245chr71147 --1181 --
NM_001007553chr11373 ----1108
NM_001007559chr1832006 741 414 --2354 194 --
NM_001008393chr462110 1166 697 275 192 46 1116 1211 --
NM_001008405chr771858 1713 697 690 619 387 302 --11809 1718
NM_001008529chr1721292 905 --132 --
NM_001008539chr8105154 4304 4066 3892 3475 3374 1299 925 821 439 34621 2061 132 13488 14520
NM_001008541chr1041763 1477 575 129 ----4221 212 170 38
NM_001008564chr1322108 1970 --11424 --
NM_001008738chr5132759 2660 2065 973 900 894 820 814 768 677 669 292 149 1830 ----
NM_001008783chr61695 1884 1743 --
NM_001008938chr112345 164 ------
NM_001009554chr4124373 4364 4114 4058 3968 3941 3706 3201 1551 971 482 324 13186 34433 3208 1807 11365
NM_001009555chr411408 1452 1395 --
NM_001009569chr1021436 464 --1415 --
NM_001009894chr1261591 1395 675 587 496 32 --147 --
NM_001009899chr3166205 5066 4832 4674 4561 4430 4308 2460 2238 1777 1729 989 925 745 265 164 24948 1993 26423 1959 --
NM_001010853chr653197 3126 3014 2828 910 21035 403 --22840 886
NM_001010888chrX124612 4542 4370 4049 1690 1492 1162 866 837 734 46 40 24256 3319 13794 --
NM_001010895chr971919 1784 1583 560 509 387 29 1593 1373 --
NM_001010986chrX52405 1908 1592 344 50 --2542 446 1211
NM_001011513chr4103746 3687 3474 3298 3055 2950 2831 916 160 83 14129 --1443
NM_001011537chr331959 1613 1528 1667 --199
NM_001011666chr796188 5707 5429 5391 4952 2289 2080 1836 521 25032 163 36401 5564 4816 --
NM_001011708chr272845 2731 2070 2032 901 278 154 --22678 382 --
NM_001011713chr1451428 1045 486 464 146 --11620 --
NM_001012418chr633741 3363 704 ----13287
NM_001012755chrX75112 4726 4329 4154 3862 3760 1020 --24408 3515 --
NM_001013031chr1033242 2902 914 --2333 169 --
NM_001013620chr12258510 8256 8197 7925 7572 7209 6881 6564 6410 6237 6061 5635 5628 5122 3318 3242 2677 2578 2466 1506 1417 1380 1185 486 464 11298 67828 5431 5334 3329 2762 2707 12475
NM_001014764chr17----1161 --
NM_001014797chr1087292 7039 6888 6073 5900 1445 1213 293 46479 5991 2158 2017 27493 1760 --
NM_001015877chrX82745 2612 2395 2276 2217 1907 1215 961 2448 359 ----
NM_001015880chr1031417 1170 374 11522 1223 --
NM_001017371chr24959 550 162 58 ------
NM_001017395chr363245 3124 3057 2594 1006 777 12984 12776 2794 685
NM_001017424chr131779 1224 54 11517 --11759
NM_001017923chr1461582 1498 1331 359 78 44 --31107 1091 322 --
NM_001017930chrX2556 393 31367 1255 1135 --11529
NM_001017998chr92817 238 1154 ----
NM_001018056chr91401 --1177 --
NM_001018067chr1115098 4321 4212 1537 1482 916 744 634 546 514 416 22154 452 1273 --
NM_001024649chr542832 2555 807 751 12668 52675 2579 2220 1098 176 --
NM_001024847chr372402 2394 2301 2220 2134 1874 1813 22368 2155 1399 12502
NM_001024855chr391910 1893 1184 545 439 347 234 77 42 --11729 11200
NM_001024934chr64524 485 155 22 --1626 --
NM_001024956chr11105839 5703 5375 4983 4776 3994 2306 2263 505 416 25369 4034 24765 3676 14756
NM_001025072chr322081 459 ------
NM_001025076chr1096041 5955 5514 3930 1918 1829 1192 657 634 14624 36077 3950 1906 26241 5425
NM_001025077chr1097399 7313 6872 5288 4642 2550 2015 1992 627 15982 37435 5308 752 37599 6783 5103
NM_001025105chr531518 1136 211 --11254 1429
NM_001025233chr1252254 2059 1983 698 65 1519 1581 --
NM_001025356chr1232787 1983 511 --32994 2952 612 12599
NM_001025580chrX114198 3889 3459 2884 2693 1599 1272 1235 1218 840 267 --22926 936 --
NM_001025616chr471937 1478 1440 1283 755 413 189 11837 1504 --
NM_001025780chr971586 558 391 339 308 287 254 ----1430
NM_001029863chr632935 2355 1154 --2928 785 12579
NM_001029875chr582890 2042 1051 905 801 630 490 343 12365 11857 --
NM_001030007chr1643821 3171 3127 3011 1869 12521 11333
NM_001030055chr14144765 4656 4442 4195 3893 3821 3537 3499 3159 1599 1471 1110 370 81 14094 21056 871 --
NM_001030287chr121201 1156 11120 1858 --
NM_001031679chr1233443 1308 1179 12322 ----
NM_001031695chr2284755 3941 3802 3652 2107 1023 476 65 --1149 --
NM_001031700chr462158 2088 970 546 399 210 1174 22340 1767 --
NM_001031748chr122485 167 1140 ----
NM_001031804chr1653776 3713 3376 1081 90 --11457 12979
NM_001032283chr12------1372
NM_001032296chr1352119 1091 1026 986 277 22560 2164 1538 --
NM_001032380chr1041530 620 386 347 --1688 --
NM_001032394chr682191 2170 793 709 618 458 342 94 --12716 32858 2021 69
NM_001032394chr682191 2170 793 709 618 458 342 94 --12716 32858 2021 69
NM_001033047chr442571 2316 1912 693 --11646 --
NM_001033057chr362101 1947 1396 660 248 223 --11879 --
NM_001033059chr651766 1736 1509 475 332 --2771 200 11375
NM_001033551chr1753318 2809 2792 1311 1123 23343 2725 14099 --
NM_001033566chr173240 117 59 1263 139 --
NM_001033925chr1082154 2061 1586 755 534 432 315 96 1493 --1799
NM_001034841chr1645180 3600 559 261 32061 2039 920 133 --
NM_001034850chr54648 527 388 260 --2576 328 --
NM_001035003chr43480 449 233 ----1245
NM_001035260chr1041557 1297 585 508 ----11596
NM_001037131chr2----11254 --
NM_001037132chr742001 553 369 198 11895 31878 319 24 11449
NM_001037164chr711798 1637 11548 --
NM_001037631chr221152 1120 ------
NM_001038628chr341830 732 500 38 --11499 11365
NM_001039348chr221020 48 1926 11093 --
NM_001039538chr273511 3265 839 833 826 813 33 182 11401 --
NM_001039574chr12810 245 1231 ----
NM_001039590chrX31404 771 81 ----13393
NM_001039618chr11145876 5624 4905 4876 4681 4385 4066 3931 3917 3910 2306 2143 322 121 --55446 4869 4833 2239 1966 --
NM_001039840chrX145448 5063 4968 4395 3972 3694 3684 1750 1448 1074 813 563 537 379 24879 336 35144 5010 122 --
NM_001039937chr13173851 3768 3475 3444 3372 3284 3265 2840 2826 1541 1502 1348 933 792 737 480 116 --31597 518 242 --
NM_001040020chr751430 1354 1336 380 82 --21592 1496 --
NM_001040057chr72460 405 --1283 --
NM_001040100chr361117 1067 907 507 243 132 --1872 --
NM_001040135chr72815 629 --1780 --
NM_001040142chr252408 2153 1860 1739 1551 1126 12064 --
NM_001040153chr137951 926 847 304 189 176 93 --2806 273 --
NM_001040157chr4112843 2778 2752 2717 2266 2052 1824 1121 673 168 94 ----1466
NM_001040214chr652239 2039 1904 1864 556 --12409 12279
NM_001040284chr16155130 5052 4296 3860 3635 2203 2187 2050 1715 1655 1612 1504 1466 1194 470 31171 83 49 53758 2090 1824 1286 560 --
NM_001040409chr22756 77 1363 --1642
NM_001040441chr184624 4254 4194 3344 1577 1439 1176 305 13894 31145 813 345 --
NM_001040450chr1582679 2622 2481 2328 1958 395 245 219 22426 2239 --1678
NM_001040665chr7134979 4906 3666 3652 3595 3478 3408 3216 3075 1507 1264 1110 948 14796 14246 2976 294
NM_001040876chr451924 1627 1426 322 101 2308 126 1223 31942 1862 1776
NM_001042355chr1685056 4971 4961 2066 1415 1365 1266 766 --24301 957 1582
NM_001042404chr171823 1768 1673 1383 1300 718 51 --1499 1469
NM_001042406chr64865 848 421 325 ----31251 338 55
NM_001042459chr31221 --1310 --
NM_001042481chr1442031 856 284 127 1728 21866 880 1414
NM_001042494chr1573699 3191 2901 977 642 626 550 13095 1205 1228
NM_001042506chrX11431 --11457 --
NM_001042533chr343029 2327 2164 1019 --21258 494 21323 623
NM_001042537chrX42335 1971 178 114 --21872 849 --
NM_001042555chr12174677 4598 4480 4067 4023 3994 3755 3486 3271 3186 2968 1553 1348 1342 1259 170 124 24766 4667 2407 291 --
NM_001042599chr2247569 7184 6173 5950 5713 5300 5185 4991 4900 2885 2648 2573 2350 2268 2237 1803 1786 1606 1567 1338 989 833 766 285 27017 1069 15377 --
NM_001042601chr3103233 3026 2878 1282 859 844 781 771 703 326 --22467 2064 11032
NM_001042604chr361937 1926 1358 1239 813 648 --14866 23681 1466
NM_001042749chrX81735 1610 1328 753 632 531 495 233 11927 ----
NM_001044385chr263303 2815 1361 515 136 118 --23579 2512 --
NM_001099678chr376442 6230 6037 5743 5659 2054 1318 --36450 5535 781 22019 30
NM_001106chr3129174 8695 8652 7406 7084 3091 2617 2481 1282 1221 406 174 16209 11004 17698
NM_001116chr1622115 54 --23111 2547 --
NM_001123chr103735 155 117 ----1616
NM_001146chr862366 2140 2044 922 892 96 1575 21801 1500 --
NM_001148chr422081 1843 31616 1564 1552 1395 1569
NM_001177chr12102136 1761 1614 810 585 533 357 298 248 131 --1215 --
NM_001201chr4123896 3333 3305 3276 3243 3055 2517 1302 1042 1000 874 26 11375 43787 3649 3067 2712 --
NM_001204chr2227660 6763 6404 5947 5728 5594 2950 2765 2701 2610 2359 2337 2163 2151 1817 1757 1742 1631 880 614 573 294 26885 5431 37373 5290 3015 25822 2594
NM_001206chr963004 2744 2725 2402 2122 267 --2137 54 12944
NM_001219chr742256 2196 1841 451 ----1843
NM_001233chr772238 1820 1684 575 333 168 34 --2413 43 --
