TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4999-5p
miRNA Sequence: UGCUGUAUUGUCAGGUAGUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541530 1296 608 55 1239 11565 --
NM_000084chrX55203 2636 1741 1240 665 11692 12759 --
NM_000115chr1332582 2277 244 32403 1710 182 12395 12242
NM_000158chr32495 31 --199 1156
NM_000163chr522231 642 ------
NM_000165chr6------11114
NM_000166chrX--1637 ----
NM_000170chr9------1155
NM_000176chr553543 1207 812 598 504 13909 ----
NM_000217chr1234614 4072 759 ----25000 1386
NM_000222chr4------12029
NM_000248chr372299 2264 2048 1985 1123 929 705 ----22976 502
NM_000252chrX------11332
NM_000259chr1594610 4593 4197 3974 2387 1452 932 556 250 1207 12515 --
NM_000264chr932404 2374 205 32772 2339 834 --11046
NM_000314chr1073191 3046 2942 2653 1987 724 603 33128 2601 1119 ----
NM_000332chr696779 5790 5283 5124 4828 2821 2511 1430 750 26259 144 15395 --
NM_000337chr566568 6276 5504 2118 1956 728 --35382 4955 4074 --
NM_000351chrX32966 627 203 1788 --2734 659
NM_000362chr2223538 2396 --1933 1630
NM_000389chr6------11501
NM_000390chrX32397 504 455 13283 --12324
NM_000411chr212944 931 33121 2643 2235 --12762
NM_000430chr17--13707 --1972
NM_000444chrX1343 ------
NM_000448chr1142856 2719 897 742 42991 2212 1135 547 1866 --
NM_000461chr3104614 4588 4421 4217 4144 3501 1047 1021 971 548 2508 34 ----
NM_000462chr1541407 1172 660 292 --11523 --
NM_000489chrX32708 668 224 --22389 2235 --
NM_000555chrX127433 7302 7023 6802 6729 6601 5913 5873 4846 2979 1707 1406 21262 933 1335 1370
NM_000609chr1022051 897 132 12203 --
NM_000618chr1265043 2584 1746 859 825 460 --14432 --
NM_000618chr1265043 2584 1746 859 825 460 --14432 --
NM_000663chr16121 12895 ----
NM_000722chr7--174 ----
NM_000756chr8--1187 1112 163
NM_000786chr711420 ------
NM_000800chr5----11533 --
NM_000806chr551810 1607 1439 1305 520 11714 21242 185 --
NM_000807chr44557 547 117 66 3575 108 34 ----
NM_000809chr466178 6125 5832 1010 422 43 28173 8071 11483 18230
NM_000813chr575567 3913 3629 3588 3439 1023 56 --1278 --
NM_000814chr1544026 2716 1553 266 --2748 481 --
NM_000831chr196124 6107 5681 5130 4640 2368 2291 1928 398 14689 25225 829 --
NM_000866chr331905 1527 1393 1615 11502 --
NM_000875chr15106351 5201 5089 2749 2652 2294 1617 1258 1161 1036 16198 12346 --
NM_000880chr83742 70 22 1628 --1879
NM_000891chr1732891 1308 74 --12243 11376
NM_000901chr462437 2142 1940 998 933 487 --12079 --
NM_000902chr34864 467 143 22 --1379 --
NM_000912chr892934 2420 2359 2232 770 666 532 151 26 --23173 1062 --
NM_000921chr121158 ------
NM_000944chr43883 629 420 --12148 12119
NM_001001330chr101845 1942 11090 --
NM_001001395chr1222466 110 --22082 331 --
NM_001001419chr5145016 4695 4648 4634 4238 2072 1616 1086 1052 750 610 217 105 69 --1369 --
NM_001001420chr5145016 4695 4648 4634 4238 2072 1616 1086 1052 750 610 217 105 69 --1369 --
NM_001001481chr883051 2594 2356 1282 1230 754 717 224 1675 12189 1215
NM_001001484chr1042274 1855 739 232 --12112 12375
NM_001001928chr22138331 8312 7964 7408 7078 5945 5605 5584 5125 5054 2957 2517 240 15328 1917 16088
NM_001002243chr2----1809 --
NM_001002255chr6--1111 ----
NM_001002294chr1----1144 --
NM_001003652chr18138452 8285 8157 6951 6741 6583 6429 5652 2617 2152 2105 1820 309 22642 1451 --27044 843
NM_001003674chr1876891 5838 5166 4878 1528 1382 960 25565 1022 22133 1806 15272
NM_001003675chr1876891 5838 5166 4878 1528 1382 960 25565 1022 22133 1806 15272
NM_001003679chr142075 1804 1635 705 11435 ----
NM_001003681chr2232096 1674 238 11512 ----
NM_001003712chr1243932 3266 2693 663 33889 3675 2629 33199 2903 1544 --
NM_001003800chr943407 2658 526 27 2453 273 --12296
NM_001004065chr9103528 3462 3006 2669 2651 2548 1463 1372 1195 401 1455 13973 --
NM_001004106chr5163 --1273 --
NM_001004304chr1252297 2020 473 427 285 1219 ----
NM_001004317chr684395 3781 3644 3078 2985 2731 1317 282 23071 1168 --11254
NM_001004360chr22561 384 --1677 --
NM_001004419chr1263987 3767 3671 3006 2984 833 184 --13054
NM_001005404chr1744294 3627 3494 1091 21704 1447 ----
NM_001005473chr596559 6269 6182 5582 5244 4781 2559 2074 660 14212 36053 4302 1679 15692
NM_001005474chr321475 141 --1327 1406
NM_001005739chr22762 201 ------
NM_001006605chr1--1799 ----
NM_001006605chr1--1799 ----
NM_001006657chr252633 1024 983 716 465 ------
NM_001006946chr2--11235 ----
NM_001007024chr1774257 3529 3352 2881 2684 758 341 ------
NM_001007025chr1774257 3529 3352 2881 2684 758 341 ------
NM_001007067chr8--2732 387 ----
NM_001007068chr8--2732 387 ----
NM_001007069chr8--2732 387 ----
NM_001007070chr8--2732 387 ----
NM_001007088chrX----2951 866 1852
NM_001007097chr954647 4312 4151 970 206 31744 1392 276 ----
NM_001007466chr694825 4567 3872 3326 2067 1357 1283 546 125 ------
NM_001007471chr9----1777 --
NM_001007527chr53660 289 246 --1240 --
NM_001008215chr221155 336 11006 1373 11033
NM_001008393chr492834 2441 2395 1865 1826 1806 1156 445 82 ------
NM_001008539chr865244 4375 4353 3336 1828 497 21901 1139 14120 --
NM_001008564chr133463 357 73 ----11864
NM_001009554chr443721 1798 1148 59 14704 23825 3253 --
NM_001009554chr443721 1798 1148 59 14704 23825 3253 --
NM_001009569chr102356 128 1483 --1562
NM_001009899chr3116516 6352 5360 2051 1631 1311 1161 715 571 389 159 25303 4142 25755 4691 --
NM_001009909chr1153707 3563 3061 1103 325 13738 ----
NM_001010000chr1842386 1391 1216 914 1103 --12794
NM_001010888chrX54170 1514 1075 1032 304 --14486 23844 3137
NM_001010891chr545452 2477 1818 682 ------
NM_001010927chr6------1515
NM_001010986chrX72334 2062 1913 1768 1731 924 456 --1865 --
NM_001011657chrX11139 --2403 103 --
NM_001011663chr101142 ------
NM_001011666chr734559 4527 2106 26410 1408 34000 1028 287 --
NM_001011885chr1521288 1213 --21754 536 --
NM_001012393chr1174891 4500 3436 3425 3284 825 579 --23328 1714 11928
NM_001012426chr611148 ------
NM_001012427chr611148 ------
NM_001012515chr1862218 1841 1465 684 406 307 --1120 1195
NM_001012659chr393364 3244 2698 1380 1349 1140 865 354 21 --1347 --
NM_001012968chrX51920 1789 1716 723 410 11857 ----
NM_001012979chrX1155 ------
NM_001013399chr61398 ------
NM_001013406chr771361 1337 1288 1238 438 400 44 ------
NM_001013438chr33990 179 74 1784 ----
NM_001014797chr10107985 6820 5852 5342 5111 2881 1822 1454 1309 363 36582 5578 2486 17754 --
NM_001015877chrX11912 12215 12930 --
NM_001017371chr2--11270 11240 144
NM_001017926chr821673 1366 1445 --1258
NM_001018009chr3------11166
NM_001018037chr951207 1179 1022 987 44 ------
NM_001018074chr553543 1207 812 598 504 13909 ----
NM_001018075chr553543 1207 812 598 504 13909 ----
NM_001018076chr553543 1207 812 598 504 13909 ----
NM_001018077chr553543 1207 812 598 504 13909 ----
NM_001018676chr81491 --1398 --
NM_001018677chr81491 --1398 --
NM_001020658chr151691 1499 1422 1237 1096 --11173 --
NM_001020658chr151691 1499 1422 1237 1096 --11173 --
NM_001024094chr553543 1207 812 598 504 13909 ----
NM_001024226chr111170 ------
NM_001024227chr111170 ------
NM_001024228chr111170 ------
NM_001024647chr1256846 5708 4726 2423 650 --17187 --
NM_001024660chr341563 1087 517 446 --11202 1478
NM_001024934chr61186 ------
NM_001024935chr61186 ------
NM_001024936chr61186 ------
NM_001024948chr142979 2962 2281 454 22271 2216 22330 1341 --
NM_001025076chr10106193 6072 4374 4189 3906 2188 1083 753 599 377 35039 2478 2373 14065 --
NM_001025077chr10107551 7430 5732 5547 5264 2441 2111 1957 1735 1108 16397 15423 --
NM_001025079chr343818 2681 931 530 14022 ----
NM_001025105chr5--11479 ----
NM_001025108chr274091 3853 2795 1327 1175 1109 1093 12597 13734 1438
NM_001025580chrX33535 1652 859 1232 23310 1640 --
NM_001029863chr642545 1299 1291 1077 --12033 22672 949
NM_001030007chr1622486 277 1377 --11579
NM_001030055chr1433374 1897 95 23523 1678 11753 22999 1044
NM_001030272chr11164 ------
NM_001030273chr11164 ------
NM_001031695chr2224243 1360 34112 1556 89 13394 15248
NM_001031716chr241028 863 853 305 1155 ----
NM_001031804chr1643837 3241 3074 703 11067 13317 11677
NM_001032280chr6--11458 ----
NM_001033057chr341522 1373 593 408 11357 1718 --
NM_001033087chr2042802 2615 2401 826 --42857 2547 2330 1116 --
NM_001033551chr1743524 2521 1316 206 13614 --12717
NM_001033557chr221376 263 --21352 85 --
NM_001033561chr17--1696 ----
NM_001033925chr1031622 1430 810 --22129 1770 --
NM_001034954chr1073162 2960 2746 2554 2129 1274 821 1616 22307 96 --
NM_001034955chr1073162 2960 2746 2554 2129 1274 821 1616 22307 96 --
NM_001034956chr1073162 2960 2746 2554 2129 1274 821 1616 22307 96 --
NM_001034957chr1073162 2960 2746 2554 2129 1274 821 1616 22307 96 --
NM_001035003chr42396 269 21126 932 ----
NM_001035004chr42396 269 21126 932 ----
NM_001037132chr732205 1644 500 3663 546 140 2834 294 --
NM_001037133chr732205 1644 500 3663 546 140 2834 294 --
NM_001037165chr738455 7712 6092 ----18738
NM_001037339chr121312 576 ------
NM_001037340chr121312 576 ------
NM_001037341chr121312 576 ------
NM_001037341chr121312 576 ------
NM_001037535chrX41549 1066 330 129 ------
NM_001037536chrX41549 1066 330 129 ------
NM_001037540chrX41549 1066 330 129 ------
NM_001037954chr1143360 3300 1411 669 2405 375 ----
NM_001039538chr253208 3000 2853 1415 171 13104 --23112 765
NM_001039547chr356801 6273 6100 1887 1542 26667 1279 1444 --
