TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-497-3p
miRNA Sequence: CAAACCACACUGUGGUGUUAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001001419chr532085 1954 1008 14358 13959 14010
NM_001001420chr532085 1954 1008 14358 13959 14010
NM_001002257chr243449 3361 3318 759 22390 993 --12677
NM_001003652chr1868458 8407 6246 5776 2545 1377 11113 32837 1656 656 --
NM_001009554chr454036 3867 3118 1466 1166 23780 501 11569 --
NM_001009554chr454036 3867 3118 1466 1166 23780 501 11569 --
NM_001039547chr347219 5349 3155 2562 139 15941 16617
NM_002015chr1352977 2599 2086 948 377 ----13022
NM_002025chrX79252 9060 9046 7258 6905 6877 1900 12102 29191 2988 --
NM_003108chr256686 5568 5098 2171 805 11105 26874 6122 11157
NM_003392chr333283 78 71 ----21390 161
NM_003463chr621295 1179 13197 --23208 438
NM_003574chr181966 --34766 3537 291 14002
NM_004171chr1136077 3782 3471 11628 --27869 6490
NM_005056chr1215401 11941 21957 79 2494 319
NM_005121chr1711370 1916 --23402 867
NM_005156chr954137 1412 1271 919 213 --35084 4696 1199 13993
NM_005901chr1868458 8407 6246 5776 2545 1377 11113 32837 1656 656 --
NM_005903chr532085 1954 1008 14358 13959 14010
NM_006252chr177309 6946 4736 4586 2994 2276 1034 15697 1332 --
NM_006599chr1677596 6180 5620 3239 3067 1652 59 11927 13016 27974 2901
NM_007038chr2165644 4567 2122 1191 1174 1156 22255 2218 ----
NM_012234chr322448 323 13217 23558 1093 1801
NM_015458chr833419 1211 753 35194 3286 912 --1389
NM_017709chr112642 1639 --21687 632
NM_018440chr887799 7003 6762 2832 2535 1617 1257 469 ----11364
NM_020772chr172508 340 37617 7568 7474 15509 13275
NM_021647chr454036 3867 3118 1466 1166 23780 501 11569 --
NM_024052chr1712763 --12100 22945 2454
NM_138713chr1677596 6180 5620 3239 3067 1652 59 11927 13016 27974 2901
NM_138714chr1677596 6180 5620 3239 3067 1652 59 11927 13016 27974 2901
NM_139279chr223465 2643 13317 --22992 2174
NM_152624chr585513 5171 4907 4615 2933 2488 2390 676 12760 15180 12713
NM_173214chr1677596 6180 5620 3239 3067 1652 59 11927 13016 27974 2901
NM_175861chr1256019 5120 4628 4235 743 24961 269 24249 1285 --
NM_182551chr243449 3361 3318 759 22390 993 --12677
NM_194434chr181966 --34766 3537 291 14002
NM_198270chrX43326 3027 2235 1335 13253 --1169