NM_001241chr2132390 2367 2357 2209 1962 1924 1706 1687 917 497 431 305 217 ----1620
NM_001259chr7115780 5198 5032 4914 4464 4059 3859 2126 2117 741 313 15747 24298 4223 --
NM_001278chr1031190 1181 240 --1958 --
NM_001304chr1773613 3366 2686 1021 1014 861 460 13567 1185 12697
NM_001315chr682098 2042 2030 1803 1577 904 240 74 --22161 2007 --
NM_001343chr531575 1203 164 21680 1417 --11350
NM_001356chrX72454 2316 1818 1795 1769 1568 524 ----1366
NM_001364chr1144797 4781 790 773 14664 24527 3433 14592
NM_001390chr1863495 2266 796 765 462 456 22228 823 1912 13471
NM_001392chr18----246 35 --
NM_001396chr2132408 921 524 --12087 1311
NM_001401chr941286 1143 1015 601 ------
NM_001419chr1954563 1016 813 707 144 14811 ----
NM_001427chr732002 194 109 21529 648 1137 --
NM_001431chr621226 483 --1237 --
NM_001432chr4113465 3173 3050 2680 2500 1387 859 249 194 77 51 12944 158 13071
NM_001438chr173668 2780 2416 2250 1388 944 925 ----12971
NM_001451chr1611045 --1425 --
NM_001452chr62700 680 1630 ----
NM_001482chr15--1793 1631 --
NM_001494chr10174 --1135 --
NM_001498chr621255 1182 --2963 330 --
NM_001518chr72241 84 1297 --11042
NM_001554chr12656 574 1609 1213 --
NM_001609chr10103140 3094 1102 1052 877 734 702 665 642 115 23538 1270 24486 4174 11034
NM_001616chr2123486 3327 3147 3125 2653 2619 2455 2158 1403 1193 1162 923 23265 882 ----
NM_001627chr341952 1834 1667 677 --21641 1510 --
NM_001650chr1874059 3160 2910 391 364 213 147 13982 13578 1670
NM_001656chr592007 1944 1786 1538 1448 830 812 558 152 --21516 589 --
NM_001660chr31119 ----1631
NM_001677chr13357 343 188 ----1440
NM_001688chr11577 ------
NM_001690chr35927 766 590 493 354 22280 2272 ----
NM_001695chr883841 3807 3652 3420 2817 2603 1559 1135 11028 --24297 3488
NM_001701chr921023 409 ------
NM_001709chr1162749 2313 2278 929 643 439 ----1747
NM_001717chr1521101 1079 125 11469 --
NM_001742chr761767 1672 1506 372 354 329 1653 ----
NM_001781chr123901 825 729 --3888 880 798 --
NM_001786chr10----1159 --
NM_001792chr1831173 333 54 ----1881
NM_001796chr16----147 --
NM_001797chr163259 205 171 ------
NM_001821chr1154895 4725 4571 4383 4306 4108 4069 3998 3616 3239 3075 863 378 114 22 24541 960 43938 3669 1230 765 1613
NM_001873chr42601 124 --1283 192
NM_001880chr21221 135 ----
NM_001895chr201252 --11196 --
NM_001904chr32719 144 --150 1261
NM_001938chr161837 1745 1545 1521 538 73 1525 ----
NM_001946chr122824 160 --1981 --
NM_001949chr652460 2434 2282 647 540 --12745 --
NM_001967chr3188 1621 --1109
NM_001977chr491527 1520 1383 425 410 239 194 183 110 1205 ----
NM_001987chr1254018 3540 3173 1527 569 --32823 1051 480 --
NM_002006chr4165597 5057 4928 4900 4644 4485 4391 4091 2078 1942 1740 1242 1047 1040 1002 194 13862 11563 1766
NM_002009chr1572370 2191 2168 1816 728 646 495 --22147 352 --
NM_002015chr1383191 2492 2151 1011 923 428 415 32 11021 13362 --
NM_002024chrX82145 1623 1489 660 577 421 284 270 --11681 --
NM_002025chrX208954 8684 8118 7593 7499 7397 7169 7046 6848 6531 6327 3533 3386 3134 2659 1889 1815 840 585 288 48912 7940 6774 6519 17686 16576
NM_002026chr22932 407 --1753 --
NM_002040chr21123174 2977 2969 2963 2803 2618 2319 1966 948 903 145 137 42832 2768 2459 1103 11042 --
NM_002054chr21188 ----1436
NM_002061chr151625 1534 619 436 108 11614 1249 1155
NM_002072chr92155 97 ------
NM_002077chr9--11884 21968 524 --
NM_002094chr16129 ----1432
NM_002136chr12------1143
NM_002137chr782416 2360 2288 1881 1639 1590 767 617 11781 22240 2223 --
NM_002158chr293572 3394 3330 3149 3014 2409 949 430 99 --23116 25 13740
NM_002199chr43805 723 155 --1757 --
NM_002211chr103907 759 82 ----11171
NM_002214chr7225529 5514 5403 5353 5158 5144 4990 4923 4514 4354 4144 3866 3479 2275 2223 2123 2089 2082 777 627 437 348 --14832 11632
NM_002239chr251133 826 340 300 54 ----1780
NM_002241chr1169 21036 300 1908 12777
NM_002245chr11558 --1276 --
NM_002264chr3115023 4003 3754 1349 1246 1047 696 661 469 460 111 11695 13851 1834
NM_002267chr134783 689 470 343 --2977 309 --
NM_002270chr5125592 5186 5066 4538 4460 3739 2252 1951 1865 1080 812 327 --34266 3913 3794 13765
NM_002336chr1294613 4022 3993 3822 1937 1406 844 518 144 --13401 1958
NM_002351chrX2632 355 --21259 269 --
NM_002356chr641919 1091 997 316 --22822 1908 --
NM_002397chr551386 801 188 143 126 --11835 1505
NM_002399chr1541456 1349 1222 1169 --11388 --
NM_002408chr141812 ----1698
NM_002439chr53935 866 124 --1947 --
NM_002449chr521069 865 --2972 88 --
NM_002468chr321572 1345 --11725 --
NM_002480chr1231389 1160 604 --1368 11062
NM_002481chr1136628 6393 5811 5221 5163 3102 2896 2755 2633 2614 2520 2495 1309 11900 2963 262 27941 1806
NM_002500chr2--11036 1111 --
NM_002515chr1481958 1854 1578 1420 635 541 472 217 ------
NM_002522chr1711177 --13058 13640
NM_002526chr631481 1455 487 --11463 21312 570
NM_002547chrX113976 3809 3419 3340 3235 3063 2986 1692 1557 1386 861 34288 3090 2765 11130 --
NM_002553chr7----1153 --
NM_002577chr353416 2913 1087 577 24 11161 1355 13449
NM_002581chr965661 5637 5001 4549 4316 1654 14990 11440 15514
NM_002583chr123510 65 31 --3598 153 77 --
NM_002591chr202599 543 ------
NM_002594chr2032502 2300 2263 11964 --11982
NM_002601chr2----1507 --
NM_002605chr1521019 91 --1987 --
NM_002610chr253016 2674 2425 887 88 --42654 2441 2281 330 --
NM_002612chr742126 2030 1882 506 --11832 12039
NM_002613chr1635050 3561 3309 --25342 4968 13272
NM_002645chr11123151 3077 2873 2560 2388 2267 917 548 299 244 146 117 23102 2569 13039 --
NM_002655chr8135241 5213 5147 4994 4426 3751 3572 1997 1832 1696 1243 585 554 22038 1467 14881 --
NM_002657chr2013316 ------
NM_002687chr1431099 463 281 ----11195
NM_002698chr19------1935
NM_002709chr2133397 3266 2967 2768 2299 2190 1207 1119 1064 746 680 195 48 13391 1429 --
NM_002719chr1472359 2212 2100 1548 785 658 68 --22132 1679 --
NM_002731chr173126 2898 2325 2131 1938 409 217 12464 --22932 980
NM_002734chr1732252 1917 733 22112 1892 1671 1182
NM_002736chr731947 624 234 ------
NM_002742chr14----2750 678 --
NM_002745chr22144555 4496 4326 4287 3375 3270 3073 2897 2782 1484 1169 1160 786 698 --13218 34571 1753 1154
NM_002819chr1911196 ------
NM_002829chr9----1909 --
NM_002833chr152622 441 11589 ----
NM_002836chr20144 --155 --
NM_002857chr162614 2286 2067 1725 675 501 --11061 --
NM_002858chr131212 916 172 21352 53 --1548
NM_002869chr1192135 2019 1991 1844 1702 693 232 221 81 11885 --11806
NM_002874chr922524 960 11537 31979 560 97 --
NM_002892chr1451473 1174 647 365 120 --11636 --
NM_002906chr11----21913 1559 22390 1544
NM_002912chr63857 784 623 1777 1708 --
NM_002941chr351531 1136 1100 654 592 1408 11079 --
NM_002942chr311051 --11310 --
NM_002951chr20----1229 --
NM_002956chr122191 134 ----21310 556
NM_002959chr154430 4055 3436 1363 713 13425 --14083
NM_002968chr1661134 1077 921 854 804 258 1770 --11060
NM_002977chr293435 3017 2777 2512 2396 1237 1024 887 440 11351 1106 33383 3048 2120
NM_003010chr1752348 1708 955 534 147 1248 ----
NM_003012chr823032 2599 --12991 13178
NM_003013chr45828 809 785 679 261 --1588 1239
NM_003016chr1751946 1627 475 315 148 --11981 --
NM_003051chr151576 1374 529 517 487 11437 159 --
NM_003071chr352004 758 660 632 343 140 11638 1303
NM_003071chr352004 758 660 632 343 140 11638 1303
NM_003074chr342026 1707 834 381 --11908 --
NM_003079chr171666 --2772 32 --
NM_003081chr2021137 31 --1160 1310
NM_003100chr53451 379 318 ------
NM_003108chr296704 6534 5975 5422 5083 4994 4562 4522 1212 15870 --17237
NM_003131chr61765 --12285 --
NM_003155chr822623 2059 11985 1905 1422
NM_003161chr1763343 2988 1401 1235 1206 802 --22189 396 13110
NM_003180chr19------1376
NM_003184chr851107 1021 1007 948 435 --11082 1764
NM_003185chr2041280 1077 194 117 --11096 --
NM_003244chr18196 ----1321
NM_003292chr162265 2243 2231 1791 1634 819 2374 103 21980 114 --
NM_003305chr4153 --171 --
NM_003319chr23894 86 22 ----1144
NM_003342chr1762951 1322 1170 614 336 165 --11237 1624
NM_003344chr71203 ----168
NM_003390chr1151021 925 896 841 745 ----1336
NM_003392chr3114219 4206 3901 3891 3867 876 661 590 219 172 89 --23708 636 --
NM_003406chr861956 1817 1806 1415 271 162 ----21947 501
NM_003410chrX133071 3060 3020 2892 2693 2601 2135 1025 617 513 325 300 89 ------
NM_003423chr1961849 1001 927 562 453 364 11024 21869 145 --
NM_003463chr682955 2300 1087 1079 1046 850 831 194 22832 926 33116 2994 371 --
NM_003473chr10------1132
NM_003482chr1211817 12458 ----