NM_001039577chr154263 1368 1086 858 271 ----1480
NM_001039590chrX33525 246 52 --11381 --
NM_001039591chrX33525 246 52 --11381 --
NM_001039618chr1165736 5303 5218 4204 3704 816 14393 34260 1789 1363 --
NM_001039840chrX45412 4349 4180 247 12191 15971 22154 1130
NM_001039937chr1331562 1547 156 43601 2953 1414 926 1430 --
NM_001040020chr731536 1069 479 --197 --
NM_001040152chr734395 3468 523 11140 14258 --
NM_001040157chr412163 21978 271 12224 --
NM_001040181chr31786 ------
NM_001040182chr31786 ------
NM_001040183chr31786 ------
NM_001040199chr31786 ------
NM_001040200chr31786 ------
NM_001040284chr1664807 4214 654 520 508 319 --11565 --
NM_001040402chr472838 2190 2115 1279 1161 685 596 13176 12030 --
NM_001040441chr165105 4799 4246 4041 1971 676 23496 1458 --14884
NM_001040446chr542411 1872 278 78 --11833 12168
NM_001040633chr7----1935 2923 374
NM_001040665chr784278 3559 3281 1577 1374 771 309 298 --14022 --
NM_001040712chr932909 936 72 1742 1967 --
NM_001042388chr181392 1185 ----
NM_001042425chr6--11458 ----
NM_001042453chrX51701 1538 1388 342 328 1620 11339 --
NM_001042475chr61326 ------
NM_001042537chrX52392 2122 1669 740 730 2921 620 ----
NM_001042555chr1221370 927 33656 3626 214 --13824
NM_001042599chr277221 6340 6232 4906 4859 775 127 ------
NM_001042603chr1274873 1860 1415 1023 973 331 193 23879 3671 ----
NM_001042604chr354611 4543 4335 968 851 11234 11824 13843
NM_001042683chr611432 --1145 --
NM_001042749chrX51760 653 334 212 91 11902 177 --
NM_001042750chrX51760 653 334 212 91 11902 177 --
NM_001042751chrX51760 653 334 212 91 11902 177 --
NM_001043318chr1484011 3849 3754 3124 2522 364 195 89 --13055 --
NM_001044305chr621112 299 11640 11603 --
NM_001044385chr2------23858 2652
NM_001069chr6--1151 ----
NM_001071775chr1321501 276 ----199
NM_001100108chr197670 5900 3020 2979 2570 1774 1258 784 153 22121 351 2933 290 --
NM_001106chr3149515 9335 8765 8465 8228 7431 6773 6566 3550 3330 2776 2070 820 273 12435 1110 18693
NM_001128chr1622486 277 1377 --11579
NM_001148chr4----3700 558 220 1302
NM_001156chr10------2228 77
NM_001167chrX34785 2272 1417 --24970 4640 --
NM_001173chr1433374 1897 95 23523 1678 11753 22999 1044
NM_001178chr11164 ------
NM_001186chr2152850 2838 2790 2533 2318 32702 1049 318 32747 2511 808 --
NM_001201chr483836 3817 3655 3532 2755 2530 1174 735 --1776 13971
NM_001204chr297702 5900 5408 1648 1033 867 704 155 54 15673 ----
NM_001241chr231969 655 351 --11955 --
NM_001241chr231969 655 351 --11955 --
NM_001257chr1681522 1515 1460 1322 1033 1011 967 91 ------
NM_001259chr764886 1882 1625 1305 371 196 14923 12380 --
NM_001304chr1733637 1193 50 13182 --1219
NM_001356chrX------1747
NM_001378chr21374 --1204 1133
NM_001396chr2142433 2206 1090 520 12236 ----
NM_001419chr1924783 4083 14137 ----
NM_001431chr6--11184 ----
NM_001438chr183452 3407 2549 2228 1296 1252 818 692 ------
NM_001453chr621487 265 --11665 --
NM_001483chr72926 178 --1118 --
NM_001498chr621161 1079 147 2877 175 --
NM_001527chr654191 1860 604 546 449 14714 ----
NM_001609chr1063679 2931 1447 1329 592 343 --11041 --
NM_001656chr541983 596 576 408 1622 --11896
NM_001658chr111170 ------
NM_001695chr842946 1169 567 188 --1822 --
NM_001706chr3----11041 --
NM_001709chr1112887 --12346 1135
NM_001716chr11------11529
NM_001718chr611096 ----1846
NM_001730chr1341323 1084 653 305 ----1455
NM_001730chr1341323 1084 653 305 ----1455
NM_001735chr9----127 --
NM_001755chr1652115 1849 1780 1600 639 1546 1472 --
NM_001759chr1265192 4709 4688 2103 2067 721 34756 619 212 14453 --
NM_001777chr343818 2681 931 530 14022 ----
NM_001792chr18--1218 ----
NM_001830chrX23060 193 --21192 1000 1723
NM_001855chr9196 ------
NM_001858chr684264 4241 3880 3674 1118 602 546 462 21108 164 11223 --
NM_001882chr5--2476 416 ----
NM_001892chr5--11479 ----
NM_001901chr6----1947 --
NM_001918chr1118931 8905 8829 7202 6195 3178 2777 1843 1731 941 624 16341 --12743
NM_001938chr121821 505 1672 1319 11251
NM_001969chr1443397 3057 2848 1272 23533 220 21206 273 --
NM_001981chr141524 597 326 31 ------
NM_002006chr464046 3998 3930 3585 1145 94 ----1571
NM_002009chr1532085 598 394 1905 22578 2467 --
NM_002015chr1373317 3050 2679 2263 663 351 187 --12573 --
NM_002024chrX21423 591 ----1360
NM_002025chrX88994 8375 7890 7789 2629 1918 1866 1665 29161 2410 23687 1042 --
NM_002027chr81491 --1398 --
NM_002040chr2142339 1145 109 58 12453 11089 13228
NM_002041chr15154 ----1108
NM_002061chr111445 ------
NM_002077chr932030 751 316 ------
NM_002082chr5126 --1236 --
NM_002092chr444898 4227 1196 1087 --180 11964
NM_002107chr1------1402
NM_002126chr1763330 2915 2730 1585 1512 1426 11458 --23872 1557
NM_002128chr1352258 576 558 411 127 1225 1338 --
NM_002146chr1711076 ------
NM_002203chr563530 3171 2659 1477 991 717 12584 13482 --
NM_002210chr263546 2870 2432 1053 919 458 1857 --13079
NM_002214chr775508 5380 5205 4116 3924 3811 2206 34546 3990 388 23940 1986 14985
NM_002227chr1------1481
NM_002233chr11------1108
NM_002270chr555605 5533 1465 551 399 --34488 2023 1009 22280 130
NM_002285chr274091 3853 2795 1327 1175 1109 1093 12597 13734 1438
NM_002296chr141450 1396 1230 192 1663 21683 166 --
NM_002310chr526239 949 46465 5045 2002 1217 1839 --
NM_002312chr133887 282 132 152 1931 --
NM_002349chr221515 1507 1245 ----
NM_002351chrX1365 --178 --
NM_002374chr253208 3000 2853 1415 171 13104 --23112 765
NM_002376chr143465 456 389 ------
NM_002387chr565138 5104 4334 3664 3319 608 33144 496 48 --13902
NM_002395chr651441 1358 582 570 289 ------
NM_002397chr532009 1659 411 ----1168
NM_002408chr14--1347 1651 --
NM_002448chr41756 ------
NM_002449chr5------1302
NM_002481chr157897 7508 6954 2908 411 25465 1811 ----
NM_002487chr155783 655 647 127 90 ------
NM_002500chr241177 456 208 51 11113 1508 1239
NM_002508chr111994 --11717 --
NM_002519chr1141518 1479 1016 251 ------
NM_002537chr15------1834
NM_002545chr1174891 4500 3436 3425 3284 825 579 --23328 1714 11928
NM_002581chr994959 4205 3650 3538 2045 2039 1811 1618 1329 13941 25502 241 --
NM_002594chr2032244 976 101 --1198 12111
NM_002595chr1251939 620 260 242 197 11864 ----
NM_002600chr121312 576 ------
NM_002641chrX11926 ------
NM_002645chr1172367 2273 1935 1035 708 432 382 11177 ----
NM_002655chr8105263 5246 5074 4378 3801 3407 937 871 815 259 1651 --23629 1330
NM_002706chr21659 --1635 --
NM_002709chr263597 2559 1274 787 693 666 --1644 --
NM_002717chr81145 ------
NM_002721chr9--1177 ----
NM_002745chr2263152 1390 748 670 547 310 31088 1052 555 1365 --
NM_002755chr151275 ------
NM_002822chr1221628 57 21723 534 1285 11787
NM_002828chr182704 142 177 ----
NM_002833chr1511601 --21609 1169 --
NM_002835chr72788 261 --2593 507 --
NM_002838chr11186 --3912 106 88 --
NM_002839chr932909 936 72 1742 1967 --
NM_002843chr1163376 2972 2792 2144 875 601 12602 13086 --
NM_002848chr122920 178 31154 990 279 ----
NM_002851chr7--1227 ----
NM_002874chr932456 400 149 --1167 22173 863
NM_002886chr354886 4364 3961 3906 661 23951 230 1722 21535 990
NM_002892chr143671 591 266 ------
NM_002902chr15--1608 ----
NM_002906chr1142273 1500 596 482 ----12092
NM_002941chr33550 446 394 1375 --1543
NM_002942chr331233 1114 901 --11172 --
NM_002959chr153224 1381 1373 1319 161 --11354 1765
NM_002973chr121498 ------
NM_002977chr272690 2554 997 938 520 370 29 1234 ----
NM_002997chr2--11235 ----
NM_003013chr4--1624 ----
NM_003016chr1731362 1281 702 --21810 743 --
NM_003017chr661061 403 395 338 62 30 11161 ----
NM_003034chr1267387 5884 2465 880 590 287 27531 210 17462 12006
NM_003046chr865244 4375 4353 3336 1828 497 21901 1139 14120 --
NM_003068chr81942 ------
NM_003071chr381981 1844 708 570 555 442 411 65 ----11632
NM_003072chr19------1145
NM_003092chr20144 ------
NM_003108chr2107225 7049 5782 5323 5223 1451 1246 1187 981 722 14825 ----
NM_003111chr2--11270 11240 144
NM_003112chr742255 2215 621 267 43140 2860 2534 419 12691 --
NM_003113chr2--1217 ----
NM_003161chr1713091 23373 1087 --13341
NM_003183chr21646 --1274 --
NM_003199chr1855228 5068 1867 1725 268 14290 14629 11422
NM_003220chr6--11458 ----
NM_003244chr18--1335 1155 --
NM_003253chr2141277 748 720 440 21237 299 ----
NM_003257chr151104 21099 497 11199 --
NM_003262chr334726 4011 185 33424 887 230 --23960 554
NM_003286chr201379 ------
NM_003298chr3146139 5994 5933 5705 4127 4089 4080 4020 2150 1353 1097 863 653 541 11437 16004 11514
NM_003300chr14------1485
NM_003339chr5----11426 21109 138
NM_003340chr431169 1027 35 1525 --1408
NM_003369chr1132510 1960 261 ------
NM_003387chr21223 12535 11887 12491
NM_003390chr111140 ------
NM_003392chr384286 3791 3451 3238 1501 1481 1263 59 13696 ----
NM_003412chr33914 604 368 ------
NM_003413chrX41719 1458 708 108 11519 21501 570 --
NM_003416chr8144 ------
NM_003442chr11------2896 236
NM_003463chr672724 2406 663 584 393 271 177 12506 ----
NM_003468chr274068 3835 3266 2787 1362 1270 549 ------
NM_003472chr62492 388 1933 ----
NM_003473chr10--2727 701 ----
NM_003474chr1042274 1837 223 208 22171 1756 1423 --
NM_003489chr2133261 2586 987 --22915 1181 --
NM_003574chr1875636 4492 4230 1757 460 128 118 34276 887 724 ----
NM_003583chr1243627 1503 1460 883 22739 2375 23856 2411 --
NM_003590chr263772 3670 2898 1079 438 223 1111 2919 309 --
NM_003615chr323322 29 --23809 3038 --
NM_003620chr17----2871 112 --
