TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-499a-5p
miRNA Sequence: UUAAGACUUGCAGUGAUGUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511236 ------
NM_000037chr812400 ------
NM_000081chr121697 603 --170 1241
NM_000088chr1721284 172 ------
NM_000090chr21207 ------
NM_000093chr922507 837 ----22431 578
NM_000096chr32952 274 ------
NM_000108chr781792 1604 1320 1294 1252 1207 749 505 2699 561 --11932
NM_000109chrX42124 666 263 94 22541 2287 12589 --
NM_000110chr12937 275 1799 ----
NM_000112chr5135498 5334 4962 4743 4415 4204 1770 1587 1569 540 516 502 308 --35258 1128 885 13836
NM_000139chr113218 110 58 --1545 --
NM_000141chr1011205 ------
NM_000142chr411306 --11363 --
NM_000163chr51785 1261 ----
NM_000165chr641581 1352 432 374 ----11716
NM_000168chr772989 2849 2780 2537 2283 681 212 --12029 --
NM_000173chr173416 382 107 ------
NM_000176chr533721 3318 95 2523 129 ----
NM_000189chr22743 731 153 21899 914 --
NM_000202chrX32610 218 183 23419 561 13114 --
NM_000210chr212336 21441 664 --1324
NM_000214chr203394 292 121 --2350 337 --
NM_000218chr11--1921 ----
NM_000242chr1042192 2122 1056 765 12632 12205 --
NM_000248chr392466 2209 1081 1005 908 814 735 708 525 --11981 --
NM_000251chr2168 --158 --
NM_000252chrX41196 1085 567 248 1283 ----
NM_000259chr1595994 5209 4989 4564 2481 2254 1688 1594 1438 24344 1382 --1732
NM_000264chr952755 2669 2508 2413 670 12270 23122 2234 1334
NM_000267chr1752965 2892 2877 2468 111 ------
NM_000268chr2243443 2793 313 229 23775 237 --12329
NM_000280chr1131011 759 661 --1405 1907
NM_000304chr171351 ------
NM_000314chr1041223 1002 287 147 --1298 --
NM_000325chr42671 639 --1547 --
NM_000327chr111268 ------
NM_000328chrX5373 302 150 122 94 ------
NM_000329chr11138 1106 ----
NM_000332chr696614 6405 6125 5987 1953 1793 1740 1708 1574 37142 6680 5136 25748 2034 --
NM_000333chr33914 790 286 1153 ----
NM_000337chr554825 4153 1732 1700 507 26454 6271 ----
NM_000340chr331159 1103 107 ------
NM_000346chr1721277 680 --11738 --
NM_000368chr933033 1826 1521 11896 24551 2970 --
NM_000390chrX53418 2298 1159 926 317 --22702 1082 12683
NM_000393chr212007 3608 537 139 --1197
NM_000397chrX2721 416 ------
NM_000430chr1723702 3000 1705 --11032
NM_000439chr582535 2381 2211 2202 956 748 721 423 ------
NM_000441chr732162 2047 381 --11964 32257 776 516
NM_000447chr1----166 --
NM_000448chr1152758 2690 2521 933 369 --22369 2356 1871
NM_000461chr343504 1665 986 227 14526 13497 --
NM_000462chr1541869 1299 739 585 21463 653 --1539
NM_000489chrX52878 2274 2238 2173 953 22183 488 31234 629 135 13461
NM_000492chr721091 128 1184 11076 --
NM_000495chrX--2827 29 ----
NM_000503chr841709 1555 1203 238 ----2666 136
NM_000509chr4----1148 --
NM_000522chr7--1183 ----
NM_000527chr1942472 265 111 63 ------
NM_000555chrX107247 7019 6650 5892 4786 1395 1388 1174 338 105 47310 6937 6223 5138 16158 --
NM_000565chr11928 21750 1555 ----
NM_000587chr551131 1100 993 978 952 ------
NM_000589chr5121 ------
NM_000615chr1152542 2456 1922 1144 915 ------
NM_000618chr1286399 5672 5486 4435 2325 2073 1625 456 1728 ----
NM_000618chr1286399 5672 5486 4435 2325 2073 1625 456 1728 ----
NM_000633chr1864918 4820 4083 3441 1511 176 14968 14457 14312
NM_000675chr22--1854 ----
NM_000681chr1011279 ------
NM_000684chr1011260 ------
NM_000718chr9----162 --
NM_000719chr1276241 4977 1990 1797 1537 1076 778 --26486 956 15451
NM_000724chr1031320 112 76 1313 2491 44 1653
NM_000726chr241415 1375 1366 1139 ------
NM_000739chr7------178
NM_000758chr51282 ------
NM_000783chr10152 ------
NM_000788chr42993 103 1121 1506 --
NM_000793chr1454767 4757 4428 1069 560 132 11573 --
NM_000800chr5--11512 ----
NM_000809chr4169157 8818 8112 7446 7409 6811 6469 6014 5920 5756 5715 3304 3221 1585 1288 1232 13313 --13402
NM_000812chr43302 128 122 --1142 --
NM_000813chr564498 4122 3632 3512 3404 979 13783 14955 --
NM_000814chr1554116 430 406 313 70 13478 ----
NM_000817chr211210 ------
NM_000826chr441961 856 518 413 ----11896
NM_000827chr53471 361 334 12491 ----
NM_000833chr1621110 21 ------
NM_000840chr71370 ------
NM_000859chr531351 319 93 ------
NM_000868chrX32607 2571 2138 22391 82 21044 550 --
NM_000875chr1566755 5954 2447 2194 1156 806 26399 5554 --176
NM_000876chr61128 ------
NM_000880chr8174 ------
NM_000891chr1763683 3629 3220 3128 2612 435 12718 ----
NM_000895chr121101 ------
NM_000899chr1253427 2934 2781 1496 182 11403 --23787 3323
NM_000901chr462207 2022 1603 1553 694 562 31576 385 356 11588 1317
NM_000917chr101910 --1316 170
NM_000944chr412060 --1806 2732 547
NM_000945chr232024 1577 1383 11418 1469 --
NM_000950chrX83618 3269 3050 2270 880 231 148 134 2980 329 12654 --
NM_000958chr531205 1163 902 11300 1992 --
NM_000963chr161782 640 347 246 223 211 12151 ----
NM_000965chr35863 476 393 135 91 ------
NM_000975chr1137 ------
NM_000989chr8--177 ----
NM_001001132chr21--1584 1954 1331
NM_001001323chr1262987 2602 2447 2144 1257 347 13185 12286 --
NM_001001330chr1041248 526 504 462 ------
NM_001001331chr342476 2302 923 474 ------
NM_001001395chr1211871 22523 1751 1335 --
NM_001001396chr143287 3272 2844 1168 ----24415 3412
NM_001001419chr5105162 3994 3961 3849 2087 1785 1016 870 579 383 146 21090 516 --
NM_001001420chr5105162 3994 3961 3849 2087 1785 1016 870 579 383 146 21090 516 --
NM_001001433chr2033011 2374 1283 12074 --1673
NM_001001436chr161817 ------
NM_001001481chr862892 2203 1234 1048 382 71 11145 13358 --
NM_001001484chr1032169 2154 1552 ------
NM_001001549chr752138 2112 1812 751 485 ------
NM_001001550chr752138 2112 1812 751 485 ------
NM_001001555chr752138 2112 1812 751 485 ------
NM_001001664chr233576 621 234 33207 2881 930 --13899
NM_001001715chr132458 407 ------
NM_001001852chr22--1740 ----
NM_001001872chr142623 207 --1602 --
NM_001001928chr2278335 8204 2315 1514 1489 1387 1266 58351 6472 1275 867 167 11405 --
NM_001001937chr18137 ------
NM_001001971chr10182 ------
NM_001001974chr102763 653 ----21539 1512
NM_001001994chrX--1415 ----
NM_001001996chrX--1415 ----
NM_001002257chr233528 1358 1215 --21385 1105 13500
NM_001002759chr10----1525 1495
NM_001002800chr321046 125 ------
NM_001002814chr843509 2966 1276 552 11329 --1211
NM_001002843chr1521284 207 21247 836 ----
NM_001002860chr1483898 3077 3056 1575 1484 1239 536 128 14114 ----
NM_001002919chr22452 145 ------
NM_001002926chr752046 1971 705 533 25 12722 ----
NM_001003396chr6129 ------
NM_001003397chr6129 ------
NM_001003652chr18148690 7563 7429 6633 6545 6305 6149 3431 3163 2312 1791 1326 875 249 16939 16073 --
NM_001003674chr18106839 6151 5924 4835 4665 2746 2451 623 374 132 2575 477 12174 11573
NM_001003675chr18106839 6151 5924 4835 4665 2746 2451 623 374 132 2575 477 12174 11573
NM_001003681chr2232046 2031 419 1103 --11655
NM_001003688chr441112 959 435 408 ------
NM_001003712chr12103845 3670 3550 3506 2673 1316 794 628 318 77 --1434 13093
NM_001003792chr351131 980 957 186 164 2783 459 ----
NM_001003793chr351131 980 957 186 164 2783 459 ----
NM_001003810chr45715 633 324 245 206 1573 1279 --
NM_001004065chr974009 3938 3443 3047 2735 2606 1523 ------
NM_001004106chr5166 ------
NM_001004317chr694474 4447 4239 3869 3830 3361 2815 434 184 33923 3812 751 23535 2919 23671 414
NM_001004329chr1211174 11435 ----
NM_001004342chr166020 5157 4675 1863 959 526 14125 16070 16082
NM_001004346chr4----1156 1188
NM_001004360chr251966 1924 1828 1767 250 11510 ----
NM_001004419chr1243632 1604 401 358 11638 ----
NM_001005242chr1251417 1281 663 230 165 11242 ----
NM_001005266chr151608 --138 --
NM_001005267chr151608 --138 --
NM_001005268chr151608 --138 --
NM_001005269chr151608 --138 --
NM_001005375chrY51597 1508 1201 418 150 --31175 623 232 --
NM_001005386chr241651 603 326 143 12190 22345 130 11608
NM_001005404chr1784529 3888 3776 3652 3300 1259 1087 238 --11152 --
NM_001005463chr1052560 2459 1027 1008 309 21658 948 1992 --
NM_001005473chr564632 4222 4041 1182 472 275 1458 24058 2317 24447 4307
NM_001005474chr331544 1391 1279 21632 1027 11304 --
NM_001005732chr211556 ------
NM_001005733chr211513 ------
NM_001005743chr1451152 1128 1100 1084 862 1900 ----
NM_001005744chr1451152 1128 1100 1084 862 1900 ----
NM_001005745chr1451152 1128 1100 1084 862 1900 ----
NM_001005746chr241415 1375 1366 1139 ------
NM_001005747chr241415 1375 1366 1139 ------
NM_001005782chr21400 1717 ----
NM_001005845chr851884 1860 1610 721 31 --1627 --
NM_001006600chr542387 2137 885 762 ----21791 961
NM_001006612chrX1116 --1453 --
NM_001006613chrX1116 --1453 --
NM_001006614chrX1116 --1453 --
NM_001006618chr91198 ------
NM_001006626chr7------178
NM_001006627chr7------178
NM_001006628chr7------178
NM_001006629chr7------178
NM_001006630chr7------178
NM_001006631chr7------178
NM_001006632chr7------178
NM_001006636chr2--2810 642 ----
NM_001006656chr1951707 1512 1196 537 521 --11266 --
NM_001006684chrX1112 ------
NM_001007023chr1454767 4757 4428 1069 560 132 11573 --
NM_001007024chr1794300 3896 3265 3038 2917 2896 2672 336 290 190 ----
NM_001007025chr1794300 3896 3265 3038 2917 2896 2672 336 290 190 ----
NM_001007075chr421025 811 ------
NM_001007097chr934564 4558 1826 35050 1474 682 ----
NM_001007099chr12807 703 ------
NM_001007100chr12807 703 ------
NM_001007102chr621588 52 ------
NM_001007156chr1511488 11388 ----
NM_001007214chr14713 620 404 205 --2733 278 --
NM_001007226chr1721185 1115 11400 --1392
NM_001007227chr1721185 1115 11400 --1392
NM_001007228chr1721185 1115 11400 --1392
NM_001007229chr1721185 1115 11400 --1392
NM_001007230chr1721185 1115 11400 --1392
NM_001007245chr7179 ------
NM_001007246chr2121668 251 11882 ----
NM_001007257chr11376 ------
NM_001007267chr21842 ----1657
NM_001007278chr1395096 4907 4331 4312 3816 2076 2016 946 24 23596 597 33336 1993 390 --
NM_001007466chr694961 4246 3496 3256 1872 1767 993 278 146 15003 11597 --
NM_001007468chr221299 ------
NM_001007471chr9167 ------
NM_001007553chr121197 1107 --11235 1136
NM_001007559chr183703 667 105 1748 11644 --
NM_001007794chr1----1696 1724
NM_001008239chr1853734 3667 1449 556 345 --22692 1098 13192
NM_001008401chr191435 11323 ----
NM_001008405chr761798 1585 655 375 283 127 ----183
NM_001008408chr7115804 5777 5168 4947 4882 4857 1500 1445 437 377 248 ------
NM_001008495chr871915 1868 1535 477 435 264 121 --11445 1395
NM_001008539chr875128 1767 1114 1055 761 312 32 25282 4670 14551 --
NM_001008540chr24444 136 121 96 --1485 --
NM_001008541chr1011794 --11584 --
NM_001008541chr1011794 --11584 --
NM_001008564chr1331847 874 109 ------
NM_001008660chr1121501 1367 ------
NM_001008726chr1441580 355 156 33 --11349 --
NM_001008738chr552819 2498 2371 448 391 22685 2019 ----
NM_001008777chr173527 473 240 ------
NM_001008801chr193799 548 194 --11487 --
NM_001008860chr151739 ----1288
NM_001008892chr151739 ----1288
NM_001008894chr151739 ----1288
NM_001008925chr483222 3122 1121 901 741 729 718 427 --12434 1569
NM_001008938chr112456 365 ------
NM_001009554chr443342 3125 1868 1571 ----22876 441
NM_001009554chr443342 3125 1868 1571 ----22876 441
NM_001009555chr421728 1419 1325 ----
NM_001009880chr2254053 3585 3137 1636 1244 23835 3690 ----
NM_001009881chr11237 1451 ----
NM_001009882chr11237 1451 ----
NM_001009894chr1231352 1220 574 ----11569
NM_001009899chr3115861 5255 4077 3973 2520 1823 1165 813 685 622 119 32192 1546 895 14586 --
NM_001010000chr1823445 3263 23035 1329 13338 --
NM_001010853chr652990 2950 2882 2235 1171 1523 12320 1982
NM_001010854chr142505 277 ------
NM_001010861chr122584 2021 11934 --12197
NM_001010867chr1116565 6317 6271 5468 5022 4163 2298 2173 1592 924 72 15367 12008 --
NM_001010888chrX74500 4149 3885 1296 719 377 155 ----24442 1129
NM_001010891chr596669 5960 5924 2171 1470 1410 916 662 389 22717 1234 56498 5107 4474 2104 729 11446
NM_001010895chr941647 1523 279 43 21899 353 1667 --
NM_001010942chr1211049 11311 ----
NM_001010971chr12744 356 ------
NM_001010986chrX32428 1702 531 ------
NM_001010989chr162452 100 --1576 --
NM_001010990chr162452 100 --1576 --
NM_001011513chr442528 1107 504 96 --13907 --
NM_001011553chr7----197 --
NM_001011663chr102434 314 ----1917
NM_001011666chr796065 5861 5413 4304 1536 1022 670 605 240 32558 1893 1752 12051 --
NM_001011708chr252581 2503 1849 576 374 1142 ----
NM_001011713chr1461066 614 536 451 412 372 1196 1444 --
NM_001011724chr131131 1251 ----
NM_001011725chr131131 1251 ----
NM_001011885chr1521812 496 1561 ----
NM_001012398chr161203 --1839 --
NM_001012420chr1532817 2312 2290 1932 ----
NM_001012423chr1532817 2312 2290 1932 ----
NM_001012456chr7122 ------
NM_001012614chr42490 269 ------
NM_001012751chr1051931 1650 1303 634 121 3552 88 78 ----
NM_001012754chr1351957 1942 1860 1845 1488 1461 21970 179 --
NM_001012755chrX74903 4703 4697 4665 4129 3726 1817 --34925 3915 3362 --
NM_001012761chr562612 1987 1065 816 741 234 1804 ----
NM_001012979chrX1242 ------
NM_001013031chr1043321 3177 976 858 ------
NM_001013406chr721291 50 --1481 --
NM_001013415chr431452 1289 1217 --21249 1209 --
NM_001013620chr12107375 7237 7099 6806 6431 6396 6208 2526 1618 129 28144 7384 17935 12370
NM_001013629chr1032120 1811 220 --21653 204 --
NM_001013699chr121565 ------
NM_001013703chr151451 1385 ----
NM_001013843chr151194 126 ----
NM_001014380chr1365465 4540 4199 4028 1320 341 --45170 2273 1823 1796 --
NM_001014434chr13269 248 24 1861 ----
NM_001014446chr4128 ------
NM_001014797chr1078184 7152 6828 2873 1496 1156 768 --11109 15408
NM_001014809chr44874 862 281 270 --189 --
NM_001014812chr15--1136 ----
NM_001015508chr83575 560 207 ------
NM_001015877chrX52933 1047 899 157 148 --12728 12340
NM_001015881chrX144 1433 ----
NM_001017371chr241243 1224 1020 1001 ------
NM_001017395chr3123479 3183 3073 2700 2504 2342 2292 1351 1101 886 194 86 1971 1995 --
NM_001017922chr11485 ----11732
NM_001017923chr141154 ------
NM_001017926chr821603 509 ------
NM_001017930chrX31322 1210 279 31468 1456 1336 1977 --
NM_001017962chr101910 --1316 170
NM_001017969chr93580 549 24 1145 ----
NM_001017977chr11113 1397 ----
NM_001017999chr132166 734 683 ------
NM_001017999chr132166 734 683 ------
NM_001018000chr132166 734 683 ------
NM_001018000chr132166 734 683 ------
NM_001018001chr132166 734 683 ------
NM_001018004chr15--1449 1455 1682
NM_001018006chr15--1449 1455 1682
NM_001018007chr15--1449 1455 1682
NM_001018020chr15--1449 1455 1682
NM_001018064chr911927 11367 ----
NM_001018065chr975349 5052 4789 4656 1108 566 306 ------
NM_001018066chr975349 5052 4789 4656 1108 566 306 ------
NM_001018067chr165388 5252 4380 1875 1346 201 44809 433 411 151 23246 846 21475 542
NM_001018068chr165388 5252 4380 1875 1346 201 44809 433 411 151 23246 846 21475 542
NM_001018069chr165388 5252 4380 1875 1346 201 44809 433 411 151 23246 846 21475 542
NM_001018074chr533721 3318 95 2523 129 ----
NM_001018075chr533721 3318 95 2523 129 ----
NM_001018076chr533721 3318 95 2523 129 ----
NM_001018077chr533721 3318 95 2523 129 ----
NM_001018111chr7103903 3844 3661 3586 3178 3108 3090 3062 1173 550 ------
NM_001018113chrX1128 ------
NM_001020658chr131212 425 237 ------
NM_001020658chr131212 425 237 ------
NM_001023560chr631061 683 311 ------
NM_001023567chr1522209 1735 1940 ----
NM_001024094chr533721 3318 95 2523 129 ----
NM_001024218chr14183 ------
NM_001024226chr121139 183 ------
NM_001024227chr121139 183 ------
NM_001024228chr121139 183 ------
NM_001024463chr15----1309 --
NM_001024649chr542706 2456 408 319 ------
NM_001024660chr331427 630 508 ------
NM_001024688chr851542 753 704 664 113 11675 1546 11825
NM_001024847chr32416 312 --22338 1580 --
NM_001024934chr62508 182 ------
NM_001024935chr62508 182 ------
NM_001024936chr62508 182 ------
NM_001024947chr5----11057 --
NM_001024948chr132401 1246 1235 11148 12413 13076
NM_001024956chr1155654 3562 2214 1680 1221 14772 --11332
NM_001025076chr10146053 5577 5461 4910 4242 4235 3910 3817 2209 1424 1254 966 548 521 12163 --36184 1723 826
NM_001025077chr10197411 6935 6819 6268 5600 5593 5268 5175 4711 4634 2782 2612 2324 1906 1879 1321 667 657 569 15026 --27542 2184
NM_001025079chr373814 3435 2816 2638 731 238 164 13151 13306 24187 4174
NM_001025201chr23167 51 32 ------
NM_001025233chr1232358 278 134 12034 11793 1837
NM_001025266chr354306 3493 3354 199 165 13931 11017 24817 4299
NM_001025366chr631815 1220 658 --1315 --
NM_001025366chr631815 1220 658 --1315 --
NM_001025367chr631815 1220 658 --1315 --
NM_001025367chr631815 1220 658 --1315 --
NM_001025368chr631815 1220 658 --1315 --
NM_001025368chr631815 1220 658 --1315 --
NM_001025369chr631831 1236 674 --1331 --
NM_001025369chr631831 1236 674 --1331 --
NM_001025370chr631815 1220 658 --1315 --
NM_001025370chr631815 1220 658 --1315 --
NM_001025579chr1721012 448 ------
NM_001025580chrX84280 3922 2995 1385 589 460 428 199 --11227 --
NM_001025595chr421330 1228 21257 180 ----
NM_001025616chr441545 1325 640 233 --2569 291 --
NM_001025777chr23301 64 45 --11517 11276
NM_001025780chr9--21130 156 --11507
NM_001029835chr71327 ------
NM_001029858chr642771 2391 2203 1062 --12337 --
NM_001029860chr82340 269 ------
NM_001029863chr642528 2210 385 141 12241 ----
NM_001029875chr552417 1007 933 550 414 12963 ----
NM_001029882chr11451 --1278 --
NM_001029882chr11451 --1278 --
NM_001030001chr141441 ------
NM_001030002chr172355 132 ------
NM_001030006chr171410 --1171 --
NM_001030007chr1653315 2928 2465 1504 1252 --23922 2890 --
NM_001030055chr1474376 4125 4046 3976 3934 2989 790 14465 11821 14577
NM_001030272chr11----160 --
NM_001030273chr11----160 --
NM_001031623chr621214 428 11671 ----
NM_001031679chr12103385 2984 2846 2824 2492 2309 552 333 296 109 1469 11376 --
NM_001031695chr2261598 1419 1147 674 502 486 33731 3700 962 --11258
NM_001031700chr462405 2379 2320 2106 1948 296 11563 1704 --
NM_001031710chr73932 695 83 ------
NM_001031712chr61165 1101 ----
NM_001031716chr23380 335 28 ----1997
NM_001031732chr483255 3228 2538 2375 1276 1070 821 550 23676 3650 11381 --
NM_001031748chr122556 233 1613 ----
NM_001031801chr221162 ------
NM_001031803chr172307 231 1270 ----
NM_001031804chr1681718 1490 1406 1089 912 822 625 494 22884 241 --13581
NM_001031812chr552369 2176 212 153 54 11786 11972 --
NM_001032280chr61598 --11725 --
NM_001032282chr81504 ----11259
NM_001032288chr2031068 94 57 ----21113 535
NM_001032296chr1342048 1907 618 158 1786 12739 --
NM_001032380chr1031801 1243 86 ------
NM_001032393chrX1202 ------
NM_001032394chr611129 12671 --1133
NM_001032395chr61996 12538 ----
NM_001033030chr31258 2213 104 ----
NM_001033031chr31258 2213 104 ----
NM_001033032chr31258 2213 104 ----
NM_001033057chr322121 452 11723 2620 486 --
NM_001033059chr631986 1687 543 ------
NM_001033087chr2032728 914 750 --12334 --
NM_001033112chr52784 121 --1132 --
NM_001033503chr52463 378 ------
NM_001033507chr121415 115 --1215 --
NM_001033518chr71548 ------
NM_001033519chr71548 ------
NM_001033520chr71548 ------
NM_001033557chr21248 1398 21251 113 --
NM_001033561chr171879 ------
NM_001033578chr812233 12045 11598 --
NM_001033602chr1361820 824 768 450 310 215 --1810 1699
NM_001033659chr1711474 --1356 --
NM_001033723chr841910 1115 740 237 12685 ----
NM_001033756chr631749 1154 592 --1249 --
NM_001033756chr631749 1154 592 --1249 --