NM_003483chr1282872 2160 1974 1963 1817 689 610 531 ------
NM_003489chr2173252 2856 2388 1209 1071 808 283 --1743 12363
NM_003503chr11815 21303 1038 21286 55 1161
NM_003505chr7------11626
NM_003566chr1283475 3335 3054 1113 1057 630 108 28 33223 3204 2830 1451 --
NM_003567chr11392 ----1423
NM_003583chr12103840 3513 3498 3438 1571 1332 927 411 203 187 13611 ----
NM_003607chr194362 4292 4171 4143 4091 3178 1283 1075 559 13381 14340 --
NM_003615chr3173096 2914 2819 2738 2661 2561 2454 1338 1075 1050 845 785 765 340 276 219 80 --21513 178 --
NM_003617chr1114731 4690 4577 4383 3907 3764 1814 1560 1191 543 372 23263 171 14941 --
NM_003620chr1721041 998 1899 11091 1365
NM_003644chr1756530 5688 4305 1847 176 --16290 12400
NM_003645chr15------1262
NM_003670chr331415 1083 79 ----11458
NM_003672chr141541 778 554 225 ------
NM_003679chr133120 3047 2568 12682 --12863
NM_003692chr94995 264 116 74 1941 --2866 140
NM_003713chr121747 1411 ----11696
NM_003716chr32774 239 ----11043
NM_003743chr21553 1643 ----
NM_003750chr103774 332 68 ----1989
NM_003760chr14780 749 626 246 1288 2698 689 --
NM_003764chr61794 ----1802
NM_003774chr12112904 2527 2492 2384 2169 1263 1246 846 825 310 192 13101 43204 2770 2315 1301 --
NM_003783chr1140 --11113 --
NM_003787chr1871557 1236 1222 1137 344 192 79 --1116 --
NM_003800chr6--11497 1165 12376
NM_003822chr133186 1197 761 --2797 89 22121 168
NM_003850chr13158 --1512 --
NM_003873chr1062110 1959 1649 580 544 530 --1998 --
NM_003884chr321790 1733 11449 --11458
NM_003887chr221833 586 22178 624 22342 1880 --
NM_003895chr2192122 1998 1912 1556 838 534 364 261 254 ----11539
NM_003902chr13642 310 185 --1745 --
NM_003922chr15171 ----2385 46
NM_003941chr7132383 2312 897 889 855 838 617 578 553 467 283 251 43 1234 1679 11600
NM_003953chr122876 736 1123 1167 --
NM_003972chr103344 173 131 158 --1121
NM_003980chr63907 471 267 --2397 223 --
NM_003998chr42660 540 --2629 531 --
NM_004075chr12121 --281 55 --
NM_004093chr1343278 3128 3066 1034 11138 ----
NM_004112chr17------11190
NM_004124chr14113340 3070 3008 2974 2643 1216 1179 1125 1013 790 365 --33210 3195 870 170
NM_004161chr251181 598 543 515 150 ----11590
NM_004170chr941666 1600 1420 322 --1367 --
NM_004171chr11149628 9593 8999 7665 6969 3844 3514 2970 1235 1071 609 564 323 196 38622 3553 2650 49246 7829 6496 3296 38610 6047 816
NM_004180chr23646 456 58 --168 --
NM_004225chr821502 1365 --1534 --
NM_004227chr783129 3070 3033 2948 2577 1970 577 555 11068 1865 --
NM_004229chrX31793 506 395 --3903 266 119 --
NM_004232chr1863267 3217 2879 2782 2531 831 11350 23690 3483 --
NM_004235chr92890 552 1854 1250 --
NM_004267chr31107 --2554 366 --
NM_004268chr111259 --2374 297 --
NM_004272chr542034 1551 1359 812 11796 ----
NM_004277chr621577 1521 11402 ----
NM_004282chr62180 56 --1136 --
NM_004329chr1051399 1044 951 477 139 --1155 --
NM_004370chr622065 1572 11735 21865 1584 --
NM_004392chr1362358 2210 2108 1653 958 580 12427 ----
NM_004397chr11113912 3025 3008 2894 2848 2816 2699 1495 1379 1157 982 --2616 69 --
NM_004411chr71723 --1749 --
NM_004414chr2141589 1548 1395 171 21001 38 --11314
NM_004430chr852714 2671 2466 2178 1921 --12096 --
NM_004431chr11305 --140 --
NM_004432chr962356 2020 1708 714 584 346 22141 1829 2830 729 --
NM_004438chr262937 2883 2627 2376 1209 234 ------
NM_004454chr342281 1908 1794 527 --12235 --
NM_004457chr241688 1650 1626 467 1557 158 --
NM_004458chrX62520 2004 758 400 299 278 ------
NM_004464chr494004 3887 3149 2857 2722 2636 1296 396 377 1106 21116 992 --
NM_004480chr141123 1232 --2682 627
NM_004482chr22686 351 --2835 36 --
NM_004496chr1441282 967 529 391 --1455 --
NM_004504chr273078 2782 2587 1943 619 282 243 12494 11162 11214
NM_004538chrX2832 789 --1216 --
NM_004540chr213769 654 279 --2911 146 --
NM_004560chr92664 361 187 ----
NM_004567chr31106 --12051 --
NM_004575chr441432 1400 1234 597 --11247 --
NM_004580chr153716 217 181 11528 11419 --
NM_004586chrX125406 5271 5111 4748 3944 3652 3348 1037 840 821 335 123 21792 900 35300 649 354 --
NM_004600chr141578 1339 978 218 --31549 1038 415 --
NM_004612chr9114487 4156 3918 3483 1918 1571 1496 1155 1000 992 954 --24243 909 --
NM_004660chrY62015 1748 1725 1701 881 707 ----1364
NM_004685chr1382803 2702 2601 2561 2147 771 474 421 --1627 --
NM_004709chrX61732 1704 1616 1473 1124 377 --11721 --
NM_004719chr1272890 2859 2123 1861 1788 474 280 --22449 1756 --
NM_004721chr3----1255 --
NM_004742chr341538 730 439 298 --11672 --
NM_004745chr842704 2088 1149 918 12609 11920 16440
NM_004774chr1762914 1256 1167 849 727 597 22949 2391 23075 248 1323
NM_004775chr1882156 1958 1932 1896 1798 1707 311 37 ------
NM_004798chr2073440 3300 2601 2387 1313 880 835 12485 23573 3323 --
NM_004808chr1052344 2069 1207 554 48 12478 ----
NM_004824chr641478 917 313 171 31275 1045 231 1556 11446
NM_004827chr441906 1888 556 427 11235 31537 1467 376 11440
NM_004840chrX52185 2104 1960 862 493 1973 22305 2083 --
NM_004850chr241300 1178 709 497 --1490 --
NM_004857chr1484740 4712 4457 3103 1803 1443 1303 1119 11214 24751 4252 --
NM_004859chr17103097 2856 2745 2453 2055 1161 992 844 631 348 --12495 1284
NM_004866chr5144771 4645 3850 3235 1939 1693 1635 1069 877 694 328 213 187 71 11861 33742 1948 232 --
NM_004869chr1881729 1643 1525 1409 1374 1309 1110 291 --1178 --
NM_004905chr13748 647 175 ------
NM_004921chr172397 2328 2138 2020 1922 819 423 22057 1591 21716 924 --
NM_004929chr831102 430 257 --1986 1485
NM_004936chr942668 2436 2372 1887 11975 11174 --
NM_004956chr7104361 4235 4195 3426 3122 1529 1105 1099 1089 773 44600 4545 4283 3191 11132 --
NM_004958chr14785 338 108 60 --1751 1853
NM_004973chr641526 193 68 54 --11147 --
NM_004985chr1294490 4229 3874 3183 1648 1402 1233 591 141 33950 2988 2929 24190 2953 --
NM_004999chr674465 2926 2905 1406 1113 703 257 --44510 831 692 349 --
NM_005000chr711021 1917 151 1190
NM_005030chr161242 --1304 --
NM_005034chr82490 37 ------
NM_005065chr14105296 4471 4444 4343 4225 3466 1829 1035 892 632 2707 560 ----
NM_005095chr142026 1864 712 296 --12236 1495
NM_005109chr352425 2331 2239 2224 2159 ----22516 1694
NM_005121chr17123795 3158 3103 3087 2878 2561 2555 1075 995 933 322 133 12952 23473 2990 --
NM_005126chr31856 --1667 --
NM_005156chr9115408 5294 5228 5008 4999 4874 4544 4503 3257 2121 1516 2485 123 13844 34259 1013 902
NM_005168chr221750 1628 1136 ----
NM_005180chr1041409 1050 540 163 11708 1298 --
NM_005188chr11108338 5837 5150 3185 3036 2097 1860 1196 799 767 12796 38160 7313 1405 --
NM_005224chr19----1623 --
NM_005233chr3102617 2518 2283 2178 1639 1583 561 391 229 89 22046 908 21797 723 --
NM_005245chr4----1801 --
NM_005257chr1831255 496 296 11220 11004 --
NM_005259chr241044 969 467 363 --11293 --
NM_005274chr1------157
NM_005284chr62452 338 ------
NM_005295chr73232 207 93 ----1253
NM_005333chrX31112 427 144 1403 21233 366 --
NM_005339chr483960 3450 2728 2660 1533 1076 1005 351 --3833 647 211 --
NM_005342chrX51803 1763 812 643 443 ----134
NM_005385chr392261 1734 1672 1665 552 485 419 286 190 22754 2281 12660 --
NM_005388chr961640 1621 1404 1368 276 155 --41693 1166 1101 1070 --
NM_005400chr242212 2034 2027 1047 22226 1205 ----
NM_005407chr14----11151 --
NM_005413chr21339 --1427 --
NM_005433chr1862736 2707 2634 2613 1710 237 12271 11902 1643
NM_005445chr10186 --1262 --
NM_005461chr2041922 1777 734 642 11392 ----
NM_005465chr11643 32022 1890 1571 ----
NM_005493chr63805 737 228 ----1530
NM_005499chr192602 409 1637 ----
NM_005509chr591881 1808 1758 1464 1164 1148 292 217 99 --11251 1370
NM_005520chr5------2652 296
NM_005522chr731367 1234 1023 11126 1522 --
NM_005542chr71434 --11220 --
NM_005569chr2231390 1359 496 --1226 --
NM_005596chr9104685 4225 2390 2062 1810 1749 1625 1617 843 435 14644 45242 4103 2457 1437 --
NM_005599chr121489 579 ------
NM_005604chr632553 2322 2307 12117 12475 --
NM_005630chr321658 1269 167 11997 --
NM_005639chr1241830 1541 1249 573 --11695 --
NM_005665chr184260 3450 3085 3036 1565 1218 378 267 23795 387 11344 14491
NM_005711chr53982 841 412 11017 1756 1388
NM_005721chr25397 388 334 211 140 --2934 807 --
NM_005737chr242361 2088 1166 960 ----22468 2388
NM_005746chr721089 923 12733 1471 1864
NM_005749chr173627 510 207 --2655 543 --
NM_005751chr72482 388 ----191
NM_005776chr142613 551 1191 ----
NM_005795chr292967 2871 2804 2396 2247 1095 1079 1036 89 22796 2421 2935 218 12626
NM_005822chr641579 1567 960 681 1607 1581 --
NM_005841chr411042 11103 --11133