NM_003622chr12--11796 --1522
NM_003626chr1131327 981 241 21194 502 --148
NM_003629chr162152 2146 1020 982 316 47 1387 11249 --
NM_003630chr62292 25 --1748 --
NM_003663chr352902 2716 2392 2368 132 12572 --12241
NM_003672chr121845 317 ----21858 747
NM_003716chr311002 ------
NM_003722chr332391 552 207 --12056 1357
NM_003750chr101655 ------
NM_003758chr1531365 1052 1002 21478 414 1357 --
NM_003758chr1531365 1052 1002 21478 414 1357 --
NM_003759chr474215 3718 3316 1606 1475 1249 1213 1923 1263 --
NM_003799chr1873847 3721 3321 1483 1426 1256 455 1350 --1428
NM_003818chr203989 703 207 --1169 --
NM_003870chr1551878 1833 1768 1525 292 ------
NM_003887chr242263 2025 667 573 22209 1496 12146 --
NM_003907chr3--1140 ----
NM_003909chr843075 2292 998 536 21941 1129 1483 --
NM_003913chr674184 3352 3334 1233 1038 825 239 1516 ----
NM_003919chr7------149
NM_003927chr181920 ------
NM_003930chr782153 2090 2010 1720 1653 566 310 138 1322 --12484
NM_003931chr61186 ------
NM_003958chr643425 3193 3053 2733 43751 2788 2717 953 12855 --
NM_003966chr545675 3002 1591 636 27767 602 37547 6484 2865 --
NM_004034chr10------2228 77
NM_004061chr5--1427 ----
NM_004094chr1411022 22365 1029 12122 --
NM_004100chr622202 1008 ------
NM_004124chr1422859 102 1638 --13269
NM_004130chr3193 1584 ----
NM_004162chr351276 1119 824 281 132 1340 ----
NM_004171chr11139273 8951 8815 8678 8498 8169 7985 7186 6718 2124 1988 1380 309 49385 7090 3030 2256 13023 --
NM_004177chr1111772 --1688 --
NM_004180chr21621 ------
NM_004225chr811097 31416 1238 342 1494 --
NM_004229chrX21656 756 12232 ----
NM_004241chr101542 1158 1224 --
NM_004268chr1141123 248 200 186 ----1214
NM_004280chr6----192 --
NM_004293chr922922 672 1136 11474 --
NM_004331chr822008 949 11932 22652 1638 --
NM_004337chr832188 1996 325 22042 425 ----
NM_004338chr1876891 5838 5166 4878 1528 1382 960 25565 1022 22133 1806 15272
NM_004342chr731780 1508 393 --21522 1435 --
NM_004346chr431012 282 259 ------
NM_004392chr1372272 1904 1733 945 850 282 245 1810 ----
NM_004432chr942260 1794 789 219 22318 1957 ----
NM_004438chr242874 2705 403 137 12089 12102 --
NM_004454chr342196 1829 1704 922 ------
NM_004457chr2131 --11571 --
NM_004458chrX62537 2349 604 574 358 196 ------
NM_004463chrX3653 486 199 --1635 --
NM_004492chr15------1183
NM_004496chr1421204 1127 ----1543
NM_004520chr5----1664 --
NM_004586chrX64269 3341 2066 1797 1226 238 ----2480 315
NM_004593chr31243 1640 ----
NM_004598chr553073 2689 1217 664 406 43142 3049 1024 387 ----
NM_004606chrX--188 ----
NM_004612chr984492 4116 3512 3146 1704 1598 1012 540 24304 121 --11726
NM_004621chr11--1858 11304 --
NM_004622chr222414 541 1736 1177 1418
NM_004637chr31379 --1931 --
NM_004641chr102356 128 1483 --1562
NM_004642chr124549 146 103 55 1272 ----
NM_004685chr1362707 2623 1121 1041 761 526 11910 ----
NM_004687chr17----52103 1378 1338 1310 1302 --
NM_004726chrX14036 15081 ----
NM_004734chr1332461 2208 1269 12333 12916 1421
NM_004745chr8106882 6541 5148 4887 4551 2621 1598 1124 634 57 17061 ----
NM_004748chr1542927 1354 1023 925 23651 1136 13968 --
NM_004774chr1732104 958 714 12717 1628 22768 1918
NM_004775chr1822250 2137 --1155 1545
NM_004801chr221068 993 1328 --11299
NM_004830chr6197 ----1826
NM_004831chr19--21000 273 ----
NM_004844chr3------11166
NM_004849chr61534 31470 1233 494 1632 1671
NM_004850chr231314 485 402 --11203 11388
NM_004857chr1474804 3072 3025 1174 431 242 183 ----24537 4067
NM_004859chr1772889 2616 2342 2098 819 623 602 ------
NM_004860chr17--1569 ----
NM_004865chr61128 ------
NM_004866chr553442 843 791 758 96 24918 991 11185 21845 1229
NM_004871chr1774257 3529 3352 2881 2684 758 341 ------
NM_004891chr21228 ------
NM_004898chr462853 2364 1896 544 417 110 12887 ----
NM_004904chr734559 4527 2106 26410 1408 34000 1028 287 --
NM_004906chr6--1464 2530 27 --
NM_004912chr771361 1337 1288 1238 438 400 44 ------
NM_004929chr841294 496 275 112 --1177 --
NM_004956chr754450 4311 1588 384 58 34585 1690 964 13903 --
NM_004960chr16----1277 --
NM_004973chr611637 11350 ----
NM_004985chr1284546 4340 4134 3640 3368 965 279 116 1750 --13458
NM_004992chrX68384 3175 2971 1862 1749 424 28030 1726 17653 --
NM_004992chrX68384 3175 2971 1862 1749 424 28030 1726 17653 --
NM_004993chr1441261 1072 1023 352 161 ----
NM_005010chr732205 1644 500 3663 546 140 2834 294 --
NM_005036chr22138331 8312 7964 7408 7078 5945 5605 5584 5125 5054 2957 2517 240 15328 1917 16088
NM_005045chr71255 ------
NM_005056chr1275117 2104 1659 1267 1217 575 437 24123 3915 ----
NM_005063chr1043780 3725 946 741 1127 1624 --
NM_005065chr1454865 3987 3923 1017 793 24944 1827 ----
NM_005077chr9--1496 ----
NM_005103chr112284 111 ------
NM_005116chr2033595 2976 296 21737 927 --13349
NM_005121chr1742603 2359 720 662 32568 800 751 ----
NM_005124chr6--11006 ----
NM_005126chr342164 2156 884 832 ----11870
NM_005134chr181392 1185 ----
NM_005154chr152660 87 ------
NM_005156chr964159 4001 3636 2051 885 669 15289 --15367
NM_005164chr121703 ----12508
NM_005180chr1051623 1561 1196 69 48 11164 ----
NM_005190chr61398 ------
NM_005197chr1431388 1224 977 --12136 14629
NM_005233chr352304 2289 707 532 402 --1286 --
NM_005235chr277221 6340 6232 4906 4859 775 127 ------
NM_005238chr1152312 1248 811 715 147 22995 2511 ----
NM_005254chr1551046 471 229 92 78 ------
NM_005259chr22400 111 2506 133 --1386
NM_005284chr6--1352 1188 --
NM_005302chr7--1337 ----
NM_005339chr473589 3312 1638 1310 1294 944 23 ----13032
NM_005347chr921591 132 --11571 --
NM_005359chr1835696 4848 1006 25330 1533 16380 --
NM_005399chr184405 4283 4179 3517 3426 2740 796 321 11758 --14455
NM_005415chr22790 78 ------
NM_005475chr1242725 2567 916 706 1906 --13149
NM_005487chr2232096 1674 238 11512 ----
NM_005497chr1776082 5627 4772 4533 2356 1688 787 21665 305 26167 216 --
NM_005502chr932614 2325 2119 12104 ----
NM_005504chr1265173 4105 2059 1516 711 423 14477 --25453 2483
NM_005573chr5----158 --
NM_005578chr373627 3570 3351 1904 1833 1264 836 14467 ----
NM_005585chr151278 ----1350
NM_005596chr976068 5868 5505 4722 1238 1099 642 24654 253 14362 15360
NM_005625chr8--2732 387 ----
NM_005648chr8------182
NM_005649chr5--1393 ----
NM_005665chr134057 3096 153 22982 1321 14356 --
NM_005668chr544321 3986 3662 709 24584 4243 21358 234 --
NM_005669chr551845 1817 1773 199 176 32222 1468 542 ----
NM_005725chr142293 2212 1745 418 ----2608 562
NM_005739chr1572372 2345 2061 1818 1582 789 543 1164 --11485
NM_005742chr2----1671 1731
NM_005749chr171503 1229 --1243
NM_005783chr2----1123 --
NM_005813chr231669 960 163 1972 1399 1670
NM_005822chr652367 1904 1806 1563 955 11818 --11557
NM_005832chr31405 1448 ----
NM_005840chrX86730 6290 5819 1727 1288 1064 1039 349 --22748 1824 --
NM_005871chr101757 1697 1769 1256
NM_005896chr21148 --1168 --
NM_005901chr18138452 8285 8157 6951 6741 6583 6429 5652 2617 2152 2105 1820 309 22642 1451 --27044 843
NM_005902chr1553977 2827 2800 436 51 33230 1546 1331 21633 927 --
NM_005903chr5145016 4695 4648 4634 4238 2072 1616 1086 1052 750 610 217 105 69 --1369 --
NM_005909chr554125 3450 2671 1357 1024 11281 14025 1867
NM_005924chr731115 847 412 ----1723
NM_005935chr454382 3881 1655 992 189 11109 ----
NM_005941chr894032 3865 3673 3423 2594 1389 961 682 619 12576 22776 723 --
NM_005964chr1741070 390 253 192 11145 131 --
NM_005966chr252297 2289 1967 1924 485 11608 22120 379 --
NM_005967chr12--1706 ----
NM_005977chr133771 206 114 1339 --1854
NM_006007chr964488 4402 4266 2759 1488 1401 21096 325 34318 4130 187 1801
NM_006037chr284540 3709 3618 1742 1736 1261 874 509 23476 1507 ----
NM_006047chr2053232 1363 1166 1152 500 1197 1115 --
NM_006051chr5179 1282 ----
NM_006060chr743658 3596 3430 2857 24108 1593 13539 --
NM_006153chr32264 175 ----1588
NM_006186chr21504 --1267 11007
NM_006203chr544988 4509 1860 1243 11898 15545 --
NM_006210chr193749 422 337 11113 1416 --
NM_006224chr1772529 2391 2371 2329 2038 542 260 ------
NM_006246chr1411053 2126 97 ----
NM_006251chr51171 22254 31 11309 1220
NM_006252chr157133 6669 5242 2304 942 34830 2339 1286 57066 6916 5910 5901 1046 --
NM_006275chr2031949 1703 227 11983 ----
NM_006282chr2074493 4281 4111 3982 1759 435 429 --11254 11439
NM_006298chr642503 2309 870 761 ----12494
NM_006306chrX65807 5605 4051 3775 1328 612 13681 25744 658 --
NM_006313chr1241717 1233 238 210 11114 ----
NM_006324chr16178 ------
NM_006330chr841457 1308 1180 438 ----1284
NM_006335chr1173 ----1256
NM_006359chrX52392 2122 1669 740 730 2921 620 ----
NM_006364chr141222 ------
NM_006366chr621202 1152 ----1139
NM_006379chr7--11630 ----
NM_006393chr1074382 3695 3450 3434 3189 1313 1142 12853 1403 --
NM_006415chr9------11052
NM_006434chr1073162 2960 2746 2554 2129 1274 821 1616 22307 96 --
NM_006460chr17145 --1570 --
NM_006482chr1243627 1503 1460 883 22739 2375 23856 2411 --
NM_006526chr2042201 1938 1661 165 --1473 --
NM_006538chr273719 3568 3543 2593 404 300 32 32736 1092 1076 197 --
NM_006544chr1495386 3770 2291 1733 1327 1236 1096 867 410 25791 576 1898 --
NM_006546chr1765175 4585 1729 619 461 353 34942 1306 544 ----
NM_006557chr921551 677 ------
NM_006561chr10106193 6072 4374 4189 3906 2188 1083 753 599 377 35039 2478 2373 14065 --
NM_006572chr171208 --12680 21124 425
NM_006577chr2----11052 --