NM_001033910chr132105 589 264 ------
NM_001033925chr102578 185 --21847 1682 --
NM_001034841chr1694982 4409 4397 3779 1961 1824 1219 975 417 24234 1044 11182 --
NM_001034850chr541420 1141 345 125 --1672 --
NM_001034852chr1432081 1739 251 ------
NM_001034915chr811532 --1353 1347
NM_001034954chr1062963 2821 2253 2211 2109 852 ------
NM_001034955chr1062963 2821 2253 2211 2109 852 ------
NM_001034956chr1062963 2821 2253 2211 2109 852 ------
NM_001034957chr1062963 2821 2253 2211 2109 852 ------
NM_001035chr131060 1021 309 ------
NM_001035003chr4--1133 2564 274 --
NM_001035004chr4--1133 2564 274 --
NM_001035260chr1021387 210 11150 11323 --
NM_001035267chr121291 ------
NM_001037163chr74959 805 113 47 ------
NM_001037164chr732014 1475 655 --1687 --
NM_001037165chr7128918 8330 7646 7524 7335 7308 6012 2791 2742 1401 1359 574 58822 8347 7198 6902 3366 16002 --
NM_001037172chr321250 70 --1996 1885
NM_001037174chr251726 1670 1663 1473 193 11911 ----
NM_001037317chr122584 2021 11934 --12197
NM_001037334chr1832212 1874 783 11592 --22253 686
NM_001037339chr131346 1250 538 ------
NM_001037340chr131346 1250 538 ------
NM_001037341chr131346 1250 538 ------
NM_001037341chr131346 1250 538 ------
NM_001037535chrX61552 1545 1470 970 548 236 ----1613
NM_001037536chrX61552 1545 1470 970 548 236 ----1613
NM_001037540chrX61552 1545 1470 970 548 236 ----1613
NM_001037553chr2154521 4473 3988 1493 177 15049 13807 --
NM_001037637chr5----1267 --
NM_001037954chr1133404 1406 715 23072 656 --13472
NM_001038493chr2----11496 --
NM_001038707chr142205 1827 1602 807 ------
NM_001038707chr142205 1827 1602 807 ------
NM_001039199chr2023041 678 13282 23969 91 --
NM_001039348chr22410 230 ----1851
NM_001039349chr22410 230 ----1851
NM_001039350chr72465 150 21582 621 1562 --
NM_001039459chr731108 999 988 ------
NM_001039538chr263357 3211 2300 1453 1011 475 ----12259
NM_001039547chr3127776 6595 5998 5870 5847 5127 5019 2994 2806 1828 1805 1734 24887 601 17039 --
NM_001039577chr154193 4009 3892 1549 987 21042 221 ----
NM_001039580chr444280 3325 3083 856 44034 3294 1392 587 24194 3250 --
NM_001039590chrX93718 3631 3566 3421 2939 2849 2810 1415 139 ------
NM_001039591chrX93718 3631 3566 3421 2939 2849 2810 1415 139 ------
NM_001039616chr19153 ------
NM_001039618chr1194917 4659 4118 3973 2358 1648 1553 901 801 45127 4862 4056 2158 --15638
NM_001039693chr263683 3281 2774 1621 942 697 13695 23657 1470 --
NM_001039762chr1032010 1583 772 11963 ----
NM_001039840chrX75349 5337 4291 3774 1831 714 438 25617 4811 ----
NM_001039937chr1321040 715 --13122 --
NM_001040001chr621918 255 ------
NM_001040101chr411224 ------
NM_001040102chr1042220 1717 635 313 ------
NM_001040103chr1042220 1717 635 313 ------
NM_001040110chr741585 1539 496 110 1744 ----
NM_001040135chr73735 706 538 ------
NM_001040142chr241921 1898 1532 750 1368 ----
NM_001040143chr241921 1898 1532 750 1368 ----
NM_001040147chr183701 619 589 ------
NM_001040152chr764534 4211 4005 3776 3339 1464 ------
NM_001040153chr133836 320 245 1112 ----
NM_001040158chr52483 111 ------
NM_001040159chr43273 250 191 1407 ----
NM_001040214chr632064 1533 835 ------
NM_001040260chr421084 1023 ------
NM_001040261chr421084 1023 ------
NM_001040284chr1685390 5321 4309 2310 2127 1241 942 895 11875 ----
NM_001040402chr423187 44 22383 565 ----
NM_001040409chr21687 ------
NM_001040429chr1343131 1185 943 897 23018 816 12513 --
NM_001040441chr124835 492 15466 ----
NM_001040450chr1521000 745 139 11783 1609
NM_001040453chr1521000 745 139 11783 1609
NM_001040458chr541790 1184 655 159 ------
NM_001040633chr71269 1758 ----
NM_001040708chr82967 203 ------
NM_001040712chr943491 1001 781 505 ----12732
NM_001040876chr42495 267 11617 --11240
NM_001042355chr16105226 5034 4871 4535 4256 4010 1461 1344 546 442 14865 15083 13454
NM_001042403chr121401 1256 --2879 201
NM_001042404chr141376 746 599 248 31645 1415 731 ----
NM_001042412chr16105226 5034 4871 4535 4256 4010 1461 1344 546 442 14865 15083 13454
NM_001042413chr993892 3717 3668 3265 3043 2698 2569 774 589 12881 14109 12710
NM_001042414chr132117 88 ------
NM_001042425chr61598 --11725 --
NM_001042453chrX51749 1342 1218 501 347 ------
NM_001042473chr101631 11583 12023 --
NM_001042492chr1752965 2892 2877 2468 111 ------
NM_001042494chr1543871 2388 1330 234 --23290 2951 --
NM_001042495chr1543871 2388 1330 234 --23290 2951 --
NM_001042496chr1543871 2388 1330 234 --23290 2951 --
NM_001042497chr1543871 2388 1330 234 --23290 2951 --
NM_001042510chr862178 1753 1728 1703 1639 336 ------
NM_001042511chr862178 1753 1728 1703 1639 336 ------
NM_001042517chr131904 ----1107
NM_001042537chrX41697 942 222 189 --1265 --
NM_001042555chr1284340 3732 1762 931 876 851 775 41 13170 21643 1381 --
NM_001042599chr267126 4984 3094 2969 103 77 --15993 --
NM_001042601chr372892 2798 1270 852 835 804 102 13288 ----
NM_001042603chr1275145 4160 4021 2137 1733 1106 759 12053 1751 --
NM_001042604chr3104234 4133 3739 3485 3328 3118 1838 1195 598 551 34715 3199 523 23964 1340 12954
NM_001042632chr2032208 2049 192 --12306 --
NM_001042633chr2032208 2049 192 --12306 --
NM_001042669chr441545 1325 640 233 --2569 291 --
NM_001042683chr631745 749 398 11529 1359 21176 77
NM_001042749chrX51789 1643 1469 215 158 21866 526 ----
NM_001042750chrX51789 1643 1469 215 158 21866 526 ----
NM_001042751chrX51789 1643 1469 215 158 21866 526 ----
NM_001042762chr76847 716 685 245 171 41 ------
NM_001043351chr122244 596 11943 11731 --
NM_001044305chr61279 ------
NM_001044722chr552369 2176 212 153 54 11786 11972 --
NM_001044723chr552369 2176 212 153 54 11786 11972 --
NM_001046chr532315 250 182 12977 --11081
NM_001048183chr183769 2899 2593 2583 1527 684 296 246 23148 982 1168 --
NM_001071775chr1331442 1303 598 --1780 --
NM_001076chr4--172 ----
NM_001076chr4--172 ----
NM_001078chr11506 ------
NM_001079874chr142072 1888 1618 1583 2636 509 11725 1149
NM_001083620chr441959 855 517 412 ----11894
NM_001099678chr396180 5698 4331 2392 2126 2111 1846 258 246 14051 16158 --
NM_001100108chr185237 2908 2562 2536 2261 1977 1666 1017 18360 17923 --
NM_001106chr3209703 9157 8807 8637 7638 7186 6784 6731 6258 6163 5988 2710 2655 2265 2107 2060 1516 534 392 197 17462 59773 8979 8865 6990 1702 18295
NM_001109977chr43856 234 46 155 ----
NM_001113490chrX52875 2755 2605 1464 535 11067 --11392
NM_001117chr1812186 ----22396 2154
NM_001119chr411514 ------
NM_001121chr101142 21593 603 --31178 521 222
NM_001122679chr511236 ------
NM_001126chr13394 323 135 --1358 --
NM_001128chr1653315 2928 2465 1504 1252 --23922 2890 --
NM_001144chr1621258 131 --11108 --
NM_001146chr862180 2029 1824 1614 1572 704 ------
NM_001148chr421691 317 --1704 --
NM_001149chr102484 32 11274 ----
NM_001159chr22716 512 --1614 --
NM_001166chr11296 40 1418 ----
NM_001167chrX116489 2323 2213 1435 1388 1108 1086 976 813 495 141 26513 2444 11880 25696 2180
NM_001173chr1474376 4125 4046 3976 3934 2989 790 14465 11821 14577
NM_001178chr11----160 --
NM_001186chr2152979 2436 2374 533 47 2251 60 22751 1204 --
NM_001191chr2041205 942 366 159 ------
NM_001197chr221151 ------
NM_001204chr2137635 7183 6292 6245 5298 5193 2450 2028 1984 1361 442 420 205 --25685 2648 16225
NM_001206chr922716 1115 22473 2326 23032 2764 12042
NM_001207chr5----1267 --
NM_001233chr752352 2036 863 261 155 --1345 12156
NM_001237chr44946 913 187 63 2155 78 ----
NM_001237chr44946 913 187 63 2155 78 ----
NM_001253chr61253 ------
NM_001256chr1752944 2779 1995 701 78 --11873 --
NM_001257chr1611306 11342 --11043
NM_001263chr43402 111 65 1320 ----
NM_001269chr12902 770 --1975 --
NM_001270chr511034 1746 --1887
NM_001278chr1041200 792 388 177 21166 248 1298 --
NM_001280chr192687 274 ------
NM_001282chr171410 --1171 --
NM_001290chr4--1293 ----
NM_001304chr17113761 3686 3600 3251 3220 3129 2628 1319 1079 490 161 33091 1398 361 12972 --
NM_001310chr1232772 2649 386 1624 12619 12929
NM_001313chr44874 862 281 270 --189 --
NM_001319chr1911029 ------
NM_001326chr111306 --1318 --
NM_001328chr42490 269 ------
NM_001329chr1041161 1096 244 93 ------
NM_001331chr1142128 2110 2082 296 ------
NM_001332chr51634 ------
NM_001351chr361857 1571 1482 1170 1143 524 --1144 --
NM_001356chrX21609 658 22097 556 22301 1786 --
NM_001363chrX3714 624 518 2309 187 ----
NM_001364chr1194763 4458 3879 3022 1241 1222 1079 763 541 ------
NM_001379chr192277 215 ------
NM_001380chr10--2790 718 1285 --
NM_001401chr9----11052 --
NM_001402chr631982 357 210 ----1198
NM_001408chr141314 1151 258 73 ------
NM_001412chrX33413 2301 1200 1618 12858 --
NM_001415chrX31790 671 301 11462 ----
NM_001419chr1964619 4458 4391 4189 2987 1532 14172 24674 386 11066
NM_001420chr1922242 261 22503 2423 --12117
NM_001427chr721959 206 --11792 --
NM_001429chr221329 ------
NM_001430chr22709 209 --11861 --
NM_001431chr62494 218 --1993 174
NM_001432chr453443 3368 3268 2998 150 23244 981 12791 11025
NM_001438chr153065 3039 2998 2862 850 --13340 --
NM_001448chrX61518 1153 1116 442 168 114 11124 ----
NM_001451chr1641129 486 263 135 ------
NM_001453chr621235 260 1486 ----
NM_001463chr22797 227 ------
NM_001482chr151785 ------
NM_001483chr72758 380 1103 ----
NM_001491chr622527 331 12613 1225 --
NM_001494chr101292 1581 ----
NM_001495chr81168 ------
NM_001498chr641023 896 880 301 ------
NM_001514chr11394 ------
NM_001518chr721019 421 --1938 --
NM_001530chr141217 ------
NM_001539chr9--2126 105 ----
NM_001541chr111166 ------
NM_001546chr641487 1080 949 933 ------
NM_001550chr7179 ------
NM_001554chr11529 1515 ----
NM_001604chr1131011 759 661 --1405 1907
NM_001609chr1073807 2872 987 481 459 293 64 24443 815 11287 11799
NM_001616chr252758 2567 1086 1009 753 1842 12366 --
NM_001619chr11184 ------
NM_001627chr32957 212 --11721 --
NM_001634chr631986 1687 543 ------
NM_001635chr73873 746 675 ------
NM_001655chr1152015 1550 1355 724 74 ------
NM_001656chr541857 603 270 29 165 11379 --
NM_001658chr121139 183 ------
NM_001660chr31767 2326 189 ----
NM_001663chr1412639 12267 ----
NM_001677chr11382 1878 --177
NM_001682chr1272701 2316 2161 1858 1011 971 61 12899 12000 --
NM_001683chr342476 2302 923 474 ------
NM_001684chr143004 2989 2561 885 ----24132 3129
NM_001690chr331874 1032 160 11953 ----
NM_001695chr863859 2895 1704 1628 1502 795 ------
NM_001704chr62527 414 ------
NM_001706chr32852 795 ------
NM_001709chr1142197 2179 1129 451 22881 896 12596 --
NM_001713chr51176 ------
NM_001717chr1561476 992 982 369 221 133 21387 1075 ----
NM_001719chr202176 37 ------
NM_001726chr11139 ------
NM_001730chr1341371 1331 591 421 11257 ----
NM_001730chr1341371 1331 591 421 11257 ----
NM_001746chr542706 2456 408 319 ------
NM_001753chr721516 146 --11595 --
NM_001755chr1641858 1605 867 273 12072 --1829
NM_001759chr1275215 4966 3465 3354 840 645 84 ------
NM_001777chr373814 3435 2816 2638 731 238 164 13151 13306 24187 4174
NM_001788chr7----197 --
NM_001789chr32539 409 11235 ----
NM_001792chr183963 719 276 ------
NM_001796chr16192 ------
NM_001801chr52235 26 --2488 214 --
NM_001806chr192747 567 41097 529 372 194 ----
NM_001822chr23167 51 32 ------
NM_001826chr11463 ------
NM_001829chr42902 855 1842 ----
NM_001854chr121337 80 11193 11542 --
NM_001855chr9299 29 ------
NM_001858chr664468 3322 1248 749 614 586 24039 1815 25078 250 13137
NM_001859chr943921 3441 3087 2771 23969 1086 ----
NM_001880chr2--1311 127 --
NM_001881chr102402 343 ------
NM_001882chr5144 --2407 389 --
NM_001884chr5------128
NM_001893chr171373 ------
NM_001904chr31161 1285 --126
NM_001924chr1145 --1458 --
NM_001931chr11--11314 ----
NM_001936chr72465 150 21582 621 1562 --
NM_001938chr111949 11586 31505 1465 664 --
NM_001942chr1821962 239 ----22075 748
NM_001949chr612654 ----12294
NM_001951chr81507 ------
NM_001969chr1433673 3218 1115 --22966 509 --
NM_001977chr441703 495 331 139 --1536 --
NM_001981chr122308 2041 ----22149 843
NM_001987chr1243864 2630 1455 549 23267 335 1712 --
NM_001992chr512090 ------
NM_001995chr421463 1224 1307 ----
NM_001999chr521392 127 21068 966 ----
NM_002006chr4103711 3643 3617 3595 3558 1720 1705 1262 955 617 24639 1797 1456 24349 2292
NM_002009chr1562690 2612 2540 1996 1945 801 1167 11911 --
NM_002014chr12169 ------
NM_002015chr1372979 2475 2088 1175 668 330 103 1449 13375 --
NM_002017chr111506 --1937 --
NM_002024chrX31499 410 345 11617 1256 --
NM_002025chrX128960 8867 7746 7608 6433 6222 5794 5749 2575 1045 372 193 1295 23144 709 --
NM_002031chr61609 ----1689
NM_002039chr41600 ------
NM_002040chr2152569 2357 2326 1024 31 33117 2895 2545 --1991
NM_002054chr2--1427 1178 --
NM_002061chr121577 702 ----1148
NM_002063chrX--21170 1062 ----
NM_002069chr731472 601 306 1328 177 1424
NM_002076chr1242020 1124 253 83 11038 43125 2961 2049 1133 --
NM_002082chr5129 ------
NM_002086chr1752164 2119 1564 395 216 ------
NM_002089chr42179 143 ------
NM_002104chr51182 ------
NM_002107chr11175 ------
NM_002126chr1773981 2701 1616 1078 945 563 437 11545 ----
NM_002128chr1362381 2030 1626 649 519 311 --11740 --
NM_002130chr521195 1077 --11723 --
NM_002136chr121131 1251 ----
NM_002137chr771952 1911 1809 1681 1605 388 293 12157 --1829
NM_002138chr45715 633 324 245 206 1573 1279 --
NM_002140chr94999 469 198 52 --1886 --
NM_002145chr171310 ------
NM_002154chr51110 ------
NM_002158chr253844 3745 3066 2749 1259 33144 486 283 31375 766 81 --
NM_002165chr201363 ------
NM_002166chr21507 ------
NM_002182chr32407 65 22697 2488 1999 1917
NM_002193chr2------11602
NM_002196chr201890 ----1931
NM_002196chr201890 ----1931
NM_002210chr253364 953 839 599 248 1383 11347 12351
NM_002211chr102147 94 21094 456 21001 924 11110
NM_002214chr785590 4560 3684 1989 1747 1562 863 203 35736 5499 1672 1583 1785
NM_002222chr321134 1059 --1126 --
NM_002224chr61722 ------
NM_002232chr121261 76 ------
NM_002239chr2----1261 --
NM_002247chr1011761 --11616 --
NM_002264chr354228 3865 3436 782 772 14365 ----
NM_002267chr1362321 2257 1763 1660 1654 216 32165 1727 987 ----
NM_002268chr331902 1526 1390 ------
NM_002270chr575574 4928 4910 4388 1749 489 475 25539 208 55274 5201 4583 3778 49 --
NM_002293chr152212 1818 1089 980 197 22752 942 21970 892 --
NM_002296chr151547 1520 1486 625 413 21360 1139 --21769 283
NM_002310chr556016 5625 4182 2392 1060 ------
NM_002332chr121480 1725 ----
NM_002335chr11------149
NM_002336chr1254422 3587 3350 1905 1790 34849 1712 952 24267 253 --
NM_002351chrX61729 1226 1070 701 386 325 11353 158 --
NM_002355chr121354 11390 ----
NM_002356chr622654 2355 --22880 644 21833 570
NM_002358chr43632 504 83 ----1648
NM_002374chr263357 3211 2300 1453 1011 475 ----12259
NM_002397chr522249 23 ------
NM_002403chr11411 ------
NM_002408chr143788 742 28 1207 ----
NM_002430chr2242559 928 208 125 12093 --22184 1806
NM_002442chr1211757 ----11770
NM_002449chr511285 ------
NM_002480chr1231046 526 445 ------
NM_002481chr157901 7879 5576 2852 1500 38004 5449 5308 52541 1833 1615 421 207 2617 219
NM_002485chr851542 753 704 664 113 11675 1546 11825
NM_002486chr942391 2026 787 57 22263 610 ----
NM_002505chr631300 196 129 ------
NM_002507chr1711789 ------
NM_002515chr1451977 1807 329 164 88 130 1434 21395 489
NM_002518chr221192 852 1491 ----
NM_002519chr111544 --1958 --
NM_002527chr121293 ------
NM_002538chr52492 121 ------
NM_002539chr2185 ------
NM_002542chr31204 ------
NM_002543chr1241533 1201 307 34 --21340 43 --
NM_002544chr17--1257 --1119
NM_002547chrX84218 3441 3323 3162 1283 413 329 60 --23818 3306 --
NM_002553chr7--1457 ----
NM_002556chr1142115 1742 1561 746 ------
NM_002568chr8--1365 ----
NM_002577chr373930 3710 3553 1344 404 375 242 --1660 --
NM_002581chr944369 4039 3991 3467 ----15507
NM_002583chr121567 1174 ----
NM_002588chr52667 568 --11738 --
NM_002591chr201511 --1644 --
NM_002595chr1251699 1545 426 213 134 1207 ----
NM_002600chr131346 1250 538 ------
NM_002610chr262203 2181 546 450 311 240 22470 2340 ----
NM_002611chr17----1841 --
NM_002612chr731791 1683 278 ----1744
NM_002648chr621248 966 ------
NM_002655chr884907 4157 4071 3861 3267 2030 833 799 ----11308
NM_002656chr621061 972 144 --11021
NM_002657chr2053879 1394 1142 921 28 --11081 --
NM_002687chr1441261 1005 834 521 2949 840 ----
NM_002706chr2----2534 111 --
NM_002707chr2165 ------
NM_002709chr233612 3227 354 1598 --13333
NM_002713chr11774 ------
NM_002715chr521002 456 11017 11300 --
NM_002719chr1442384 2058 1805 1565 ----1768
NM_002721chr92384 184 ----1400
NM_002729chr101752 1349 ----
NM_002731chr142092 822 520 128 ------
NM_002734chr1752101 1990 1635 626 580 12274 11933 --
NM_002736chr771971 1652 804 682 635 484 340 1478 11465 1555
NM_002738chr161766 ------
NM_002740chr362828 2522 2421 456 238 163 32401 1954 1744 ----
NM_002742chr141528 ----1517
NM_002748chr153406 296 173 ----1965
NM_002755chr151699 ------
NM_002756chr17--1981 ----
NM_002786chr111118 1279 ----
NM_002814chrX2286 104 --1122 1650
NM_002815chr171166 ------
NM_002821chr62598 233 ------
NM_002822chr1231730 539 33 ----11646
NM_002828chr185968 749 707 700 387 ------
NM_002833chr1511612 ------
NM_002835chr71311 --1784 --
NM_002836chr202193 104 ------
NM_002839chr943491 1001 781 505 ----12732
NM_002840chr121436 659 ------
NM_002841chr32665 124 1155 ----
NM_002843chr1142776 1003 755 422 --13173 13206
NM_002844chr661431 1283 1056 920 873 187 ------
NM_002851chr74733 634 620 569 ------
NM_002858chr131010 418 95 ------
NM_002868chr1252341 2297 2070 1768 803 11703 ----
NM_002874chr932156 1857 251 ----1786
NM_002886chr394700 4467 3861 3619 3420 3331 3238 1857 120 23706 919 --1474
NM_002890chr51346 --1959 --
NM_002892chr1451384 1341 1187 690 604 11739 ----
NM_002893chrX--1268 --1378
NM_002894chr182205 37 ------
NM_002897chr22583 105 ------
NM_002902chr153537 238 148 ----1105
NM_002906chr114823 704 611 529 ------
NM_002912chr62629 230 1934 ----
NM_002924chr11622 ------
NM_002940chr42495 267 11617 --11240
NM_002941chr321029 504 ------
NM_002942chr31904 ------
NM_002945chr17--1870 ----
NM_002946chr11164 ------
NM_002956chr1221030 206 ------
NM_002959chr184232 3120 1758 1718 1509 1394 1249 952 21786 1403 --23546 1348
NM_002971chr31186 1810 --1819
NM_002973chr12------1591
NM_002979chr12807 703 ------
NM_002994chr441952 274 55 40 21435 334 ----
NM_002998chr832251 856 371 11747 ----
NM_003014chr731405 391 167 1434 ----
NM_003017chr641041 424 118 76 ------
NM_003026chr9----1841 --
NM_003034chr1246379 5964 1379 420 25805 1641 11341 17331
NM_003035chr13939 922 330 1952 ----
NM_003042chr3--12111 ----
NM_003046chr875128 1767 1114 1055 761 312 32 25282 4670 14551 --
NM_003048chr242629 2388 1075 886 ------
NM_003060chr531132 842 45 ----11316
NM_003068chr831030 1011 701 ------
NM_003069chrX------1168
NM_003070chr92644 329 ------
NM_003071chr321970 1664 --3595 72 47 --
NM_003073chr221299 ------
NM_003074chr362127 1982 1880 1861 362 349 1424 ----
NM_003079chr171860 163 1942 --
NM_003082chr143473 36 22 1932 ----
NM_003093chr63173 85 33 ------
NM_003096chr23226 180 54 ------
NM_003100chr51124 ------
NM_003106chr331067 711 405 --1734 --
NM_003107chr642246 1947 478 423 12503 12252 22006 1641
NM_003108chr2117281 6752 6742 6601 6343 5818 5563 941 807 465 238 26645 6022 15762 --
NM_003110chr1711020 ------
NM_003111chr241243 1224 1020 1001 ------