NM_005853chr162529 475 ------
NM_005868chr7102448 2044 1915 1903 903 896 462 298 177 98 --22308 914 --
NM_005898chr1173190 1953 1249 754 640 623 282 1244 12534 --
NM_005902chr1573992 3311 3298 1616 1353 1222 981 ------
NM_005907chr621541 1363 --1548 --
NM_005909chr553093 1703 971 812 124 11039 12887 13472
NM_005920chr133762 2661 215 ----22825 576
NM_005924chr73938 743 108 --1226 --
NM_005937chr1731662 1650 991 --21669 984 --
NM_005941chr863922 3871 3695 3496 2602 1638 1766 1913 --
NM_005966chr291989 1822 1600 1480 928 569 555 278 219 --2658 55 1534
NM_005969chr11----11220 --
NM_005977chr134733 372 219 24 ------
NM_005996chr121960 11432 1589 --
NM_006016chr672234 1487 794 614 467 195 64 11641 21740 205 --
NM_006038chr2022059 71 ----1784
NM_006047chr20103542 3487 2994 2717 2431 2365 2238 2186 1207 871 ----13066
NM_006060chr793770 3515 3458 2818 1595 1586 1522 607 591 --23810 3528 --
NM_006067chr161391 1810 1331 --
NM_006079chr61754 1737 1824 --
NM_006080chr742667 1908 531 506 --22760 418 --
NM_006089chrX51914 1883 1494 507 113 2315 257 --11685
NM_006099chr11180 --1572 --
NM_006106chr1143468 2557 661 130 13385 --33133 490 353
NM_006136chr751277 1182 1156 1037 302 --1917 --
NM_006154chr1572775 2345 2007 1174 1116 910 393 12408 1467 --
NM_006164chr21374 1294 --181
NM_006194chr14------1428
NM_006195chr931225 1122 283 1178 --1932
NM_006237chr1352008 1967 1635 873 499 ------
NM_006251chr5103293 3075 2633 2479 2471 946 906 376 304 64 1900 1935 --
NM_006256chr152803 2630 2476 2413 413 1801 41899 461 271 161 --
NM_006275chr2032311 1752 74 --2810 747 22532 399
NM_006283chr864316 4291 4252 3275 1825 1235 44931 4451 1707 1471 13868 24858 3300
NM_006298chr672723 2608 2099 1308 1244 986 602 1962 1556 --
NM_006306chrX85933 5008 3745 2200 1828 1613 1580 935 1480 11948 --
NM_006320chr441130 877 712 278 --1821 --
NM_006325chr122730 585 ----1275
NM_006330chr841617 1392 538 286 --21605 640 --
NM_006371chr363972 3515 3506 1101 1051 976 ----14467
NM_006375chrX21663 252 --21399 1345 --
NM_006389chr11----11397 --
NM_006393chr10114135 3583 3537 3487 3014 1584 981 900 645 455 73 21629 667 --11115
NM_006415chr961314 1171 1062 982 309 274 --11256 --
NM_006449chr221723 809 22155 779 1120 --
NM_006451chr51889 --1847 --
NM_006460chr171370 ----1608
NM_006495chr17----1448 --
NM_006496chr151941 1490 1232 263 145 --31498 542 486 --
NM_006516chr121636 1201 11163 --1157
NM_006527chr41229 --1597 1716
NM_006534chr2083280 3253 2588 2213 1228 1068 880 842 --2750 602 --
NM_006537chr15----2461 66 --
NM_006544chr14256101 5647 5592 5540 4833 4827 4702 4599 4166 4140 3983 3941 3853 3829 1920 1868 1603 1429 923 875 819 584 536 359 58 1154 22160 660 21999 1972
NM_006546chr1785667 2477 2384 2218 1792 1617 1483 1185 --25682 4569 1840
NM_006572chr1762828 2792 1362 1354 692 138 12266 23189 359 1384
NM_006593chr21659 --1699 1728
NM_006599chr16188248 8209 7604 7543 7437 7298 6771 6497 5846 5023 5003 3101 2928 2851 2397 992 634 210 17260 25791 577 15302
NM_006602chr205766 592 556 184 166 --1282 --
NM_006614chr3103647 3214 2522 2263 1303 1140 1008 913 296 155 13234 --13567
NM_006624chr1061782 1748 1525 846 709 573 --1167 --
NM_006626chr962131 2094 1057 510 266 82 22543 632 32218 1960 600 --
NM_006628chr15124661 4627 4469 4165 3783 3253 3113 3103 1759 1485 563 266 21774 777 21435 1138 1627
NM_006646chr1352962 2742 2028 776 570 ----22156 176
NM_006656chr11----197 --
NM_006682chr782892 2885 2523 2473 2241 1852 1793 230 12099 22618 868 22407 2186
NM_006699chr132475 2341 429 --22493 1073 32560 2547 683
NM_006713chr52650 163 1610 1135 --
NM_006729chrX135268 5222 3895 2070 1995 1622 1435 889 876 532 487 154 29 31470 1287 1181 1776 --
NM_006734chr64483 477 267 129 ----11401
NM_006747chr11----1160 --
NM_006750chr16127968 7775 7467 6731 6595 5767 2919 1477 1455 1311 191 45 36383 6144 5591 ----
NM_006754chr721097 41 ----1993
NM_006777chrX82844 2779 2763 2613 2552 1904 1125 493 22413 1873 32494 2313 840 --
NM_006827chr1453106 2953 2103 679 623 ----11236
NM_006837chr81122 ----151
NM_006838chr126639 339 326 300 239 205 --1114 --
NM_006851chr1262791 2635 2218 2064 552 517 --21008 129 11936
NM_006873chr273161 2924 1391 1384 1182 1001 808 12192 12673 12449
NM_006885chr1674223 4210 4076 3815 3272 3107 214 --11391 13304
NM_006887chr21558 ----1282
NM_006888chr1462938 2898 2684 2397 908 849 11416 1234 --
NM_006902chr141157 991 433 289 ------
NM_006939chr144973 782 120 90 --1107 1991
NM_006981chr9102489 2375 2293 2250 2218 2159 1921 1175 1139 301 1943 12972 --
NM_007005chr941535 1485 1300 1212 3613 242 109 ----
NM_007017chr53863 844 311 ----1668
NM_007034chr12996 802 --1859 --
NM_007036chr51779 1158 1210 --
NM_007038chr2176013 5638 4020 2128 1275 1258 1197 35035 2198 812 12150 --
NM_007085chr342647 729 595 586 --1634 --
NM_007087chr16------1133
NM_007106chr1341893 965 815 576 --11757 22346 430
NM_007114chr3113199 3117 3064 3037 2911 2618 2603 2568 1128 185 158 32438 2097 703 22556 2484 1935
NM_007125chrY61439 1307 1167 529 259 207 --11461 1317
NM_007146chr1752882 2379 861 666 40 ------
NM_007172chr2243025 2495 2354 543 --33301 3253 2824 --
NM_007217chr32363 298 ----1379
NM_007218chr81957 1769 2972 322 --
NM_007245chr161932 ------
NM_007249chr13179255 9038 8998 8241 7900 7616 7322 6787 5804 5765 3541 3373 2691 1807 1319 1196 231 89092 8377 8323 8072 7468 6089 3776 1073 --16922
NM_007282chr33959 713 177 ----1751
NM_007373chr1021707 321 ----11354
NM_007375chr192728 2508 1835 1110 1078 1071 615 299 215 1132 1600 --
NM_012096chr3103553 3408 2860 2737 1025 988 819 485 474 23 --11370 13280
NM_012104chr1122557 359 --23803 235 23855 2776
NM_012110chr4------1215
NM_012120chr682833 2713 2482 2469 912 687 569 260 --12039 11049
NM_012158chr1361851 1815 1775 1526 346 320 --11785 --
NM_012164chr987116 7024 6747 6423 5367 4969 1071 942 14925 37496 6918 2108 24983 4866
NM_012180chr42737 280 ------
NM_012193chr11105181 4487 3720 3680 3641 2100 634 415 383 324 21075 641 --14815
NM_012199chr163678 1184 797 535 525 400 ----1704
NM_012207chr103234 188 125 1215 ----
NM_012214chr2146257 5972 5942 5907 5717 5368 4511 2205 1234 1197 1044 678 648 507 --25726 2149 15863
NM_012224chr43431 234 181 --11175 --
NM_012234chr333656 3370 693 --23012 2820 --
NM_012242chr103721 513 339 ------
NM_012243chr12796 227 ----1867
NM_012247chr1041050 961 701 245 ----1776
NM_012249chr263277 3128 2707 2429 584 59 --33218 2874 217 --
NM_012262chr1185250 5210 5159 4950 4651 4510 4016 3405 1958 1767 1185 965 956 702 690 679 324 157 24743 4276 ----
NM_012281chr762100 1923 1693 1534 915 729 1664 2211 86 12446
NM_012290chr261719 1556 1475 1407 1345 1199 11415 1674 1336
NM_012297chr472324 2039 1987 1973 647 487 366 --12430 12377
NM_012300chr552209 1560 757 586 571 --22575 2553 --
NM_012301chr752205 2040 1833 1742 1419 --1313 --
NM_012304chr511597 --32199 984 544 12501
NM_012325chr2031447 1232 287 --31242 1125 68 --
NM_012328chr751054 1039 960 304 188 11148 ----
NM_012338chr771259 1048 493 421 398 387 210 ----1777
NM_012345chr1361650 1267 615 571 555 441 11206 51847 1661 1502 1492 498 --
NM_012395chr743298 2882 2351 1324 12870 --12661
NM_012398chr1922260 2144 --12566 --
NM_012405chr163839 2527 2497 1077 921 627 --33812 525 252 11447
NM_012417chr17--1423 2458 405 --
NM_012428chr153861 261 184 --1840 --
NM_012431chr7133320 3064 2774 2309 1288 1098 934 789 469 439 387 328 268 32677 1194 156 --23224 593
NM_012443chr105684 670 128 91 75 123 1149 --
NM_012448chr1722346 122 --11567 1102
NM_013230chrY81708 1409 1338 1323 1142 526 317 212 --21390 1169 --
NM_013231chr14103912 3837 3812 3501 3366 1592 1289 850 553 259 44402 4210 3753 2901 2860 128 --
NM_013233chr22906 449 1486 31130 427 288 --
NM_013242chr163421 325 127 1391 ----
NM_013261chr473608 3049 2898 2464 835 818 632 189 12809 11212
NM_013281chr2041373 1127 1040 272 ------
NM_013309chr1562587 721 585 486 332 280 --32473 713 349 12579
NM_013316chr7------1289
NM_013354chr871315 1122 1074 908 278 227 141 ----11189
NM_013374chr392472 2271 1110 654 645 578 362 302 102 1337 1887 12974
NM_013386chr151789 1782 1542 1225 227 ----11650
NM_013437chr841355 1296 928 267 2461 214 ----
NM_013445chr21123 --1143 --
NM_013995chrX112338 2243 2234 1923 1796 1662 1605 850 816 578 66 --12529 --
NM_014016chr3101733 1532 1521 1490 1278 1252 1209 1141 672 432 11115 ----
NM_014106chr1592541 2383 2344 2262 2210 2201 1027 253 239 1364 12993 --