NM_006599chr16106629 6417 6389 5967 3289 2031 1828 1463 1202 304 2976 780 56975 6514 5600 1898 1354 --
NM_006603chrX51760 653 334 212 91 11902 177 --
NM_006614chr342605 985 932 82 --2507 383 --
NM_006618chr131496 1031 651 1316 --11571
NM_006620chr653809 3074 1659 1550 66 54271 4213 4131 3786 3458 23096 35 --
NM_006625chr121189 326 ------
NM_006625chr121189 326 ------
NM_006625chr121189 326 ------
NM_006628chr1544328 1014 844 338 --13332 23185 730
NM_006629chr1842625 1924 1147 728 ----12191
NM_006654chr1221370 927 33656 3626 214 --13824
NM_006699chr172518 2104 2041 1800 1660 405 342 11840 ----
NM_006704chr13------1332
NM_006722chr372299 2264 2048 1985 1123 929 705 ----22976 502
NM_006726chr4----1275 --
NM_006731chr995749 5550 5388 4905 3524 1672 1011 324 204 13605 14225 --
NM_006746chrX41549 1066 330 129 ------
NM_006750chr1667979 2362 2086 1776 1758 1224 37572 2611 448 --38025 6510 1129
NM_006756chr811341 21081 1066 ----
NM_006775chr652758 2652 569 544 108 --12193 --
NM_006805chr52428 235 ------
NM_006811chr204710 254 165 125 ----1218
NM_006822chr171602 ------
NM_006827chr1473348 3255 2622 1191 1014 877 764 12088 11331 --
NM_006874chr431109 473 330 1216 --1379
NM_006888chr1433538 2301 822 --1323 1121
NM_006894chr1----1144 --
NM_006912chr142026 971 921 835 11695 11731 --
NM_006914chr931335 228 145 ------
NM_006922chr262450 1934 1729 561 315 41 --1965 --
NM_006924chr1754401 3536 3140 930 808 21360 1160 143 --
NM_006931chr1221546 326 --1442 --
NM_006948chr2152450 2405 1835 465 129 --12055 1922
NM_006956chr762065 2046 1832 1783 1756 631 1557 1905 --
NM_006962chrX----2951 866 1852
NM_006988chr2111068 ----1235
NM_007006chr161597 22829 1080 162 --
NM_007007chr1264377 4368 3363 1235 852 243 11011 23810 1002 13162
NM_007034chr12931 173 --1834 --
NM_007038chr2195826 4981 4631 4520 4447 4113 490 204 55 ------
NM_007040chr193966 404 328 --1317 --
NM_007054chr543871 3136 3098 284 23473 2535 1913 13971
NM_007064chr341563 1087 517 446 --11202 1478
NM_007067chr17--1103 ----
NM_007106chr133985 248 30 22776 704 12446 12690
NM_007107chr332076 1526 889 12159 12022 --
NM_007124chr62632 38 11540 --1304
NM_007137chrX84848 4676 4183 1709 1505 1370 1178 219 21453 411 ----
NM_007156chrX146 ------
NM_007157chrX22424 46 1639 12123 12881
NM_007187chr13----1208 --
NM_007203chr9103528 3462 3006 2669 2651 2548 1463 1372 1195 401 1455 13973 --
NM_007207chr11846 ------
NM_007210chr122650 555 ------
NM_007212chr142153 745 380 40 ------
NM_007222chr821673 1366 1445 --1258
NM_007246chr4----11000 --
NM_007249chr1378674 7999 6989 3742 3546 3035 1713 11131 --11561
NM_007271chr641539 1430 570 426 ------
NM_007282chr35812 351 283 249 118 ------
NM_007287chr34864 467 143 22 --1379 --
NM_007288chr34864 467 143 22 --1379 --
NM_007289chr34864 467 143 22 --1379 --
NM_007317chr16_random----162 --
NM_007347chr152937 722 2319 201 1909 --
NM_007373chr1021839 484 --21242 648 --
NM_012081chr543472 3406 2952 574 ------
NM_012092chr2--21644 1639 ----
NM_012095chr1043247 2924 2369 384 23280 2584 ----
NM_012096chr353769 3566 1356 535 449 --11468 --
NM_012120chr652767 1189 1169 902 639 1846 ----
NM_012129chr722245 2115 --11725 --
NM_012141chr1331562 1547 156 43601 2953 1414 926 1430 --
NM_012156chr2083187 2766 904 431 185 173 165 157 ------
NM_012158chr132604 276 11536 1430 --
NM_012164chr997220 5431 4800 2786 2774 2702 2668 1170 817 35025 726 439 22803 1028 --
NM_012175chr11------195
NM_012224chr411013 11117 1756 187
NM_012252chr784300 3914 3652 3598 2051 1728 1457 1424 1268 13525 --
NM_012255chr20142 1102 ----
NM_012257chr71702 1300 1910 --
NM_012262chr131431 1237 1173 --13996 --
NM_012287chr363525 3489 3396 3084 1311 641 14452 21094 54 21010 682
NM_012289chr19----131 --
NM_012300chr562494 2377 2110 2065 1956 844 12144 2938 659 --
NM_012325chr20------11206
NM_012328chr7--1556 1122 --
NM_012342chr10----1179 --
NM_012347chr652878 2338 1855 1189 683 --22085 50 --
NM_012382chr554468 4172 3430 2787 1218 1713 ----
NM_012388chr1583060 2419 2376 2171 1926 947 912 520 --13094 --
NM_012399chr221278 11981 1480 --
NM_012419chr6192 ------
NM_012426chr16----1357 --
NM_012428chr151414 2829 394 1327 --
NM_012454chr6------1515
NM_012465chr1012524 1102 --1708
NM_012471chrX1143 --11271 --
NM_012479chr752610 2549 2447 933 609 1594 --12261
NM_013231chr1473371 3057 2994 2870 652 265 142 13614 --14385
NM_013243chr151217 1125 2944 53 --
NM_013261chr442596 2557 1149 958 --22333 1168 --
NM_013269chr1263914 3694 3598 2933 2911 760 ----12981
NM_013296chr1--184 196 --
NM_013354chr831384 1198 53 --11093 1552
NM_013374chr362835 2778 2644 241 140 119 --12109 --
NM_013386chr121799 1121 1481 ----
NM_013396chr212348 143 --11256 --
NM_013423chrX31006 801 300 ------
NM_013427chrX31006 801 300 ------
NM_013438chr941445 1284 1204 484 3622 394 148 --1682
NM_013448chr141181 ----1226
NM_013450chr2--1834 1824 --
NM_013995chrX62396 2059 2014 1856 863 846 1218 11681 --
NM_014023chr1082532 2304 1804 1080 979 742 530 162 ------
NM_014043chr321086 457 ------
NM_014048chr1651952 1238 1065 814 195 ----1319
NM_014055chr121439 194 ----
NM_014089chr133463 357 73 ----11864
NM_014106chr1522481 1846 1402 --12419
NM_014112chr821556 1121 35243 4782 597 13754 --
NM_014141chr764598 4495 4473 3342 1741 198 25010 931 --14913
NM_014155chr1176818 6707 6616 2388 2305 1324 1161 36761 6548 2368 25015 1994 --
NM_014184chr1140 ------
NM_014243chr441449 741 651 467 1343 ----
NM_014250chr2232096 1674 238 11512 ----
NM_014252chr132285 48 --1359 --
NM_014253chrX52465 2168 1681 824 660 12022 ----
NM_014267chr11------1228
NM_014283chr12181 23 11137 11457 --
NM_014294chr821161 1001 11192 194 --
NM_014309chr2224233 1350 34102 1546 79 13384 15238
NM_014319chr1231759 716 493 11409 21839 396 --
NM_014331chr487522 6319 5298 5290 5208 2907 1751 207 15605 ----
NM_014333chr1142707 2525 2062 723 12281 22485 958 --
NM_014421chr462079 1447 194 188 125 88 21406 62 ----
NM_014423chr573967 3441 1354 1100 1053 739 577 2720 223 11093 --
NM_014445chr352110 2057 1981 1784 595 --1417 1247
NM_014454chr62910 47 ----1277
NM_014517chr3----1290 --
NM_014562chr21250 ----1815
NM_014604chr171118 147 ----
NM_014606chr451540 1482 1187 499 62 1159 21503 1059 --
NM_014612chr9----1356 --
NM_014616chr363463 3177 2680 2296 1041 921 11140 11157 --
NM_014630chr1553759 3613 2690 2656 908 21334 1306 13097 --
NM_014636chr964160 3798 1446 1120 920 607 23855 220 13186 --
NM_014666chr511237 ----21004 966
NM_014667chr371828 1562 953 927 859 666 282 --1642 --
NM_014673chr8--1103 ----
NM_014676chr151691 1499 1422 1237 1096 --11173 --
NM_014682chr831863 803 201 ----21894 707
NM_014702chr632892 1184 444 13420 11195 --
NM_014707chr762054 591 573 153 123 101 2740 606 --11507
NM_014717chr19171 1176 --1185
NM_014719chr7----11121 --
NM_014733chr552021 1782 1603 1397 628 2714 265 11979 --
NM_014743chr473030 2564 971 940 896 776 453 12897 --12034
NM_014752chr1151719 1447 315 309 274 11538 11963 --
NM_014774chr11331 11200 --12191
NM_014803chr1072918 2244 2020 1072 554 503 76 ----11867
NM_014824chr1111985 1361 ----
NM_014829chr532336 1794 1606 11584 11511 11637
NM_014832chr1322116 1602 --11628 11366
NM_014839chr162506 2411 2089 449 440 403 21946 391 ----
NM_014848chr1532360 1855 849 12494 22027 1999 --
NM_014873chr164611 4582 3517 2980 904 742 14500 1768 1750
NM_014876chr2221846 69 1508 ----
NM_014877chr17117700 7691 7285 6979 6844 6697 5955 4837 4765 2696 2086 11853 27430 6747 --
NM_014888chr731536 1069 479 --197 --
NM_014897chr1722935 2353 12786 12911 13026
NM_014899chr542850 713 341 239 12238 23116 120 --
NM_014901chr542059 2012 1623 677 21672 1533 1726 --
NM_014904chr101511 13273 1894 --
NM_014906chr1753497 1578 1094 374 159 12987 1356 --
NM_014912chr1072211 1418 1411 1197 193 159 80 12498 ----
NM_014915chr1051455 1442 1015 416 128 --1463 --
NM_014920chr673619 3189 2823 2788 2648 393 189 11172 1294 --
NM_014923chr1321864 1818 1116 ----
NM_014934chr1363759 3399 2896 2786 1349 501 1345 1668 3771 616 166
NM_014946chr233088 2984 2509 11157 12907 --
NM_014950chr1471699 1453 523 439 399 285 64 ------
NM_014953chr1364200 3571 3285 1691 1426 207 23388 1676 2243 90 --
NM_014962chr203850 701 160 12785 --1174
NM_014969chr131081 983 960 21031 799 --128
NM_014978chr1021624 1603 ----11754
NM_014982chr1494737 3731 3577 1743 1608 1310 1037 767 483 52008 1703 1690 572 462 --15400
NM_014988chr421854 666 11093 --12337
NM_014991chr452442 1258 1063 1017 168 23047 1214 ----
NM_015020chr1653621 3214 3101 2814 183 13888 1803 --
NM_015025chr272386 2233 2217 2070 2038 1959 248 ------
NM_015026chr1284089 3681 3657 3537 794 674 517 300 33261 1332 250 11542 --
NM_015032chr1321024 307 22441 2177 ----
NM_015054chr12131 ------
NM_015056chr2132154 961 40 1680 21871 1755 --
NM_015059chr15----1724 --
NM_015071chr556023 5893 4177 1298 521 15180 34262 2466 99 15820
NM_015074chr185002 4927 4909 4868 4855 4207 1400 963 1674 11424 --
NM_015094chr2274669 4586 4416 1846 1465 1294 439 ----177
NM_015097chr321824 512 --11799 --
NM_015115chr472838 2190 2115 1279 1161 685 596 13176 12030 --
NM_015144chr1623859 3417 --11040 13015
NM_015147chr272617 1181 938 812 671 559 492 1949 ----
NM_015155chr1042593 2351 2042 338 12566 12716 12809
NM_015156chr1473622 3511 2970 2653 1494 1170 592 --12864 --
NM_015184chr31134 ------