NM_003112chr773230 3041 2849 2100 1985 1295 1280 12350 12731 --
NM_003113chr22804 303 ------
NM_003115chr13403 114 81 ------
NM_003128chr222839 2378 1654 12069 --
NM_003137chr61791 1430 --11966
NM_003142chr2--141 ----
NM_003144chr662133 1548 1394 292 256 28 --11772 1412
NM_003155chr862841 2473 2409 832 522 67 3702 531 415 --1948
NM_003161chr1722359 488 12895 11110 22583 1169
NM_003174chr101116 ------
NM_003185chr2021319 1302 --1112 --
NM_003188chr6----1631 --
NM_003194chr61387 ------
NM_003199chr1841999 1780 929 792 25677 1982 ----
NM_003201chr101290 1811 ----
NM_003206chr61416 ------
NM_003211chr1241545 707 472 89 ----141
NM_003214chr611281 ------
NM_003217chr1231780 1249 439 ----12005
NM_003220chr61598 --11725 --
NM_003222chr2011004 --1306 --
NM_003234chr3--12421 22131 1568 11807
NM_003242chr32416 312 --22338 1580 --
NM_003246chr1541408 1395 1324 174 11370 ----
NM_003248chr51105 ------
NM_003250chr171362 ------
NM_003253chr212617 585 --11584 --
NM_003259chr191152 ------
NM_003262chr394328 3307 1331 1194 1173 1152 898 450 208 13230 35009 4231 314 11805
NM_003269chr6--1472 ----
NM_003275chr93425 193 137 ------
NM_003285chr11450 ------
NM_003286chr20----11056 1111
NM_003291chr13----141 --
NM_003292chr151894 1472 1440 859 50 11609 ----
NM_003298chr355797 4161 3921 1401 294 45486 5126 3864 199 15753 16107
NM_003300chr141175 ------
NM_003304chr341271 591 424 179 1410 ----
NM_003305chr44445 339 157 149 ------
NM_003315chr171239 ------
NM_003319chr23278 240 107 ------
NM_003336chrX4741 267 242 140 ----1839
NM_003337chr53549 374 267 194 ----
NM_003338chr1021974 550 21751 1431 1370 11423
NM_003340chr411124 ------
NM_003341chr32511 434 --1130 --
NM_003342chr1723316 3167 1232 ----
NM_003347chr221144 21492 225 ----
NM_003348chr1251345 1207 659 456 164 --186 --
NM_003349chr2031068 94 57 ----21113 535
NM_003352chr21400 1717 ----
NM_003360chr41218 ----1287
NM_003367chr19--1477 ----
NM_003369chr1142634 2502 2406 819 ------
NM_003370chr192800 638 ------
NM_003372chrX130 193 ----
NM_003373chr1011701 ------
NM_003376chr631815 1220 658 --1315 --
NM_003376chr631815 1220 658 --1315 --
NM_003379chr62887 732 ----1718
NM_003380chr10198 ------
NM_003390chr1121111 974 --2836 110 --
NM_003392chr383929 3309 2990 2807 1578 1415 1211 479 11222 13586 23522 1589
NM_003404chr202807 218 ------
NM_003405chr221600 ------
NM_003406chr851502 1489 1371 671 83 ----11981
NM_003409chr1831289 1066 205 ----21229 425
NM_003410chrX33101 1929 504 12825 1269 22762 2185
NM_003411chrY2692 420 --2649 69 11262
NM_003418chr31788 ------
NM_003430chr192409 241 --11613 21378 1217
NM_003432chr51214 ------
NM_003442chr11294 38 1853 2315 305 --
NM_003452chr91355 1981 158 --
NM_003453chr133518 187 107 ------
NM_003454chr1631398 1375 1202 ----1512
NM_003463chr621102 809 --2580 127 33074 2400 2052
NM_003467chr24444 136 121 96 --1485 --
NM_003469chr22458 339 --1428 --
NM_003472chr61616 21246 174 ----
NM_003478chr1153069 2736 2153 2062 688 --12998 12193
NM_003482chr1252742 2485 2470 2463 2297 ------
NM_003487chr17160 ------
NM_003489chr212858 22 33135 3028 980 ----
NM_003505chr731886 1764 345 11683 ----
NM_003506chr821110 530 1896 --11057
NM_003557chr121531 1474 11638 ----
NM_003558chr92698 143 ------
NM_003563chr1721185 1115 11400 --1392
NM_003566chr1283250 2855 2733 2711 1068 1024 881 72 22998 623 12458 11224
NM_003567chr1------1316
NM_003574chr1875802 5359 4388 3814 2074 1888 542 55672 5112 4166 969 294 44809 1735 1003 323 --
NM_003576chr1342048 1907 618 158 1786 12739 --
NM_003580chr8--1132 1107 --
NM_003583chr1243051 2663 2589 196 23494 2927 ----
NM_003590chr221511 350 13823 53895 3674 3616 668 484 32888 2796 1057
NM_003592chr7--1476 1482 --
NM_003597chr262246 2170 1852 467 207 103 11933 1801 --
NM_003603chr462114 1589 845 656 642 493 ------
NM_003608chr141179 ------
NM_003615chr363645 3603 2887 2779 1281 581 53283 3202 2848 1615 839 ----
NM_003618chr231165 1108 328 21289 157 ----
NM_003620chr172874 801 2756 396 1139 --
NM_003630chr63613 198 128 ----1697
NM_003644chr17126610 5365 4442 4123 3985 2348 2294 1556 1097 1027 572 303 --15055 --
NM_003659chr221053 48 ------
NM_003663chr393417 3043 2724 2375 2255 844 784 532 117 ------
NM_003670chr32903 69 21450 1160 21065 362 --
NM_003671chr933577 3292 1415 13392 12823 13355
NM_003672chr131361 719 533 --31988 1670 467 1241
NM_003676chr11645 ------
NM_003677chr121902 11593 --11523
NM_003685chr193927 818 713 ------
NM_003692chr93179 172 154 1729 ----
NM_003713chr151603 1097 482 432 141 1496 ----
NM_003716chr31713 ------
NM_003722chr352457 2415 2004 1942 773 --22592 1054 --
NM_003735chr52667 568 --11738 --
NM_003736chr52667 568 --11738 --
NM_003741chr31378 ------
NM_003743chr232073 2053 1768 ------
NM_003744chr1451152 1128 1100 1084 862 1900 ----
NM_003749chr1362137 1805 1794 1683 1592 98 21562 249 ----
NM_003750chr1021003 696 134 ----
NM_003758chr15--21350 458 ----
NM_003758chr15--21350 458 ----
NM_003759chr474056 3689 3377 2638 1396 937 239 --14219 --
NM_003760chr1--1257 ----
NM_003762chr111440 ------
NM_003763chr2033011 2374 1283 12074 --1673
NM_003766chr171216 168 ----
NM_003768chr111527 ------
NM_003772chr1121057 904 --11020 --
NM_003777chr7------1559
NM_003778chr32697 686 ------
NM_003783chr131221 1089 277 --190 --
NM_003784chr183701 619 589 ------
NM_003787chr1851409 1352 233 101 88 ------
NM_003794chr3--11065 --1684
NM_003795chr61135 1230 ----
NM_003800chr642249 2009 1528 579 ----11509
NM_003816chr841498 1474 1224 335 --1241 --
NM_003819chr11266 --1286 --
NM_003825chr1551095 611 573 485 82 --11290 --
NM_003861chr1422217 1922 ----12676
NM_003873chr1032225 1985 590 11604 ----
NM_003884chr3167 11570 --21856 1293
NM_003885chr1732369 778 68 12217 ----
NM_003887chr231550 1481 1414 1133 ----
NM_003893chr101492 ------
NM_003895chr213428 301 202 11673 11626 --
NM_003899chr1332337 954 595 11856 21767 290 1670
NM_003902chr12826 788 ------
NM_003909chr863082 2381 2332 2295 2137 627 12191 ----
NM_003913chr6123722 3680 3355 3089 2842 2655 1389 1315 1277 857 653 184 43578 565 352 212 --12965
NM_003921chr131799 378 237 146 --11788
NM_003922chr15--1404 1373 --
NM_003930chr762283 1888 1678 447 253 101 ------
NM_003931chr62508 182 ------
NM_003934chr941332 499 464 348 --1382 --
NM_003946chr16--1565 ----
NM_003947chr31411 ----1875
NM_003948chr411713 12066 12594 12182
NM_003953chr152795 805 571 560 247 12718 1414 --
NM_003955chr1711276 ------
NM_003966chr5117801 5671 5364 2537 2186 2175 2048 1873 1820 326 234 --12913 12791
NM_003971chr172594 415 ------
NM_003982chr141255 ------
NM_003983chr1643792 3248 664 397 --2695 248 --
NM_003993chr12315 294 ------
NM_003994chr1253427 2934 2781 1496 182 11403 --23787 3323
NM_004006chrX42124 666 263 94 22541 2287 12589 --
NM_004007chrX42124 666 263 94 22541 2287 12589 --
NM_004009chrX42124 666 263 94 22541 2287 12589 --
NM_004010chrX42124 666 263 94 22541 2287 12589 --
NM_004011chrX42124 666 263 94 22541 2287 12589 --
NM_004012chrX42124 666 263 94 22541 2287 12589 --
NM_004013chrX42124 666 263 94 22541 2287 12589 --
NM_004014chrX42124 666 263 94 22541 2287 12589 --
NM_004015chrX42124 666 263 94 22541 2287 12589 --
NM_004016chrX32038 580 177 22455 2201 12503 --
NM_004017chrX42124 666 263 94 22541 2287 12589 --
NM_004018chrX32038 580 177 22455 2201 12503 --
NM_004020chrX42124 666 263 94 22541 2287 12589 --
NM_004021chrX32038 580 177 22455 2201 12503 --
NM_004022chrX32038 580 177 22455 2201 12503 --
NM_004023chrX32038 580 177 22455 2201 12503 --
NM_004040chr231346 1257 1085 ------
NM_004046chr18137 ------
NM_004060chr541304 1213 1194 374 ------
NM_004061chr51195 ------
NM_004067chr731507 1011 218 --21291 315 --
NM_004075chr121450 1513 ----
NM_004079chr142026 1973 1954 574 21123 904 ----
NM_004080chr741422 545 181 127 --11374 --
NM_004081chrY51597 1508 1201 418 150 --31175 623 232 --
NM_004089chrX144 1433 ----
NM_004094chr1422864 77 --1569 1503
NM_004098chr1011119 ------
NM_004100chr632257 1057 200 1100 11012 --
NM_004105chr22410 230 ----1851
NM_004112chr1711455 ------
NM_004124chr1473551 2499 2339 2320 2220 1025 711 --33437 1163 649 --
NM_004125chr93926 851 381 ------
NM_004130chr31572 ------
NM_004133chr841817 975 422 299 ------
NM_004136chr1542728 2668 2344 349 22276 1067 12262 13191
NM_004145chr191377 ------
NM_004170chr91239 ----1558
NM_004171chr1199509 7217 5997 3432 2600 1853 1177 1164 532 19644 26874 1963 21336 595
NM_004172chr51640 --32059 403 228 --
NM_004225chr81213 11149 ----
NM_004232chr1863379 2999 898 496 214 171 11043 1114 53340 3237 1285 1010 207
NM_004235chr9------1874
NM_004237chr53918 910 329 1183 ----
NM_004238chr21264 ------
NM_004240chr192261 219 ------
NM_004242chr62360 319 ------
NM_004244chr121438 ------
NM_004261chr13937 102 79 --2678 303 --
NM_004263chr251621 1536 1137 514 303 ------
NM_004270chr51258 ----175
NM_004272chr511663 ----11912
NM_004274chr1473186 2952 2458 2296 2041 1160 729 --1488 --
NM_004280chr62176 154 2457 43 ----
NM_004286chr2232593 1754 271 12213 ----
NM_004290chr511296 ----11362
NM_004291chr51100 ------
NM_004293chr952763 1110 877 676 563 12389 ----
NM_004316chr1241151 1115 952 771 ------
NM_004330chr153400 276 228 --11100 --
NM_004331chr852553 2243 1757 1674 962 ------
NM_004338chr18106839 6151 5924 4835 4665 2746 2451 623 374 132 2575 477 12174 11573
NM_004342chr731488 1446 376 --12055 --
NM_004346chr421219 384 ------
NM_004349chr81873 ------
NM_004354chr42728 651 1602 ----
NM_004365chr5------1232
NM_004370chr631964 377 290 ------
NM_004380chr1632439 663 617 11950 12026 --
NM_004384chr552369 2176 212 153 54 11786 11972 --
NM_004385chr51249 ------
NM_004392chr1352482 2263 1908 1641 166 1936 --12078
NM_004397chr1153723 2725 2655 2633 1005 --11131 --
NM_004412chr1065702 4360 4049 2380 432 380 --34492 1893 951 15678
NM_004414chr2121360 575 1263 ----
NM_004415chr61609 1711 ----
NM_004430chr822230 694 32407 2242 1722 ----
NM_004432chr932266 1999 1669 --11906 --
NM_004437chr163185 2586 1302 1229 925 260 1253 1444 --
NM_004438chr243251 1218 1137 300 13180 1705 --
NM_004447chr12--161 ----
NM_004449chr2121105 391 1306 1176 1277
NM_004451chr11--1736 ----
NM_004454chr321990 814 ----11408
NM_004457chr22522 297 1565 ----
NM_004458chrX21651 178 --12423 --
NM_004459chr171228 ------
NM_004464chr444296 3631 1724 879 --22914 633 --
NM_004482chr23655 363 75 ------
NM_004500chr1461857 1558 1421 1409 730 205 --1216 1559
NM_004501chr133319 3277 2649 32944 2823 1191 --13699
NM_004504chr262809 2049 1051 478 114 77 21869 1170 12558 --
NM_004505chr1721695 1324 --1436 --
NM_004506chr6------1669
NM_004514chr174953 598 553 458 ----13054
NM_004520chr5----1270 --
NM_004523chr101527 ------
NM_004524chr172279 203 1242 ----
NM_004526chr31219 ----1635
NM_004529chr911461 ------
NM_004535chr202498 321 ------
NM_004537chr1221113 248 1187 11410 11467
NM_004571chr2133352 2942 78 32975 2902 1047 22927 62 11056
NM_004575chr441606 1254 1204 1196 --11133 11483
NM_004576chr54373 284 76 56 ------
NM_004586chrX75338 5312 5085 4943 4771 4381 1265 ------
NM_004598chr533089 529 28 --12746 --
NM_004600chr131514 615 275 --2551 530 --
NM_004612chr9104574 4457 4447 4210 3183 1788 1601 1519 477 374 2293 56 13949 --
NM_004619chr132105 589 264 ------
NM_004622chr262247 2165 1919 1823 1708 622 1689 --11786
NM_004635chr311209 1123 ----
NM_004654chrY41381 1114 201 46 11226 ----
NM_004655chr173902 562 58 --11267 1452
NM_004660chrY62188 2090 1553 850 576 528 12022 12294 --
NM_004663chr1551236 1162 974 135 96 1335 ----
NM_004671chr181310 ------
NM_004681chrY2606 589 1138 ----
NM_004685chr1322208 1868 --22752 522 --
NM_004687chr1721620 1381 ------
NM_004694chr17--2347 181 ----
NM_004701chr151120 ------
NM_004707chr521387 70 ------
NM_004709chrX41644 1436 700 77 --1637 --
NM_004719chr1272670 2611 2218 2182 2040 1874 720 ------
NM_004725chr1061385 1335 1135 575 269 256 ------
NM_004726chrX105383 4968 4484 3710 3598 1411 1397 650 292 166 25244 4123 ----
NM_004730chr521937 264 21589 1368 ----
NM_004731chr1251838 299 281 160 90 1618 ----
NM_004733chr3------149
NM_004736chr11619 21555 252 --11763
NM_004740chr17136 ------
NM_004744chr442796 1455 1216 539 --13325 13907
NM_004745chr857040 4862 4361 1477 1364 --46896 2410 1748 757 16362
NM_004760chr721735 1709 --11754 32352 2283 1881
NM_004762chr1721893 1852 ------
NM_004768chr121165 470 1874 1235 --
NM_004772chr51172 ------
NM_004774chr1763016 2896 2460 1975 309 212 22577 368 ----
NM_004775chr1862241 2040 1946 1489 563 397 --11769 --
NM_004776chr2042673 2329 443 299 23247 3200 1879 --
NM_004781chr111120 1613 ----
NM_004781chr111120 1613 ----
NM_004788chr1162339 2219 1848 1752 1061 649 ------
NM_004789chr91326 ------
NM_004792chr2------1199
NM_004794chrX143 ------
NM_004796chr1452328 2182 1897 1525 30 ----12176
NM_004798chr20----33589 1255 562 --
NM_004800chr13----185 --
NM_004801chr2140 --11095 --
NM_004817chr92566 540 --1795 --
NM_004821chr52672 527 ------
NM_004824chr631429 1261 338 ----1165
NM_004831chr192861 693 ------
NM_004834chr253221 2740 390 347 39 12419 1898 --
NM_004836chr24877 767 669 187 ------
NM_004842chr631514 1399 600 ------
NM_004845chrX63933 3644 2988 1171 649 145 --13858 --
NM_004846chr2--1129 ----
NM_004850chr231444 1407 1368 ------
NM_004855chr151211 ------
NM_004857chr1434161 3053 410 11697 13733 1609
NM_004859chr1761937 971 860 802 420 229 --1981 22312 936
NM_004865chr63359 344 299 ------
NM_004866chr574035 4013 3950 3539 1532 1343 159 13736 44700 3765 1766 1507 --
NM_004871chr1794300 3896 3265 3038 2917 2896 2672 336 290 190 ----
NM_004874chr81189 ------
NM_004893chr52483 111 ------
NM_004904chr796065 5861 5413 4304 1536 1022 670 605 240 32558 1893 1752 12051 --
NM_004906chr63606 533 469 ------
NM_004912chr721291 50 --1481 --
NM_004921chr121757 270 --12356 --
NM_004926chr1411685 1659 --11334
NM_004927chr1111423 ------
NM_004932chr51315 --11660 11785
NM_004939chr2----1145 150
NM_004946chr51416 ------
NM_004956chr754438 1493 578 300 81 ------
NM_004965chr212301 94 ------
NM_004966chr101996 ------
NM_004967chr4----1498 --
NM_004972chr94820 420 374 166 --152 --
NM_004973chr641766 1713 146 127 21141 234 ----
NM_004985chr12134168 4140 3998 3398 2960 1789 1619 908 368 260 201 167 84 12834 33004 1736 1313 1923
NM_004992chrX108279 5693 5424 5412 3271 2301 2206 1967 1483 992 28324 1128 12134 --
NM_004992chrX108279 5693 5424 5412 3271 2301 2206 1967 1483 992 28324 1128 12134 --
NM_004993chr1451501 1331 1230 374 231 --1977 --
NM_004996chr1661702 1183 594 508 425 320 ------
NM_004999chr6114146 3743 1745 1393 1251 1187 1034 792 763 751 548 ----13213
NM_005011chr741585 1539 496 110 1744 ----
NM_005016chr12--196 ----
NM_005023chr52614 514 21114 148 21287 105 11487
NM_005025chr3182 ------
NM_005036chr2278335 8204 2315 1514 1489 1387 1266 58351 6472 1275 867 167 11405 --
NM_005053chr19----157 1587
NM_005054chr221521 587 11186 ----
NM_005056chr1265389 4404 4265 1977 1350 1003 --1995 --
NM_005063chr1053481 3429 3188 362 301 153 --21340 871
NM_005065chr1425021 671 14291 22113 1142 13844
NM_005067chr33991 812 75 ------
NM_005088chrX1795 ------
NM_005114chr4----1552 --
NM_005116chr2074447 4323 3386 3060 1506 899 844 --11320 --
NM_005119chr121244 340 ------
NM_005121chr1773517 3367 3150 2531 794 477 457 33644 3381 572 1967 23502 1047
NM_005125chr11----1151 --
NM_005126chr342181 2071 1947 1877 ------
NM_005135chr1543871 2388 1330 234 --23290 2951 --
NM_005151chr1832212 1874 783 11592 --22253 686
NM_005156chr9135107 5086 4968 4932 4645 4326 4034 3953 3407 3318 1217 955 318 34699 3805 771 --34165 4087 890
NM_005160chr2286350 4971 4267 2704 943 936 766 756 26306 2607 35455 1284 732 11233
NM_005168chr241488 1472 471 208 1395 ----
NM_005171chr1231071 889 522 --167 --
NM_005180chr1021575 1495 --1588 --
NM_005188chr11208248 7876 7830 7001 6091 5892 5575 5470 5050 2840 2704 2649 2533 2079 1832 1748 1136 999 582 188 25066 206 1109 --
NM_005192chr14----1131 --
NM_005197chr1465762 5751 5143 4009 3965 246 1154 ----
NM_005201chr31339 ------
NM_005203chr10166 ------
NM_005204chr101831 --1902 --
NM_005207chr2283708 3564 2658 2508 1492 1220 1020 288 33579 3355 1125 ----
NM_005222chr71696 ------
NM_005229chrX21224 488 ------
NM_005230chr121541 ------
NM_005231chr1121321 251 ------
NM_005233chr3--2616 556 ----
NM_005235chr267126 4984 3094 2969 103 77 --15993 --
NM_005238chr1173523 3469 2990 2345 1175 932 515 2620 336 11320 --
NM_005241chr311020 --1468 --
NM_005242chr521316 1128 ------
NM_005243chr22--165 ----
NM_005252chr144711 632 616 536 ------
NM_005254chr1521249 215 ----1347
NM_005256chr112917 621 ------
NM_005257chr1811377 ----11128
NM_005259chr22353 222 11127 1206 --
NM_005264chr10----1373 --
NM_005273chr72339 311 ------
NM_005277chr41397 11730 ----
NM_005278chrX--1415 ----
NM_005281chr1----1267 --
NM_005295chr7------145
NM_005296chrX1145 --1409 --
NM_005302chr7160 ------
NM_005308chr101335 ------
NM_005310chr172355 132 ------
NM_005311chr752138 2112 1812 751 485 ------
NM_005318chr221414 --11051 --
NM_005324chr171566 --1591 21431 437
NM_005334chrX21641 1415 ------
NM_005336chr231985 1955 1417 ------
NM_005339chr463152 1239 1064 962 880 742 24225 3205 --13714
NM_005342chrX3668 566 381 ----12426
NM_005359chr1885335 4269 2485 2407 1732 1109 603 311 24092 2295 62255 2106 2009 1934 1922 617 --
NM_005369chrX--1441 ----
NM_005376chr131073 1028 221 ------
NM_005378chr21666 ------
NM_005381chr21386 ------
NM_005385chr332185 1834 1081 11950 2444 360 --
NM_005392chr921812 759 ----11879
NM_005397chr7103903 3844 3661 3586 3178 3108 3090 3062 1173 550 ------
NM_005399chr164047 3546 864 817 656 469 21023 749 171 --
NM_005406chr1841024 468 442 326 ------
NM_005415chr22793 104 1304 ----
NM_005433chr1852691 2164 1736 483 447 32519 2355 1895 11041 --
NM_005436chr1054102 4076 3261 2673 216 23613 1592 11562 12909
NM_005440chr1733117 792 567 ----12509
NM_005443chr42493 141 1194 ----
NM_005445chr102325 100 ------
NM_005450chr17------1229
NM_005461chr20----21946 591 11772
NM_005465chr151905 762 352 250 190 ------
NM_005471chr521105 48 11282 --1265
NM_005475chr1243310 3228 2107 1067 ------
NM_005487chr2232046 2031 419 1103 --11655
NM_005493chr62607 591 2759 598 ----
NM_005496chr321046 125 ------
NM_005497chr1776170 1272 1259 1105 559 470 292 35846 1784 1336 1567 --
NM_005499chr191526 ----1199
NM_005502chr942016 510 242 207 ------
NM_005504chr1276113 5896 5769 1833 1373 734 670 25927 4667 --35016 4927 4087
NM_005513chr311593 ------
NM_005517chr131322 237 97 --174 --
NM_005530chr151209 ------
NM_005539chr1041177 918 320 313 ------
NM_005542chr781910 1705 1504 1468 1400 1227 362 192 11301 1692 --
NM_005544chr21912 1635 ----
NM_005565chr52605 126 --1432 --
NM_005570chr1831126 1117 425 ----1988
NM_005573chr52587 162 ------
NM_005578chr3105108 5028 4394 4375 3790 2022 1669 1657 1070 359 --14473 --
NM_005585chr15----1142 --
NM_005587chr152384 308 --1972 --
NM_005595chr12643 632 ------
NM_005596chr9106233 5516 5201 4746 4378 3995 3944 2330 1859 1003 11961 25427 455 16310
NM_005599chr141534 1443 1141 994 1312 ----
NM_005604chr621850 1840 ------
NM_005610chr11308 1778 ----
NM_005611chr1621127 835 1822 ----
NM_005613chr131979 1920 1536 --1320 --
NM_005618chr61600 ------