NM_014112chr8125331 4881 4852 4395 3766 3640 1832 1782 1579 1499 1306 386 --24219 96 35250 1185 701
NM_014117chr1642655 613 606 349 --11771 1724
NM_014141chr74736 243 188 83 11464 35295 5175 150 11925
NM_014155chr11217298 6697 6604 6558 6263 6000 4985 4914 4640 4624 2732 2392 2198 1894 1881 1848 1772 1393 1145 1135 712 1683 22381 780 --
NM_014159chr3----1525 --
NM_014181chr22400 297 21851 544 --12318
NM_014208chr41240 --2296 286 1225
NM_014243chr442050 1349 482 448 22042 772 ----
NM_014294chr831120 420 187 ------
NM_014372chr182050 2000 1804 1576 1486 835 755 621 11359 ----
NM_014379chr84955 402 153 102 ------
NM_014393chr862284 2267 1855 1768 545 256 --11901 --
NM_014421chr431953 586 253 --31579 672 419 1846
NM_014431chr1011354 --11623 --
NM_014487chr41462 ----1483
NM_014494chr1632135 1769 177 --1157 --
NM_014496chrX3300 116 106 ------
NM_014554chr1232050 1833 181 --11556 --
NM_014572chr1341722 1236 653 234 11634 11373 --
NM_014584chr14101672 1655 1609 1076 1012 530 516 379 243 187 --21101 209 1543
NM_014585chr231275 936 478 ----1998
NM_014600chr231540 1213 173 21591 1461 11610 --
NM_014616chr383356 2471 1259 1057 963 786 741 493 22333 2127 23368 2857 11222
NM_014618chr9------1114
NM_014636chr944056 2910 2796 1684 --34345 3068 1724 --
NM_014655chr132076 618 253 ----12308
NM_014660chr731033 320 294 1795 ----
NM_014667chr33961 455 66 2983 941 --1885
NM_014683chr1752183 2124 1805 1788 667 ------
NM_014686chr1952522 2217 1833 610 525 ----12158
NM_014701chr1562997 2898 2375 2332 288 124 --33435 2196 744 --
NM_014705chr772138 1664 1583 1371 815 373 156 1510 31562 564 367 --
NM_014707chr771979 1775 1588 1447 806 765 620 ----11871
NM_014720chr1021752 1737 1246 --11810
NM_014747chr134040 3767 3722 12179 22219 2046 11210
NM_014774chr182256 2042 1986 1287 786 673 448 113 12934 11275 11132
NM_014787chr172667 2253 2222 1862 521 111 43 --1839 --
NM_014790chr5------1337
NM_014797chr673276 2904 2368 2197 2068 899 217 ------
NM_014810chr173672 3176 3083 2272 1474 1444 1356 1809 23066 2581 --
NM_014819chr5122505 2279 2183 2109 2101 1809 1674 831 793 325 136 101 ------
NM_014827chr121572 390 --11690 --
NM_014839chr182426 2058 2049 2009 824 723 697 544 2416 149 11905 --
NM_014841chr6------1114
NM_014860chr282329 2279 2242 1865 971 768 702 333 1415 11978 --
NM_014877chr17137273 5159 4896 2993 2524 2499 2441 2213 1343 1028 391 172 109 1693 37190 5081 1214 --
NM_014897chr1733095 2201 2157 --1862 33201 2873 269
NM_014900chr23770 429 117 184 1935 --
NM_014904chr10113828 2806 1445 1370 1326 1243 945 414 398 149 112 33440 3377 488 23925 1583 11484
NM_014910chr193805 746 197 1565 1835 --
NM_014912chr1083507 3416 3312 2958 2368 1155 1121 28 --31052 727 452 1974
NM_014913chr1821439 1306 --21371 377 --
NM_014920chr682677 2516 1338 750 386 355 176 47 23691 2440 32368 2341 149 --
NM_014924chr1432902 2670 2515 --12713 --
NM_014932chr341754 472 224 109 --21460 1311 --
NM_014939chr1831574 1460 327 1224 2370 123 1174
NM_014942chr642547 2084 1988 562 --1954 11885
NM_014947chr152435 2196 853 830 190 --13084 --
NM_014949chr121037 898 --21076 982 --
NM_014950chr1481786 1729 1503 1398 1118 548 448 226 ----11247
NM_014951chr1052633 2316 2253 1928 452 --12594 --
NM_014978chr1031799 1646 693 --11704 --
NM_014990chr1431087 1078 337 --11345 --
NM_014991chr453069 2884 2029 1224 755 ------
NM_015000chr1272926 2870 1208 1081 1050 705 201 1737 190 --
NM_015017chr111191 ----1205
NM_015020chr1673291 3030 2856 2775 1523 1511 1469 11489 ----
NM_015025chr282646 2417 2254 2240 576 566 548 335 22478 2081 11864 11878
NM_015032chr1342546 2434 2169 2072 11827 1969 --
NM_015035chr2046414 5209 2558 1827 22648 293 --12036
NM_015042chr1554203 3901 3519 1378 232 11300 14082 --
NM_015045chr1072123 2093 2081 1774 815 743 35 1681 11622 --
NM_015049chr2103230 3122 3025 2498 2233 814 541 324 306 245 ----12981
NM_015057chr131631 --1437 --
NM_015061chr92749 275 --1581 --
NM_015076chr6154528 4248 4195 4100 4085 3884 3506 3401 3170 1665 1594 1467 1319 535 416 13998 --11708
NM_015079chr1523237 457 --12619 --
NM_015091chr142814 253 1178 --1202
NM_015093chr631885 1194 502 ----11381
NM_015097chr382374 1951 1920 1446 471 419 356 339 1744 ----
NM_015130chr491247 1079 858 556 505 351 341 168 100 ----11411
NM_015132chr731611 1361 81 31642 1625 712 11311 --
NM_015144chr16113949 3872 3845 3728 3049 2923 2828 2591 2552 1380 1357 --33880 3542 1343 11448
NM_015147chr221227 882 22922 2368 23277 380 1374
NM_015153chr62699 220 1249 --1644
NM_015155chr1042738 2626 1278 1184 ----12183
NM_015170chr832350 2306 2272 --22297 1753 --
NM_015184chr3----197 --
NM_015192chr2082810 2412 2406 2390 2058 955 594 363 1865 12711 --
NM_015199chr352614 1138 828 623 531 176 1754 --
NM_015206chr1573580 3460 3046 2911 2808 1130 864 1676 31198 1109 285 --
NM_015215chr173176 3168 2419 1082 1052 438 379 ----12004
NM_015251chr1631730 1557 502 22297 385 --12023
NM_015271chr4104110 4101 3872 3581 3528 3274 2882 753 695 411 --23780 3138 --
NM_015272chr1631519 527 159 --21850 388 145
NM_015275chr1241706 1435 528 498 11898 21324 463 1691
NM_015277chr1851280 611 586 294 252 1640 1515 --
NM_015291chr173396 3380 3108 3047 2524 770 450 33188 2639 300 ----
NM_015296chr13------2877 333
NM_015299chr1463615 2847 1619 1051 1036 411 --21385 890 --
NM_015310chr8108143 8078 6984 6118 6107 5441 5289 2301 1002 489 27733 5451 56391 3138 2247 1359 1244 17492
NM_015315chr523370 902 --13341 --
NM_015328chr742748 2452 924 356 12630 13138 --
NM_015336chr12132702 2686 2396 2196 2181 2111 1952 1768 1028 911 775 608 491 1259 ----
NM_015344chr832144 266 84 21540 530 ----
NM_015349chr673000 2929 2752 2701 2086 864 341 12606 1181 --
NM_015375chr164999 4959 4883 4777 1653 326 2862 190 ----
NM_015384chr5------163
NM_015393chr473697 3170 2680 2604 2338 1367 884 12542 --13108
NM_015419chrX----11142 --
NM_015435chr861483 1399 1158 938 456 325 2562 283 ----
NM_015446chr141390 1140 358 260 1327 11506 --
NM_015455chr594140 3805 3774 2858 1204 1054 1021 393 280 ----23151 1637
NM_015460chr342015 1981 446 80 --11540 11757
NM_015464chr73818 752 283 --1919 --
NM_015483chr721171 141 ------
NM_015530chr2----1363 1378
NM_015553chr6103948 3299 1510 1137 1112 860 609 557 402 324 --24032 1718 11185
NM_015564chr583576 3491 3293 3151 2542 924 537 236 13034 --1199
NM_015570chr7--1681 21317 503 --
NM_015576chr362952 2750 2689 2184 985 725 12979 32276 2023 88 --
NM_015577chr551762 1656 1267 1232 381 --31750 1576 364 1592
NM_015578chr19111852 1727 1553 1528 1430 1347 1334 622 569 381 275 --22118 1905 --
NM_015622chr72244 174 ------
NM_015626chr1731028 405 159 ----11211
NM_015630chr23841 211 52 1240 ----
NM_015695chr651998 1877 1630 1362 543 --11913 --
NM_015865chr181327 1140 11061 --
NM_015878chr822089 1582 ------
NM_015885chr113699 326 301 ----1871
NM_015902chr83596 92 32 --1667 --
NM_015906chr184536 3965 3138 3073 1683 1200 336 302 33449 1433 619 44761 4267 4196 356 11527
NM_015986chr1731194 339 144 ----11154
NM_016021chr682840 2360 2184 1977 1076 905 897 622 --2389 296 --
NM_016072chr12122416 2404 2352 2246 1734 837 701 684 605 572 411 34 ----167
NM_016073chr153980 402 146 --168 1850
NM_016076chr152440 1163 998 750 381 --13234 --
NM_016083chr6143848 3834 3776 3684 3299 2529 1432 1409 1241 968 704 607 476 409 42672 726 174 108 13762 --
NM_016087chr751731 1533 1506 1376 1075 31437 336 228 --21593 1423
NM_016107chr541251 923 864 462 11404 11200 --
NM_016131chr232386 2356 2240 ------
NM_016205chr441386 1370 1339 899 1475 ----
NM_016221chr552322 2110 1464 787 762 ----11567
NM_016248chr13113665 3642 3221 2956 2813 2558 733 656 195 175 92 23328 3241 23347 3017 --
NM_016252chr2164 ------
NM_016255chr6103236 3154 2466 1209 1078 1053 1032 632 256 151 33058 2413 958 --13368
NM_016257chr193425 3391 3071 2801 2791 1308 1141 898 849 52993 2394 2169 1071 785 12694 --
NM_016271chr1842249 2204 904 280 --12062 --
NM_016275chr372341 2240 2224 1064 955 407 221 2719 563 2571 465 --
NM_016277chr681559 1522 1085 444 344 295 253 135 --1429 --
NM_016289chr24930 864 704 537 12144 1911 2893 792
NM_016308chr171700 1491 1460 726 710 600 41 ------
NM_016338chr52844 325 --1952 11090
NM_016352chr72918 485 ----11492
NM_016357chr1251190 1106 790 319 190 --1272 1959
NM_016359chr153674 666 314 1585 127 --
NM_016396chr1582794 2333 2204 2015 1891 1143 1034 816 12073 2714 647 --
NM_016410chr94643 596 175 60 1634 ----
NM_016424chr1761801 1773 1570 751 720 442 1708 11260 --
NM_016441chr242167 1989 1724 1584 --11818 --