NM_015205chr1394847 4588 3517 3387 3265 1967 1108 408 53 --14818 --
NM_015208chr1853320 2805 1190 684 473 ----1707
NM_015215chr142279 1023 395 341 22157 598 ----
NM_015271chr423186 2931 23828 465 23152 1188 --
NM_015275chr1221745 125 1541 1399 --
NM_015286chr1561865 950 924 623 606 560 1729 --11700
NM_015310chr898226 3243 3035 2918 2857 2158 1325 550 157 48308 2272 2215 790 15196 --
NM_015313chr1154757 4751 4745 492 87 ----1567
NM_015317chr252572 2352 1125 678 433 32170 627 357 ----
NM_015335chr1251900 1662 946 887 571 32557 2541 672 --12484
NM_015336chr1241703 1666 399 134 ----12275
NM_015344chr82498 490 197 1543 11362
NM_015355chr1731498 1285 1241 11934 --1175
NM_015361chr25839 819 378 212 125 1324 ----
NM_015365chrX33535 1652 859 1232 23310 1640 --
NM_015375chr134754 1054 508 24892 3956 ----
NM_015381chr2231668 817 355 22027 2002 ----
NM_015382chr143810 690 629 ----1207
NM_015385chr1073162 2960 2746 2554 2129 1274 821 1616 22307 96 --
NM_015387chr241549 646 258 94 11444 --11728
NM_015443chr171365 ------
NM_015446chr141536 1198 1160 410 --11682 --
NM_015455chr5103796 3702 3615 3307 2810 1551 982 881 430 143 --14152 --
NM_015460chr311743 ------
NM_015496chr8--1283 ----
NM_015508chr321449 273 --11001 --
NM_015520chr332220 2071 1106 22055 129 ----
NM_015530chr22977 741 1780 --1767
NM_015542chr101879 1472 ----
NM_015550chr733428 1200 495 11184 22709 902 1607
NM_015554chr1552795 2230 2211 2134 2074 12059 1270 12843
NM_015571chr652541 1867 804 774 733 ----11009
NM_015576chr352917 2513 2098 936 266 182 31181 1154 73 --
NM_015578chr1951478 1401 656 601 169 ------
NM_015602chr131675 286 242 21766 599 ----
NM_015695chr6------11588
NM_015850chr822401 1791 1431 1630 --
NM_015852chr753200 2352 2234 877 709 ----12842
NM_015906chr11110 24011 1371 23604 785 --
NM_015933chr32168 94 ------
NM_015975chrX41382 446 393 315 --1660 11585
NM_015995chr1595413 5406 5393 4000 3655 3421 3414 838 706 23703 1780 14580 --
NM_016037chr1--21148 748 ----
NM_016072chr122661 130 ------
NM_016076chr153060 2692 2408 2266 516 22078 281 --13182
NM_016083chr643375 2427 782 200 23824 1123 ----
NM_016094chr3------157
NM_016107chr541290 1080 342 152 21030 470 ----
NM_016132chr1532194 795 610 --11117 --
NM_016147chr112919 867 --1749 --
NM_016192chr21238 ----157
NM_016203chr7----1935 2923 374
NM_016206chr357080 6288 2704 723 648 37726 6569 32 48613 5983 1389 275 18513
NM_016224chr632236 1563 541 11672 ----
NM_016227chr12181 23 11137 11457 --
NM_016234chr101743 1712 ----
NM_016255chr632813 986 121 1894 --1952
NM_016260chr257241 5524 5256 5142 2063 26887 5241 11796 1610
NM_016271chr1842304 2213 938 490 180 ----
NM_016275chr332542 228 107 1947 1516 1531
NM_016322chr932951 1983 1207 22187 765 ----
NM_016376chr1773922 3551 1746 968 671 640 300 ------
NM_016395chr1541816 1716 351 55 --11495 --
NM_016441chr232348 2179 119 1156 2663 580 --
NM_016475chr141836 ----1510
NM_016513chr673619 3189 2823 2788 2648 393 189 11172 1294 --
NM_016516chr22762 201 ------
NM_016522chr11------11028
NM_016525chr9----1916 --
NM_016530chr1573839 3637 3494 3133 1156 1030 225 42577 874 413 26 ----
NM_016531chr483807 3710 3483 1294 1107 1033 599 487 34121 3457 807 13174 33732 3437 375
NM_016542chrX51701 1538 1388 342 328 1620 11339 --
NM_016545chr1--1873 ----
NM_016559chr331538 334 195 --1123 --
NM_016578chr111502 1647 ----
NM_016628chr10--1695 ----
NM_016654chr1551046 471 229 92 78 ------
NM_016655chr15154 ----1108
NM_017420chr1473632 3144 1231 1024 676 190 167 13504 12667 --
NM_017455chr151414 2829 394 1327 --
NM_017610chr1531340 587 155 --1168 --
NM_017628chr484899 4589 4494 2108 1997 1947 540 110 11085 14618 --
NM_017633chr642739 768 475 407 23915 3771 --13517
NM_017637chr998536 8171 6881 5813 2967 1783 734 628 604 39354 2538 765 --11286
NM_017643chr1762893 2365 2286 581 560 74 12185 1360 --
NM_017644chr363153 2083 1885 950 871 65 21976 1440 ----
NM_017645chr922642 2238 12423 ----
NM_017650chr755222 4047 1813 1758 642 --35144 774 738 --
NM_017657chr2----1809 --
NM_017658chr1433449 1740 1725 24034 790 ----
NM_017664chr131206 ------
NM_017676chr52478 210 11161 --11643
NM_017694chr221978 1778 21716 167 ----
NM_017709chr164240 4105 4002 2810 206 168 --13437 --
NM_017714chr20----1658 1757
NM_017719chr372452 2246 2016 1886 1840 1628 877 12254 ----
NM_017734chr11115 ------
NM_017753chr91801 ------
NM_017768chr11885 2671 312 ----
NM_017769chr1462916 2070 1278 358 230 151 --11039 --
NM_017778chr841323 1272 1054 217 1524 ----
NM_017813chr864227 4105 3604 1002 352 23 --25483 232 --
NM_017824chr102809 692 ----12707
NM_017831chr1883987 3619 3531 3332 1713 1148 964 760 24110 1028 ----
NM_017848chrX13567 ----1258
NM_017857chr114191 176 149 122 1668 ----
NM_017867chr4--128 ----
NM_017902chr10105558 4228 4082 3868 1850 1799 1436 1123 1034 752 --1628 --
NM_017907chr11------191
NM_017913chr91353 ------
NM_017925chr941730 1588 630 102 21636 1579 1771 --
NM_017964chr21845 ------
NM_017987chr101601 ------
NM_018008chr3--199 1340 --
NM_018046chr551897 1539 1425 199 144 --11945 11181
NM_018084chr242695 2484 2053 503 ----1495
NM_018094chrX--1276 ----
NM_018182chr17----1717 --
NM_018184chr321813 84 ----1428
NM_018195chr112632 45 ----2437 274
NM_018202chr11219 ------
NM_018227chr432988 2143 539 --13204 12314
NM_018246chr832315 1976 1929 22503 915 1824 12843
NM_018254chr142111 1866 537 368 1957 1685 --
NM_018286chr172629 375 ----1680
NM_018299chr883051 2594 2356 1282 1230 754 717 224 1675 12189 1215
NM_018328chr23335 326 65 1375 178 --
NM_018339chr931269 1141 107 11813 ----
NM_018340chr1694518 4393 3835 3716 3700 1082 877 597 519 24647 3171 1607 11143
NM_018362chr1162879 2746 2608 579 444 256 23588 482 ----
NM_018364chr153880 3280 2924 1285 436 1204 --33725 1213 1046
NM_018373chr1465729 4976 4182 2333 2013 1287 11642 11619 36419 4206 2316
NM_018374chr7115014 4805 3515 3422 1845 1775 1209 878 788 515 127 --1759 --
NM_018375chr14----21754 356 --
NM_018383chr251818 1722 1567 379 342 ------
NM_018403chr343786 3627 1243 946 44026 3961 648 632 13218 --
NM_018409chr452429 2298 2244 955 767 2565 65 --1278
NM_018425chr1021673 716 --22304 1717 12642
NM_018431chr202583 245 ------
NM_018433chr2------1476
NM_018440chr886972 6707 6537 3258 2948 2868 2300 518 47419 6637 2959 2751 ----
NM_018482chr842282 1589 496 376 12076 184 --
NM_018557chr221674 378 1218 2502 398 --
NM_018566chr174943 4815 4745 4465 4083 3768 196 23984 3497 11263 --
NM_018602chr1541364 1110 1081 177 ------
NM_018640chr1222466 110 --22082 331 --
NM_018682chr71571 1651 --1593
NM_018713chr1129 1106 1323 1888
NM_018834chr5--1162 ----
NM_018843chr7134 ------
NM_018898chr522316 928 12261 ----
NM_018899chr522316 928 12261 ----
NM_018900chr522316 928 12261 ----
NM_018901chr522316 928 12261 ----
NM_018902chr522316 928 12261 ----
NM_018903chr522316 928 12261 ----
NM_018904chr522316 928 12261 ----
NM_018905chr522316 928 12261 ----
NM_018906chr522316 928 12261 ----
NM_018907chr522316 928 12261 ----
NM_018908chr522316 928 12261 ----
NM_018909chr522316 928 12261 ----
NM_018910chr522316 928 12261 ----
NM_018911chr522316 928 12261 ----
NM_018947chr764976 4294 3811 1722 1699 1291 31094 979 958 13173 --
NM_018948chr121282 1142 11399 --1433
NM_018955chr17155 ------
NM_018976chr1252789 2695 2533 1891 850 42084 1847 1141 399 ----
NM_018992chr1611651 ------
NM_018999chr10124506 4234 4101 3894 3764 1956 1743 799 792 643 344 226 54622 4400 3601 1768 271 ----
NM_019001chr354611 4543 4335 968 851 11234 11824 13843
NM_019004chr781987 1869 1562 929 597 298 130 39 1655 1846 12346
NM_019030chr5----149 --
NM_019041chr63827 634 190 21850 49 ----
NM_019063chr211420 --21978 164 1932
NM_019072chr564207 4114 4006 3898 3698 2639 --14259 1254
NM_019102chr71162 ------
NM_019102chr71162 ------
NM_019555chr311184 150 --11598
NM_019593chr2092914 2859 2789 1269 1181 995 489 339 144 ----1978
NM_019857chrX11542 --1607 --
NM_019895chr31786 ------
NM_020116chr42730 646 1687 --21598 1576
NM_020122chr275989 5813 4641 1480 1156 595 387 24574 4342 --25925 5578
NM_020140chr12----122 --
NM_020154chr151232 ------
NM_020156chr7----1435 1198
NM_020159chr411392 --2484 467 --
NM_020177chr53851 693 444 12237 --1581
NM_020193chr1131207 998 239 ------
NM_020199chr511096 1816 ----
NM_020245chr694731 4473 3778 3232 1973 1263 1189 452 31 ------
NM_020336chr2033471 1213 354 11222 13622 --
NM_020337chr442696 1223 256 127 ----33092 2615 1961
NM_020353chr321472 67 ------
NM_020357chr331455 563 185 --1489 11260
NM_020416chr432090 790 282 11718 12179 --
NM_020432chr742230 1809 541 511 32319 2030 1865 ----
NM_020443chr166806 5920 5680 1645 1183 741 1355 16199 --
NM_020452chr1----12004 --
NM_020466chr643839 3317 1035 670 23725 106 ----
NM_020473chrX11926 ------
NM_020474chr1841263 748 728 593 ------
NM_020645chr111527 ------
NM_020686chr16121 12895 ----
NM_020698chr12179 ------
NM_020718chr1636565 4282 1317 36355 6078 5528 26573 4971 11455
NM_020727chr2154003 2936 2618 2597 720 --1184 --
NM_020731chr583039 2782 1239 1104 925 850 820 480 1153 13176 --
NM_020739chr1542927 1354 1023 925 23651 1136 13968 --
NM_020742chrX31078 1045 548 12351 1635 --
NM_020752chr1042225 2036 1837 619 42909 2861 1130 690 ----
NM_020766chrX54500 4124 3743 1518 739 24320 4063 13517 --
NM_020769chrX--2957 653 ----
