TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-499b-5p
miRNA Sequence: ACAGACUUGCUGUGAUGUUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr832399 2374 2337 ------
NM_000052chrX62525 1028 881 867 798 641 22859 2172 1733 --
NM_000070chr15----1493 --
NM_000081chr151359 411 317 238 129 ------
NM_000084chrX66449 5156 4675 2680 984 564 --46463 5289 2328 2230 --
NM_000093chr962428 2345 1956 1920 723 337 --21943 769 --
NM_000097chr331087 485 357 ------
NM_000104chr242579 1977 861 440 ------
NM_000109chrX32331 2239 2225 --1233 --
NM_000151chr1721910 246 ------
NM_000163chr532380 1529 501 ------
NM_000176chr553127 2436 1017 463 71 --22816 327 --
NM_000194chrX2456 23 ------
NM_000210chr262335 2015 1796 1635 889 760 ------
NM_000217chr1255162 4625 4318 4125 763 --21583 1202 --
NM_000220chr117984 970 817 346 311 115 33 ------
NM_000222chr442063 1868 1544 621 1856 --1799
NM_000232chr453203 2306 1961 771 81 ----1311
NM_000240chrX51732 1714 1455 582 67 --12194 --
NM_000242chr1062629 2231 2191 1967 818 444 --1785 --
NM_000248chr341080 1004 671 376 ------
NM_000259chr1576019 4563 2480 1593 1379 688 438 22185 342 12060 --
NM_000267chr1733059 2503 445 12322 ----
NM_000284chrX21593 157 ------
NM_000297chr442007 1821 1595 287 --11675 --
NM_000310chr151217 1163 367 272 206 ------
NM_000314chr1033292 3074 2836 --1438 12293
NM_000321chr1331816 1783 1477 ------
NM_000327chr111267 ----147
NM_000328chrX180 ------
NM_000330chrX21948 449 ------
NM_000332chr697171 7024 6177 6124 4610 2032 1739 1304 973 12805 ----
NM_000346chr1711323 11671 ----
NM_000368chr984802 4683 3991 1520 1348 563 422 353 34334 3868 95 1442 --
NM_000374chr1167 ------
NM_000393chr22702 194 ------
NM_000397chrX22231 720 12046 --21822 1609
NM_000408chr253295 1265 1123 640 616 ----13308
NM_000430chr1721029 977 --11141 11293
NM_000437chr151970 1569 821 551 39 ----1490
NM_000459chr92846 692 ------
NM_000489chrX73458 3397 3361 1232 1156 627 100 --12779 1510
NM_000494chr105937 344 90 67 35 1149 --1619
NM_000495chrX2367 193 ------
NM_000503chr841799 1554 1485 1202 ------
NM_000555chrX96767 6156 5891 4931 4775 2499 2186 753 104 15941 17721 1908
NM_000560chr12717 570 ------
NM_000594chr6----1786 --
NM_000596chr71172 1381 ----
NM_000598chr721483 140 1230 21448 1281 --
NM_000618chr1254775 2293 936 920 741 --11959 1104
NM_000618chr1254775 2293 936 920 741 --11959 1104
NM_000621chr13298 46 11253 ----
NM_000633chr1865151 4917 4819 4082 1961 1505 --24184 4062 --
NM_000681chr1011381 11101 ----
NM_000684chr101482 --1164 --
NM_000685chr31728 1699 ----
NM_000685chr31728 1699 ----
NM_000700chr9181 ------
NM_000701chr1189 ------
NM_000702chr121985 672 12214 ----
NM_000719chr12106513 6215 5702 5559 5520 5448 5441 1807 1796 1161 --16120 --
NM_000720chr3184 ------
NM_000724chr1051519 650 565 75 42 1631 11783 --
NM_000782chr2031314 819 282 ------
NM_000806chr551768 1625 1564 164 113 ------
NM_000809chr499156 9131 9095 6386 5714 3706 3321 644 21 28388 883 --18088
NM_000813chr535114 4953 3403 --24515 4479 12199
NM_000814chr1553464 3081 2795 758 69 ------
NM_000826chr431893 895 412 ------
NM_000828chrX42170 2002 1451 1421 ------