NM_005626chr12553 38 ----1413
NM_005627chr62623 53 123 ----
NM_005634chrX1141 ------
NM_005637chr183703 667 105 1748 11644 --
NM_005638chrX31695 1516 167 --2434 324 --
NM_005639chr1221905 1365 1141 --21438 1267
NM_005647chrX63265 3243 3064 1198 621 177 23468 1093 12860 12529
NM_005650chr22--1417 11324 11213
NM_005655chr81504 ----11259
NM_005657chr15124 265 54 1117 --
NM_005660chrX1227 ------
NM_005665chr164946 4754 1779 1713 1484 1441 21186 958 24634 157 24680 946
NM_005668chr554603 4324 3846 3492 1686 23880 511 1972 --
NM_005685chr7199 ------
NM_005688chr321123 213 ------
NM_005711chr51433 --1778 --
NM_005717chr121196 1005 ------
NM_005721chr21246 194 ----
NM_005722chr241651 603 326 143 12190 22345 130 11608
NM_005725chr11666 --1575 --
NM_005734chr111252 ------
NM_005738chr732014 1475 655 --1687 --
NM_005739chr1532406 2385 1918 --21629 1573 --
NM_005746chr752014 1865 1011 423 76 11708 12653 --
NM_005748chr1253073 2894 2255 605 570 --31186 875 121 --
NM_005751chr71453 ------
NM_005759chr254517 3887 3757 3724 44 23975 1743 ----
NM_005779chr543109 2777 2717 1047 --12541 --
NM_005780chr131368 ------
NM_005791chr2163 ------
NM_005798chr1395096 4907 4331 4312 3816 2076 2016 946 24 23596 597 33336 1993 390 --
NM_005801chr17------2765 189
NM_005802chr9------1746
NM_005806chr2121260 267 ------
NM_005822chr611543 --12068 --
NM_005826chr13447 409 160 ----1419
NM_005828chr1731676 1098 550 ----1224
NM_005832chr321315 1044 ------
NM_005842chr132274 119 1162 1636 --
NM_005845chr1361732 1381 1349 1212 1154 49 11676 ----
NM_005857chr161273 1112 974 946 429 285 1473 1222 --
NM_005859chr531473 1232 519 11239 ----
NM_005862chr31339 1416 ----
NM_005863chr102996 60 --1921 --
NM_005868chr742290 2079 1671 169 --1698 --
NM_005875chr3139 ------
NM_005880chr1651570 1072 542 304 81 ------
NM_005896chr21750 ------
NM_005898chr1132895 2678 1053 --12636 --
NM_005899chr1721083 226 21499 1432 11513 --
NM_005900chr441112 959 435 408 ------
NM_005901chr18148690 7563 7429 6633 6545 6305 6149 3431 3163 2312 1791 1326 875 249 16939 16073 --
NM_005902chr1534500 1816 583 ------
NM_005903chr5105162 3994 3961 3849 2087 1785 1016 870 579 383 146 21090 516 --
NM_005907chr62217 134 11616 11588 --
NM_005909chr574146 2678 1462 1300 563 315 167 24059 3428 13291 1601
NM_005930chr14----1252 --
NM_005933chr11------1945
NM_005935chr465152 4918 3495 3335 946 481 24859 4696 --11950
NM_005955chr155236 4169 1871 395 374 --45268 4402 3666 3433 --
NM_005962chr1011794 --11584 --
NM_005962chr1011794 --11584 --
NM_005966chr252123 2068 1920 1815 949 11672 ----
NM_005975chr201803 ------
NM_005977chr13------1881
NM_005986chr1352385 844 716 481 221 ------
NM_005989chr72611 97 ----1528
NM_005999chr131518 1495 1253 1130 ----
NM_006007chr952838 1789 1349 1321 129 34430 3182 655 1109 --
NM_006011chr1534259 4011 3989 11553 ----
NM_006015chr1--1822 ----
NM_006016chr651785 1617 774 317 229 ------
NM_006035chr1421253 385 --1160 11328
NM_006036chr242507 2411 2187 448 --153 --
NM_006037chr2104782 4426 4006 3855 3589 3390 1797 1729 1578 1500 147 ----
NM_006047chr2053397 2466 2322 1145 310 ----23537 3088
NM_006051chr5161 ------
NM_006060chr774451 3607 3542 3228 3154 2876 2753 23970 1120 --14052
NM_006067chr162829 414 1113 --1301
NM_006080chr732323 739 716 31132 1104 747 --12535
NM_006089chrX51898 1891 1816 662 83 ------
NM_006090chr1----1696 1724
NM_006094chr8------21527 773
NM_006095chr484396 4355 4238 1425 1374 1045 909 226 64473 3658 3320 1267 903 518 --13235
NM_006100chr32243 212 --141 --
NM_006106chr1183367 3290 2675 2419 1367 1352 537 86 --12141 --
NM_006107chr172337 156 --1508 --
NM_006108chr1141526 917 689 101 11680 22056 134 --
NM_006113chr142072 1888 1618 1583 2636 509 11725 1149
NM_006136chr71282 ------
NM_006139chr232488 2220 1782 --22794 215 --
NM_006141chr1682554 2447 2264 2203 2033 1075 940 98 ------
NM_006143chr121109 ------
NM_006153chr32267 219 ------
NM_006154chr152358 103 --2671 43 --
NM_006159chr121571 ------
NM_006164chr2135 ------
NM_006166chr1231945 1659 458 --2861 678 --
NM_006180chr911927 11367 ----
NM_006186chr21476 ------
NM_006187chr1232959 2356 160 1524 12629 --
NM_006190chr21945 ------
NM_006196chr2--187 ----
NM_006197chr83454 361 234 ----21993 286
NM_006203chr5125607 5470 3449 1958 1483 1334 1093 874 802 695 502 172 44360 1598 1541 1007 11864 14934
NM_006206chr421099 773 12919 11840 --
NM_006211chr82232 78 ------
NM_006223chrX2433 218 1488 128 --
NM_006226chr2181 2382 195 ----
NM_006237chr133926 905 852 1302 12249 --
NM_006246chr143829 267 74 ------
NM_006251chr522985 2458 12741 12996 22797 928
NM_006252chr1127379 7021 6590 6463 6066 5200 2688 2039 1860 1322 1223 530 12911 25224 4628 25526 4650
NM_006255chr14--1995 ----
NM_006256chr142646 567 386 99 22695 2369 --1984
NM_006265chr831385 409 115 41297 1269 1139 534 1953 --
NM_006281chr81828 ------
NM_006281chr81828 ------
NM_006282chr2044224 3663 1720 1690 34753 3360 3252 21289 296 2441 248
NM_006283chr874129 3082 1992 1448 931 425 358 41722 1428 1410 304 1692 --
NM_006300chr1931976 1932 306 --12358 --
NM_006306chrX24103 406 11576 1499 14804
NM_006310chr172913 97 11304 --11135
NM_006311chr172258 49 ------
NM_006324chr16174 ------
NM_006325chr12--1761 138 --
NM_006330chr821172 77 ------
NM_006350chr5151 ------
NM_006352chr162039 1999 1800 1503 611 350 11450 2396 88 1775
NM_006353chr641221 1032 529 392 --175 --
NM_006357chr21430 ------
NM_006359chrX41697 942 222 189 --1265 --
NM_006364chr141245 ----11156
NM_006369chr11435 ------
NM_006371chr365316 4750 3612 3328 834 642 14413 15138 11278
NM_006379chr732110 538 21 --21937 132 --
NM_006380chr1794050 3706 3688 3505 3370 3360 2764 1672 1513 --11112 --
NM_006386chr2252155 1592 890 697 606 ------
NM_006390chr1231462 655 286 ------
NM_006416chr61216 ------
NM_006420chr2083412 3239 3165 3044 2860 2543 696 655 23099 2993 ----
NM_006421chr821249 1163 --1137 --
NM_006434chr1062963 2821 2253 2211 2109 852 ------
NM_006451chr53992 799 341 --126 --
NM_006457chr442528 1107 504 96 --13907 --
NM_006460chr1721790 234 ------
NM_006464chr244528 3856 1191 933 --11511 --
NM_006482chr1243051 2663 2589 196 23494 2927 ----
NM_006489chr1451977 1807 329 164 88 130 1434 21395 489
NM_006496chr141959 1698 1357 1323 ------
NM_006504chr1032777 921 548 12618 ----
NM_006526chr2042145 2003 1648 28 1593 11496 --
NM_006529chr431653 1321 609 ----11061
NM_006536chr13872 289 114 1759 1783 --
NM_006537chr152123 54 ------
NM_006540chr811210 21279 490 ----
NM_006544chr14135909 5212 4125 3707 2440 2205 2131 1564 1269 965 439 168 53 14227 25861 1708 --
NM_006546chr1766614 6396 5566 5370 2429 2230 35773 366 343 --11787
NM_006547chr742048 1503 1350 107 --1476 11709
NM_006559chr11405 ------
NM_006561chr10146053 5577 5461 4910 4242 4235 3910 3817 2209 1424 1254 966 548 521 12163 --36184 1723 826
NM_006565chr163874 373 356 --11080 1413
NM_006572chr1722933 2182 21192 24 12371 --
NM_006593chr21574 ------
NM_006597chr11--1215 --187
NM_006599chr16116792 6395 5289 2969 2375 1917 1901 1357 1068 998 404 17931 2829 517 --
NM_006603chrX51789 1643 1469 215 158 21866 526 ----
NM_006609chr272368 1926 1841 900 889 416 219 ----1576
NM_006614chr353119 3048 1393 942 752 --2545 479 --
NM_006618chr141531 1150 487 471 11275 ----
NM_006622chr51215 1235 ----
NM_006624chr1041967 1433 281 179 --11942 11704
NM_006626chr9154 1782 12292 --
NM_006628chr1564333 4217 2841 1107 735 164 24396 2997 23161 1668 1295
NM_006629chr1842337 2179 1089 268 --2941 674 --
NM_006633chr52789 508 1278 ----
NM_006636chr21687 ------
NM_006646chr1352922 2777 2563 484 151 12497 22830 1959 --
NM_006654chr1284340 3732 1762 931 876 851 775 41 13170 21643 1381 --
NM_006660chr151247 ------
NM_006667chrX61205 1142 999 440 121 101 ------
NM_006713chr51310 146 ----
NM_006717chr963199 2929 2780 2771 1036 495 13048 11086 --
NM_006718chr621061 972 144 --11021
NM_006722chr392466 2209 1081 1005 908 814 735 708 525 --11981 --
NM_006726chr42881 150 ----1214
NM_006727chr52555 511 ------
NM_006729chrX84537 4272 3609 2242 2236 2154 1847 1031 --13477 --
NM_006731chr955736 3799 1686 1645 1187 ----12054
NM_006738chr1543459 3261 2821 1609 13954 --14527
NM_006746chrX61552 1545 1470 970 548 236 ----1613
NM_006750chr1687630 7217 6581 6440 3229 945 740 490 12164 47864 6551 5506 2649 --
NM_006751chr21837 ----1780
NM_006756chr851531 1434 1102 961 83 --11004 --
NM_006772chr621627 1117 ------
NM_006774chr72293 154 ------
NM_006775chr682989 2931 2799 2574 2372 2196 643 136 ------
NM_006777chrX82267 2260 2186 1015 428 222 172 26 --21099 457 --
NM_006788chr1821683 221 ------
NM_006790chr51368 1105 ----
NM_006791chr152599 255 1565 ----
NM_006802chr12183 174 1269 ----
NM_006803chr831580 1545 713 --31846 1556 29 --
NM_006805chr531175 503 303 1309 ----
NM_006808chr91156 ------
NM_006815chr1231306 966 280 --11173 --
NM_006822chr172605 533 ------
NM_006823chr811321 11294 ----
NM_006827chr1433114 1154 990 --12511 --
NM_006832chr141757 1411 --1851
NM_006838chr1211398 193 ----
NM_006852chr1732855 1036 549 ----12908
NM_006868chr1863225 2101 2046 2003 1949 466 12964 1314 --
NM_006873chr243104 3088 941 109 ----22317 1258
NM_006874chr441185 1013 952 334 ------
NM_006885chr1663847 2755 1467 986 566 543 --24048 3617 2808 426
NM_006888chr1473497 2706 2410 2267 1248 855 310 13165 1220 --
NM_006892chr2021379 1243 ------
NM_006892chr2021379 1243 ------
NM_006897chr121204 ------
NM_006898chr21615 ------
NM_006908chr751208 1154 1109 605 584 ------
NM_006910chr161402 ------
NM_006915chrX41648 779 688 242 ----1197
NM_006918chr1155654 3562 2214 1680 1221 14772 --11332
NM_006924chr1734168 3746 46 1714 34053 3280 1079 --
NM_006930chr531802 231 187 1108 1611 31289 525 73
NM_006931chr12--12159 1470 --
NM_006938chr182900 75 1214 4949 832 817 127 --
NM_006939chr145756 454 441 213 49 ----11205
NM_006940chr1221833 437 --1286 1122
NM_006947chr441693 1420 1263 408 1545 --11631
NM_006948chr2162283 2198 1795 986 959 156 12466 1607 12123
NM_006951chr103790 763 581 ------
NM_006963chr101477 21166 1083 1388 --
NM_006965chr1841207 1131 92 38 1223 ----
NM_006981chr932900 630 211 32708 429 340 1640 --
NM_006982chr121227 ------
NM_006996chr141830 735 502 332 ------
NM_006999chr572064 1446 1419 1337 838 685 429 ------
NM_007006chr1683482 2598 1305 863 727 673 99 89 ------
NM_007007chr1284395 4040 3992 3913 3180 2991 207 42 33758 3110 811 21622 486 14521
NM_007011chr1586226 5934 5857 4729 2535 1225 794 552 ------
NM_007013chr8----1299 --
NM_007017chr51365 1791 ----
NM_007027chr31146 ------
NM_007033chr161761 1599 1565 879 844 42 1463 ----
NM_007034chr11837 11039 ----
NM_007035chr12--2849 706 1255 --
NM_007038chr2195935 5865 4667 4526 3979 2326 1806 1754 973 1565 14235 --
NM_007040chr192826 435 11008 ----
NM_007042chr342502 2016 492 377 1638 ----
NM_007054chr553720 3627 3489 2540 587 12434 12667 --
NM_007064chr331427 630 508 ------
NM_007073chr64918 361 260 205 42827 2593 283 42 --14081
NM_007076chr121124 ------
NM_007084chr1321426 364 11449 ----
NM_007106chr1322092 34 1225 12748 --
NM_007107chr332254 1798 242 12403 ----
NM_007111chr131299 1919 ----
NM_007112chr12240 179 ------
NM_007114chr323102 141 23113 1114 13027 --
NM_007124chr611571 1806 ----
NM_007125chrY21003 452 --1980 --
NM_007129chr134756 335 217 158 21010 389 ----
NM_007137chrX75460 4092 3763 3747 1909 1158 622 35447 5310 3791 24853 1922 11144
NM_007146chr1742540 2319 1025 1004 ------
NM_007147chr19----11245 --
NM_007150chrX4777 563 551 67 --11987 --
NM_007157chrX82844 2561 2547 2037 1955 854 710 267 12540 12985 --
NM_007158chr121197 1107 --11235 1136
NM_007159chr3--11669 ----
NM_007166chr1121501 1367 ------
NM_007172chr2273292 3063 2855 2722 2636 658 73 ------
NM_007175chr873549 3513 3416 2994 2738 2542 190 32329 981 804 23531 3519 --
NM_007191chr122719 167 124 ----
NM_007195chr1843551 2436 1486 455 42928 2852 2643 2304 ----
NM_007200chr1543459 3261 2821 1609 13954 --14527
NM_007202chr174631 539 298 264 ----1218
NM_007203chr974009 3938 3443 3047 2735 2606 1523 ------
NM_007207chr1--1691 ----
NM_007212chr131416 749 443 11445 1428 12158
NM_007214chr62942 114 1403 1379 --
NM_007218chr82740 362 1756 1903 --
NM_007222chr821603 509 ------
NM_007249chr1379477 8270 7962 6330 2805 2177 1116 67177 3678 3315 3190 2776 2442 17186 --
NM_007250chrX--1577 ----
NM_007269chr11450 ------
NM_007274chr11126 ------
NM_007276chr7155 1735 11133 --
NM_007282chr31329 ------
NM_007285chr161194 --1183 --
NM_007308chr44512 216 124 103 ------
NM_007315chr241461 1358 475 37 11365 ----
NM_007345chr183479 304 114 22255 81 --11747
NM_007347chr1532637 2231 368 ------
NM_007350chr1264472 4104 1017 328 249 167 24378 3605 33764 1506 1262 --
NM_007358chr131942 1255 324 1568 ----
NM_007359chr1721108 496 11704 ----
NM_007361chr14--1672 ----
NM_007373chr1061619 1525 718 534 396 195 ------
NM_007374chr141383 ------
NM_007375chr121022 192 22388 385 ----
NM_012081chr593495 3152 2807 2740 1350 1274 1017 514 281 --23230 3043 --
NM_012082chr8----1788 --
NM_012090chr11818 11109 ----
NM_012095chr1053463 3275 2920 992 885 --12636 --
NM_012096chr342649 1509 1471 866 --12944 --
NM_012097chr251726 1670 1663 1473 193 11911 ----
NM_012104chr1153119 3095 2987 2670 2424 --1676 --
NM_012104chr1153119 3095 2987 2670 2424 --1676 --
NM_012115chr61621 171 ----
NM_012120chr652924 1993 1924 1056 294 12392 ----
NM_012129chr752248 2044 2025 1986 155 ----11860
NM_012141chr1321040 715 --13122 --
NM_012155chr191224 ------
NM_012157chr32165 61 --1942 --
NM_012158chr1331141 391 164 --21435 58 11263
NM_012160chr62524 389 188 ----
NM_012164chr9147245 6477 6058 5847 5688 5388 4635 2939 2687 2508 1405 969 658 182 36575 2423 304 22761 2636 --
NM_012183chr1----1455 --
NM_012193chr1155455 4919 4252 3952 426 11436 41960 1213 492 79 --
NM_012197chr911613 1524 ----
NM_012199chr164663 3874 3784 3336 1725 1203 21703 546 ----
NM_012207chr102825 729 --1954 2374 29
NM_012215chr1081841 1773 1671 1661 1408 1343 287 68 11681 2407 238 --
NM_012218chr194797 546 256 248 --2412 62 --
NM_012223chr221285 65 1334 1969 1168
NM_012224chr431045 865 402 ------
NM_012229chr101500 11317 ----
NM_012234chr383754 3259 2457 1449 1206 996 463 214 23589 2897 21002 634 --
NM_012238chr1041650 1537 1260 353 21756 1596 ----
NM_012242chr101547 ------
NM_012245chr141181 1420 ----
NM_012249chr243181 2897 2502 551 ------
NM_012252chr785278 5142 4825 4410 1363 1219 938 418 33814 3493 297 ----
NM_012255chr202435 86 --146 --
NM_012259chr651431 1391 1247 565 422 --1499 --
NM_012262chr135014 4119 1543 34506 925 567 1721 --
NM_012281chr742227 1593 1509 863 ------
NM_012287chr354104 3636 1707 1261 924 42948 1639 1206 808 14447 --
NM_012290chr231154 524 383 ------
NM_012291chr121109 ------
NM_012294chr793814 3520 3485 3395 2903 2788 1194 389 293 1335 42656 1414 406 103 --
NM_012297chr452411 2253 2063 2021 1853 1714 41968 1875 924 24 12336
NM_012300chr531789 563 316 22271 1007 --141
NM_012301chr711766 2730 74 ----
NM_012307chr182895 280 ------
NM_012308chr1122044 1695 ------
NM_012317chrX2669 563 ------
NM_012327chr1841566 1500 1367 996 ------
NM_012328chr731464 1066 582 ------
NM_012329chr1741581 1207 662 491 11270 1620 --
NM_012330chr102651 534 2571 349 ----
NM_012331chr8--1552 ----
NM_012333chr121266 1227 1186 ----
NM_012338chr731095 843 38 ------
NM_012341chr101470 --1398 --
NM_012382chr594529 4126 3114 1662 1390 694 360 230 55 ------
NM_012388chr1533081 2523 199 ------
NM_012399chr2221359 703 ------
NM_012412chr71233 --1790 --
NM_012416chr931078 496 177 1226 ----
NM_012464chr462713 1129 798 494 419 92 --11793 --
NM_012482chr1249 30 1284 ----
NM_012486chr1----166 --
NM_013230chrY31526 374 98 --1540 11593
NM_013231chr1483988 3935 3791 3779 3678 3405 2707 209 --24413 1241 --
NM_013233chr21349 --11031 1528
NM_013238chr1341876 1414 685 85 2450 441 2163 118 --
NM_013242chr161352 ------
NM_013254chr12--1665 ----
NM_013255chr7138183 7344 7110 7016 6803 6322 5799 2572 2084 1898 1501 579 142 38517 3153 2107 ----
NM_013257chr812233 12045 11598 --
NM_013261chr433708 2918 2599 --11483 --
NM_013262chr631007 472 286 1494 ----
NM_013269chr1243559 1531 328 285 11565 ----
NM_013283chr53799 743 82 ------
NM_013309chr1522176 544 2861 308 --2748 563
NM_013316chr71823 1721 ----
NM_013322chr761614 1604 1459 1292 303 167 1285 ----
NM_013330chr1--197 ----
NM_013336chr312011 1287 ----
NM_013341chr252581 2503 1849 576 374 1142 ----
NM_013354chr84961 463 425 59 --1396 --
NM_013357chr8182 ----1672
NM_013372chr1562870 2653 1209 1186 765 414 32526 2152 1219 12239 --
NM_013373chr221997 ------
NM_013374chr352595 2409 789 624 379 ------
NM_013380chr19----1808 --
NM_013390chr941754 1657 1550 353 11536 --1511
NM_013396chr212586 95 --1422 --
NM_013400chr711091 ------
NM_013436chr2296 50 1757 ----
NM_013437chr811232 11384 21333 84 --
NM_013438chr921280 468 11253 ----
NM_013448chr141184 1614 ----
NM_013449chr1242508 2482 577 277 ------
NM_013450chr221105 916 --11186 --
NM_013986chr22--165 ----
NM_013989chr1454767 4757 4428 1069 560 132 11573 --
NM_013995chrX32493 2312 2101 1266 12426 --
NM_014000chr1011701 ------
NM_014011chr242601 2225 2119 396 22473 2368 32305 1853 740 --
NM_014023chr1092865 2731 2451 1982 1115 927 763 622 197 --12849 --
NM_014038chr71405 ------
NM_014043chr311230 1514 11090 --
NM_014048chr1654952 4878 4855 1968 67 ------
NM_014055chr122130 27 --1443 --
NM_014089chr1331847 874 109 ------
NM_014110chr11774 ------
NM_014112chr855386 3586 2091 526 72 13901 15513 --
NM_014117chr1622490 537 22517 2105 --1731
NM_014141chr794283 2062 1990 1006 827 555 343 290 206 33546 3302 1884 35095 3845 756 25371 1489
NM_014154chr311116 --1372 --
NM_014155chr11127500 7043 6648 5324 3025 2443 2168 1650 1070 325 295 276 11467 12830 --
NM_014157chr1653301 1431 1077 1026 862 23029 2585 11012 --
NM_014170chr31315 193 ----
NM_014189chr411514 ------
NM_014190chr411866 ------
NM_014203chr19164 ------
NM_014211chr54541 461 129 34 ------
NM_014233chr1712166 21901 730 ----
NM_014236chr1--1226 ----
NM_014241chr101281 ----163
NM_014243chr441916 1616 795 329 ------
NM_014245chr311026 11099 2731 172 --
NM_014246chr2252246 2192 1693 1617 147 21462 435 11845 --
NM_014250chr2232046 2031 419 1103 --11655
NM_014253chrX1260 12476 ----
NM_014263chr10133 ------
NM_014264chr42449 91 ------
NM_014271chrX3224 186 135 1680 1318 --
NM_014278chr42144 131 ------
NM_014282chr92883 432 ------
NM_014283chr111349 --1185 --
NM_014290chr91158 1165 ----
NM_014300chr15140 ----1438
NM_014302chr7122 ------
NM_014309chr2261588 1409 1137 664 492 476 33721 3690 952 --11248
NM_014315chr14--1117 ----
NM_014319chr1252001 1639 1386 240 206 --1612 1138
NM_014323chr221171 1695 1891 --
NM_014331chr477319 6783 6603 6117 5813 985 383 --36990 5135 713 16182
NM_014332chrX1361 ------
NM_014335chr1531363 1215 83 1951 ----
NM_014342chr1121020 942 11448 ----
NM_014344chr11----1769 --
NM_014363chr132919 421 ------
NM_014372chr171976 1957 1502 1322 775 538 432 ----1481
NM_014374chr711091 ------
NM_014382chr321209 544 --11357 --
NM_014392chr411224 ------
NM_014393chr81584 52117 1616 851 281 115 --12031
NM_014394chr1041197 967 450 294 11050 ----
NM_014397chr91546 ------
NM_014415chr31402 11479 ----