NM_020772chr17158482 8411 8341 8162 7999 7984 6839 6539 6107 5259 2386 1462 1301 323 164 21313 36 13058 --
NM_020774chr1855718 5385 4439 4184 1936 14098 14066 15285
NM_020779chr252633 1024 983 716 465 ------
NM_020791chr17197 --11037 --
NM_020801chr52662 367 2794 169 1518 --
NM_020805chr1821628 309 41920 1645 1487 591 ----
NM_020810chr1463521 3060 2944 2907 788 662 21018 975 23651 1068 11303
NM_020813chr1942886 2246 1129 257 --12766 --
NM_020824chr102161 148 1301 2536 98 --
NM_020825chr1643245 1447 874 671 --13660 13089
NM_020830chr273126 2904 2469 2449 2435 2327 361 12595 12166 --
NM_020841chr1243932 3266 2693 663 33889 3675 2629 33199 2903 1544 --
NM_020854chr1861454 1149 1117 598 443 281 ------
NM_020860chr41247 ------
NM_020868chr22561 384 --1677 --
NM_020871chrX------11979
NM_020873chr32305 157 ------
NM_020935chr264131 3626 3155 1415 728 686 --13347 --
NM_020948chr153615 3311 2302 760 552 1694 22335 1439 --
NM_020952chr9----1777 --
NM_020977chr4----3700 558 220 1302
NM_021005chr1511035 ------
NM_021033chr1363359 2958 2200 663 187 117 12496 ----
NM_021045chr1042274 2186 727 613 1996 142 --
NM_021083chrX32646 2498 646 ----23489 3364
NM_021090chr22104445 3916 3565 3527 1837 1817 1795 838 816 118 ------
NM_021097chr232193 1132 224 ----13018
NM_021116chr748886 7439 576 471 26827 368 27162 5768 --
NM_021148chr752373 2299 1767 641 586 1267 --1523
NM_021151chr741005 803 254 244 --11113 1214
NM_021183chrX32126 1574 259 2760 131 ----
NM_021215chr20--11996 --11921
NM_021252chr1022046 200 1693 11765 --
NM_021255chr1473523 3383 3141 2886 1033 985 494 1818 11626 --
NM_021629chr365068 1635 1416 998 63 56 1307 14574 14659
NM_021647chr443721 1798 1148 59 14704 23825 3253 --
NM_021648chr662560 1760 737 280 247 78 11814 ----
NM_021813chr675433 5398 4416 4182 2147 414 121 1838 ----
NM_021814chr621619 164 11089 11082 --
NM_021911chr575567 3913 3629 3588 3439 1023 56 --1278 --
NM_021912chr1544026 2716 1553 266 --2748 481 --
NM_021940chr621112 299 11640 11603 --
NM_021961chr11157478 5800 5355 4537 2263 2059 1233 1027 996 756 611 381 265 215 22 27106 1378 ----
NM_021964chr3116141 5963 5810 5130 4930 4866 4415 1672 1648 744 88 15280 35971 5703 2173 35036 1566 1374
NM_022048chr1585192 5125 4023 2270 1475 1060 286 58 2922 547 14315 --
NM_022166chr16106336 6303 5897 5844 4906 4397 4370 1889 1635 663 ------
NM_022351chr873431 3298 3165 1127 783 765 541 --23565 3241 1659
NM_022456chr1256846 5708 4726 2423 650 --17187 --
NM_022459chr1365015 4494 1968 1652 1501 307 --21298 147 45924 5841 1862 1526
NM_022469chr111325 42931 2804 1071 900 --12065
NM_022483chr541901 1621 1462 1398 1686 187 --
NM_022497chr373669 3646 3601 3446 2381 766 535 ------
NM_022659chr83530 433 169 123 ----
NM_022735chr14747 557 430 381 11867 11331 --
NM_022739chr1741055 991 859 92 ------
NM_022745chr142607 2576 611 338 11202 --1836
NM_022781chr983152 2244 2172 2077 1302 376 303 55 --12148 1361
NM_022784chr15------2863 154
NM_022841chr1511003 52706 2273 2188 1930 1922 12045 --
NM_022843chr132564 261 31260 1136 182 ----
NM_022845chr1652069 1803 1734 1554 593 1500 1426 --
NM_022894chr21251 1244 156 11766
NM_022901chr931595 649 637 --190 1180
NM_022913chr5----152 --
NM_022977chrX62537 2349 604 574 358 196 ------
NM_023000chr143671 591 266 ------
NM_023001chr143671 591 266 ------
NM_023012chr121614 ------
NM_023071chr1221136 74 11076 ----
NM_023074chr1911382 1913 128 --
NM_023105chr822401 1791 1431 1630 --
NM_023106chr822401 1791 1431 1630 --
NM_023110chr822401 1791 1431 1630 --
NM_023111chr822401 1791 1431 1630 --
NM_023929chr832058 476 369 22679 149 --32224 277 189
NM_024007chr533065 2859 984 --32988 2930 672 11268
NM_024324chr22----1190 --
NM_024345chr976112 5391 4926 4425 4147 4054 173 45323 5107 1084 216 --1201
NM_024408chr123664 320 13559 --11463
NM_024429chr7----1935 2923 374
NM_024501chr2------1663
NM_024539chrX--11126 ----
NM_024548chr31116 --11228 1406
NM_024551chr1252401 2238 2039 715 645 --12026 --
NM_024551chr1252401 2238 2039 715 645 --12026 --
NM_024567chr81543 189 ----
NM_024586chr12616 109 ------
NM_024594chr5----31754 225 196 --
NM_024631chr111623 --1218 --
NM_024640chr11785 ------
NM_024646chr142609 1554 354 280 1784 13153 11194
NM_024665chr364276 1505 1462 1365 424 113 24379 453 33599 1760 142 --
NM_024670chr1041765 1447 413 251 ----21361 1256
NM_024686chr12454 375 1548 ----
NM_024704chr20163 31043 926 863 --1124
NM_024713chr1521041 452 --21457 1021 --
NM_024740chr1163480 2660 2528 1526 1065 221 23629 939 11471 --
NM_024828chr921495 219 1613 --11093
NM_024899chr181267 ------
NM_024921chrX11805 --21448 487 1644
NM_024930chr542687 2651 918 73 1195 --1310
NM_024942chr10----2291 197 --
NM_024943chr41833 ----1338
NM_024947chr3169498 9205 9097 8355 8103 8004 7786 6663 6486 3641 3036 2692 2633 2567 2113 892 --33857 3018 1781 --
NM_024949chr494608 4471 3195 3181 1960 1933 1708 1276 492 --11771 11383
NM_024969chr2----1181 --
NM_024971chr9----1777 --
NM_024989chr2137814 7580 6244 5944 5864 5489 4960 3078 3069 2674 2018 1467 466 12978 --1335
NM_024991chr1073162 2960 2746 2554 2129 1274 821 1616 22307 96 --
NM_025073chr184696 4310 3763 3699 3495 3092 1334 545 13822 ----
NM_025126chr121609 1620 ----
NM_025134chr1662386 2363 2128 1029 366 357 ------
NM_025138chr132904 322 1353 1332 --
NM_025181chr22235 212 1623 144 --
NM_025191chr123329 1168 12982 32573 1240 1232 1237
NM_025203chr211268 ------
NM_025214chr1852546 1028 927 886 496 --22150 1037 --
NM_025221chr42396 269 21126 932 ----
NM_025238chr1531085 1010 636 --21551 333 --
NM_025268chr141393 ------
NM_030623chr24595 178 150 56 1556 ----
NM_030627chr553892 2651 2614 1302 152 23933 1057 ----
NM_030647chr735402 5314 1541 36077 4093 1009 15481 --
NM_030650chr253972 3824 1242 719 551 --11224 --
NM_030660chr1441261 1072 1023 352 161 ----
NM_030664chr1042274 1855 739 232 --12112 12375
NM_030667chr122920 178 31154 990 279 ----
NM_030668chr122920 178 31154 990 279 ----
NM_030669chr122920 178 31154 990 279 ----
NM_030674chr1284887 4698 4604 4213 3929 3755 1348 112 24569 2149 14925 --
NM_030755chr1452931 1080 1056 582 561 ----12110
NM_030786chr11534 ----11855
NM_030806chr1109372 7364 7040 6889 6015 5734 2831 1841 687 148 36504 3119 106 36373 3376 1797 28786 277
NM_030816chr153261 2817 2537 2466 45 13672 33566 2675 141 --
NM_030953chr521612 608 --21287 1070 1553
NM_031283chr21144 ------
NM_031296chr412273 11768 ----
NM_031411chr522316 928 12261 ----
NM_031418chr1152585 2147 793 590 387 22483 1955 1972 --
NM_031419chr321475 141 --1327 1406
NM_031422chr18------1552
NM_031442chrX62893 2750 2620 2600 2523 2193 1774 --12656
NM_031845chr253208 3000 2853 1415 171 13104 --23112 765
NM_031847chr253208 3000 2853 1415 171 13104 --23112 765
NM_031849chr522316 928 12261 ----
NM_031857chr522316 928 12261 ----
NM_031860chr522316 928 12261 ----
NM_031942chr21298 --11181 --
NM_032012chr995085 4886 4717 3820 3270 2102 1930 1230 141 --34606 3994 1069 14115
NM_032121chrX42468 2235 1847 21 --22770 620 --
NM_032154chr101142 ------
NM_032160chr1853559 1274 769 589 577 ----14293
NM_032181chr2--1367 ----
NM_032189chr1384649 4390 3319 3189 3067 1769 910 210 --14620 --
NM_032199chr1033685 3152 589 --11501 13661
NM_032208chr263356 2520 549 339 223 211 ------
NM_032217chr411247 ------
NM_032221chr2011434 1642 --1267
NM_032228chr1122900 355 1213 1765 --
NM_032287chr2284267 3688 3115 1033 1025 646 544 31 --13678 11270
NM_032291chr1--31727 604 183 ----
NM_032373chr1084607 2172 2137 1587 1323 1076 926 831 --34875 4805 4238 15915
NM_032439chr1051118 1099 606 597 305 1425 ----
NM_032441chrX11139 --2403 103 --
NM_032445chr1562519 2241 1808 997 570 88 1680 2286 259 11023
NM_032446chr563047 2859 958 829 529 400 13606 1381 13080
NM_032457chr483884 3667 3563 2594 1532 1331 1176 539 13057 ----
NM_032458chrX22242 80 12545 13260 --
NM_032523chr2176 ------
NM_032547chr4--182 ----
NM_032558chr911497 ------
NM_032598chr17--136 ----
NM_032689chr193486 174 23 1559 1109 --
NM_032784chr6------1390
NM_032826chr764796 4600 4128 3657 3399 1287 3699 594 381 --15298
NM_032858chr1161 ------
NM_032859chr1363733 3543 2944 1376 756 709 --12510 --
NM_032866chr1543157 1054 398 50 ----12178
NM_032867chr11------1549
NM_032873chr1164188 4007 3606 3310 3027 648 33441 1016 943 14495 --
NM_032875chr171789 ------
NM_032900chr1053146 2890 608 92 33 ----2698 269
NM_032918chr1221077 1032 1916 --1402
NM_032961chr431300 1182 1174 1262 ----
NM_032966chr11------11529
NM_032968chrX63798 1437 1208 663 137 43 2282 241 --14106
NM_032969chrX63798 1437 1208 663 137 43 2282 241 --14106
NM_032973chrY73790 2687 1437 1208 663 137 43 2282 241 --14098
NM_032991chr431012 282 259 ------
NM_033020chr11110 24011 1371 23604 785 --
NM_033081chr20--11164 ----
NM_033083chr321174 545 --13151 --
NM_033121chr1241604 1258 593 136 --21444 1276 1109
NM_033132chr1351926 1854 1825 1576 684 ----1733
NM_033138chr731780 1508 393 --21522 1435 --
NM_033139chr731780 1508 393 --21522 1435 --
NM_033140chr731780 1508 393 --21522 1435 --
NM_033143chr483783 3397 3019 866 717 529 309 133 ------
NM_033157chr731780 1508 393 --21522 1435 --
NM_033181chr643375 2427 782 200 23824 1123 ----
NM_033208chr161123 ------
NM_033211chr53658 247 157 1281 11686 --
NM_033222chr9121 --11373 1204
NM_033224chr798102 8056 5032 3111 2636 2324 1914 1017 625 --17903 --