NM_000831chr1126269 5777 5759 5620 4711 4301 2471 1460 1199 723 630 312 --24699 1445 15662
NM_000857chr41448 ------
NM_000859chr531350 318 157 --1451 --
NM_000868chrX52313 1788 1663 1625 1042 --11811 --
NM_000875chr1586659 6117 4596 4323 2368 2339 805 755 1402 14868 --
NM_000891chr1753628 2478 1288 885 45 11369 23215 2522 --
NM_000899chr1264197 3061 2959 2933 1194 771 23743 594 ----
NM_000901chr452260 1586 314 127 35 1198 ----
NM_000917chr102909 856 ------
NM_000922chr11------1703
NM_000933chr203653 452 431 ------
NM_000937chr172420 409 ------
NM_000944chr442151 2023 804 729 ------
NM_000945chr231973 703 614 ----1208
NM_000950chrX43237 3175 2652 1304 13000 ----
NM_000963chr11346 --22483 199 --
NM_000965chr341284 862 318 134 --11189 --
NM_000966chr122952 143 ------
NM_000975chr1136 ------
NM_001001132chr2131028 952 530 ------
NM_001001323chr1243174 2143 2010 271 --1233 --
NM_001001330chr101525 ------
NM_001001331chr32720 466 --11721 --
NM_001001396chr134167 2843 2808 22944 283 2646 152 --
NM_001001419chr544063 1950 514 382 11372 15054 13584
NM_001001420chr544063 1950 514 382 11372 15054 13584
NM_001001433chr201670 ------
NM_001001481chr833356 1047 381 ----11010
NM_001001664chr243927 662 421 347 ------
NM_001001715chr131435 ------
NM_001001890chr211639 14317 ----
NM_001001938chr984021 3766 3360 3165 2801 1480 1127 272 --12627 --
NM_001001971chr1041176 334 148 50 --2944 522 --
NM_001001974chr1032168 812 762 ------
NM_001002257chr233497 3216 1357 1686 ----
NM_001002269chr91393 ------
NM_001002295chr1021125 362 ----1411
NM_001002759chr103599 576 523 ------
NM_001002838chrX61605 1436 608 480 187 72 ------
NM_001002860chr1413035 --1651 --
NM_001002909chr1721864 301 --1164 --
NM_001002919chr21164 ------
NM_001003407chr1054375 3791 1780 1552 457 --2750 134 13755
NM_001003408chr1054375 3791 1780 1552 457 --2750 134 13755
NM_001003652chr18128046 7562 6304 6285 6148 6071 3162 2192 1325 923 367 125 21353 1104 ----
NM_001003674chr18106838 6150 6133 5996 5616 5176 4561 2745 1937 787 1203 16964 --
NM_001003675chr18106838 6150 6133 5996 5616 5176 4561 2745 1937 787 1203 16964 --
NM_001003679chr141827 468 247 213 ------
NM_001003688chr42434 377 11066 ----
NM_001003712chr1253341 1097 627 617 432 ------
NM_001003760chr662771 2577 2370 1290 981 397 ------
NM_001003792chr33979 163 79 1198 ----
NM_001003793chr33979 163 79 1198 ----
NM_001004303chr11586 ------
NM_001004303chr11586 ------
NM_001004317chr673668 3582 3437 3161 2828 254 45 --13210 --
NM_001005266chr152752 36 1654 ----
NM_001005267chr152752 36 1654 ----
NM_001005268chr152752 36 1654 ----
NM_001005269chr152752 36 1654 ----
NM_001005366chr121983 ------
NM_001005375chrY3621 417 149 1457 168 --
NM_001005386chr21128 --11675 --
NM_001005404chr1764528 3651 3317 1607 1409 889 --11437 --
NM_001005463chr1062308 2284 1630 990 813 295 ------
NM_001005473chr5116621 6562 5669 5339 5042 4631 4014 1405 1393 1181 98 15955 --11307
NM_001005474chr321390 1302 ------
NM_001005505chr321559 138 1443 ----
NM_001005609chrX52923 2807 2563 1536 897 --33806 1185 654 --
NM_001005782chr21399 ------
NM_001006600chr552458 2386 2136 2015 1990 ------
NM_001006610chr161988 --1324 --
NM_001006612chrX2451 177 ------
NM_001006613chrX2451 177 ------