NM_016442chr5122285 2275 2265 2125 2079 2001 1828 1538 1531 595 370 295 11785 21557 1494 --
NM_016463chr5----1115 --
NM_016530chr1584061 3042 2882 1634 1351 1141 783 469 ----13197
NM_016531chr4123776 3753 3573 3564 3459 3346 3332 3083 2715 1192 961 430 22932 838 34154 4068 3468 --
NM_016559chr351377 1045 1033 985 21 --21014 271 1103
NM_016577chr334052 1103 875 ------
NM_016591chr53442 194 81 --1908 11166
NM_016604chr511054 --11246 --
NM_016620chr141316 1017 523 94 21104 297 --2931 153
NM_016623chr81603 --1495 --
NM_016631chr211219 1125 --1913
NM_016644chr54468 405 382 363 1525 1548 --
NM_016831chr162363 2229 1899 1500 840 723 --11554 --
NM_017415chr544293 3853 3802 3464 23219 980 --12846
NM_017420chr1483541 2816 2806 2530 1392 1179 897 861 13589 ----
NM_017423chr432237 1927 1371 --1632 12153
NM_017508chr111594 2699 509 22497 30 --
NM_017551chr1031965 801 720 22527 2034 2961 189 --
NM_017590chr2232585 1894 1773 ----12594
NM_017594chr963029 2985 2855 2721 2709 2261 13053 11030 12998
NM_017610chr1582035 1329 825 796 675 552 465 144 11642 ----
NM_017629chr13312 202 144 --11467 1751
NM_017633chr683924 3803 3385 2672 2665 1347 1138 128 12754 1965 --
NM_017635chr1121605 1037 ----11113
NM_017640chr61846 --1821 2876 752
NM_017643chr1782730 2708 2667 2587 2049 647 588 248 1732 --12147
NM_017644chr3135135 5064 4251 2013 1933 1895 1723 1298 889 835 572 429 359 34820 4803 3347 --35109 4722 3199
NM_017664chr135952 942 757 278 113 ------
NM_017667chr72574 141 ------
NM_017672chr1551324 1279 1010 959 305 --1149 11079
NM_017680chr941069 814 356 295 --163 1993
NM_017684chr1542002 1917 1614 281 ----11399
NM_017693chr1361557 1453 1227 1157 1106 146 ----1331
NM_017741chr462677 2430 2412 1890 691 417 --1507 --
NM_017742chr1831891 1834 173 --1294 --
NM_017747chr51399 1325 --1413
NM_017779chr171940 1841 1722 1101 577 490 434 1690 2217 29 11070
NM_017811chr932636 1996 1983 11180 12478 1739
NM_017812chr7------1720
NM_017826chr131641 --1298 1804
NM_017845chr44769 267 127 66 1717 2777 565 --
NM_017848chrX124644 4100 4033 3887 3660 3463 3313 2845 1264 1140 689 90 1385 ----
NM_017922chr142454 180 --1500 1609
NM_017925chr951761 1376 1212 778 205 1310 --11880
NM_017926chr142872 201 ------
NM_018015chrX2102 56 --1821 1760
NM_018018chr1241191 727 581 52 1625 21179 325 --
NM_018027chr1012099 1569 1588 --
NM_018061chr121150 421 --21357 567 --
NM_018084chr2123145 2739 2690 2545 2274 2118 2097 1336 1042 563 465 401 22215 1188 1340 --
NM_018117chr103248 240 215 --1282 --
NM_018121chr1032366 757 480 --12022 --
NM_018133chr352102 1980 1955 1701 519 --1841 --
NM_018157chr1242552 1319 574 28 --13289 --
NM_018181chr1871920 1611 1354 681 228 117 94 --11942 11978
NM_018184chr34775 642 408 380 1284 11506 --
NM_018191chr1352136 2106 2074 1812 738 --1633 --
NM_018211chr152227 2205 1873 503 491 1869 1271 --
NM_018223chr1211176 --1988 --
NM_018241chr41841 1230 ----
NM_018247chr672448 1244 1103 957 757 499 72 12130 32529 1227 964 2915 620
NM_018254chr162153 853 596 375 336 101 11759 --11745
NM_018287chr1031015 902 249 --1390 --
NM_018321chr5----167 --
NM_018325chr941488 1241 248 91 --1423 --
NM_018351chr12104700 3494 3322 3290 1722 1602 910 617 499 291 --24653 831 --
NM_018364chr1143645 3324 3253 3106 3004 2698 1575 1496 1481 1334 1191 1083 767 402 --32760 1452 1243 13754
NM_018370chr1242037 1869 1555 540 1409 --12229
NM_018375chr1431509 1225 260 2590 327 ----
NM_018409chr463147 2960 2851 2811 923 34 --32740 2022 810 23246 324
NM_018425chr103380 338 26 --12476 --
NM_018427chr1631501 1268 1250 --21365 1284 --
NM_018439chr1832509 616 402 --12670 --
NM_018440chr8188406 8313 8247 7331 6735 5396 5286 3464 3271 2863 2471 2269 1386 1378 1163 714 368 89 --15268 17426
NM_018444chr882044 1530 597 574 374 140 122 69 --11816 --
NM_018482chr872612 2585 2554 1689 1603 917 780 ----1574
NM_018489chr132227 1585 1485 11684 ----
NM_018557chr241566 1145 235 78 11080 11714 --
NM_018566chr195127 4929 4452 4019 1963 1534 1293 1202 103 21845 581 24792 1023 --
NM_018584chr151003 878 814 498 346 --11184 --
NM_018638chr12175665 5363 5210 4435 4384 3757 3589 3515 2244 2011 1537 934 755 684 600 78 39 11450 64501 4138 4115 1893 1548 1524 --
NM_018650chr152250 2144 1448 885 801 12101 ----
NM_018685chr72983 287 --1832 1122
NM_018710chr841348 1263 1244 357 11285 --1153
NM_018841chr173801 3693 2790 2640 2627 400 295 22904 2619 23759 3065 --
NM_018898chr531836 1767 1650 11457 11777 1842
NM_018963chr2121464 594 --31420 1350 949 --
NM_018976chr1262546 2457 2359 2038 569 406 --1619 21076 455
NM_018979chr1262194 1896 1864 1753 144 48 1267 21656 870 --
NM_018993chr2031482 955 537 --1557 1593
NM_018999chr1094637 4121 3941 3881 1785 1646 1389 1023 696 --11845 1183
NM_019004chr782386 2320 1854 1715 1599 836 808 725 --22047 1723 1330
NM_019022chr18103184 2831 2661 2560 2095 2019 984 711 320 22 1589 1285 --
NM_019035chr4102096 1709 1607 1536 1278 805 740 726 141 134 --11635 --
NM_019050chr462194 1990 1782 1622 1488 792 11401 11641 32226 828 437
NM_019063chr272125 2063 1899 600 459 285 216 21814 1573 --21671 748
NM_019084chr1042411 1987 1649 260 1933 12070 1273
NM_019087chr561656 1324 1298 1124 426 289 11138 21286 154 --
NM_019116chr1633634 3601 391 1119 22508 289 --
NM_019117chrX103496 3226 2619 1292 1172 748 702 400 287 279 22657 2198 --1955
NM_019600chr152288 161 1822 --1309
NM_019885chr262799 2768 2714 2658 2585 113 --12888 12944
NM_019891chr181213 923 856 510 502 437 199 142 ----1132
NM_020116chr441800 739 460 210 --2523 435 1200
NM_020122chr265927 5198 4255 2165 1039 329 25455 2283 45608 5584 4529 264 --
NM_020159chr461747 1676 1512 595 407 299 ----1175
NM_020177chr563306 3168 3108 2204 328 169 --1650 22551 1002
NM_020182chr2053401 849 394 313 143 ----13630
NM_020200chr104402 375 353 251 --1818 --
NM_020205chr1----11203 --
NM_020297chr1263302 3074 1451 1196 642 360 1576 --12624
NM_020336chr2063843 3685 2381 2375 835 813 12776 23491 1130 --
NM_020337chr462877 2818 2798 2390 1189 606 12767 22787 1067 --
NM_020338chr1063703 3596 3516 3376 3214 2326 --12902 --
NM_020341chr2041712 788 606 481 --2521 350 --
NM_020342chr292618 2561 2395 2289 2055 1980 1818 372 160 1452 1714 --
NM_020390chr3124227 4139 3823 3645 3244 3013 1898 1855 1379 883 849 839 --2898 224 --
NM_020418chr3----1593 --
NM_020432chr772093 1977 1936 1665 396 259 48 31686 815 707 1655 --
NM_020456chr1332195 384 93 --1172 --
NM_020474chr1841872 1808 438 278 11851 22057 2039 --
NM_020640chr332300 826 343 --31648 1419 899 --
NM_020648chr1852196 1915 1090 1040 566 --12220 --
NM_020651chr221365 720 --21832 604 11407
NM_020661chr1221482 131 11275 --11624
NM_020666chr55377 352 125 82 30 --1366 --
NM_020708chr2042469 2186 2083 1538 11810 22457 1912 --
NM_020715chr1482256 2209 2084 1409 654 632 338 75 ------
NM_020717chrX84558 4470 4122 3432 3113 1835 1512 269 24491 3999 11710 1340
NM_020718chr1655217 4247 2285 1482 551 21876 582 11353 --
NM_020734chr1253202 2053 986 875 79 2279 97 22148 302 --
NM_020748chr1782177 2156 2004 1689 1624 803 711 685 ----32070 1960 825
NM_020760chr211421 ----1479
NM_020772chr17168465 7971 7951 7466 7451 6957 6220 5462 5428 5333 3354 3037 1138 892 536 77 --2842 637 16552
NM_020794chr171558 1521 1344 1195 486 428 126 1637 11152 11309
NM_020801chr5112514 2488 2368 2208 2072 2015 1986 1898 1812 872 416 3548 333 237 22245 2194 --
NM_020809chr1172141 2097 2038 2003 1535 898 262 --1173 1127
NM_020810chr1442274 2235 301 256 22257 639 12919 --
NM_020839chr321393 588 128 11118 --
NM_020856chr1931471 562 395 --11179 --
NM_020858chr1582328 2224 2059 1971 1847 1775 1726 699 --1326 1303
NM_020870chr411688 11803 21900 1789 --
NM_020917chr1993357 3129 2750 2706 1431 1355 967 326 276 32640 1442 78 23254 927 --
NM_020935chr293500 3462 2855 1852 1439 1083 971 920 755 34003 2960 452 23039 162 1953
NM_020940chr1042229 2213 390 301 --22922 1891 12464
NM_020964chr1864760 3973 2951 1664 1365 1265 14639 --14727
NM_021003chr141829 ----1310
NM_021038chr3102797 2253 2243 2137 1108 1075 944 751 529 244 1331 --12345
NM_021072chr552172 1978 924 886 660 22377 56 134 --
NM_021090chr2284375 3756 1881 1831 1466 1289 653 500 --23628 2004 --
NM_021097chr243023 2133 2098 132 12645 --11995
NM_021101chr372464 1566 841 806 361 341 59 3582 371 259 --1159
NM_021111chr93209 155 88 --31160 1115 26 --
NM_021117chr11------12303
NM_021132chr1021361 854 ----1939
NM_021167chr731808 1105 970 11996 1153 12239