NM_033225chr843014 2913 142 108 --23165 1105 1844
NM_033227chr51513 ----1426
NM_033228chr51553 ----1466
NM_033254chr31103 1486 ----
NM_033281chr51126 ----1656
NM_033285chr894469 3831 3735 1691 1604 668 636 252 70 --23638 589 14369
NM_033305chr951207 1179 1022 987 44 ------
NM_033360chr1284667 4461 4255 3761 3489 1086 400 237 1871 --13579
NM_033394chr231207 439 433 1643 ----
NM_033425chr1143360 3300 1411 669 2405 375 ----
NM_033430chr463906 3820 3595 1622 1350 292 1152 ----
NM_033437chr463906 3820 3595 1622 1350 292 1152 ----
NM_033480chr652878 2338 1855 1189 683 --22085 50 --
NM_033481chr652878 2338 1855 1189 683 --22085 50 --
NM_033505chr286695 6104 4936 4191 1650 1640 821 294 24514 1945 12452 25662 2306
NM_033644chr562494 2377 2110 2065 1956 844 12144 2938 659 --
NM_033645chr562494 2377 2110 2065 1956 844 12144 2938 659 --
NM_033656chr2195943 5542 4968 4957 4503 2180 1016 913 341 25095 1346 --1258
NM_044472chr11648 ------
NM_052879chr1211207 33845 2531 1081 11258 --
NM_052885chr1264699 4239 3808 3290 1461 1358 13776 44385 3499 3478 1713 11340
NM_052900chr841582 1323 365 133 ----11278
NM_052907chr1264036 3969 3490 1132 1051 637 12818 1788 --
NM_052910chr1322050 375 ----21465 652
NM_052937chr862669 2367 2350 2207 1969 583 12053 12463 --
NM_053016chr997688 6952 6043 5346 2993 2869 2401 2106 1539 58016 6175 2739 1497 567 17719 --
NM_053023chr1143200 2450 1155 730 12481 12761 --
NM_053042chr453170 3164 2785 2195 86 1568 --12797
NM_058175chr212687 244 ------
NM_058237chr14----1852 --
NM_058241chr231869 555 251 --11855 --
NM_058241chr231869 555 251 --11855 --
NM_078467chr6------11501
NM_078483chr573800 3370 3134 2935 2519 1040 23 11191 22632 1642 --
NM_080599chr101879 1472 ----
NM_080664chr14124 ------
NM_080676chr2042802 2615 2401 826 --42857 2547 2330 1116 --
NM_080678chr2140 ----1198
NM_080759chr1372272 1904 1733 945 850 282 245 1810 ----
NM_080760chr1372272 1904 1733 945 850 282 245 1810 ----
NM_080836chr20104289 3877 3511 3326 3048 1366 1279 1134 558 98 ------
NM_080867chr1434516 1197 452 --14936 14241
NM_080921chr11186 --3912 106 88 --
NM_080927chr362782 1232 518 254 138 80 --12366 --
NM_100264chr10--1695 ----
NM_100486chr10--1695 ----
NM_130391chr932909 936 72 1742 1967 --
NM_130392chr932909 936 72 1742 1967 --
NM_130393chr932909 936 72 1742 1967 --
NM_130436chr2142433 2206 1090 520 12236 ----
NM_130438chr2143010 2783 1097 464 12813 ----
NM_130838chr1541407 1172 660 292 --11523 --
NM_130839chr1541407 1172 660 292 --11523 --
NM_130847chr1194657 3872 1721 1138 881 695 452 284 28 --35718 5269 1290 --
NM_133172chr5179 1282 ----
NM_133173chr5179 1282 ----
NM_133174chr5179 1282 ----
NM_133334chr455959 5542 4961 4593 1934 44417 1470 596 299 --1566
NM_133510chr14------1288
NM_133631chr33550 446 394 1375 --1543
NM_138270chrX32708 668 224 --22389 2235 --
NM_138423chr1522195 330 1854 1219 12061
NM_138426chr711561 ------
NM_138444chr1384787 4124 3832 1925 1458 1126 681 174 ------
NM_138457chr611148 ------
NM_138468chr285729 4945 4307 1793 1029 829 819 195 11874 ----
NM_138554chr942209 358 197 138 32593 2003 1015 ----
NM_138621chr273719 3568 3543 2593 404 300 32 32736 1092 1076 197 --
NM_138694chr62413 201 23647 596 ----
NM_138713chr16106629 6417 6389 5967 3289 2031 1828 1463 1202 304 2976 780 56975 6514 5600 1898 1354 --
NM_138714chr16106629 6417 6389 5967 3289 2031 1828 1463 1202 304 2976 780 56975 6514 5600 1898 1354 --
NM_138731chr1464145 3501 3297 549 448 244 11007 ----
NM_138735chr221068 993 1328 --11281
NM_138771chr731312 1287 439 ----11147
NM_138779chr131184 --134 --
NM_138782chr542219 2086 1883 866 ----11690
NM_138923chrX--188 ----
NM_138931chr3----11041 --
NM_138933chr101136 ------
NM_138959chr1106616 5612 2340 2300 1998 1519 687 576 262 47 35393 1602 875 11963 --
NM_139048chr341144 1007 412 182 ----1795
NM_139068chr5----1728 --
NM_139069chr5----1728 --
NM_139283chr12----1571 --
NM_144571chr486679 5866 5815 5582 5570 1989 982 50 --1540 1402
NM_144590chr1052521 2178 1833 598 29 21203 164 12451 --
NM_144599chr1583569 2150 1947 1471 1413 932 423 187 21044 965 1799 --
NM_144633chr321429 213 --11235 122
NM_144664chr1131698 866 787 1619 --1151
NM_144665chr11------180
NM_144718chr321663 197 11972 1518 11967
NM_144728chr11846 ------
NM_144729chr11846 ------
NM_144732chr193966 404 328 --1317 --
NM_144778chr1342682 2170 346 338 1531 ----
NM_145049chr5----11003 --
NM_145176chr632840 409 378 ----22979 2616
NM_145251chr1431114 519 473 ----11594
NM_145259chr237118 2691 1231 45992 5355 615 116 16030 --
NM_145320chr733428 1200 495 11184 22709 902 1607
NM_145321chr733428 1200 495 11184 22709 902 1607
NM_145322chr733428 1200 495 11184 22709 902 1607
NM_145330chr21154 ------
NM_145350chr1711541 ------
NM_145725chr14------1485
NM_145726chr14------1485
NM_145728chr1561865 950 924 623 606 560 1729 --11700
NM_145735chr1352836 2626 2447 1918 263 32762 1014 787 1321 1484
NM_145739chr2176 ------
NM_145808chr732566 2137 2110 --11211 22606 771
NM_145810chr21298 --11181 --
NM_147150chr9103528 3462 3006 2669 2651 2548 1463 1372 1195 401 1455 13973 --
NM_147175chrX22060 142 --11640 --
NM_147181chr42396 269 21126 932 ----
NM_147182chr42396 269 21126 932 ----
NM_147183chr42396 269 21126 932 ----
NM_148904chr12616 109 ------
NM_148905chr12616 109 ------
NM_148906chr12616 109 ------
NM_148907chr12616 109 ------
NM_148908chr12616 109 ------
NM_148909chr12616 109 ------
NM_152265chr121423 1346 --21410 327 --
NM_152317chr12--1230 ----
NM_152352chr1821891 309 12550 --33031 2510 2471
NM_152373chr1--1648 ----
NM_152388chr2------23858 2652
NM_152407chr5--12715 ----
NM_152409chr552686 1410 1370 864 769 1368 13069 --
NM_152437chr12--12459 ----
NM_152470chr1853027 1435 1111 746 68 13306 --11571
NM_152556chr772262 1996 1817 417 195 174 114 ------
NM_152581chrX5487 448 410 368 210 ----1126
NM_152588chr12--11455 11635 --
NM_152608chr132065 1658 225 --12056 --
NM_152622chr563497 2763 1033 781 440 236 22822 34 --11296
NM_152624chr5146454 6381 5474 5032 2834 2525 2239 1324 1013 684 358 196 178 103 36839 5355 2048 26932 1702 --
NM_152625chr5----156 --
NM_152630chrX3390 124 100 11092 --11432
NM_152636chr11175 23072 2823 ----
NM_152641chr1262700 2493 1170 1096 761 657 12626 12799 --
NM_152660chr11118 ------
NM_152678chr322688 645 --22258 2023 --
NM_152695chrX31944 1912 336 2373 67 12237 --
NM_152699chr373144 3106 1099 354 320 278 265 23736 3134 1841 --
NM_152704chr131973 ----1826
NM_152737chr631959 1560 1554 --21697 759 --
NM_152740chr7----1733 --
NM_152756chr573536 1444 1096 715 399 348 23 ------
NM_152774chr742255 1909 1007 746 31731 1059 773 --1761
NM_152780chrX21235 233 ------
NM_152787chrX73217 2742 2602 1198 1118 690 374 11011 ----
NM_152788chr12----122 --
NM_152838chr2053232 1363 1166 1152 500 1197 1115 --
NM_152999chr784278 3559 3281 1577 1374 771 309 298 --14022 --
NM_153042chr641810 1787 1149 465 ----2705 521
NM_153050chr22104445 3916 3565 3527 1837 1817 1795 838 816 118 ------
NM_153051chr22104445 3916 3565 3527 1837 1817 1795 838 816 118 ------
NM_153184chr351949 629 617 332 197 --2262 247 12002
NM_153188chr555605 5533 1465 551 399 --34488 2023 1009 22280 130
NM_153207chr1263896 2938 2558 1571 1510 1460 23184 727 ----
NM_153235chr652217 608 386 251 182 --11748 --
NM_153260chr15--1103 ----
NM_153262chr122937 621 12826 22897 1225 1904
NM_153331chr31513 ------
NM_153371chr13--11648 11864 21882 1795
NM_153607chr563096 2834 2729 748 679 257 11961 11981 --
NM_153619chr1553072 2863 2472 1083 120 33516 2588 1413 13093 --
NM_153702chr41241 ------
NM_153810chr1045135 4747 3381 1531 43743 3254 458 453 21406 973 --
NM_153816chr61313 ------
NM_170695chr18--1335 1155 --
NM_170707chr11169 ------
NM_170708chr11169 ------
NM_170719chr132904 322 1353 1332 --
NM_170731chr1112887 --12346 1135
NM_170732chr1112887 --12346 1135
NM_170733chr1112887 --12346 1135
NM_170734chr1112887 --12346 1135
NM_170735chr1112887 --12346 1135
NM_171998chrX1922 12139 ----
NM_172037chr811016 21268 565 ----
NM_172069chr21454 --12263 1482
NM_172070chr211774 ----22164 683
NM_172103chr622202 1008 ------
NM_172105chr622202 1008 ------
NM_172127chr411491 ----11750
NM_173054chr71255 ------
NM_173082chr611169 ------
NM_173171chr21504 --1267 11007
NM_173172chr21225 --1575 11315
NM_173173chr21504 --1267 11007
NM_173207chr18--1335 1155 --
NM_173208chr18--1335 1155 --
NM_173209chr18--1335 1155 --
NM_173210chr18--1335 1155 --
NM_173211chr18--1335 1155 --
NM_173214chr16106629 6417 6389 5967 3289 2031 1828 1463 1202 304 2976 780 56975 6514 5600 1898 1354 --
NM_173468chr465997 4938 1929 1098 783 423 22403 1291 --25629 2066
NM_173469chr154399 391 163 62 21538 92 ----
NM_173470chrX82691 2646 2506 1090 802 741 213 172 32522 1034 397 ----
NM_173500chr15----11434 1373
NM_173511chr243482 3354 2974 2583 --23753 1297 --
NM_173531chr1942796 1352 779 730 1837 --13193
NM_173582chr1166112 4338 3881 1976 1548 563 1356 ----
NM_173602chr1241366 1251 1034 513 13674 ----
NM_173642chr188818 8239 7870 6069 2005 1976 1921 262 --13041 17513
NM_173694chrX82400 2128 1979 1834 1797 990 522 63 --1931 --
NM_173808chr143869 3845 576 70 13530 11292 34015 3066 963
NM_173825chr352931 2132 808 270 163 13115 21234 735 --
NM_173827chr462881 2860 2840 557 496 360 12123 ----