NM_014423chr585209 4613 4292 2149 2098 2015 1509 111 14988 24441 1474 --
NM_014445chr361907 1621 1602 524 285 172 --1402 1555
NM_014447chr421329 1227 21256 180 ----
NM_014456chr1031742 293 74 2539 473 123 --
NM_014458chr111172 1209 ----
NM_014462chr82298 103 ------
NM_014469chr112254 190 ------
NM_014470chr122737 104 ------
NM_014488chr111664 1595 ----
NM_014494chr1622372 596 ------
NM_014503chr121400 ------
NM_014507chr222903 878 ------
NM_014516chr19----1269 --
NM_014517chr341810 1711 1612 1508 11704 180 --
NM_014554chr1262162 2009 1729 1511 1477 616 ------
NM_014570chr223913 828 92 ------
NM_014572chr13--1102 ----
NM_014574chr1491418 1401 1391 1358 1268 990 597 587 309 --11187 --
NM_014575chr31456 --1546 1356
NM_014577chr223149 137 25 1775 ----
NM_014583chr32512 326 ------
NM_014584chr1451516 1147 1134 508 315 1143 1590 190
NM_014585chr23954 900 369 11075 ----
NM_014606chr421471 1463 21572 245 ----
NM_014607chr24824 550 538 482 ------
NM_014612chr941434 1102 492 342 ----1178
NM_014613chr543110 2650 2528 511 11104 ----
NM_014614chr221318 603 ----188
NM_014615chr1632625 816 234 ------
NM_014616chr363248 3154 3001 2318 2268 1370 11392 ----
NM_014634chr2221069 746 --12938 --
NM_014635chr231493 1418 551 11149 ----
NM_014637chr841353 360 261 113 11484 ----
NM_014646chr1852995 2678 2195 2004 1053 1756 --13149
NM_014649chr19121 ------
NM_014655chr152351 2170 1972 1931 894 1675 --12034
NM_014659chr15----1309 --
NM_014660chr71334 1811 --11006
NM_014666chr531193 474 143 ------
NM_014667chr331565 1558 678 1823 ----
NM_014670chr221543 238 1192 --1345
NM_014671chr731427 1407 272 ----11375
NM_014674chr353717 3008 1234 693 637 2757 418 197 13724
NM_014676chr131212 425 237 ------
NM_014677chr811096 ------
NM_014679chr1131253 487 288 ----1206
NM_014682chr822200 334 2775 454 --11798
NM_014685chr162452 100 --1576 --
NM_014686chr1932093 1826 964 12166 ----
NM_014689chr2196 ------
NM_014701chr1552796 2557 2418 2151 1262 13424 21102 855 --
NM_014702chr693348 3332 3146 2405 905 728 432 213 128 ------
NM_014705chr711735 ------
NM_014707chr772306 2089 1887 1688 1512 377 130 1583 --1446
NM_014709chr23567 225 67 ------
NM_014711chr1642093 1926 1847 1799 ------
NM_014713chr22208 190 ------
NM_014730chr1231215 1069 765 25295 3406 14556 --
NM_014730chr1231215 1069 765 25295 3406 14556 --
NM_014733chr551973 736 632 467 459 ----11642
NM_014735chrX82088 2074 1445 1300 860 169 145 138 ------
NM_014739chr683916 3667 2687 1116 1055 755 627 353 23865 138 13566 22988 840
NM_014742chr2021611 217 1330 1659 --
NM_014743chr432170 1053 273 ------
NM_014747chr185281 3997 1681 1096 745 459 283 78 --24832 1823 14941
NM_014749chr141165 144 ----
NM_014751chr832103 1895 294 163 ----
NM_014752chr1141397 1256 713 258 11916 1593 --
NM_014755chr284000 3350 3209 3040 1679 1487 710 139 23729 3297 34278 4264 366 --
NM_014756chr112456 365 ------
NM_014757chr532370 847 699 --12239 --
NM_014765chr132330 2070 328 --32671 2122 1693 1563
NM_014774chr123152 1245 32515 2408 891 1762 --
NM_014779chr34438 421 294 284 ------
NM_014793chr15147 ----1537
NM_014800chr731108 999 988 ------
NM_014803chr1062802 2747 2669 2195 583 198 12967 12631 22392 1172
NM_014812chr141376 746 599 248 31645 1415 731 ----
NM_014819chr522407 2046 ----1590
NM_014822chr4189 ------
NM_014827chr131220 1054 335 21703 377 21728 1366 11137
NM_014828chr1412470 12058 1882 --
NM_014829chr51509 --32202 1532 489 1909
NM_014830chr1253817 3289 2398 866 338 --1320 11300
NM_014836chr1031801 1243 86 ------
NM_014838chr2272721 2133 493 305 286 276 195 ------
NM_014839chr152092 2029 1899 738 226 ------
NM_014840chr1262968 2839 2768 2435 2247 2081 22988 1293 ----
NM_014841chr6------11077
NM_014848chr1542712 2345 1943 241 ----11782
NM_014849chr131295 205 126 ------
NM_014860chr262656 1895 568 432 191 182 22323 275 22630 1635 --
NM_014871chr122636 596 ------
NM_014872chr951821 1497 859 665 187 2658 443 ----
NM_014876chr222243 111 --1872 --
NM_014877chr17187673 7633 7365 7220 6758 6582 6546 6206 5902 5650 5257 4928 2973 2643 2237 1947 1292 1043 35183 105 35 47351 4866 571 512 --
NM_014885chr4142 ------
NM_014887chr135864 711 587 331 64 ------
NM_014897chr1753121 2629 2100 871 582 --12489 12181
NM_014898chr19----1124 --
NM_014901chr531937 1556 789 --11494 --
NM_014903chr1252316 2308 1905 683 656 11748 1720 --
NM_014904chr1063784 3714 3386 2960 1132 743 11096 1137 --
NM_014905chr241960 755 276 129 11798 ----
NM_014906chr1723500 1356 23426 776 ----
NM_014909chr1421427 220 --12540 --
NM_014912chr1033437 992 132 ------
NM_014916chr72724 597 ------
NM_014918chr1551615 1330 1249 1128 74 1434 ----
NM_014920chr643595 628 280 163 ------
NM_014923chr1321467 225 3703 485 361 22379 1552 --
NM_014924chr1452986 706 642 469 227 22198 2080 1394 --
NM_014932chr341277 694 421 404 ------
NM_014939chr1881296 598 586 497 476 448 57 41 ------
NM_014946chr273049 2697 2567 2536 749 500 274 1445 22457 116 --
NM_014947chr153002 2753 2646 437 395 42987 2279 1958 420 1939 --
NM_014949chr1121 --1359 --
NM_014951chr1042617 2442 2304 1972 ------
NM_014953chr1343736 3641 3615 1201 --24132 428 14215
NM_014961chr412202 ----11840
NM_014962chr2062565 2118 1003 514 455 301 11781 ----
NM_014974chr1011799 21375 425 ----
NM_014978chr1011781 ------
NM_014982chr1444385 3462 833 285 --24856 4191 --
NM_014988chr461893 1783 882 440 356 269 ------
NM_014989chr651955 1619 512 473 127 22017 1791 1698 --
NM_014992chr141647 ------
NM_014996chr32665 58 ------
NM_015000chr1232989 2953 416 1540 22517 2159 --
NM_015001chr11979 ------
NM_015008chr3123479 3183 3073 2700 2504 2342 2292 1351 1101 886 194 86 1971 1995 --
NM_015009chr33620 106 82 ------
NM_015011chr1331093 457 401 ------
NM_015017chr121126 217 --21018 249 1198
NM_015018chr6180 ------
NM_015025chr262270 1962 603 354 179 149 ------
NM_015026chr12104117 3991 3959 3684 3564 3323 1606 1545 1450 64 ------
NM_015032chr1342350 1179 859 813 32360 1991 1813 1205 --
NM_015035chr2096168 5635 5195 4362 4287 1838 1723 1612 1092 26469 6131 26061 1237 --
NM_015040chr243182 924 537 79 22204 329 --13164
NM_015042chr1554363 4024 3429 903 589 13187 ----
NM_015045chr1011871 ----12054
NM_015046chr941994 932 395 256 --1629 --
NM_015049chr222596 260 22424 270 1410 --
NM_015051chr983369 2989 2847 2296 2182 865 488 467 --2875 263 --
NM_015055chr1132927 2780 2665 11812 ----
NM_015061chr93836 256 87 --1211 --
NM_015062chr101107 ------
NM_015068chr763386 3063 2857 2628 1513 316 11229 ----
NM_015071chr5105270 4696 4233 2207 2074 2003 1933 1406 1276 618 24552 2404 11727 1981
NM_015074chr194814 4618 3783 3775 1892 1881 1820 1736 552 14276 ----
NM_015076chr653959 1807 1139 926 381 22953 1492 1411 1507
NM_015091chr142776 748 --1614 --
NM_015092chr1664476 4292 3729 3526 3316 2934 13039 11089 --
NM_015093chr631777 1766 377 11563 ----
NM_015094chr2224461 1459 ----24661 1537
NM_015097chr341711 1657 762 440 --21691 117 --
NM_015115chr423187 44 22383 565 ----
NM_015124chr2222254 158 ------
NM_015130chr4173 11039 ----
NM_015132chr741518 1235 576 101 21354 201 1794 11305
NM_015137chr852619 2578 2106 2020 157 21040 291 12407 --
NM_015139chr1139 ------
NM_015144chr1683941 3863 3315 3272 3114 2791 1365 645 --13676 --
NM_015153chr62502 262 --2298 233 --
NM_015156chr1443528 2742 904 896 ------
NM_015163chr1431768 1627 141 --21489 569 --
NM_015170chr821707 1440 ------
NM_015173chr411180 ------
NM_015180chr14--1799 ----
NM_015184chr32678 638 ------
NM_015185chrX2718 291 1284 ----
NM_015186chr92442 312 ------
NM_015192chr2032463 615 585 ------
NM_015197chr1433352 2225 529 ----1120
NM_015199chr353021 2169 1032 934 573 1561 1170 1158
NM_015200chr452467 2264 955 858 359 ------
NM_015203chr11162 ------
NM_015208chr1883758 3542 3260 2912 1321 636 477 360 11104 --1494
NM_015209chr132166 734 683 ------
NM_015213chr111683 1644 ----
NM_015215chr131133 641 148 22472 587 13045 --
NM_015216chr521476 1450 11357 ----
NM_015229chr1711195 ----1763
NM_015231chr112925 806 ------
NM_015233chr1361820 824 768 450 310 215 --1810 1699
NM_015236chr411329 1321 ----
NM_015238chr5----1710 --
NM_015239chr91185 ------
NM_015247chr16105226 5034 4871 4535 4256 4010 1461 1344 546 442 14865 15083 13454
NM_015251chr1652329 1999 1510 604 250 ------
NM_015264chr2254053 3585 3137 1636 1244 23835 3690 ----
NM_015265chr242542 2379 1946 70 --12303 1955
NM_015267chr1222031 1756 ------
NM_015269chr11237 1451 ----
NM_015271chr464060 1634 831 541 90 34 24269 3559 24081 234 --
NM_015272chr1632047 645 151 --22165 451 --
NM_015275chr121521 12013 ----
NM_015277chr1811298 ------
NM_015278chr632595 2415 1231 23350 905 --22728 2347
NM_015282chr272677 2162 1867 821 304 258 204 --1530 --
NM_015285chr1872329 1819 1615 660 244 135 31 ------
NM_015296chr134996 952 340 32 1353 --11025
NM_015305chr14--11933 ----
NM_015308chr111147 2828 671 171 2277 62
NM_015310chr8108303 8023 7914 7786 7012 5865 5249 3276 981 314 16346 25076 403 --
NM_015313chr1144563 3997 3367 3339 24373 404 1423 --
NM_015314chr772421 2304 2168 1719 561 449 123 12367 --32192 2099 699
NM_015315chr51723 ----1302
NM_015317chr242857 2368 1970 338 1640 ----
NM_015326chr142582 833 812 438 11118 2965 923 21892 955
NM_015328chr742635 969 680 374 --1772 --
NM_015335chr1232189 2037 2011 --1941 --
NM_015336chr1242454 1892 662 137 31966 1764 442 --1356
NM_015339chr20----1914 --
NM_015344chr871971 1685 1601 873 813 609 452 ------
NM_015349chr63920 494 463 --12590 --
NM_015350chr12510 443 ------
NM_015354chr91368 ------
NM_015358chr213889 838 79 --11074 --
NM_015359chr842941 2070 1911 625 22693 1172 11818 --
NM_015361chr21279 ------
NM_015365chrX84280 3922 2995 1385 589 460 428 199 --11227 --
NM_015375chr144980 4838 1575 1131 24904 4733 ----
NM_015381chr2212022 1791 ----
NM_015382chr141151 --1698 1616
NM_015385chr1062963 2821 2253 2211 2109 852 ------
NM_015387chr251517 501 445 439 395 1483 21990 1592 --
NM_015394chr1221571 479 --2672 106 1254
NM_015397chr921481 102 11731 ----
NM_015409chr122792 475 22658 1839 ----
NM_015419chrX5959 875 717 692 419 ------
NM_015428chr1951707 1512 1196 537 521 --11266 --
NM_015435chr831324 1005 591 1301 ----
NM_015436chr483041 2941 940 720 560 548 537 246 --12253 1388
NM_015441chr11335 ----2432 413
NM_015446chr12279 129 --1319 2645 371
NM_015455chr553708 3455 2725 2546 1251 22756 1279 13158 --
NM_015464chr72187 172 2954 143 --1251
NM_015475chr25975 804 352 330 141 ------
NM_015497chr1521098 67 11090 ----
NM_015503chr16--1695 ----
NM_015508chr311533 ----1173
NM_015520chr312819 12421 ----
NM_015530chr21862 ----1700
NM_015534chr13401 387 242 ----1437
NM_015550chr763334 3177 3048 1178 1129 994 23539 2433 --22311 1191
NM_015554chr1572949 2387 2373 1979 1834 1007 829 12302 12834 --
NM_015555chr621214 428 11671 ----
NM_015564chr522861 130 1790 ----
NM_015565chr2121603 376 1536 ----
NM_015567chr1321031 1023 ------
NM_015569chr144089 3956 1269 312 34431 4292 3190 2889 124 11258
NM_015571chr612479 22522 2196 12270 12605
NM_015575chr263569 2578 2467 2397 1004 225 ------
NM_015577chr511785 ------
NM_015578chr1941865 779 765 70 ------
NM_015599chr6145 --1275 --
NM_015601chr10--11018 2869 258 --
NM_015602chr111640 ------
NM_015610chr71548 ------
NM_015622chr71282 ------
NM_015626chr1711234 ------
NM_015630chr221043 965 1343 ----
NM_015640chr165388 5252 4380 1875 1346 201 44809 433 411 151 23246 846 21475 542
NM_015641chr731124 1021 444 ------
NM_015642chr31213 ------
NM_015646chr1211049 11311 ----
NM_015652chr102495 253 1233 ----
NM_015660chr7----1248 --
NM_015678chr1311668 --11441 --
NM_015686chrX11773 ------
NM_015691chrX72697 2543 2198 2032 280 268 42 ------
NM_015702chr2179 ----1298
NM_015713chr833320 2667 202 22701 1230 --22250 1444
NM_015723chr71573 ------
NM_015850chr832346 1675 831 ------
NM_015866chr11376 ------
NM_015878chr862217 2076 1705 680 618 340 --1369 --
NM_015879chr1827242 92 13134 57309 5981 5649 2307 160 12103
NM_015885chr11----1644 --
NM_015886chr885430 5359 4867 3968 3943 2055 1602 1294 34175 3710 1973 15606 --
NM_015891chr621941 1446 ----21882 488
NM_015902chr81821 ------
NM_015904chr21830 2815 270 ----
NM_015906chr1104863 4702 3258 3106 972 896 880 832 602 563 --13473 14799
NM_015955chr21366 ------
NM_015960chr10--1119 ----
NM_015975chrX188 --11486 --
NM_015976chr1--2351 247 ----
NM_015981chr573174 3054 1207 947 931 544 314 ------
NM_015982chr17154 ------
NM_015990chr421025 811 ------
NM_015995chr152886 333 15540 ----
NM_015997chr1------1174
NM_015999chr1------1579
NM_016003chr71548 ------
NM_016009chr184822 3853 3808 1933 1784 1704 1285 727 21492 429 11621 --
NM_016013chr15124 ------
NM_016019chr71736 --1229 --
NM_016021chr652952 2744 2594 2247 709 1342 ----
NM_016022chr11994 1848 ----
NM_016023chr842168 1413 805 688 2387 30 1116 --
NM_016037chr131140 737 245 --1203 --
NM_016045chr2051508 1190 738 628 101 ----1458
NM_016048chr51329 1704 ----
NM_016072chr1232422 2028 669 11813 --22037 1557
NM_016073chr151963 ------
NM_016075chr1353041 2693 2475 2108 319 32740 2485 1007 --12829
NM_016076chr142712 470 251 125 11112 ----
NM_016078chr1751082 1049 435 163 150 ----11001
NM_016081chr442276 2250 2053 791 11606 ----
NM_016087chr721640 1405 --11154 11294
NM_016090chr114755 218 199 167 ------
NM_016096chr862178 1753 1728 1703 1639 336 ------
NM_016097chr181365 --11009 --
NM_016103chr52463 378 ------
NM_016107chr52316 128 ------
NM_016120chrX31162 1037 157 ------
NM_016125chr171115 1175 ----
NM_016131chr232094 1671 1521 1699 22227 693 --
NM_016132chr1543145 930 367 312 1434 21016 450 33202 1065 801
NM_016133chr231214 661 106 --11040 11382
NM_016142chr1131135 1102 497 --1329 1924
NM_016152chr35863 476 393 135 91 ------
NM_016166chr15180 --1182 --
NM_016200chr72737 76 ------
NM_016203chr71269 1758 ----
NM_016206chr398412 5643 5440 3033 2088 1560 735 707 283 --27414 7117 16652
NM_016213chr15138 ------
NM_016217chr653641 3550 3395 3228 2372 1164 12838 12764
NM_016224chr641609 781 328 183 --1344 --
NM_016227chr111349 --1185 --
NM_016231chr172309 234 11305 --21454 114
NM_016239chr171755 ------
NM_016248chr1373896 2617 2509 1607 1227 1066 994 13661 ----
NM_016260chr2157607 7235 7172 6991 6896 5801 5465 5168 2495 1141 1062 784 708 593 383 11134 37298 4991 2781 36641 6267 6056
NM_016264chr19135 ------
NM_016270chr191486 ------
NM_016271chr1841992 1540 690 125 11986 32327 2308 2023 --
NM_016272chr2252559 2119 1076 280 241 ------
NM_016275chr352422 2215 2093 1832 1091 ------
NM_016277chr621535 1515 ----11099
NM_016287chr131837 1735 77 11831 1746 --
NM_016289chr21871 11627 ----
NM_016290chr51187 --198 --
NM_016299chr101113 ------
NM_016300chr31440 ------
NM_016303chrX1116 --1453 --
NM_016308chr151976 1928 1893 1734 563 ----1387
NM_016315chr221524 669 ------
NM_016322chr973117 2825 2658 2177 1991 1255 545 ------
NM_016328chr7199 ------
NM_016338chr531114 1040 968 ------
NM_016356chr662846 2622 2248 2030 977 871 1209 22942 2856 --
NM_016357chr122879 507 11140 11227 11054
NM_016377chr631514 1399 600 ------
NM_016383chrX----1745 --
NM_016395chr15185 --159 --
NM_016396chr1572932 1180 576 551 453 216 111 12818 11071 --
NM_016400chr15----173 --
NM_016418chr2243503 2853 373 289 23835 297 --12389
NM_016422chr1132377 470 204 13110 ----
NM_016424chr1731842 1661 516 1474 12013 --
NM_016436chr2032478 1844 265 --1519 11795
NM_016441chr252102 1908 1710 898 226 ------
NM_016463chr5--1168 ----
NM_016467chr241037 943 501 472 ------
NM_016480chr52784 121 --1132 --
NM_016485chr62873 177 ----189
NM_016507chr1762817 2458 2429 2088 388 294 12663 ----
NM_016513chr643595 628 280 163 ------
NM_016529chr13----1354 --
NM_016530chr15103919 3225 2854 2546 2523 1212 1110 1099 866 252 --11173 --
NM_016531chr423338 614 33182 3148 2669 ----
NM_016542chrX51749 1342 1218 501 347 ------
NM_016544chr283913 3738 3387 3238 2948 1179 1056 80 --23595 3022 --
NM_016559chr31576 11266 ----
NM_016586chr141173 ------
NM_016587chr7155 1735 11133 --
NM_016588chr62745 179 ------
NM_016599chr431464 506 336 41482 1437 1299 497 ----
NM_016603chr511844 11895 12131 --
NM_016605chr542661 579 528 358 1674 12744 --
NM_016607chrX41673 1631 153 98 ------
NM_016612chr81473 ------
NM_016613chr462405 2379 2320 2106 1948 296 --1704 --
NM_016620chr131273 1179 219 ------
NM_016623chr8167 ----1511
NM_016626chr1821422 446 --11749 --
NM_016631chr211881 2928 105 ----
NM_016644chr51453 ------
NM_016647chr811450 ------
NM_016651chr1441135 760 390 245 1225 1318 --
NM_016653chr221194 120 ------
NM_016654chr1521249 215 ----1347
NM_016819chr31511 ------
NM_016820chr3126 ------
NM_016824chr101142 21593 603 --31178 521 222
NM_016836chr22583 105 ------
NM_016839chr22583 105 ------
NM_016936chr163865 858 670 --11663 --
NM_016937chrX31025 884 627 ------
NM_016950chr43273 250 191 1407 ----
NM_016952chr11103984 3926 3694 3446 3375 3091 3025 1159 607 413 1937 1466 --
NM_017412chr8----21168 458 --
NM_017420chr1463798 3665 3600 2410 319 104 --31448 803 524 --
NM_017423chr42829 284 1247 11634 --
NM_017426chr41450 ------
NM_017437chr1442014 1773 626 451 ----1720
NM_017440chr12187 ------
NM_017447chr2173589 3102 2836 2722 1685 1188 173 23137 626 ----
NM_017456chr1721893 1852 ------
NM_017459chr11411 ------
NM_017488chr21495 11538 ----
NM_017514chrX1908 ------
NM_017519chr61443 --1856 --
NM_017545chr201561 ------
NM_017548chr321452 1366 ----22094 1639
NM_017590chr2212210 12632 ----
NM_017599chr1232066 1748 234 --22014 1676 1462
NM_017610chr1542076 1553 759 342 ----11295
NM_017623chr261699 1008 974 945 113 75 ------
NM_017626chr1041684 1327 1256 596 ------
NM_017628chr485073 4429 1157 1040 390 192 114 84 --11909 25032 1263
NM_017629chr121498 105 --51902 559 550 540 350 --
NM_017631chr4147 ------
NM_017632chr41113 1436 ----
NM_017633chr633026 2452 1279 1138 12822 --
NM_017634chr821973 276 ------
NM_017635chr112488 326 11549 --11151
NM_017637chr9119242 7556 3557 3450 3395 3312 2514 710 367 346 221 38331 3639 1536 12735 12458
NM_017640chr64742 357 229 22 ------
NM_017641chr1211116 ----1189
NM_017643chr1732382 2207 1972 22242 1167 ----
NM_017644chr385046 4327 4074 3691 1379 1270 756 609 34445 3602 53 --1463
NM_017645chr952658 2541 2410 2164 358 33168 2279 2176 --12287
NM_017649chr10------1390
NM_017650chr775978 4306 4040 2210 1809 1684 955 11902 14337 --
NM_017658chr14114542 3757 3573 1444 1012 883 773 579 165 135 71 23265 481 1286 11465
NM_017661chr1521284 207 21247 836 ----
NM_017666chrX32193 1902 1656 --1358 11993
NM_017670chr111134 ------
NM_017672chr151374 --11113 --
NM_017684chr1551415 1259 164 148 49 --2429 111 --
NM_017693chr1331653 1343 457 --1389 --
NM_017694chr211296 1710 ----
NM_017700chr4199 ------
NM_017703chr19135 ------
NM_017709chr154046 3909 3151 963 899 1975 ----
NM_017714chr20297 83 ------
NM_017719chr332075 161 81 31620 757 586 12289 --
NM_017724chr31102 ------
NM_017736chr1672153 635 452 355 335 162 92 1691 13016 12287
NM_017737chr13636 531 317 1364 --11785
NM_017744chr131951 784 728 12250 ----
NM_017745chrX2584 191 ------
NM_017753chr91754 --1325 --
NM_017754chr61250 34703 3264 986 --14627
NM_017769chr1453273 3108 2968 2826 325 23094 2123 ----
NM_017770chr632289 1026 86 154 1561 --
NM_017772chr631730 1717 1422 1137 ----
NM_017778chr8------11139