NM_021183chrX52303 1020 988 309 203 --1513 21864 359
NM_021190chr111109 --11227 11085
NM_021239chr1441326 348 306 164 1209 ----
NM_021259chr16----11177 --
NM_021620chr61504 --1681 --
NM_021629chr3145098 4696 4614 4385 4153 3875 3864 3112 3096 1652 1315 1138 428 51 34405 837 263 34013 3899 1498 --
NM_021639chr13896 835 753 1608 1103 --
NM_021818chr1481410 1307 487 431 405 218 91 45 --176 1948
NM_021960chr13558 514 466 11914 1614 11110
NM_021961chr11137361 6258 6090 5350 5075 4735 2306 2234 1380 1002 947 624 348 16006 --14965
NM_021964chr3216619 6608 6198 5909 5860 5561 5225 5207 5196 5023 4733 4516 4176 2630 1947 1848 864 846 659 418 27 34309 4022 2396 36010 1611 1354 --
NM_021973chr43743 729 614 ----1754
NM_021977chr663777 3756 3653 2684 186 119 23243 1128 11183 --
NM_022058chr272091 1911 1671 1607 1390 771 753 --41335 1327 1283 227 1612
NM_022073chr1451590 1320 344 281 190 --11640 --
NM_022130chr521392 1275 1479 --1520
NM_022133chr84760 401 269 61 1174 2662 544 --
NM_022145chr51467 --2277 235 --
NM_022451chr102854 797 1757 1904 --
NM_022459chr13125115 4838 4649 4576 4080 4003 3989 2289 2193 2165 1395 809 26367 5063 45377 5195 2498 1800 12264
NM_022465chr1293021 2620 2485 2318 2305 871 705 552 411 --12695 --
NM_022475chr42555 250 1198 123 --
NM_022484chr741044 537 302 208 --21440 889 --
NM_022491chr1253402 2745 2207 552 298 11178 13211 23459 2598
NM_022497chr333819 3791 3497 --23744 3294 --
NM_022574chr71258 1490 22178 1669 --
NM_022726chr651779 1536 1460 1225 227 --21580 1187 --
NM_022763chr3133142 2836 2709 2527 2410 2385 2043 1996 1040 841 105 65 32 1363 ----
NM_022780chr251559 1298 689 200 178 --31347 338 118 --
NM_022781chr973255 3130 2975 2680 934 901 588 --1667 --
NM_022818chr1641548 1458 1163 1100 --2311 262 --
NM_022831chr12404 311 178 --21653 1176
NM_022838chrX1258 ----189
NM_022841chr15102716 2275 2182 1889 1792 804 678 593 473 89 --1939 1457
NM_022893chr252874 2602 2165 1133 283 --12848 --
NM_022897chr541073 799 285 241 --1262 --
NM_022918chr1181678 1559 1402 1363 1353 785 277 115 11379 ----
NM_023039chr52129 98 --2453 169 --
NM_023927chr531307 1032 878 ----11184
NM_024052chr1753043 2982 2481 1081 764 11183 12850 --
NM_024090chr441475 1436 1227 510 11353 31464 1321 684 --
NM_024312chr1231597 643 578 --11547 --
NM_024315chr7----1325 --
NM_024539chrX91213 1086 786 473 373 198 159 131 107 --11272 --
NM_024573chr65896 856 824 784 694 --1391 --
NM_024594chr571389 1203 588 488 358 289 178 1298 ----
NM_024629chr451016 901 876 843 812 --11026 --
NM_024631chr111424 ----1194
NM_024638chr342497 968 480 458 --22381 2267 --
NM_024698chr11----11432 --
NM_024704chr2031129 425 184 1991 --1704
NM_024745chr1631106 214 31 --1454 --
NM_024808chr133895 600 223 1233 1172 --
NM_024824chr1441749 1086 258 65 11272 11634 1498
NM_024913chr761632 1139 619 534 508 396 1645 21344 356 --
NM_024920chr4101388 1366 1334 1312 598 586 330 190 96 34 11031 ----
NM_024947chr3199504 9444 8841 8800 8586 7982 6979 6777 6287 6100 5843 5825 5797 2016 1718 1103 909 556 138 16632 68508 7768 6735 3128 993 931 23394 2977
NM_024949chr454979 4590 4481 2014 1985 11334 --11481
NM_024953chr1252760 2224 1837 1716 983 1855 21854 937 --
NM_024989chr2188118 8049 8036 7926 6509 6209 6047 6026 5266 3266 2526 2113 2073 1833 1223 979 693 125 37482 5089 1897 37043 5503 753 15687
NM_025054chr8114186 3877 3471 3323 3128 2823 2810 2618 1409 1187 51 34150 3738 3316 13595 --
NM_025076chr21663 --1568 --
NM_025132chr4----124 1282
NM_025134chr1672592 2449 2304 1693 920 636 164 2789 280 3992 485 326 12199
NM_025146chr342067 623 545 457 --1159 12674
NM_025160chr1123989 3881 3529 3270 2661 1221 1186 865 790 599 365 107 11137 12694 --
NM_025179chr144618 3935 831 788 --34596 3113 1184 --
NM_025191chr153437 3281 3170 1156 75 12282 43558 3210 2803 736 --
NM_030621chr1474100 3451 3233 3038 1669 1639 1129 1774 13259 --
NM_030623chr271686 1626 1444 1417 1353 1288 277 --174 1470
NM_030625chr1052204 1053 901 544 502 --12618 --
NM_030627chr564132 3665 3210 2827 2686 305 --1382 23406 961
NM_030629chr1641891 1737 1530 660 --21930 1429 --
NM_030647chr7136209 5156 4585 4533 4393 4188 4084 3856 2297 2003 1167 1089 1080 21128 536 35127 4729 1732 --
NM_030769chr1------1397
NM_030791chr1431666 170 63 ------
NM_030802chr171678 --1917 --
NM_030809chr1262522 2509 2491 2173 673 583 --1448 12535
NM_030816chr163451 3350 2803 1117 828 84 12459 33283 2367 461 --
NM_030918chr145449 3738 3489 954 24483 934 14536 12153
NM_030920chr151888 1572 1560 1486 1330 --22094 2022 11818
NM_030938chr1741022 946 160 145 --1469 --
NM_031217chr114538 513 228 128 --1465 --
NM_031296chr462431 2325 2307 2144 522 422 1539 146 1720
NM_031372chr431043 453 267 21356 1053 11442 --
NM_031438chr531427 187 131 11451 21701 84 --
NM_031442chrX52984 2393 2142 897 224 22643 969 --12667
NM_031461chr871572 1544 885 529 440 229 49 --22295 772 --
NM_031483chr20143513 3496 3487 2954 2634 2506 2469 2330 2290 2172 1298 1187 675 287 13047 --13478
NM_031953chr43407 326 300 ------
NM_032042chr532492 2038 668 12595 12191 --
NM_032047chr352362 2118 1868 286 110 11544 1677 1829
NM_032102chr1143038 2971 2805 929 22700 61 12921 --
NM_032124chr181435 ----1263
NM_032144chr261847 1700 1558 1235 545 82 11741 --11662
NM_032145chr62155 86 41771 1218 606 524 31961 1335 423 11521
NM_032160chr1893871 3458 3210 2804 1697 1671 1512 1188 858 13049 --139
NM_032199chr10143888 3813 3748 3635 3603 3595 3567 3500 3277 3219 3080 2953 982 949 ------
NM_032208chr273308 2995 2767 1125 503 378 277 13449 22628 1201 --
NM_032217chr431320 303 78 1499 1968 --
NM_032228chr1183391 3372 3200 1078 1012 879 413 238 1166 ----
NM_032256chr1211057 1199 1866 --
NM_032293chr9152 ----1279
NM_032295chr731376 1250 1061 1965 --1350
NM_032312chr25837 818 688 607 229 1280 1936 --
NM_032352chr1421401 928 --2134 93 --
NM_032373chr10185860 5773 5749 5533 5188 5113 5007 4666 4600 4585 4437 3843 3624 1412 1317 950 412 294 33836 2373 382 24932 1727 14986
NM_032410chr82355 47 --1265 1118
NM_032440chr1052613 2538 2472 2021 699 42766 2225 1043 965 --12712
NM_032445chr1541780 1748 937 579 --22552 43 11662
NM_032446chr5113783 3635 3375 3323 2568 1369 1191 1152 1008 579 356 33137 2840 784 22601 1380 --
NM_032457chr473467 2983 2943 2848 1338 1101 159 --33857 715 598 1628
NM_032458chrX83075 2942 2725 2606 2547 2237 1291 134 3778 689 253 ----
NM_032510chr1851933 1781 1733 1604 286 --1309 --
NM_032521chr2073106 2952 2568 2097 746 457 134 --12305 --
NM_032549chr71117 ----1384
NM_032765chr51741 ----1708
NM_032810chr1021531 125 ----11023
NM_032857chr15--1184 1246 --
NM_032859chr13113960 3556 3470 3242 2653 1448 1439 1415 633 378 143 23770 3520 11556 --
NM_032860chr62200 177 --1186 --
NM_032873chr1133162 1646 851 21225 723 24119 3928 --
NM_032876chr1441895 1877 1466 158 11800 11667 --
NM_032900chr1063906 3417 3157 2807 940 230 --33917 3732 875 11364
NM_032905chr1021074 990 --11211 11040
NM_032968chrX164036 3986 3684 3556 3506 3303 3105 3038 2965 1699 1336 1314 604 555 449 315 --13814 --
NM_032973chrY154028 3978 3552 3502 3298 3100 3033 2960 1693 1336 1314 604 555 449 315 --13806 --
NM_033030chr23640 614 477 21275 137 31134 443 434 --
NM_033055chr131145 1066 432 --11125 --
NM_033081chr202997 204 --1104 --
NM_033132chr133907 675 622 --12097 --
NM_033211chr55648 504 491 387 71 11978 --1381
NM_033222chr931162 1127 368 ----1492
NM_033225chr863216 3096 2760 2259 997 524 1296 1458 --
NM_033266chr16------1472
NM_033387chr912615 ----12714
NM_033505chr2196495 5900 5391 4944 4879 4745 4720 4652 4470 4460 4339 2713 2707 2207 1897 506 52 42 29 36091 6065 1552 1577 --
NM_033656chr2195986 5923 4369 4358 4013 3669 2056 1466 768 24671 4621 35887 5157 1235 --
NM_052879chr1263125 2770 1424 662 392 190 34028 2498 728 1604 --
NM_052885chr12174500 4000 3489 3359 3207 3131 3048 1909 1851 1657 1636 684 622 277 203 191 126 11629 24711 136 24583 4303
NM_052886chr831912 735 473 11680 --31986 805 788
NM_052911chr182916 873 --21024 820 --
NM_052917chr293417 3240 3179 3169 3061 2966 2212 383 72 22425 790 13334 11260
NM_052932chr1162321 2210 2031 1879 890 832 --31986 562 85 12251
NM_052938chr1--11136 11201 --
NM_052950chr1341911 699 387 308 --11526 12262
NM_052971chr52122 64 --148 --
NM_053056chr1162666 993 876 863 614 504 ----12001
NM_053279chr832808 2075 1825 12583 12868 --
NM_057175chr452380 1670 395 343 55 12558 11026 22107 2097
NM_058170chr141446 633 485 395 ----11296