NM_173829chr5126148 5841 5768 5264 5141 4038 1725 1610 814 643 227 116 14625 21410 542 --
NM_174886chr18--1335 1155 --
NM_174938chr9----1185 --
NM_174978chr14----1770 --
NM_175061chr7----11692 --
NM_175607chr31457 2600 563 --1155
NM_175610chr151104 21099 497 11199 --
NM_175612chr31457 2600 563 --1155
NM_175623chr1256846 5708 4726 2423 650 --17187 --
NM_175624chr1266941 5803 4821 2518 745 41 --17282 --
NM_175625chr1266941 5803 4821 2518 745 41 --17282 --
NM_175736chr1277566 6923 6732 6322 5982 4877 2313 ----15059
NM_175854chr1331043 702 65 12783 ----
NM_175856chr5--1820 ----
NM_175859chrX11542 --1607 --
NM_175861chr1275643 4801 4680 4591 4042 3723 355 13735 ----
NM_175876chr162215 2176 1996 657 392 33 1279 11112 1575
NM_176812chr20----1671 --
NM_176814chr721294 1190 11165 ----
NM_177424chr121869 321 11721 ----
NM_177538chr288436 8274 5841 5642 5569 2629 2304 781 17707 ----
NM_177969chr21659 --1635 --
NM_177974chr1522195 330 1854 1219 12061
NM_177996chr2083187 2766 904 431 185 173 165 157 ------
NM_178011chr1052922 1219 1205 918 729 32904 1001 357 1905 --
NM_178126chr1751930 1734 1659 1547 838 ----11457
NM_178151chrX127433 7302 7023 6802 6729 6601 5913 5873 4846 2979 1707 1406 21262 933 1335 1370
NM_178152chrX127433 7302 7023 6802 6729 6601 5913 5873 4846 2979 1707 1406 21262 933 1335 1370
NM_178153chrX127433 7302 7023 6802 6729 6601 5913 5873 4846 2979 1707 1406 21262 933 1335 1370
NM_178313chr231454 688 242 1290 --11388
NM_178423chr7--2323 226 ----
NM_178425chr7--2323 226 ----
NM_178505chr1073484 3453 3006 928 834 445 290 --11209 --
NM_178509chr1723993 1251 1201 2784 503 --
NM_178566chr911863 ----21678 521
NM_178585chr452442 1258 1063 1017 168 23047 1214 ----
NM_178839chr21372 ------
NM_178842chr1522258 1868 1550 12114 --
NM_180989chr13----166 --
NM_181332chrX31078 1045 548 12351 1635 --
NM_181354chr851744 1587 1567 1523 137 21402 1334 185 --
NM_181358chr154062 2938 2652 1665 1081 13757 12777 --
NM_181359chr13930 795 195 ----1834
NM_181361chr31405 1448 ----
NM_181427chr15154 ----1108
NM_181443chr203850 701 160 12785 --1174
NM_181481chr1876891 5838 5166 4878 1528 1382 960 25565 1022 22133 1806 15272
NM_181482chr1876891 5838 5166 4878 1528 1382 960 25565 1022 22133 1806 15272
NM_181483chr1876891 5838 5166 4878 1528 1382 960 25565 1022 22133 1806 15272
NM_181504chr562687 2545 1217 1031 1018 961 --33388 1467 172 12801
NM_181523chr562687 2545 1217 1031 1018 961 --33388 1467 172 12801
NM_181524chr562687 2545 1217 1031 1018 961 --33388 1467 172 12801
NM_181672chrX41968 1819 1487 305 196 ----
NM_181673chrX41968 1819 1487 305 196 ----
NM_181714chr631627 723 135 --1365 156
NM_181780chr34663 594 574 206 1691 --1428
NM_181838chr5----11426 21109 138
NM_181876chr432090 790 282 11718 12179 --
NM_181886chr431169 1027 35 1525 --1408
NM_181887chr431169 1027 35 1525 --1408
NM_181888chr431169 1027 35 1525 --1408
NM_181889chr431169 1027 35 1525 --1408
NM_181890chr431169 1027 35 1525 --1408
NM_181891chr431169 1027 35 1525 --1408
NM_181892chr431216 1074 82 1572 --1455
NM_181893chr431169 1027 35 1525 --1408
NM_182485chr491313 1073 1002 960 685 641 609 327 79 ------
NM_182493chr1634170 971 859 14417 --21420 1106
NM_182515chr19125079 4729 4391 4385 4249 2590 2246 1896 1350 1306 1098 324 15355 --15926
NM_182527chr2221830 742 ----12193
NM_182646chr491313 1073 1002 960 685 641 609 327 79 ------
NM_182648chr141181 ----1226
NM_182717chr1011029 --2469 167 151
NM_182720chr1011029 --2469 167 151
NM_182721chr1011029 --2469 167 151
NM_182722chr1011029 --2469 167 151
NM_182723chr1011029 --2469 167 151
NM_182762chr745405 2277 1360 1161 45606 5264 5144 4670 15911 14405
NM_182765chr1042051 477 445 315 --12372 1256
NM_182830chr1432017 1806 268 11680 ----
NM_182853chr1011029 --2469 167 151
NM_182894chr1421660 621 ------
NM_182898chr734559 4527 2106 26410 1408 34000 1028 287 --
NM_182899chr734559 4527 2106 26410 1408 34000 1028 287 --
NM_182931chr71571 1651 --1593
NM_182972chr162080 2053 1882 1874 934 847 12814 --11061
NM_182976chr11201 ------
NM_183004chr1443397 3057 2848 1272 23533 220 21206 273 --
NM_183011chr1011029 --2469 167 151
NM_183012chr1011029 --2469 167 151
NM_183013chr1011029 --2469 167 151
NM_183043chr133771 206 114 1339 --1854
NM_183044chr133771 206 114 1339 --1854
NM_183078chr653331 3099 2959 2639 1501 43657 2694 2623 859 12761 --
NM_183238chr1293449 2921 1487 1424 1149 1110 1006 888 24 11539 12575 13838
NM_183381chr35812 351 283 249 118 ------
NM_183383chr35812 351 283 249 118 ------
NM_183384chr35812 351 283 249 118 ------
NM_183393chr311002 ------
NM_183394chr311002 ------
NM_194071chr754713 3682 1967 1649 1248 24854 549 --14776
NM_194247chr281488 1266 984 442 423 221 161 23 23982 1239 ----
NM_194271chr121609 1620 ----
NM_194278chr1484011 3849 3754 3124 2522 364 195 89 --13055 --
NM_194283chr533245 754 291 13011 --13658
NM_194285chr1153399 2602 1312 661 197 ----13113
NM_194292chr141604 1514 1490 162 11339 --11754
NM_194314chr145373 4069 3436 1062 21595 1190 14955 --
NM_194318chr132396 225 --22295 1967 1276
NM_194328chr983152 2244 2172 2077 1302 376 303 55 --12148 1361
NM_194329chr983152 2244 2172 2077 1302 376 303 55 --12148 1361
NM_194330chr983152 2244 2172 2077 1302 376 303 55 --12148 1361
NM_194332chr983152 2244 2172 2077 1302 376 303 55 --12148 1361
NM_194434chr1875636 4492 4230 1757 460 128 118 34276 887 724 ----
NM_194442chr141450 1396 1230 192 1663 21683 166 --
NM_194454chr771361 1337 1288 1238 438 400 44 ------
NM_194455chr771361 1337 1288 1238 438 400 44 ------
NM_194456chr771361 1337 1288 1238 438 400 44 ------
NM_194463chrX--11126 ----
NM_198123chr841582 1323 365 133 ----11278
NM_198124chr841582 1323 365 133 ----11278
NM_198128chr1842304 2213 938 490 180 ----
NM_198158chr372299 2264 2048 1985 1123 929 705 ----22976 502
NM_198159chr372299 2264 2048 1985 1123 929 705 ----22976 502
NM_198177chr372299 2264 2048 1985 1123 929 705 ----22976 502
NM_198178chr372299 2264 2048 1985 1123 929 705 ----22976 502
NM_198196chr331645 107 78 --12398 1293
NM_198220chr20144 ------
NM_198261chr121614 ------
NM_198262chr121614 ------
NM_198268chr154062 2938 2652 1665 1081 13757 12777 --
NM_198269chr154062 2938 2652 1665 1081 13757 12777 --
NM_198270chrX23199 2632 22668 760 --1142
NM_198279chrX21106 214 2810 185 ----
NM_198353chr4151 ------
NM_198402chr31348 ------
NM_198428chr73799 732 83 --1273 --
NM_198465chrX2755 591 1188 2738 163 --
NM_198581chr256477 6268 6031 954 146 16108 26097 2562 32572 2208 1395
NM_198715chr186149 4482 2335 2072 1875 1764 1033 478 11752 26166 4496 1543
NM_198793chr343814 2677 927 526 14018 ----
NM_198889chr411247 ------
NM_198900chr1277566 6923 6732 6322 5982 4877 2313 ----15059
NM_198968chr1363759 3399 2896 2786 1349 501 1345 1668 3771 616 166
NM_199051chr1147 ------
NM_199136chr7----170 --
NM_199138chr131973 ----1826
NM_199188chr1211207 33845 2531 1081 11258 --
NM_199189chr5--1162 ----
NM_199190chr1211207 33845 2531 1081 11258 --
NM_199320chr472694 1971 1946 1132 870 369 322 21989 503 --1561
NM_199320chr472694 1971 1946 1132 870 369 322 21989 503 --1561
NM_199421chr1434516 1197 452 --14936 14241
NM_199436chr233088 2984 2509 11157 12907 --
NM_199461chr1042890 2861 2822 1118 --21340 680 1823
NM_199462chr134754 1054 508 24892 3956 ----
NM_199464chr131131 ------
NM_199482chr241549 646 258 94 11444 --11728
NM_201437chr811341 21081 1066 ----
NM_201545chr151441 971 494 211 36 ----1305
NM_201613chr121312 1850 --1302
NM_201999chr431109 473 330 1216 --1379
NM_203327chr2033595 2976 296 21737 927 --13349
NM_203364chr11----11033 --
NM_203372chr2131 --11571 --
NM_203379chr101743 1712 ----
NM_203380chr101743 1712 ----
NM_203382chr541499 541 492 437 ------
NM_203403chr9--1240 ----
NM_203406chr552837 919 892 591 452 1556 ----
NM_203416chr122592 111 ----1383
NM_203437chr2----1809 --
NM_203459chr162602 2496 2424 2341 2165 2111 2578 550 12198 --
NM_203463chr274512 3098 3006 1951 1335 481 73 --1507 --
NM_203500chr19----131 --
NM_206594chr183452 3407 2549 2228 1296 1252 818 692 ------
NM_206595chr183452 3407 2549 2228 1296 1252 818 692 ------
NM_206853chr654080 3946 3513 3486 2507 ----13276
NM_206854chr675341 5207 4774 4747 3768 1146 898 ----24537 29
NM_206855chr696306 6172 5739 5712 4733 2111 1863 678 613 1778 2504 475 25502 994
NM_206866chr2152850 2838 2790 2533 2318 32702 1049 318 32747 2511 808 --
NM_206876chr263597 2559 1274 787 693 666 --1644 --
NM_206907chr51171 22254 31 11309 1220
NM_206909chr898226 3243 3035 2918 2857 2158 1325 550 157 48308 2272 2215 790 15196 --
NM_206937chr133887 282 132 152 1931 --
NM_206944chr9----1777 --
NM_206945chr9----1777 --
NM_206946chr9----1777 --
NM_206947chr9----1777 --
NM_207012chr1043247 2924 2369 384 23280 2584 ----
NM_207043chr12570 533 ------
NM_207044chr12570 533 ------
NM_207047chr12570 533 ------
NM_207299chr91801 ------
NM_207303chr1083344 2964 1483 1289 591 379 237 119 33985 1520 808 23176 1375 --
NM_207304chr1342569 2057 233 225 21025 418 ----
NM_207405chr432223 2024 445 21920 433 12068 --
NM_207406chr486352 6318 5672 5013 4960 4327 4293 2476 11766 --25896 2623
NM_207517chr15--21783 233 ----
NM_207577chr1112847 ------
NM_212558chr933990 1377 1298 11480 13146 13489
NM_213589chr295536 5381 4713 3948 1273 1239 1141 214 169 24748 1723 ----
NM_213609chr32878 166 ------