NM_017786chr83711 639 485 ----2547 466
NM_017799chr146687 564 556 261 246 64 --1503 1372
NM_017801chr362619 2581 1697 1613 947 402 11625 1141 --
NM_017811chr962703 2553 2107 1252 947 359 --13004 --
NM_017813chr8115716 5436 5148 4562 4412 3820 1889 1655 968 835 786 --14175 14191
NM_017824chr1072693 2208 2056 1864 1777 781 335 12505 ----
NM_017826chr132809 751 --1785 --
NM_017831chr1854250 3324 3064 858 186 11875 ----
NM_017845chr41586 195 1296 --
NM_017851chr1561257 1150 1044 953 854 218 ------
NM_017880chr21465 ------
NM_017896chr2063547 2988 2443 2397 689 421 ------
NM_017902chr1064350 4205 4067 3948 3501 535 11302 --14887
NM_017915chr121825 --11160 --
NM_017925chr921698 70 --11320 21874 1407
NM_017933chr221503 304 ------
NM_017938chrX--1719 1109 --
NM_017944chr1163119 2966 2096 1183 977 35 21084 43 --11030
NM_017948chr91477 --173 --
NM_017958chr242857 2690 2123 90 ----1105
NM_017988chr121180 ------
NM_017994chr762771 1968 1196 780 747 555 12227 ----
NM_018000chr232078 297 145 --11926 1416
NM_018003chr1572398 1942 1871 916 165 73 31 --1971 --
NM_018004chr32299 21 ------
NM_018008chr3------1278
NM_018015chrX21151 1088 --1133 --
NM_018017chr1062565 2341 1896 1848 672 616 12687 2809 484 32758 1882 526
NM_018026chr1121276 994 ------
NM_018027chr1012599 --23034 925 --
NM_018030chr182942 398 11066 1181 147
NM_018036chr1434170 1019 712 13198 13544 1818
NM_018046chr53703 562 32 ------
NM_018048chr1251788 1538 671 482 278 --12005 --
NM_018060chr11333 ------
NM_018061chr141622 1273 1176 708 1283 ----
NM_018078chr431046 709 308 --2930 238 --
NM_018084chr23892 374 242 22709 316 11153 12885
NM_018086chr211414 ------
NM_018092chr163450 434 316 ------
NM_018098chr31920 11102 1864 --
NM_018112chr92979 676 2828 695 1251 1665
NM_018117chr103684 623 556 1592 ----
NM_018120chr84382 144 106 49 ----11447
NM_018126chr451563 1024 499 252 181 --31532 1361 1260 --
NM_018133chr342221 1814 1778 1715 --2727 51 --
NM_018137chr131188 1024 339 --11209 --
NM_018147chr31258 2213 104 ----
NM_018155chr373251 2425 1074 971 909 307 131 22866 2625 12252 --
NM_018157chr1213153 ------
NM_018159chrX11259 11503 --1573
NM_018169chr121447 --1480 --
NM_018177chr42348 96 ----1263
NM_018178chr121275 69 --11318 --
NM_018182chr174664 514 196 59 ----11490
NM_018184chr32871 329 1238 --11475
NM_018200chr1582537 1978 1899 1653 821 559 402 253 ------
NM_018202chr14680 363 330 180 ------
NM_018206chr163204 135 52 1667 ----
NM_018214chr621196 281 --21022 396 --
NM_018221chr22446 352 ------
NM_018227chr431040 903 255 --13224 1403
NM_018228chr141268 ------
NM_018237chr101238 ----1262
NM_018247chr633078 1975 134 22591 2513 11966 --
NM_018254chr141879 1839 291 186 ----11594
NM_018257chr2032156 1632 536 12224 --1866
NM_018270chr202767 682 ------
NM_018283chr1311139 11316 1822 --
NM_018286chr17------2928 380
NM_018293chr352143 1880 1832 217 113 12172 ----
NM_018299chr862892 2203 1234 1048 382 71 11145 13358 --
NM_018302chr432244 1837 570 --12103 2850 714
NM_018312chr1131935 1794 568 --2709 327 --
NM_018313chr332092 592 331 1934 32621 2263 281 --
NM_018315chr431452 1289 1217 --21249 1209 --
NM_018317chr4135 ------
NM_018318chr121908 ------
NM_018323chr451676 1609 1363 156 114 11900 ----
NM_018325chr911424 ------
NM_018327chr2021496 293 --1666 --
NM_018330chr1011338 --161 --
NM_018351chr1284136 3920 3479 3343 3334 1776 1007 373 ----13030
NM_018362chr1183799 1482 655 589 447 353 50 36 33072 2680 1245 23190 2883 --
NM_018364chr164096 3871 3431 3175 2816 864 33958 3604 239 33186 85 62 43983 2949 2694 981
NM_018368chr6124 ------
NM_018369chr52518 142 --1670 1192
NM_018374chr7114828 3826 3426 1618 1556 1239 1186 1171 1015 679 445 24550 1608 13971 14488
NM_018375chr1411489 1256 --1302
NM_018376chr91269 1716 ----
NM_018403chr373514 2703 1646 1501 1491 488 446 14067 14142 1936
NM_018416chr124849 794 564 369 1534 22667 2243 --
NM_018429chr572834 2693 2653 2369 2269 2012 98 --22415 1069 --
NM_018440chr888431 7338 6882 3144 2758 2463 1082 526 37897 7434 1871 28728 728 15421
NM_018442chr11113 1397 ----
NM_018448chr122870 227 ------
NM_018482chr852546 2379 2115 1034 653 ------
NM_018486chrX1493 ------
NM_018489chr11695 ------
NM_018490chr1121548 286 ----21678 1249
NM_018502chr5----1294 --
NM_018534chr21587 ------
NM_018557chr251470 1335 1184 150 140 ------
NM_018566chr184640 3348 1797 1478 1383 925 846 517 44967 4148 1582 825 --11184
NM_018590chr1011108 11142 --11439
NM_018593chr61705 ------
NM_018602chr1521187 636 1201 ----
NM_018638chr1254342 4196 4011 1023 379 14306 25409 389 25015 785
NM_018640chr1211871 22523 1751 1335 --
NM_018649chr102455 233 ------
NM_018650chr131595 640 56 21580 488 ----
NM_018657chr32804 759 --1247 --
NM_018667chr1612778 ----12564
NM_018682chr73751 613 466 ------
NM_018695chr542387 2137 885 762 ----21791 961
NM_018703chr161402 ------
NM_018704chr11843 2527 382 ----
NM_018834chr53207 200 117 ------
NM_018844chr752040 1827 617 525 369 ----1325
NM_018846chr73932 695 83 ------
NM_018847chr951731 1290 411 310 122 1194 ----
NM_018890chr751208 1154 1109 605 584 ------
NM_018898chr532036 372 36 2716 342 ----
NM_018899chr532036 372 36 2716 342 ----
NM_018900chr532036 372 36 2716 342 ----
NM_018901chr532036 372 36 2716 342 ----
NM_018902chr532036 372 36 2716 342 ----
NM_018903chr532036 372 36 2716 342 ----
NM_018904chr532036 372 36 2716 342 ----
NM_018905chr532036 372 36 2716 342 ----
NM_018906chr532036 372 36 2716 342 ----
NM_018907chr532036 372 36 2716 342 ----
NM_018908chr532036 372 36 2716 342 ----
NM_018909chr532036 372 36 2716 342 ----
NM_018910chr532036 372 36 2716 342 ----
NM_018911chr532036 372 36 2716 342 ----
NM_018912chr52667 568 --11738 --
NM_018913chr52667 568 --11738 --
NM_018914chr52667 568 --11738 --
NM_018915chr52667 568 --11738 --
NM_018916chr52667 568 --11738 --
NM_018917chr52667 568 --11738 --
NM_018918chr52667 568 --11738 --
NM_018919chr52667 568 --11738 --
NM_018920chr52667 568 --11738 --
NM_018921chr52667 568 --11738 --
NM_018922chr52667 568 --11738 --
NM_018923chr52667 568 --11738 --
NM_018924chr52667 568 --11738 --
NM_018925chr52667 568 --11738 --
NM_018926chr52667 568 --11738 --
NM_018927chr52667 568 --11738 --
NM_018928chr52667 568 --11738 --
NM_018929chr52667 568 --11738 --
NM_018945chr653656 3469 2731 2263 1095 32516 1237 440 --1894
NM_018947chr773815 1946 1138 486 390 323 182 11384 33724 3700 1417 --
NM_018951chr73930 799 302 11148 ----
NM_018968chr2189 ------
NM_018970chr742414 1958 706 137 12615 11155 21209 111
NM_018979chr121667 --1297 1719
NM_018983chr43297 257 197 ----198
NM_018994chr11447 ------
NM_018999chr1084612 4437 4157 3568 3378 1557 1406 64 14707 21930 1286 13276
NM_019000chr541420 1141 345 125 --1672 --
NM_019001chr3104234 4133 3739 3485 3328 3118 1838 1195 598 551 34715 3199 523 23964 1340 12954
NM_019004chr741993 1958 1793 404 ----1554
NM_019005chr72265 142 ------
NM_019018chr51642 --2694 576 --
NM_019024chr2195 ------
NM_019027chr431821 165 155 21766 991 12487 --
NM_019042chr73932 135 73 ------
NM_019045chrX2793 734 ------
NM_019049chr11743 ------
NM_019050chr471974 1833 1804 1755 1574 893 690 11666 32122 1545 304 --
NM_019063chr22681 526 --2179 142 11412
NM_019072chr522675 388 --31355 1292 1069 --
NM_019084chr1052621 2376 2060 1781 406 ------
NM_019087chr541508 1156 1143 463 --11209 --
NM_019114chr93962 477 195 ------
NM_019116chr1673752 3360 2425 1226 1013 783 575 23385 583 1705 --
NM_019117chrX31253 875 382 12376 --33338 1324 1087
NM_019555chr321325 320 11531 ----
NM_019556chrX31270 950 488 140 --11050
NM_019592chr92649 625 ------
NM_019594chr911479 11495 1651 --
NM_019597chrX1202 ------
NM_019600chr153724 540 126 ------
NM_019604chr11--11052 ----
NM_019605chr12250 85 1130 2587 518 --
NM_019610chr141825 1559 1533 1375 11702 11572 --
NM_019860chr1011643 ------
NM_019862chr1661702 1183 594 508 425 320 ------
NM_019891chr121323 1303 ------
NM_019898chr1661702 1183 594 508 425 320 ------
NM_019899chr1661702 1183 594 508 425 320 ------
NM_019900chr1661702 1183 594 508 425 320 ------
NM_019903chr101142 21593 603 --31178 521 222
NM_020120chr23301 64 45 --11517 11276
NM_020122chr294410 4279 2062 1780 1766 1288 1221 828 780 --1401 --
NM_020123chr1011581 ------
NM_020132chr2154521 4473 3988 1493 177 15049 13807 --
NM_020141chr142215 2011 1467 622 12038 --1846
NM_020144chr742066 1963 1558 845 ----1381
NM_020148chr1853083 2420 1095 693 90 12284 32359 2186 734 --
NM_020150chr1042172 1901 782 415 --130 --
NM_020156chr71506 ------
NM_020168chr1511309 11370 ----
NM_020177chr52447 363 ----12331
NM_020189chr8131 ------
NM_020193chr1191285 1202 1191 1130 1069 414 299 293 257 ------
NM_020194chr22605 267 ------
NM_020198chr1721460 161 1277 21504 106 --
NM_020204chr13269 248 24 1861 ----
NM_020205chr153478 3292 2581 743 272 --1359 --
NM_020216chr11413 ------
NM_020225chr41106 ------
NM_020226chr41266 ------
NM_020228chr113465 277 125 21873 998 22534 1733 11880
NM_020239chr142205 1827 1602 807 ------
NM_020245chr694867 4152 3402 3162 1778 1673 899 184 52 14909 11503 --
NM_020246chr71362 ------
NM_020337chr412047 23115 3048 12955 --
NM_020341chr2041701 1629 668 465 1171 ----
NM_020342chr22818 184 22517 411 22050 1711 22177 1990
NM_020347chr322338 1749 --1230 11984
NM_020353chr341462 1327 563 458 ----11923
NM_020369chr71143 ------
NM_020379chr11373 ------
NM_020381chr651852 595 556 497 199 11769 ----
NM_020390chr384820 3833 3579 1861 728 607 311 143 21137 336 11824 --
NM_020394chr141207 1172 388 38 21366 1350 11255 --
NM_020420chrY51597 1508 1201 418 150 --31175 623 232 --
NM_020432chr751984 1774 1647 190 134 --12314 --
NM_020438chr911111 11409 ----
NM_020443chr166638 6560 6351 5926 1264 277 25018 4971 25602 400 --
NM_020445chr73735 706 538 ------
NM_020449chrX2782 492 1649 1301 --
NM_020455chr611129 12671 --1133
NM_020457chr161648 ------
NM_020463chr241457 1403 595 34 1431 11100 --
NM_020466chr654279 3919 3738 3275 1629 13991 2656 88 --
NM_020474chr1831889 751 251 11942 11328 1734
NM_020475chr812337 ------
NM_020476chr812337 ------
NM_020477chr812337 ------
NM_020478chr812400 ------
NM_020480chr812337 ------
NM_020546chr532816 2788 585 --32729 2155 651 --
NM_020548chr21187 ------
NM_020640chr321443 653 11881 21681 289 --
NM_020651chr241695 222 206 85 11567 11428 --
NM_020653chr17129 ------
NM_020654chr311643 11201 1109 --
NM_020673chr20137694 7364 7080 6341 2346 2328 2232 2173 2062 1238 1010 300 84 15863 45769 5419 3028 991 47514 7179 5375 101
NM_020697chr82231 155 --1516 --
NM_020699chr13570 339 242 --14149 --
NM_020715chr1441855 855 662 644 --21716 1441 --
NM_020718chr16116539 6477 6229 5730 5334 4113 1902 1665 1321 535 24 36257 1412 748 --25802 4303
NM_020724chr451976 953 853 806 798 2877 527 1160 12138
NM_020727chr2153847 3802 3770 3656 3471 22645 2492 11251 23435 263
NM_020728chr731968 753 664 --1129 12412
NM_020732chr61443 --1856 --
NM_020734chr1242892 2381 1198 754 ------
NM_020738chr21201 21549 1270 --11599
NM_020742chrX22668 1694 ----11837
NM_020747chr54970 873 796 184 --1831 --
NM_020748chr1731808 1524 105 1785 1777 --
NM_020754chr31487 ------
NM_020755chr641667 1369 481 337 1637 1208 --
NM_020760chr221748 1434 --11474 --
NM_020766chrX21751 1320 31583 1449 68 21612 922 --
NM_020770chr111307 ------
NM_020771chr651516 1411 1360 1175 338 ------
NM_020772chr17118416 7865 7109 5671 2214 1584 1502 1270 597 510 285 68568 7684 7558 6803 5512 2224 38239 7425 5303 --
NM_020773chr432694 2551 460 12612 1353 --
NM_020774chr1875952 4921 4814 1484 1441 1104 380 46266 4847 3792 199 35958 5372 5224 --
NM_020782chr12114868 4730 4459 4297 4003 3961 3922 3866 3490 3284 42 1760 --23000 818
NM_020783chr1832152 1996 944 ------
NM_020794chr121539 237 ----1203
NM_020796chr562768 2740 2605 2329 2218 2175 ------
NM_020800chr331481 1138 268 ------
NM_020801chr522099 247 32588 1942 1819 12316 --
NM_020802chr1123179 1064 13050 --11001
NM_020805chr18--1241 ----
NM_020806chr14183 ------
NM_020809chr1131451 649 254 ------
NM_020810chr1443517 3086 2956 754 --12933 1572
NM_020819chr621075 1017 1444 ----
NM_020821chr1551415 1259 164 148 49 --2429 111 --
NM_020824chr102547 539 --1515 --
NM_020830chr222831 1063 --22226 295 12551
NM_020841chr12103845 3670 3550 3506 2673 1316 794 628 318 77 --1434 13093
NM_020844chr886849 6145 5436 2722 2391 1662 1624 524 26758 2908 27360 564 17305
NM_020854chr1831480 1265 293 --197 11105
NM_020861chr651365 877 501 363 259 ------
NM_020868chr251966 1924 1828 1767 250 11510 ----
NM_020872chr341289 1268 1182 677 ------
NM_020873chr31811 ------
NM_020890chr3----1193 --
NM_020918chr1053658 2777 2600 907 819 33665 3485 3233 1480 --
NM_020921chr1483350 2793 994 724 459 299 288 138 12843 ----
NM_020925chr121042 977 21353 1217 ----
NM_020926chrX130 ------
NM_020935chr2114643 4569 4060 3906 3841 3566 3027 2986 1831 1797 246 13575 ----
NM_020940chr1042442 2383 2185 987 1996 --11032
NM_020948chr123627 3558 1706 22377 1433 1123
NM_020951chr1942103 921 309 226 1476 1435 12133
NM_020952chr9167 ------
NM_020975chr101164 1147 31672 1272 230 --
NM_020977chr421691 317 --1704 --
NM_020987chr102484 32 11274 ----
NM_021005chr1541128 475 367 276 11046 ----
NM_021007chr241921 1898 1532 750 1368 ----
NM_021012chr1733144 132 123 ------
NM_021025chr52506 347 ------
NM_021033chr1353237 2630 1380 774 190 --23172 1358 --
NM_021038chr353325 3308 3246 2534 1353 13087 ----
NM_021069chr462114 1589 845 656 642 493 ------
NM_021072chr542522 2248 1688 907 --1792 22487 821
NM_021090chr2264493 4436 4405 4387 3574 740 1247 ----
NM_021100chr201370 1218 --1878
NM_021102chr191372 ------
NM_021104chr121291 ------
NM_021106chr91493 ------
NM_021110chr82753 604 2617 234 ----
NM_021136chr141527 ------
NM_021137chr1722255 1929 12003 --11606
NM_021140chrX3893 846 424 11014 --1864
NM_021144chr91557 ------
NM_021145chr72413 399 11185 1190 1227
NM_021151chr721077 962 --1305 --
NM_021163chr793556 3083 2739 1213 760 684 587 451 343 1523 1238 --
NM_021188chr142430 348 ------
NM_021190chr141318 1012 538 429 ----21092 1062
NM_021192chr2------1370
NM_021194chr1------1234
NM_021203chr33594 342 46 ------
NM_021204chr41345 --1802 --
NM_021215chr2032317 2091 1950 ------
NM_021227chr4------158
NM_021229chr1231066 980 134 1383 1177 --
NM_021238chr12101954 1791 1542 1290 741 597 590 498 359 102 1293 32115 1679 252 --
NM_021239chr1441154 1131 554 236 --11015 11278
NM_021252chr1042010 1458 203 111 11659 --22002 655
NM_021255chr1484028 3844 3788 3359 2635 2561 1054 300 ----11620
NM_021619chr911145 ------
NM_021620chr62808 718 ------
NM_021622chr102763 653 ----21539 1512
NM_021627chr33991 958 801 ------
NM_021637chrX11365 21256 849 ----
NM_021638chr454911 4489 4445 714 512 1779 24545 1669 --
NM_021644chr102825 729 --1954 2374 29
NM_021647chr443342 3125 1868 1571 ----22876 441
NM_021705chr631300 196 129 ------
NM_021728chr141375 --2224 64 --
NM_021738chr101116 ------
NM_021785chrX157 ------
NM_021813chr6135788 5441 5373 5046 4146 2064 1591 1563 1271 869 695 266 127 --1410 --
NM_021815chr252572 819 359 293 234 ------
NM_021818chr1431427 1228 26 ------
NM_021825chr112291 143 ------
NM_021830chr10----2872 309 --
NM_021911chr564498 4122 3632 3512 3404 979 13783 14955 --
NM_021912chr1554116 430 406 313 70 13478 ----
NM_021914chr141556 --1695 --
NM_021935chr31806 --155 --
NM_021940chr61279 ------
NM_021942chr42713 179 ------
NM_021943chr621705 881 --12146 12153
NM_021946chrX----11449 --
NM_021949chrX42771 2670 2401 1769 --1672 --
NM_021951chr91267 ----1351
NM_021956chr631182 1123 440 ------
NM_021957chr121507 ------
NM_021960chr152605 2242 1808 1035 758 ----11063
NM_021961chr1176144 4620 2862 2764 2537 2453 1659 37158 2581 435 21085 889 --
NM_021963chrX1248 --1159 --
NM_021964chr3156563 5358 5266 4209 4189 2516 2379 2217 1915 1881 1863 1659 1461 375 231 45627 2199 1362 874 35975 4713 803 --
NM_021988chr2031068 94 57 ----21113 535
NM_021998chrX1503 --11217 --
NM_021999chr132302 90 ------
NM_022037chr231033 900 691 2991 170 ----
NM_022041chr1652380 2200 1054 1023 131 22715 2602 22028 989 --
NM_022045chr8--1250 ----
NM_022048chr15106185 4809 4735 4707 4524 1918 1835 1710 825 760 ----25792 4756
NM_022049chr14613 509 386 243 21186 301 ----
NM_022051chr11721 ------
NM_022062chr11--11617 ----
NM_022063chr102562 152 1587 21689 1635 --
NM_022066chr171991 ------
NM_022073chr1451519 1358 1241 1073 139 11263 ----
NM_022079chr10--11018 2869 258 --
NM_022116chr76847 716 685 245 171 41 ------
NM_022118chr13--1539 ----
NM_022130chr52116 51 11150 1208 --
NM_022136chr21--1126 1499 --
NM_022137chr1432081 1739 251 ------
NM_022143chr7--11022 ----
NM_022145chr51497 2427 201 ----
NM_022164chr1--1685 ----
NM_022166chr1665848 5782 4891 4762 3865 1600 ----15949
NM_022173chr231033 900 691 2991 170 ----
NM_022351chr853568 3244 3159 1170 769 13832 22768 755 --
NM_022373chr74744 298 237 184 ----1723
NM_022442chr2031068 94 57 ----21113 535
NM_022443chr3129 140 ----
NM_022459chr1396030 5689 4697 2481 2433 934 632 552 511 22493 953 65724 5135 4612 4063 2223 75 --
NM_022465chr1253052 2937 2424 473 87 ------
NM_022469chr152862 2694 2562 942 811 ------
NM_022473chr1563944 3653 3376 3363 1038 503 1197 --23024 454
NM_022474chr1462442 1927 1875 929 893 634 --12512 --
NM_022475chr41629 ------
NM_022476chr161203 --1839 --
NM_022482chr2042438 1817 1673 374 31750 724 322 ----
NM_022491chr1273464 3174 2976 774 234 187 47 ------
NM_022496chr123498 351 334 ------
NM_022553chr6196 ------
NM_022566chr151588 ------
NM_022575chr20--1139 ----
NM_022650chr51346 --1959 --
NM_022716chr152657 2518 2363 1132 501 ----1333
NM_022726chr641377 367 188 175 --1639 --
NM_022733chr1----1879 --
NM_022735chr121358 361 11830 ----
NM_022753chr122469 243 42626 2199 1877 752 --1932
NM_022763chr342996 1262 934 112 33212 596 385 ----
NM_022771chr12--11058 ----
NM_022780chr241478 1190 662 208 1759 1406 --
NM_022781chr932446 2347 170 11172 --23158 539
NM_022782chr121379 --1112 --
NM_022783chr82712 115 --1147 --
NM_022802chr1041161 1096 244 93 ------
NM_022817chr242106 233 147 125 --1519 --
NM_022824chr541460 755 239 135 21650 90 ----
NM_022826chr221191 361 1282 ----
NM_022832chr482590 1769 1657 1608 696 369 334 181 ----11875
NM_022841chr1542122 955 814 434 2219 61 12582 --
NM_022845chr1641812 1559 821 227 12026 --1783
NM_022893chr253095 2751 2224 2036 548 1716 21008 518 --
NM_022898chr1464293 4017 3685 3063 1571 567 ------
NM_022909chr5----1528 --
NM_022912chr231040 431 302 12328 --13089
NM_022965chr411306 --11363 --
NM_022970chr1011205 ------
NM_022977chrX21651 178 --12423 --
NM_023000chr1451384 1341 1187 690 604 11739 ----
NM_023001chr1451384 1341 1187 690 604 11739 ----
NM_023016chr242802 1103 790 361 142 --1638
NM_023039chr5163 1121 ----
NM_023071chr1211130 11004 ----
NM_023105chr832346 1675 831 ------
NM_023106chr832346 1675 831 ------
NM_023110chr832346 1675 831 ------
NM_023111chr832346 1675 831 ------
NM_023923chr183769 2899 2593 2583 1527 684 296 246 23148 982 1168 --
NM_023929chr832279 972 433 --22615 575 --
NM_024007chr521936 1192 2649 372 12831 --
NM_024028chr51238 1972 1354 --
NM_024052chr176983 954 785 561 231 198 ------
NM_024076chr1912056 ----12081
NM_024082chrX----1139 --
