TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-499a-3p
miRNA Sequence: AACAUCACAGCAAGUCUGUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001003652chr18108486 8345 7834 7796 3369 2763 2480 1472 1186 245 ----17245
NM_001012755chrX83448 3338 3110 1489 1241 1172 834 709 14933 13876 13536
NM_001018065chr945511 3969 3804 2040 --12204 26028 4122
NM_001018066chr945511 3969 3804 2040 --12204 26028 4122
NM_001167chrX55475 4363 4240 4162 2573 16500 25324 59 14765
NM_002613chr1694631 4575 3436 3315 678 653 596 554 329 25201 4027 --15000
NM_005056chr1294926 4476 4312 1926 1339 1116 558 71 59 --14827 --
NM_005197chr1426057 4795 --35982 4850 731 26186 1068
NM_005504chr1296502 5099 4947 4605 4356 4321 1027 554 188 15142 --15154
NM_005901chr18108486 8345 7834 7796 3369 2763 2480 1472 1186 245 ----17245
NM_015879chr1865661 3233 1614 1456 752 602 25738 830 13046 16562
NM_017637chr958916 8836 6905 3619 2475 26199 555 27733 1192 13516
NM_018638chr1254671 4021 2241 204 170 35295 4410 506 25586 4820 --
NM_020772chr1768545 8527 8494 6364 5716 5494 11767 36033 5441 1376 --
NM_020844chr866444 6137 1817 1760 805 483 17419 --17322
NM_020951chr1922015 277 --11691 3748 733 684
NM_022459chr1396342 5954 5654 5235 4406 3842 2334 1894 1547 --24411 1633 --
NM_024665chr334146 4021 923 24530 4209 1806 13238
NM_024947chr3129192 8909 7357 7348 7237 6175 6159 6146 6140 3720 768 101 29290 3382 25851 305 --
NM_024989chr258194 5140 3276 2279 1716 28099 972 25282 192 15836
NM_031268chr1694631 4575 3436 3315 678 653 596 554 329 25201 4027 --15000
NM_032102chr1172854 2237 1968 1008 606 291 30 --12479 1443
NM_033394chr221444 1250 11180 --2407 392
NM_057175chr442475 2244 647 542 12074 22430 799 11783
NM_173468chr486011 5947 5535 5499 3930 2271 1178 806 12320 ----
NM_175861chr1265440 4528 4027 740 58 38 35935 4183 961 15260 --