NM_080422chr182331 312 --122 --
NM_080743chr652586 2533 668 347 320 ----1739
NM_080867chr14134925 4528 4439 3891 2028 1513 1206 1083 611 486 410 351 51 1248 ----
NM_130469chr143866 720 694 1633 --1943
NM_130808chr33387 50 35 --165 --
NM_133329chr22743 569 --1486 --
NM_134470chr35707 605 580 468 166 1159 --1286
NM_138286chr19114096 4075 3859 3731 2962 2933 2840 1669 1019 830 574 33746 3624 235 13068 1121
NM_138357chr1031187 293 213 ----11859
NM_138426chr792228 2221 1974 1797 886 571 375 267 193 ----1108
NM_138459chr6113107 2933 2916 2825 2794 2536 2269 1405 1274 1164 957 ----11367
NM_138468chr2116340 5980 5451 4340 2172 2144 2059 1961 275 243 219 22034 973 34097 1013 871 1768
NM_138473chr1284956 3527 3483 2026 1768 1203 888 619 --24967 387 --
NM_138771chr741402 1376 1195 209 11058 195 --
NM_138782chr582360 2001 1947 1809 1487 909 718 175 21744 421 --1217
NM_138806chr31350 ----1250
NM_139246chr941680 1674 1562 656 1574 12381 --
NM_139321chr2044227 3502 3239 1390 11673 21646 218 --
NM_144563chr26755 712 681 671 640 275 ----1227
NM_144590chr1043018 2277 1922 955 --22575 648 --
NM_144599chr1565502 5221 5154 4247 2208 752 34407 4035 1137 33704 3335 281 22081 762
NM_144660chr102391 286 ------
NM_144710chr251131 1038 447 191 149 3532 522 503 21276 1099 --
NM_144712chr2------1282
NM_144778chr13112712 2515 2450 2390 2024 606 525 433 384 316 208 12416 22602 981 12733
NM_144973chr12105379 4430 4338 4169 3663 3628 3503 3490 2147 1586 --25093 286 --
NM_144982chr124802 771 747 677 --1557 --
NM_145000chr53483 394 59 1529 ----
NM_145012chr10----1983 --
NM_145044chr331669 605 103 ------
NM_145203chr132957 210 --1856 --
NM_145274chr174974 378 282 271 --1251 --
NM_145307chr10154518 4512 4366 4259 4107 3630 3471 3334 1571 1111 960 641 569 397 375 14206 24385 709 1810
NM_145693chr262582 2275 986 913 804 708 11806 12546 --
NM_145808chr783111 3101 3048 2830 2796 2750 1951 1249 12839 1106 12437
NM_147128chr751465 1311 644 291 255 1106 11279 --
NM_147156chr1031252 1119 379 21535 503 ----
NM_147166chr71677 1647 1596 --
NM_148170chr1165084 4799 2003 1022 887 662 24391 2106 15595 14747
NM_152263chr185975 5525 5193 5173 4466 1984 1342 425 --26115 1660 14769
NM_152271chr81258 11046 11193 --
NM_152407chr543057 3003 948 144 21186 554 --23263 3231
NM_152414chr831682 1185 383 ----2659 469
NM_152493chr121171 1144 11311 ----
NM_152556chr792331 2319 2053 1922 1714 1642 533 84 67 --12086 1819
NM_152594chr1572283 2261 2156 2131 2018 1917 626 --21677 758 --
NM_152622chr5113430 3199 3088 3056 3021 2943 2929 2358 1326 1199 1000 1807 13292 --
NM_152624chr5157397 7296 7250 7243 6874 6498 6254 6128 5622 5016 4514 2247 1957 1906 1466 35732 2288 1592 21342 341 --
NM_152632chrX2145 39 ----1597
NM_152641chr1262012 1905 754 621 379 337 12325 1795 --
NM_152688chr61261 ----1859
NM_152716chr1131669 541 202 --11545 --
NM_152754chr7123632 3293 3143 2576 2404 1487 1455 1137 1127 765 731 89 --53068 2731 2365 2342 743 --
NM_152756chr5104196 3800 3095 2809 2792 2745 1524 1430 1275 762 143 24035 896 --
NM_152758chr872629 2464 2265 1104 629 336 178 --1996 --
NM_152780chrX11021 1438 1401 --
NM_152903chr1352273 2103 2002 1927 1032 ------
NM_152991chr111283 --1537 --
NM_153020chr671543 1514 1449 1232 1097 362 153 --21482 1302 --
NM_153207chr1283913 3521 3190 1557 1193 737 472 145 23012 2945 53756 3629 2979 2705 1480 --
NM_153223chr551448 1353 1115 1010 475 1214 ----
NM_153235chr662039 1861 614 512 352 268 147 22091 675 42244 1946 1644 291
NM_153261chr1671554 1309 1299 649 244 226 136 --11614 --
NM_153362chr61213 ----1749
NM_153607chr593203 2735 2724 2435 1113 980 637 594 336 12370 2879 166 --
NM_153619chr15133566 3462 3297 3209 3085 3013 2964 2559 808 742 515 278 212 11054 --1556
NM_153634chr1281594 1330 1310 553 447 332 214 54 --31679 1342 411 --
NM_153689chr252160 2057 529 405 249 22198 2182 12219 11575
NM_153825chr441818 1505 1479 1454 11299 1703 1115
NM_170606chr721895 1708 11593 1598 --
NM_170665chr1294492 4465 4031 3828 3684 950 663 240 125 ----1285
NM_170672chr251581 1304 1186 383 257 1333 --1739
NM_171998chrX62502 2459 2331 1703 1601 28 11889 --12180
NM_172069chr272335 2194 1816 1785 1556 720 171 21533 1452 1333 1161
NM_172127chr41201 1713 1312 --
NM_173468chr4206025 5942 5691 5285 5238 5212 4625 4527 4345 4169 4147 1566 1415 1313 694 645 596 449 273 164 ----15348
NM_173475chr1631384 226 148 ------
NM_173497chr10148 11277 1176 --
NM_173511chr243674 3399 2801 733 23337 475 1676 13344
NM_173517chr73512 411 399 --1386 --
NM_173552chr392439 2362 2262 1615 909 620 278 258 211 --32516 1567 637 --
NM_173576chr1052200 1895 1570 1435 194 --11800 --
NM_173602chr1293809 3676 3620 3246 2869 1495 1401 1348 115 12414 1662 11423
NM_173683chr831751 498 220 ------
NM_173698chrX71735 1561 1311 739 724 714 390 11985 1822 --
NM_173808chr183893 3199 3086 1487 1042 630 472 350 1535 1156 --
NM_173822chr222049 91 12190 ----
NM_174890chr102324 147 ----1832
NM_175056chr361890 1753 1456 441 279 103 1553 --1249
NM_175061chr742002 1927 1405 554 11585 2855 816 --
NM_175607chr361513 397 358 157 85 75 --11726 --
NM_175733chr1162066 1994 1792 1504 414 381 --12231 1116
NM_175747chr641076 1029 445 299 --1731 --
NM_175856chr5------1719
NM_175876chr172059 2006 1812 861 806 187 85 --1922 --
NM_176814chr771402 1234 1117 1097 973 530 514 ----1131
NM_177968chr291872 1865 1855 1839 1634 622 334 231 23 --191 --
NM_178123chr23889 822 682 --1860 --
NM_178175chrX1559 --1668 1605
NM_181358chr1114128 1443 1247 1214 1183 1091 933 427 358 327 62 1598 11133 --
NM_181504chr583636 2769 2722 1037 1011 900 720 347 --11655 21618 927
NM_181521chr1656604 6507 5947 4645 4446 --21006 732 15436
NM_181672chrX42007 1789 589 77 ----11766
NM_181787chr8103635 3549 1219 1066 847 802 583 308 275 104 13893 21288 216 --
NM_181836chr582109 1911 1060 703 510 142 83 41 32055 1820 774 --1228
NM_182485chr4143737 3728 3604 3496 3472 3365 3266 3252 2946 2383 1403 1017 443 70 --23233 2756 12712
NM_182493chr1653266 2069 2037 948 510 23712 1569 24112 226 --
NM_182526chr1422246 1963 ----1432
NM_182559chr12------2259 237
NM_182607chrX61541 1535 691 593 308 206 ----11706
NM_182691chr72367 354 --21008 306 --
NM_182700chr751977 1796 1604 1462 1409 --11817 --
NM_182734chr20103057 2659 2653 2637 2305 1989 1202 841 610 238 11112 22958 253 --
NM_182830chr1442247 2116 1692 1598 ------
NM_182975chr13334 128 87 --167 --
NM_182978chr18--1655 1740 --
NM_183416chr11114 1275 11475 11487
NM_194282chr472129 2103 2060 1907 686 620 133 ------
NM_194285chr1183451 3387 2405 2302 970 797 162 99 1108 1681 13235
NM_194292chr191778 1456 1435 1409 1282 1268 385 137 128 2701 602 11330 --
NM_194314chr1165535 5448 5394 5086 4540 4453 4101 3904 2176 2092 1918 1635 676 459 194 169 34989 1748 590 12118 --
NM_194449chr182384 312 1940 ----
NM_197941chr542932 2505 463 157 12883 ----
NM_198076chr131869 1822 716 21722 1475 --1386
NM_198097chr72244 174 ------
NM_198243chr151268 147 1784 --
NM_198270chrX33287 2166 1308 11266 12802 --
NM_198402chr33335 246 55 ----1120
NM_198465chrX72746 2558 2215 2188 1893 905 202 11051 12871 --
NM_198567chr51344 ------
NM_198578chr1231162 422 57 21073 91 11244 3498 285 163
NM_198715chr1206156 6131 5810 5525 5214 5102 4981 4748 4403 4387 4374 2008 1295 1184 1007 893 871 801 764 530 24595 2435 55402 5351 4862 914 318 1508
NM_198904chr532145 565 547 11592 --12060
NM_198935chr2052516 2040 1288 863 203 --12306 32840 1245 906
NM_198947chr112882 183 ----1218
NM_198990chr7123336 3267 3205 3174 3148 3001 1306 934 904 484 442 239 --32929 2721 2545 --
NM_199129chr201829 --1160 11159
NM_201439chr12----2437 108 --
NM_203364chr1151264 947 809 291 212 --1115 --
NM_203390chr831766 1395 105 31564 1472 342 11756 --
NM_203403chr92997 465 --1159 1825
NM_203451chr1341948 1588 761 533 ----1844
NM_203463chr294353 4021 1674 1514 1187 1049 968 344 253 23379 789 --14283
NM_206854chr6134439 4380 4262 4037 3939 3893 1829 1758 1435 1316 557 301 207 23824 1541 43815 3634 533 111 13790
NM_207321chr103418 225 101 --2245 183 --
NM_207361chr13165878 4645 4521 4319 4304 4129 2418 2297 2224 1840 1672 1271 1000 283 265 163 22060 230 24784 70 --
NM_207406chr4116435 5216 4741 4139 2527 2073 2003 1620 1459 1188 199 25312 2427 16165 21691 722
NM_207517chr1561768 1733 1536 1365 227 186 1740 ----
NM_207577chr1142930 1097 790 490 ----12839
NM_207645chr1141093 260 239 182 --1229 --
NM_207647chr982565 2294 2001 1696 1593 1019 996 597 --12538 22185 980