NM_024090chr4--21386 578 11941 --
NM_024102chr131035 338 245 1893 ----
NM_024293chr2--1201 ----
NM_024295chr841961 1289 296 117 ------
NM_024312chr1231107 404 375 1599 1570 --
NM_024334chr341864 1278 746 693 11381 ----
NM_024345chr9106081 5807 5675 5500 5140 4236 4212 4085 2051 396 36035 4632 4077 1587 --
NM_024415chr5267 53 ------
NM_024422chr1871969 1648 1572 752 690 683 573 --21547 566 1646
NM_024429chr71269 1758 ----
NM_024511chr422632 1243 1777 12640 --
NM_024519chr16----1292 --
NM_024524chr3102689 2486 2215 2035 1073 992 932 648 619 339 --12626 --
NM_024525chr12652 467 ------
NM_024539chrX11104 ------
NM_024548chr32169 135 ----1645
NM_024556chr112450 381 ------
NM_024561chr132334 208 ----2928 377
NM_024569chr152872 882 648 637 324 12795 1491 --
NM_024582chr421017 881 ------
NM_024594chr541790 1658 1306 376 ----11597
NM_024613chr821389 718 31679 1427 290 ----
NM_024624chr251548 1444 597 388 244 1229 --11185
NM_024638chr322350 2163 --11003 --
NM_024639chr642608 1959 888 738 1535 ----
NM_024646chr133576 3543 171 1620 23917 284 12719
NM_024659chr2--2810 642 ----
NM_024665chr3104500 4025 3934 3189 2860 1833 987 324 259 182 13164 23565 1827 --
NM_024675chr161204 ----167
NM_024700chr161008 790 290 270 129 50 ------
NM_024713chr1541583 1513 1133 420 41210 1185 1006 597 ----
NM_024715chr541886 1510 424 406 2561 172 ----
NM_024721chr852512 2485 2170 1821 799 22425 1771 1606 --
NM_024740chr1143737 3546 3122 103 23531 3146 22953 720 --
NM_024744chr242075 675 185 50 ------
NM_024749chr13901 613 561 --1269 --
NM_024755chr151194 126 ----
NM_024806chr111271 ------
NM_024811chr11----11850 --
NM_024814chr73346 306 126 1146 ----
NM_024824chr1431661 593 44 1186 1126 --
NM_024828chr951209 1173 430 200 84 ------
NM_024835chr171340 ------
NM_024847chr1641274 1081 977 934 ------
NM_024913chr731783 690 371 21618 1402 ----
NM_024917chrX1881 1848 ----
NM_024920chr431421 1289 1245 --1294 --
NM_024947chr3169157 8854 8702 8216 8043 7408 6666 6415 6217 5925 3323 2528 2029 683 639 407 78522 6468 3781 3573 3159 2397 1858 56237 3646 3510 2745 35 19210
NM_024949chr444359 4064 3555 1460 21423 971 23683 1937 13636
NM_024953chr1241953 622 611 402 1948 11012 --
NM_024969chr21702 ------
NM_024971chr9167 ------
NM_024989chr2117348 7119 6192 3023 2843 2710 2648 517 442 289 145 11612 31590 1432 1327 12723
NM_024991chr1062963 2821 2253 2211 2109 852 ------
NM_024993chr211283 ----21326 487
NM_025047chr3----1327 --
NM_025054chr843971 3275 3108 1575 --23931 3342 1294
NM_025073chr164692 4587 3499 1022 809 86 13927 34684 4295 3888 12996
NM_025076chr22524 258 ------
NM_025113chr1331250 1181 83 ------
NM_025133chr23895 804 205 2833 746 ----
NM_025134chr1642403 2131 1724 976 22507 538 22417 362 1796
NM_025138chr1331229 1189 1179 --11078 --
NM_025146chr332645 2412 253 12467 --1154
NM_025152chr1441926 725 441 109 11426 --11343
NM_025154chr731146 1105 350 ----11559
NM_025160chr173543 2977 1308 1287 1234 891 618 --22635 1551 --
NM_025181chr22767 69 ------
NM_025191chr163225 2882 2752 2394 1002 534 ----43572 2820 2710 1324
NM_025211chr92240 99 ------
NM_025221chr4--1133 2564 274 --
NM_025235chr1062218 2146 1798 1514 466 69 ------
NM_025248chr1723219 1123 ------
NM_025263chr641816 1527 1430 695 1414 ----
NM_025268chr141396 ------
NM_030579chr1643272 3028 1339 812 --1391 12560
NM_030594chr1541361 896 257 182 ------
NM_030621chr1453559 2851 724 691 623 23626 2725 31505 642 200 13730
NM_030625chr1021993 1819 11850 22056 220 1229
NM_030627chr563896 3788 3719 3681 2629 433 --1231 --
NM_030629chr1651637 1525 1479 602 126 ----11614
NM_030636chr742096 1553 903 490 12124 12155 --
NM_030637chr142164 105 1595 ----
NM_030647chr7106116 6097 5900 5790 5727 5691 4420 2496 1406 984 34798 4785 294 34268 4234 2364 1550
NM_030648chr465477 4619 3968 3763 1865 1323 23727 3700 ----
NM_030650chr263981 3728 2641 1509 1440 874 21039 383 21552 42 --
NM_030652chr61282 ------
NM_030660chr1451501 1331 1230 374 231 --1977 --
NM_030661chr721277 334 ----1571
NM_030664chr1032169 2154 1552 ------
NM_030674chr1285878 5703 1204 1072 1056 1032 927 905 --11167 --
NM_030751chr1061893 1640 1382 610 362 243 --31703 1603 1356 --
NM_030751chr1061893 1640 1382 610 362 243 --31703 1603 1356 --
NM_030755chr1462439 737 608 564 480 292 32615 1101 1032 --12169
NM_030756chr101256 ----1320
NM_030759chr101806 ------
NM_030762chr1231347 509 102 11615 --11861
NM_030791chr1451821 1392 638 253 176 ------
NM_030806chr186730 6221 5877 5854 3247 2165 1915 316 22455 808 --26531 3668
NM_030808chr172926 362 ------
NM_030809chr1272196 1776 1699 1687 1557 1014 120 --1213 --
NM_030811chr201370 ------
NM_030816chr132741 1341 176 1402 --1954
NM_030877chr201101 ------
NM_030881chr2252155 1592 890 697 606 ------
NM_030885chr32912 602 11529 12031 --
NM_030918chr165235 4724 1850 551 263 171 1241 ----
NM_030920chr142003 1986 1496 131 11618 ----
NM_030922chr151739 ----1288
NM_030937chr121157 973 ------
NM_030938chr1721085 1062 --1440 --
NM_030939chr63830 339 49 ------
NM_030940chr91231 --11371 --
NM_030949chr61355 1188 1473 --
NM_030958chr82394 27 ------
NM_030965chr11538 ------
NM_030979chr13--1390 ----
NM_031157chr121131 1251 ----
NM_031216chr1831921 1456 702 11429 --12122
NM_031217chr111219 ------
NM_031243chr771952 1911 1809 1681 1605 388 293 12157 --1829
NM_031262chr93942 412 141 --1829 --
NM_031263chr94999 469 198 52 --1886 --
NM_031292chr1221725 1194 167 ----
NM_031296chr452017 604 584 567 452 22354 2221 --22607 2319
NM_031305chr441545 1325 640 233 --2569 291 --
NM_031314chr1461857 1558 1421 1409 730 205 --1216 1559
NM_031369chr45715 633 324 245 206 1573 1279 --
NM_031370chr45715 633 324 245 206 1573 1279 --
NM_031372chr431177 163 74 ------
NM_031411chr532036 372 36 2716 342 ----
NM_031418chr1162434 2416 1931 987 838 391 --12401 --
NM_031419chr331544 1391 1279 21632 1027 11304 --
NM_031427chr1445889 2162 1856 786 25026 1990 15127 --
NM_031431chr1321514 1167 --161 11771
NM_031435chr1273324 3276 2770 2345 2251 520 491 23254 2689 199 --
NM_031438chr51219 1151 21678 266 --
NM_031439chr831640 364 241 ------
NM_031443chr71327 ------
NM_031445chr222974 1193 1457 ----
NM_031452chr15----184 --
NM_031453chr1062378 2301 2147 771 755 499 ------
NM_031461chr831911 500 209 --11970 --
NM_031469chr643598 2688 2612 567 --13748 11319
NM_031476chr1622590 1065 1521 12720 1912
NM_031483chr2042609 1206 588 255 1721 1995 --
NM_031492chr111531 ------
NM_031844chr133319 3277 2649 32944 2823 1191 --13699
NM_031845chr263357 3211 2300 1453 1011 475 ----12259
NM_031847chr263357 3211 2300 1453 1011 475 ----12259
NM_031849chr532036 372 36 2716 342 ----
NM_031857chr532036 372 36 2716 342 ----
NM_031858chr1721083 226 21499 1432 11513 --
NM_031860chr532036 372 36 2716 342 ----
NM_031862chr1721083 226 21499 1432 11513 --
NM_031866chr101934 ------
NM_031953chr4--1309 1128 --
NM_031966chr51566 1178 ----
NM_031989chr12--196 ----
NM_032021chr11--21207 74 ----
NM_032050chr221171 1695 1891 --
NM_032052chr221556 11080 11276 --
NM_032088chr52667 568 --11738 --
NM_032092chr52667 568 --11738 --
NM_032102chr1153132 3105 1181 1061 538 ------
NM_032109chr511019 11410 ----
NM_032116chr1365465 4540 4199 4028 1320 341 --45170 2273 1823 1796 --
NM_032125chr11927 ------
NM_032131chr63488 123 107 ------
NM_032132chr11130 ------
NM_032144chr221816 1156 1720 11213 --
NM_032145chr621698 1646 21233 569 ----
NM_032147chr121401 1256 --2879 201
NM_032153chr322320 940 12243 ----
NM_032154chr102434 314 ----1917
NM_032160chr1874231 3302 1285 673 645 452 307 1150 14327 --
NM_032165chr121247 1286 ----
NM_032182chr1011088 ------
NM_032186chr131273 1179 219 ------
NM_032199chr1041435 1420 1280 680 32716 2706 2632 13381 1209
NM_032217chr42298 198 --1368 --
NM_032221chr2031809 1437 355 --11639 --
NM_032226chr91105 1300 ----
NM_032228chr1132822 768 477 33401 2628 1305 --12371
NM_032229chr1311113 147 11104 --
NM_032236chr111109 ------
NM_032246chr152362 311 --21276 1077 --
NM_032250chr92867 670 2790 328 ----
NM_032281chr1922242 261 22503 2423 --12117
NM_032291chr131675 1372 516 1218 21561 284 1795
NM_032293chr92247 33 ------
NM_032312chr21581 ------
NM_032321chr222462 870 11142 43222 3021 467 198 1803
NM_032352chr1431125 538 307 1283 ----
NM_032373chr10125125 4878 4818 4370 4192 1459 1326 1241 1229 1219 493 372 --22167 1271 15451
NM_032403chr52667 568 --11738 --
NM_032410chr82937 166 --1898 --
NM_032424chr111525 --2533 242 --
NM_032433chr1931554 1358 1274 1124 ----
NM_032435chr131711 1636 413 2958 532 11924 --
NM_032438chr621588 52 ------
NM_032446chr522540 1083 13515 1227 13424
NM_032457chr433356 1500 1447 21125 892 23889 2997 32843 1182 736
NM_032458chrX53263 1377 1229 487 478 --13058 12670
NM_032466chr811536 --1295 1651
NM_032468chr811536 --1295 1651
NM_032482chr19----1194 --
NM_032485chr201662 ------
NM_032505chr321858 639 --31776 1053 103 1627
NM_032507chr61228 ------
NM_032510chr1862495 2485 2322 2164 950 235 ------
NM_032511chr63426 317 114 1349 ----
NM_032521chr20--1703 12465 22608 2274
NM_032539chrX1170 ------
NM_032547chr42262 23 --11138 --
NM_032558chr941128 1108 1079 946 11270 11230 --
NM_032560chr143995 849 778 1952 1830 --
NM_032569chr1631357 805 371 11707 ----
NM_032575chr16------11984
NM_032581chr74748 442 226 79 1115 --11590
NM_032582chr1731703 1343 1299 --1447 --
NM_032598chr17141 ------
NM_032603chr21149 ------
NM_032622chr42194 81 ----11046
NM_032626chr161250 ------
NM_032632chr14101968 1894 1840 1539 1423 1259 683 666 466 436 --11770 --
NM_032663chr1221999 1642 11266 11945 --
NM_032689chr192270 117 ------
NM_032717chr441079 968 683 76 ------
NM_032765chr51301 1218 194 1864
NM_032804chr1062346 2166 1805 1649 830 419 12499 --12160
NM_032826chr744739 4354 1449 331 15315 ----
NM_032829chr12--21175 909 ----
NM_032859chr1342696 905 839 154 11080 43497 1161 1139 1129 --
NM_032864chr161387 502 351 192 160 107 ------
NM_032876chr1451968 1932 1917 583 316 ----1354
NM_032900chr1033837 3482 2446 1479 ----
NM_032905chr101350 --11316 --
NM_032918chr122319 164 --1154 --
NM_032927chr42559 21 ----1666
NM_032932chr1786156 5395 4653 1670 1316 1243 1144 854 15649 --1732
NM_032961chr421122 396 1382 ----
NM_032968chrX63460 3432 2830 1358 852 500 23097 2864 ----
NM_032969chrX63460 3432 2830 1358 852 500 23097 2864 ----
NM_032973chrY63456 3428 2825 1358 852 500 23092 2859 ----
NM_032991chr421219 384 ------
NM_032993chr43297 257 197 ----198
NM_032999chr721019 421 --1938 --
NM_033000chr721019 421 --1938 --
NM_033001chr721019 421 --1938 --
NM_033020chr1104863 4702 3258 3106 972 896 880 832 602 563 --13473 14799
NM_033030chr221505 274 --11460 --
NM_033044chr11818 11109 ----
NM_033055chr13250 173 42 31108 400 109 ----
NM_033067chr12571 61 1648 ----
NM_033083chr363333 3259 2735 496 401 151 --13284 1347
NM_033089chr2011487 ------
NM_033105chr82430 116 --148 --
NM_033107chr72500 450 --11653 --
NM_033131chr11518 11758 ----
NM_033138chr731488 1446 376 --12055 --
NM_033139chr731488 1446 376 --12055 --
NM_033140chr731488 1446 376 --12055 --
NM_033143chr434627 3962 1210 --23245 964 --
NM_033157chr731488 1446 376 --12055 --
NM_033196chr1931492 420 137 --11461 --
NM_033207chr1042220 1717 635 313 ------
NM_033211chr51436 1678 ----
NM_033222chr921297 389 1143 --21378 79
NM_033224chr754874 3078 2560 1623 492 12107 48052 5575 2238 812 46320 5563 2883 1150
NM_033225chr842700 1988 1091 173 ------
NM_033285chr854472 4345 3885 3379 1792 11123 23908 120 --
NM_033300chr131210 221 203 1998 ----
NM_033326chr1182272 1815 854 355 308 286 179 152 1119 2628 295 2922 607
NM_033331chr933577 3292 1415 13392 12823 13355
NM_033360chr12134289 4261 4119 3519 3081 2849 1740 1029 489 381 322 288 205 12955 33125 1857 1434 11044
NM_033380chrX--2827 29 ----
NM_033381chrX--2827 29 ----
NM_033389chr1784671 3878 1213 1205 1097 693 632 560 1925 ----
NM_033393chr442536 680 352 337 ----12129
NM_033394chr241594 1527 1306 70 11376 11578 --
NM_033396chr111445 ------
NM_033402chr81565 ------
NM_033425chr1133404 1406 715 23072 656 --13472
NM_033426chr1442913 2543 852 444 2999 161 12123 --
NM_033427chr71699 1570 2562 246 1272
NM_033430chr453579 3465 1582 838 199 13766 11627 1970
NM_033437chr453579 3465 1582 838 199 13766 11627 1970
NM_033450chr6----1279 --
NM_033495chrX21062 401 ------
NM_033505chr244553 4530 4360 2390 26705 1805 12129 --
NM_033515chr62294 254 ------
NM_033516chr961642 1617 447 343 291 45 ------
NM_033540chr321026 374 1774 --1195
NM_033542chr2052010 1807 1406 1359 374 1313 ----
NM_033551chr51723 ----1302
NM_033632chr431452 1289 1217 --21249 1209 --
NM_033644chr531789 563 316 22271 1007 --141
NM_033645chr531789 563 316 22271 1007 --141
NM_033656chr21135971 5695 5636 5443 5283 4727 4542 4410 3677 1054 982 175 85 35881 1954 707 14991 24400 4052
NM_044472chr11146 1209 ----
NM_052811chr1395096 4907 4331 4312 3816 2076 2016 946 24 23596 597 33336 1993 390 --
NM_052832chr832070 300 267 22290 2122 22593 240 --
NM_052834chr1872329 1819 1615 660 244 135 31 ------
NM_052854chr111482 ------
NM_052865chr204895 767 702 342 --1909 --
NM_052879chr1263839 3828 3334 3281 3043 1492 21453 279 ----
NM_052880chr2221412 457 ------
NM_052885chr12104722 4131 3677 3529 3418 1280 873 740 452 110 --24638 4424 14417
NM_052886chr812077 12111 ----
NM_052898chr831882 668 267 31863 1348 334 ----
NM_052900chr811330 --1191 21588 1414
NM_052904chr681469 1295 1207 1090 965 263 106 93 1306 ----
NM_052905chr251880 1849 1476 1356 413 11424 ----
NM_052910chr1351419 882 854 811 739 ------
NM_052917chr263139 2384 2328 2061 1233 516 12631 --197
NM_052918chr1043520 3376 1175 1057 ------
NM_052923chr61194 ------
NM_052927chr552255 1569 1487 860 80 21945 165 21750 1515 22214 1458
NM_052954chr2132200 1724 539 ------
NM_052965chr12507 27 11357 ----
NM_052966chr143022 2734 323 24 ------
NM_052996chr1621386 1376 --11747 --
NM_053002chr32834 30 --11044 --
NM_053016chr977498 5165 2150 1747 1543 1327 1105 27515 1455 --22260 1617
NM_053024chr331254 1217 588 ----172
NM_053042chr441201 929 579 361 23093 1235 12142 --
NM_053043chr7115804 5777 5168 4947 4882 4857 1500 1445 437 377 248 ------
NM_053053chr11684 1335 ----
NM_053056chr1182598 2521 2443 2141 2064 2056 1080 487 --12095 --
NM_053064chr1472377 2337 2297 2042 817 808 57 13087 ----
NM_053281chrX187 ------
NM_054016chr131599 466 116 ----11338
NM_054016chr131599 466 116 ----11338
NM_054016chr131599 466 116 ----11338
NM_057157chr10152 ------
NM_057159chr9----11052 --
NM_057168chr721640 1405 --11154 11294
NM_057175chr462084 1825 664 401 360 134 12056 ----
NM_057749chr831239 496 348 --176 --
NM_058170chr121427 273 11476 ----
NM_058172chr42676 396 ------
NM_078470chr101455 1821 11774 1235
NM_080390chrX--137 ----
NM_080413chr20--1139 ----
NM_080414chr20--1139 ----
NM_080546chr942341 2323 1762 513 1280 ----
NM_080597chr182942 398 11066 1181 147
NM_080607chr201719 11092 ----
NM_080617chr20------1331
NM_080629chr121337 80 11193 11542 --
NM_080630chr121337 80 11193 11542 --
NM_080645chr631964 377 290 ------
NM_080666chr1441580 355 156 33 --11349 --
NM_080676chr2032728 914 750 --12334 --
NM_080682chr11506 ------
NM_080723chr62491 66 11335 1890 --
NM_080742chr61100 ------
NM_080759chr1352482 2263 1908 1641 166 1936 --12078
NM_080760chr1352482 2263 1908 1641 166 1936 --12078
NM_080794chr21--189 ----
NM_080798chr10166 ------
NM_080799chr10166 ------
NM_080800chr10166 ------
NM_080801chr10166 ------
NM_080802chr10166 ------
NM_080803chr10166 ------
NM_080804chr10166 ------
NM_080805chr10166 ------
NM_080806chr10166 ------
NM_080807chr10166 ------
NM_080808chr10166 ------
NM_080809chr10166 ------
NM_080810chr10166 ------
NM_080811chr10166 ------
NM_080812chr10166 ------
NM_080813chr10166 ------
NM_080814chr10166 ------
NM_080815chr10166 ------
NM_080840chr202193 104 ------
NM_080841chr202193 104 ------
NM_080867chr1464939 3294 1974 1700 1008 740 14625 14130 --
NM_080872chr863524 3095 2541 1623 1105 413 ------
NM_080927chr373342 2492 2202 2080 1110 1025 683 134 11324 --
NM_130391chr943491 1001 781 505 ----12732
NM_130392chr943491 1001 781 505 ----12732
NM_130393chr943491 1001 781 505 ----12732
NM_130434chr1521102 799 ----11017
NM_130435chr1032777 921 548 12618 ----
NM_130439chr1011794 --11584 --
NM_130439chr1011794 --11584 --
NM_130440chr121436 659 ------
NM_130442chr731108 999 988 ------
NM_130459chr941635 523 88 41 ------
NM_130782chr11275 11068 ----
NM_130787chr19164 ------
NM_130795chr91493 ------
NM_130797chr72465 150 21582 621 1562 --
NM_130798chr1551095 611 573 485 82 --11290 --
NM_130808chr31394 ------
NM_130809chr563122 2404 2083 978 427 107 --12234 --
NM_130838chr1541869 1299 739 585 21463 653 --1539
NM_130839chr1541869 1299 739 585 21463 653 --1539
NM_133172chr5161 ------
NM_133173chr5161 ------
NM_133174chr5161 ------
NM_133264chr1743712 2647 2601 949 23499 503 ----
NM_133265chrX52875 2755 2605 1464 535 11067 --11392
NM_133326chr11240 ------
NM_133334chr464696 4268 4174 1837 889 516 34091 2475 726 1546 15234
NM_133367chr673382 3324 3153 2597 2315 602 161 22506 932 ----
NM_133370chr483255 3228 2538 2375 1276 1070 821 550 23676 3650 11381 --
NM_133372chr552819 2498 2371 448 391 22685 2019 ----
NM_133378chr23278 240 107 ------
NM_133432chr23278 240 107 ------
NM_133433chr52828 683 --193 --
NM_133437chr23278 240 107 ------
NM_133443chr1611834 ------
NM_133468chr73693 396 355 ------
NM_133478chr222200 248 1265 --12294
NM_133493chr654008 1819 1296 570 104 14262 --24583 2927
NM_133496chr173518 3116 1676 1124 664 395 211 1892 --14292
NM_133631chr321029 504 ------
NM_133638chr51289 --11006 --
NM_133647chr1543871 2388 1330 234 --23290 2951 --
NM_134265chr1711234 ------
NM_134424chr1211036 ------
NM_134427chr91493 ------
NM_138270chrX52878 2274 2238 2173 953 22183 488 31234 629 135 13461
NM_138286chr19114147 3816 3307 3242 3227 3183 2910 2894 2700 1133 792 13402 13778 --
NM_138288chr1442034 764 439 212 11551 1550 --
NM_138340chr181601 ------
NM_138348chr5116621 5837 4888 4326 4160 2469 2451 2372 1442 301 182 12291 36309 4795 1555 --
NM_138350chr1----11051 --
NM_138353chr19--1441 ----
NM_138376chr14--1106 ----
NM_138426chr742513 2269 349 174 ------
NM_138443chr181184 ------
NM_138444chr1394797 4352 4170 4116 3923 1275 616 511 491 --21947 539 --
NM_138459chr683248 3176 2706 2334 1421 315 287 144 12460 23637 895 --
NM_138468chr276157 6052 4881 2022 1937 1306 442 24687 2506 ----
NM_138473chr12115195 4610 4323 4216 3658 3606 1469 1456 1176 973 588 ------
NM_138485chr31315 193 ----
NM_138554chr96891 662 645 384 330 203 --12214 --
NM_138558chr11774 ------
NM_138565chr1121321 251 ------
NM_138569chr6140 ------
NM_138576chr1464293 4017 3685 3063 1571 567 ------
NM_138578chr2041205 942 366 159 ------
NM_138609chr52483 111 ------
NM_138610chr52483 111 ------
NM_138633chr631514 1399 600 ------
NM_138638chr141556 --1695 --
NM_138694chr632329 2311 262 11401 13357 --
NM_138713chr16116792 6395 5289 2969 2375 1917 1901 1357 1068 998 404 17931 2829 517 --
NM_138714chr16116792 6395 5289 2969 2375 1917 1901 1357 1068 998 404 17931 2829 517 --
NM_138727chr131951 784 728 12250 ----
NM_138728chr131951 784 728 12250 ----
NM_138730chr62385 344 ------
NM_138731chr1454149 3899 3636 2940 498 23764 801 11594 14107