NM_001006614chrX2451 177 ------
NM_001006623chr232507 2383 23 12552 ----
NM_001006656chr1951713 1706 1623 520 80 --21393 121 --
NM_001006945chr1------1276
NM_001007024chr1774299 3037 2916 2895 642 335 51 24067 3279 --13508
NM_001007025chr1774299 3037 2916 2895 642 335 51 24067 3279 --13508
NM_001007075chr431024 1001 962 --1886 --
NM_001007097chr954557 4117 3626 1825 1285 23423 1221 1918 25116 653
NM_001007099chr12775 247 --1686 --
NM_001007100chr12775 247 --1686 --
NM_001007102chr641587 452 262 94 --11388 --
NM_001007157chr7----131 --
NM_001007214chr13712 403 276 ------
NM_001007257chr11387 ------
NM_001007794chr12721 510 ------
NM_001008239chr1872811 2690 2659 1106 1096 577 555 13342 23816 3121 --
NM_001008391chr113291 118 99 ------
NM_001008405chr771746 1631 1544 1506 1224 126 80 --11448 21577 1554
NM_001008408chr7105848 5803 5776 4856 1499 1044 737 436 247 97 1309 34424 2184 1758 --
NM_001008495chr842000 1534 347 50 --1238 --
NM_001008529chr1731255 975 149 ----1832
NM_001008540chr21146 ------
NM_001008541chr1021793 337 12047 --1874
NM_001008541chr1021793 337 12047 --1874
NM_001008564chr133873 108 55 1587 ----
NM_001008660chr1121366 517 11387 ----
NM_001008801chr1941485 798 547 193 11405 ----
NM_001008895chr1341219 1183 906 302 --1331 --
NM_001008897chr61208 ------
NM_001008925chr453184 2564 2432 740 728 ----12284
NM_001008938chr112455 377 --1472 --
NM_001009552chr81229 ------
NM_001009899chr365860 4584 2022 1656 1353 684 --36449 2118 559 --
NM_001009909chr1153597 2929 2730 727 254 1845 ----
NM_001009959chr222234 1632 1173 22650 421 12262
NM_001010853chr622881 2318 ------
NM_001010861chr1194 --174 --
NM_001010867chr1146515 6358 5165 4722 2573 2470 2006 1905 1688 1478 1286 1061 510 420 ------
NM_001010888chrX84439 4340 4111 4077 3181 1675 1259 337 11371 24025 3445 --
NM_001010908chr10--135 ----
NM_001010942chr122223 158 ----136
NM_001010984chr172603 2004 1772 1751 1683 1661 85 ------
NM_001010989chr161574 ------
NM_001010990chr161574 ------
NM_001011513chr443843 3615 1594 969 23181 602 --1151
NM_001011515chr4----11012 --
NM_001011516chr4----11012 --
NM_001011537chr332178 847 725 11777 22272 1834 --
NM_001011708chr21575 22700 2207 ----
NM_001011713chr141371 --21540 272 --
NM_001011885chr1531500 543 507 1286 ----
NM_001012393chr1163581 3341 1489 1285 346 253 --1651 14215
NM_001012398chr161837 ------
NM_001012420chr1532816 2289 268 ------
NM_001012423chr1542816 2289 268 145 ------
NM_001012751chr1041930 633 575 566 ------
NM_001012755chrX34664 4345 701 --13556 --
NM_001013031chr1043320 3176 2822 956 1434 --12697
NM_001013398chr721483 140 1230 21448 1281 --
NM_001013399chr62432 148 1908 ----
NM_001013406chr721364 547 ------
NM_001013415chr4--11464 1987 --
NM_001013620chr12117866 7236 7057 6430 5256 2848 2741 2381 828 814 304 27351 2104 28456 1142 --
NM_001013843chr151295 ------
NM_001014446chr4127 ------
NM_001014794chr111249 ------
NM_001014795chr111249 ------
NM_001014797chr1097049 6827 5080 2834 1640 1539 1495 1064 1036 17281 37061 5284 1088 15366
NM_001015045chr421911 1748 1812 11636 --
NM_001015048chr1432690 536 324 22979 2913 --1908
NM_001015049chr1432690 536 324 22979 2913 --1908
