TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4999-3p
miRNA Sequence: UCACUACCUGACAAUACAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_181358chr162644 1647 1627 1497 872 693 11342 31237 893 890 --
NM_198268chr162644 1647 1627 1497 872 693 11342 31237 893 890 --
NM_198269chr162644 1647 1627 1497 872 693 11342 31237 893 890 --