NM_138735chr2140 --11095 --
NM_138771chr71272 ------
NM_138774chr191595 ------
NM_138779chr131256 ------
NM_138782chr542065 590 454 258 1631 --12288
NM_138927chr2121069 164 --1805 --
NM_138931chr32852 795 ------
NM_138959chr1116791 6474 6262 5350 5117 5089 4203 2716 2182 1835 898 22665 2229 ----
NM_138970chr1452328 2182 1897 1525 30 ----12176
NM_138971chr1153119 3095 2987 2670 2424 --1676 --
NM_138971chr1153119 3095 2987 2670 2424 --1676 --
NM_138972chr1153119 3095 2987 2670 2424 --1676 --
NM_138972chr1153119 3095 2987 2670 2424 --1676 --
NM_138973chr1153119 3095 2987 2670 2424 --1676 --
NM_138973chr1153119 3095 2987 2670 2424 --1676 --
NM_139035chrX------1168
NM_139045chr92644 329 ------
NM_139056chr51735 --11140 --
NM_139072chr21108 1202 ----
NM_139135chr1--1822 ----
NM_139168chr561929 1912 1600 1274 592 398 ----1498
NM_139169chr1062223 2177 1793 1654 699 222 12286 21515 303 22041 1897
NM_139201chr121634 ------
NM_139207chr1231787 559 178 1861 12084 12141
NM_139215chr17160 ------
NM_139241chr121195 ------
NM_139244chr63356 140 48 1908 ----
NM_139283chr1252228 685 574 473 122 ------
NM_139312chr10133 ------
NM_139316chr73873 746 675 ------
NM_139321chr2063952 2966 2899 843 654 411 --12873 1683
NM_139323chr202807 218 ------
NM_144488chr91493 ------
NM_144489chr91493 ------
NM_144563chr22264 232 --1156 --
NM_144563chr22264 232 --1156 --
NM_144567chr122662 245 11936 --22622 1065
NM_144571chr4116389 6322 5020 4561 2762 2537 2133 1636 1406 1371 655 36574 4790 4708 --34443 1646 1586
NM_144576chr121617 ------
NM_144578chr1464752 3941 3778 1602 1378 614 --14305 --
NM_144590chr102926 421 12155 ----
NM_144595chr133836 320 245 1112 ----
NM_144599chr15105491 5348 4865 4835 4585 4025 3486 2126 1733 1475 45524 4851 1581 406 13928 --
NM_144609chr1741244 436 332 290 ------
NM_144631chr2126 ------
NM_144632chr211786 --1625 --
NM_144633chr321441 1416 --21404 57 --
NM_144635chr311272 ------
NM_144642chr341354 429 353 130 11214 --1446
NM_144643chr41340 ------
NM_144657chrX2506 32 ------
NM_144664chr1151955 1904 920 396 367 1744 12092 --
NM_144676chr161101 ------
NM_144721chr441948 617 212 196 ----12726
NM_144728chr1--1691 ----
NM_144729chr1--1691 ----
NM_144732chr192826 435 11008 ----
NM_144767chr1543459 3261 2821 1609 13954 --14527
NM_144777chr13----161 --
NM_144778chr133882 781 322 11795 --1743
NM_144949chr242601 2225 2119 396 22473 2368 32305 1853 740 --
NM_144963chr842532 2088 731 158 1611 ----
NM_144979chr4175 1107 ----
NM_145005chr92821 268 21077 729 ----
NM_145025chr631127 992 110 1128 ----
NM_145037chr321382 572 ------
NM_145049chr54849 677 132 124 ------
NM_145055chr1853734 3667 1449 556 345 --22692 1098 13192
NM_145109chr17--1981 ----
NM_145117chr1142292 2098 1022 1001 --13005 13302
NM_145175chr211090 ----11072
NM_145185chr1921756 1728 ------
NM_145203chr131809 ------
NM_145206chr1012751 1815 --12639
NM_145207chr465061 4828 4528 3749 1699 558 15087 35267 1913 206 --
NM_145247chr10----1525 1495
NM_145251chr1431322 197 97 11146 1251 --
NM_145259chr266869 6033 2353 2180 1252 314 26666 2065 12580 15566
NM_145266chr5----1240 --
NM_145284chrX32503 2228 2196 128 1101 --
NM_145307chr1052956 2919 1553 1416 420 24575 3124 --23499 1140
NM_145320chr763334 3177 3048 1178 1129 994 23539 2433 --22311 1191
NM_145321chr763334 3177 3048 1178 1129 994 23539 2433 --22311 1191
NM_145322chr763334 3177 3048 1178 1129 994 23539 2433 --22311 1191
NM_145331chr6----1631 --
NM_145332chr6----1779 --
NM_145333chr6----1779 --
NM_145341chr1031742 293 74 2539 473 123 --
NM_145647chr81202 ------
NM_145649chr622527 331 12613 1225 --
NM_145655chr622527 331 12613 1225 --
NM_145686chr253221 2740 390 347 39 12419 1898 --
NM_145687chr253221 2740 390 347 39 12419 1898 --
NM_145690chr851502 1489 1371 671 83 ----11981
NM_145693chr232005 1010 686 1955 ----
NM_145698chr101631 11583 12023 --
NM_145719chr111378 ------
NM_145725chr141175 ------
NM_145726chr141175 ------
NM_145735chr1332810 2144 259 ------
NM_145753chr31497 1174 ----
NM_145756chr181439 11595 --1606
NM_145759chr132105 589 264 ------
NM_145793chr10----1373 --
NM_145799chrX42466 1129 970 597 13083 12254 1786
NM_145808chr732473 2414 700 13120 1680 --
NM_147147chr64918 361 260 205 42827 2593 283 42 --14081
NM_147150chr974009 3938 3443 3047 2735 2606 1523 ------
NM_147156chr1031278 1066 328 11434 11208 --
NM_147171chr71453 ------
NM_147175chrX31811 1462 681 --1580 31892 1750 114
NM_147181chr4--1133 2564 274 --
NM_147182chr4--1133 2564 274 --
NM_147183chr4--1133 2564 274 --
NM_147185chr71453 ------
NM_147189chr812373 1336 1348 --
NM_147223chr232256 2236 1951 ------
NM_147233chr232073 2053 1768 ------
NM_148174chr862217 2076 1705 680 618 340 --1369 --
NM_148571chr171346 11328 1319 --
NM_148894chr431140 1034 937 21000 149 ----
NM_148957chr1322666 376 ------
NM_148976chr111118 1279 ----
NM_152238chr1--2351 247 ----
NM_152261chr1252290 693 537 434 280 22149 999 ----
NM_152265chr111588 --167 --
NM_152271chr81461 1873 ----
NM_152275chr252266 1752 505 230 94 --1677 --
NM_152282chr321250 70 --1996 1885
NM_152284chr81645 1127 1609 --
NM_152308chr161369 ------
NM_152309chr1041996 745 363 50 --21638 84 --
NM_152312chr11------1245
NM_152332chr1481934 1124 1033 948 843 732 544 440 22196 205 ----
NM_152344chr1711018 --1558 --
NM_152377chr1--1258 1208 --
NM_152380chr131344 1278 555 --21128 243 --
NM_152384chr241931 168 126 86 --12013 --
NM_152406chr521225 276 1644 ----
NM_152409chr563303 2381 1261 552 458 68 13409 --22868 874
NM_152418chr841822 1755 490 146 --11598 1621
NM_152422chr951722 1657 1577 469 375 21512 460 1610 --
NM_152424chrX83927 3892 3857 1816 1447 1013 237 137 ----13562
NM_152437chr1232262 2083 1651 --12180 --
NM_152447chr141363 ------
NM_152450chr1541732 1723 198 34 1697 --1162
NM_152455chr1532797 450 57 --22306 1813 --
NM_152512chr22----1463 --
NM_152519chr231504 624 484 1648 21389 850 1890
NM_152574chr91114 ------
NM_152594chr1531950 1823 892 --21890 486 11884
NM_152608chr121937 810 12319 2506 460 --
NM_152621chr4166 ------
NM_152622chr542880 784 505 74 11363 23264 1182 11142
NM_152624chr5137474 6852 5564 5553 5302 5098 2530 2505 2269 1917 877 386 273 47285 4816 1307 93 26604 539 36578 6056 4698
NM_152629chr993892 3717 3668 3265 3043 2698 2569 774 589 12881 14109 12710
NM_152630chrX21465 1308 21229 375 ----
NM_152633chrX1128 ------
NM_152638chr1231225 838 803 ------
NM_152641chr122833 714 11900 --182
NM_152660chr11960 ----1756
NM_152665chr121238 1022 --173 11149
NM_152666chr14880 713 540 241 --2569 293 --
NM_152672chr3--1193 ----
NM_152680chr422004 394 12412 ----
NM_152687chr521309 1270 21196 831 ----
NM_152688chr6--1840 ----
NM_152704chr1371049 968 678 273 151 97 76 ------
NM_152705chr1341414 988 305 204 ------
NM_152707chr101330 21073 783 2736 257 --
NM_152734chr645154 1851 931 433 21725 1032 15126 --
NM_152736chr631061 683 311 ------
NM_152748chr7----155 --
NM_152753chr6--1778 ----
NM_152754chr753098 273 260 185 103 --13800 --
NM_152756chr543990 3782 3046 1404 --23886 3333 1236
NM_152758chr842836 2209 1057 409 ------
NM_152774chr732039 1723 82 12453 12473 11672
NM_152787chrX53221 2851 1527 1436 174 1600 12995 12449
NM_152793chr774320 4211 1373 1264 953 914 233 24616 1114 11425 24862 1539
NM_152829chr731124 1021 444 ------
NM_152835chr142444 2018 288 171 12482 ----
NM_152838chr2053397 2466 2322 1145 310 ----23537 3088
NM_152857chr61717 ----1341
NM_152858chr61717 ----1341
NM_152890chr141127 1097 796 420 1977 --1943
NM_152896chr93760 745 568 ----1219
NM_152902chr121802 1618 ----1546
NM_152903chr1332009 448 280 1972 1490 --
NM_152910chr131121 ------
NM_152924chr1586226 5934 5857 4729 2535 1225 794 552 ------
NM_152989chr1221833 437 --1286 1122
NM_152991chr11--1292 1459 --
NM_153013chr532552 2320 922 22091 716 21684 746 --
NM_153020chr621441 1330 --11124 --
NM_153042chr61638 31803 1654 1527 173 --
NM_153050chr2264493 4436 4405 4387 3574 740 1247 ----
NM_153051chr2264493 4436 4405 4387 3574 740 1247 ----
NM_153184chr331860 562 338 11707 21517 26 --
NM_153188chr575574 4928 4910 4388 1749 489 475 25539 208 55274 5201 4583 3778 49 --
NM_153201chr11--1215 --187
NM_153207chr1253536 3043 1531 1496 1345 33615 947 435 22904 51 --
NM_153240chr32283 181 11278 ----
NM_153252chrX----1418 --
NM_153255chr61180 1954 ----
NM_153256chr1041864 1237 610 565 21715 483 11293 --
NM_153261chr1631566 1075 309 ----11535
NM_153262chr142920 2329 726 523 --12115 --
NM_153321chr171351 ------
NM_153322chr171351 ------
NM_153333chrX1112 ------
NM_153341chr1------1228
NM_153347chr1111779 11012 ----
NM_153354chr54721 361 313 127 1623 ----
NM_153362chr62905 732 ------
NM_153365chr432000 987 437 42318 2146 1941 1692 ----
NM_153371chr1331965 327 202 --11751 --
NM_153426chr42671 639 --1547 --
NM_153427chr42671 639 --1547 --
NM_153498chr101135 ------
NM_153607chr572543 2475 2338 2089 1243 961 901 22798 127 --12290
NM_153619chr1553557 3122 2237 441 158 ------
NM_153631chr721277 334 ----1571
NM_153632chr721277 334 ----1571
NM_153634chr1231154 1136 98 1584 --1442
NM_153645chr2273292 3063 2855 2722 2636 658 73 ------
NM_153649chr122244 596 11943 11731 --
NM_153682chr21149 ------
NM_153686chr472372 1986 1811 1774 715 679 172 --1281 1302
NM_153687chr1241454 1363 1256 629 --11351 21579 1434
NM_153689chr21105 21638 354 ----
NM_153690chr31650 ------
NM_153712chr261110 1067 807 742 635 494 ------
NM_153713chr1----1194 --
NM_153715chr73930 799 302 11148 ----
NM_170606chr741551 1196 627 105 ------
NM_170665chr1231816 864 726 23692 1773 1489 2820 643
NM_170675chr15----1324 --
NM_170676chr15----1324 --
NM_170679chr521107 375 ------
NM_170707chr11176 ------
NM_170708chr11176 ------
NM_170709chr812233 12045 11598 --
NM_170710chr442268 772 607 528 1518 --22949 1182
NM_170719chr1331229 1189 1179 --11078 --
NM_170721chr1741299 1235 450 113 ------
NM_170731chr1142197 2179 1129 451 22881 896 12596 --
NM_170732chr1142197 2179 1129 451 22881 896 12596 --
NM_170733chr1142197 2179 1129 451 22881 896 12596 --
NM_170734chr1142197 2179 1129 451 22881 896 12596 --
NM_170735chr1142197 2179 1129 451 22881 896 12596 --
NM_170750chrX1250 --1268 1796
NM_170751chr631429 1261 338 ----1165
NM_170752chr631429 1261 338 ----1165
NM_171825chr573174 3054 1207 947 931 544 314 ------
NM_172037chr821428 1108 --11493 --
NM_172058chr841709 1555 1203 238 ----2666 136
NM_172059chr841709 1555 1203 238 ----2666 136
NM_172060chr841709 1555 1203 238 ----2666 136
NM_172070chr211852 1384 ----
NM_172071chr1127459 6732 6472 6399 6319 5760 5699 4639 2959 1918 1027 669 46080 4619 1820 960 16998 11050
NM_172103chr632257 1057 200 1100 11012 --
NM_172105chr632257 1057 200 1100 11012 --
NM_172128chr41501 ------
NM_172193chr1411298 135 ----
NM_172337chr141375 --2224 64 --
NM_172348chr5121 ------
NM_173082chr661482 601 543 528 486 135 11266 196 --
NM_173083chr12465 382 21096 1021 --1506
NM_173163chr161498 ------
NM_173165chr161379 ------
NM_173171chr21476 ------
NM_173173chr21476 ------
NM_173198chr932900 630 211 32708 429 340 1640 --
NM_173200chr932900 630 211 32708 429 340 1640 --
NM_173214chr16116792 6395 5289 2969 2375 1917 1901 1357 1068 998 404 17931 2829 517 --
NM_173354chr2152107 1984 1724 628 149 ----1506
NM_173463chr453405 2904 2734 503 375 23019 741 12773 --
NM_173468chr4135970 5539 5447 5329 5074 4909 4614 3974 1958 1402 969 667 262 13888 31471 1436 1033 14324
NM_173469chr1511197 ------
NM_173470chrX92162 1992 1047 1039 588 525 475 419 198 ------
NM_173478chr171966 ------
NM_173495chrX72475 2458 2253 2058 495 184 35 ------
NM_173500chr1531152 1129 924 ------
NM_173508chr131157 409 95 ------
NM_173510chr2262426 2306 2145 873 619 212 --193 --
NM_173511chr263606 3367 3322 2827 1300 1067 13238 23757 2587 12791
NM_173519chr821888 371 11433 ----
NM_173536chr4154655 4629 4316 3670 3603 3485 3399 1963 1598 1523 1179 1093 1077 863 497 1307 35045 1454 1037 11270
NM_173552chr342129 1981 1637 417 ------
NM_173567chr1183 ------
NM_173570chr311939 21665 81 ----
NM_173576chr10------21481 823
NM_173582chr1186293 5694 5485 5010 2236 2204 1552 304 26178 1116 12448 --
NM_173602chr1273795 3698 3192 3093 2491 2360 551 ------
NM_173607chr1431518 535 37 1233 1379 --
NM_173609chr151608 --138 --
NM_173642chr193521 3378 3218 3179 1971 1431 1218 537 55 13601 ----
NM_173644chr2051897 1661 1516 590 345 11890 11275 --
NM_173647chr231083 857 830 ------
NM_173648chr211007 ------
NM_173794chrX1387 ------
NM_173797chr561226 1093 961 533 295 118 ----11172
NM_173808chr114392 ------
NM_173822chr2--11511 ----
NM_173829chr595951 5462 4549 3913 2322 1771 810 784 498 25009 558 45685 2030 625 198 1986
NM_173830chr62632 235 169 ----
NM_173834chrX1369 ------
NM_173848chr82844 725 1178 1152 1261
NM_173851chr843921 3521 1494 737 --33640 3362 358 --
NM_174890chr101247 --1281 2203 191
NM_174900chr42225 200 1164 ----
NM_174907chr3--150 194 --
NM_174916chr155919 724 428 216 103 ------
NM_174934chr1173593 2378 2200 1184 622 552 122 1660 ----
NM_175056chr32700 297 2463 430 --12136
NM_175061chr742127 1675 599 393 --11487 --
NM_175607chr31296 11196 1462 --
NM_175612chr31296 11196 1462 --
NM_175630chr24814 337 210 123 1145 ----
NM_175634chr81873 ------
NM_175635chr81873 ------
NM_175636chr81873 ------
NM_175736chr1266000 2252 2089 738 610 215 27523 5929 16548 --
NM_175748chr1472035 1965 1894 1571 1320 310 270 --11822 --
NM_175848chr2021379 1243 ------
NM_175848chr2021379 1243 ------
NM_175849chr2021379 1243 ------
NM_175849chr2021379 1243 ------
NM_175850chr2021379 1243 ------
NM_175850chr2021379 1243 ------
NM_175854chr1372442 2338 2316 2006 1807 1039 921 12594 ----
NM_175856chr52631 595 1130 --1580
NM_175863chr61443 --1856 --
NM_175866chr13584 337 214 ----11006
NM_175874chr121152 ------
NM_176081chr1065702 4360 4049 2380 432 380 --34492 1893 951 15678
NM_176083chr1065702 4360 4049 2380 432 380 --34492 1893 951 15678
NM_176787chr1841566 1500 1367 996 ------
NM_176801chr411866 ------
NM_176814chr721507 404 11277 ----
NM_177398chr121415 115 --1215 --
NM_177399chr121415 115 --1215 --
NM_177414chr151603 1097 482 432 141 1496 ----
NM_177438chr1453559 2851 724 691 623 23626 2725 31505 642 200 13730
NM_177553chr112917 621 ------
NM_177947chrX41673 1631 153 98 ------
NM_177948chrX41673 1631 153 98 ------
NM_177968chr231750 851 800 ----1823
NM_177969chr2----2534 111 --
NM_177983chr2165 ------
NM_177985chr251726 1670 1663 1473 193 11911 ----
NM_177990chr2041701 1629 668 465 1171 ----
NM_177995chr951722 1657 1577 469 375 21512 460 1610 --
NM_178009chr13184 ------
NM_178010chr1221833 437 --1286 1122
NM_178011chr1053089 2705 2558 2196 462 1174 12365 --
NM_178120chr2----11318 --
NM_178140chr552134 1947 1826 838 738 1852 ----
NM_178151chrX107247 7019 6650 5892 4786 1395 1388 1174 338 105 47310 6937 6223 5138 16158 --
NM_178152chrX107247 7019 6650 5892 4786 1395 1388 1174 338 105 47310 6937 6223 5138 16158 --
NM_178153chrX107247 7019 6650 5892 4786 1395 1388 1174 338 105 47310 6937 6223 5138 16158 --
NM_178177chr33758 143 75 1737 ----
NM_178313chr21801 1870 ----
NM_178424chr51102 1528 ----
NM_178426chr111900 ------
NM_178498chr1153581 3324 347 339 299 13837 12747 13755
NM_178507chr11--1787 ----
NM_178509chr1753390 1618 1467 685 417 23021 1334 ----
NM_178539chr1211391 1546 ----
NM_178557chr421772 1686 ------
NM_178565chr811320 ------
NM_178566chr961456 1385 1323 414 82 58 --1113 1199
NM_178586chr1442384 2058 1805 1565 ----1768
NM_178812chr841589 1470 423 226 147 2648 94 --
NM_178815chr1032597 2198 1751 22393 1693 22528 402 --
NM_180989chr1352444 2397 1848 1581 613 --1347 --
NM_181054chr141363 ------
NM_181077chr1522202 1733 ------
NM_181265chr442268 772 607 528 1518 --22949 1182
NM_181332chrX22668 1694 ----11837
NM_181351chr1152542 2456 1922 1144 915 ------
NM_181353chr201620 ------
NM_181354chr841630 1614 1294 532 ------
NM_181356chr64999 415 263 177 ------
NM_181358chr1114198 3662 3427 2780 1577 1225 1015 899 820 575 194 21243 582 13104 --
NM_181361chr321315 1044 ------
NM_181442chr20----1914 --
NM_181443chr2062565 2118 1003 514 455 301 11781 ----
NM_181453chr231493 1418 551 11149 ----
NM_181481chr18106839 6151 5924 4835 4665 2746 2451 623 374 132 2575 477 12174 11573
NM_181482chr18106839 6151 5924 4835 4665 2746 2451 623 374 132 2575 477 12174 11573
NM_181483chr18106839 6151 5924 4835 4665 2746 2451 623 374 132 2575 477 12174 11573
NM_181492chr22--1355 11262 11151
NM_181503chr13168 ------
NM_181504chr584155 4027 3193 2843 2716 1398 1021 883 34161 3461 1201 --1847
NM_181521chr16127162 5968 5581 4703 4668 2759 2614 2019 1268 1218 248 57 17180 ----
NM_181523chr584155 4027 3193 2843 2716 1398 1021 883 34161 3461 1201 --1847
NM_181524chr584155 4027 3193 2843 2716 1398 1021 883 34161 3461 1201 --1847
NM_181552chr71679 ------
NM_181670chr1221475 1427 21354 920 --1419
NM_181672chrX82066 1940 572 541 528 481 347 272 2753 457 ----
NM_181673chrX82066 1940 572 541 528 481 347 272 2753 457 ----
NM_181674chr54373 284 76 56 ------
NM_181675chr54373 284 76 56 ------
NM_181676chr54373 284 76 56 ------
NM_181677chr54373 284 76 56 ------
NM_181678chr54373 284 76 56 ------
NM_181701chr93328 254 155 ----12187
NM_181714chr641769 1743 1532 368 21714 231 ----
NM_181723chr852306 866 683 631 504 ------
NM_181762chrX4741 267 242 140 ----1839
NM_181777chrX4741 267 242 140 ----1839
NM_181782chr61539 21585 675 1630 1915
NM_181783chr1211536 11680 2712 521 --
NM_181787chr862645 1208 1003 684 250 51 13507 23699 460 --
NM_181828chr2243503 2853 373 289 23835 297 --12389
NM_181829chr2243503 2853 373 289 23835 297 --12389
NM_181830chr2243503 2853 373 289 23835 297 --12389
NM_181832chr2243518 2868 388 304 23850 312 --12404
NM_181833chr2243443 2793 313 229 23775 237 --12329
NM_181839chr811321 11294 ----
NM_181864chr11126 ------
NM_181865chr11126 ------
NM_181866chr11126 ------
NM_181886chr411124 ------
NM_181887chr411124 ------
NM_181888chr411124 ------
NM_181889chr411124 ------
NM_181890chr411124 ------
NM_181891chr411124 ------
NM_181892chr411171 ------
NM_181893chr411124 ------
NM_182481chr2111304 ------
NM_182482chr2111304 ------
NM_182485chr453206 2457 1411 1130 916 --2944 719 --
NM_182493chr1674472 4064 4049 2166 1546 677 658 21921 645 ----
NM_182551chr233528 1358 1215 --21385 1105 13500
NM_182565chr172207 194 ------
NM_182569chr171111 ----1245
NM_182641chr171228 ------
NM_182643chr8------21527 773
NM_182646chr453206 2457 1411 1130 916 --2944 719 --
NM_182648chr141184 1614 ----
NM_182663chr11352 12265 ----
NM_182664chr11482 12395 ----
NM_182665chr11352 12265 ----
NM_182666chr32511 434 --1130 --
NM_182678chr21430 ------
NM_182717chr1021032 959 ------
NM_182720chr1021032 959 ------
NM_182721chr1021032 959 ------
NM_182722chr1021032 959 ------
NM_182723chr1021032 959 ------
NM_182763chr152594 2231 1797 1024 747 ----11052
NM_182765chr1042294 1801 639 128 21782 1656 ----
NM_182789chr53992 799 341 --126 --
NM_182796chr53799 743 82 ------
NM_182802chr201662 ------
NM_182830chr1432303 1481 59 ------
NM_182853chr1021032 959 ------
NM_182898chr796065 5861 5413 4304 1536 1022 670 605 240 32558 1893 1752 12051 --
NM_182899chr796065 5861 5413 4304 1536 1022 670 605 240 32558 1893 1752 12051 --
NM_182910chr14--1799 ---