NM_001015508chr82689 574 ------
NM_001015877chrX63061 1206 898 872 712 213 1185 1340 --
NM_001015881chrX7999 808 356 346 333 191 63 1316 ----
NM_001017395chr352341 1350 993 193 85 1981 --13108
NM_001017424chr111370 --11933 --
NM_001017425chr111370 --11933 --
NM_001017922chr131556 1124 591 11368 11744 --
NM_001017923chr141391 ------
NM_001017930chrX31330 1218 975 163 ----
NM_001017962chr102909 856 ------
NM_001017979chr41595 ------
NM_001018053chr151749 1210 601 443 267 ------
NM_001018057chr1151258 350 236 192 116 ------
NM_001018064chr91402 ------
NM_001018067chr174249 4219 3992 3974 3636 3244 1345 ----13256
NM_001018068chr174249 4219 3992 3974 3636 3244 1345 ----13256
NM_001018069chr174249 4219 3992 3974 3636 3244 1345 ----13256
NM_001018074chr553127 2436 1017 463 71 --22816 327 --
NM_001018075chr553127 2436 1017 463 71 --22816 327 --
NM_001018076chr553127 2436 1017 463 71 --22816 327 --
NM_001018077chr553127 2436 1017 463 71 --22816 327 --
NM_001018090chr1572693 2161 2123 1089 749 181 144 1247 12314 --
NM_001018091chr1572803 2271 2233 859 291 254 50 1357 12424 --
NM_001018102chr1572693 2161 2123 1089 749 181 144 1247 12314 --
NM_001018111chr783873 3660 3107 3061 2868 2574 752 549 13919 23796 772 --
NM_001020658chr141345 621 608 424 195 --1496
NM_001020658chr141345 621 608 424 195 --1496
NM_001020825chr5----1291 --
NM_001023567chr1532208 268 145 ------
NM_001024094chr553127 2436 1017 463 71 --22816 327 --
NM_001024460chr6--1261 1314 1974
NM_001024649chr521145 145 12447 21999 433 --
NM_001024808chr121120 ------
NM_001024847chr342420 2336 1926 1554 ------
NM_001024947chr521055 811 ------
NM_001024948chr143203 2997 2411 1245 --1248 1439
NM_001024956chr1131949 1065 270 --11779 --
NM_001025072chr332206 606 290 --1467 1905
NM_001025073chr332206 606 290 --1467 1905
NM_001025076chr10156181 5073 4754 4654 4470 4290 3816 1497 1423 965 851 823 547 500 110 2474 190 21231 511 --
NM_001025077chr10177539 6431 6112 6012 5828 5648 5174 5044 2855 2781 2323 2209 2181 1905 1858 1468 175 21832 1548 22589 1869 14905
NM_001025079chr354184 3088 1642 997 163 ------
NM_001025108chr263693 2744 1294 944 833 594 23169 1520 ----
NM_001025233chr1242031 1834 805 277 --12132 --
NM_001025252chr843190 2402 850 139 22507 345 1457 --
NM_001025253chr843190 2402 850 139 22507 345 1457 --
NM_001025356chr1242716 1148 1097 107 --12918 11878
NM_001025580chrX64244 3579 2994 2953 1709 497 14146 13337 --
NM_001025595chr411093 1274 ----
NM_001029835chr71375 ------
NM_001029858chr632335 1217 502 --22419 1126 --
NM_001029863chr672835 2361 2238 2056 680 384 58 --1529 --
NM_001029874chr121347 ----1309
NM_001029875chr572485 2343 2268 2004 1893 932 413 ------
NM_001029882chr1----1653 --
NM_001029882chr1----1653 --
NM_001029884chr682641 2527 2376 1855 1803 1713 973 264 1520 12754 --
NM_001030007chr1663920 3390 2927 2888 1251 324 23203 1292 ----
NM_001030055chr1444482 4433 3975 3607 11441 13623 --
NM_001031623chr631354 427 66 ------
NM_001031679chr1252571 2491 1374 551 544 ----1499
NM_001031684chr241499 1334 1324 361 21348 191 ----
NM_001031710chr74931 110 82 70 --1386 --
NM_001031716chr25994 957 334 317 178 1868 ----
NM_001031723chr4----159 --
NM_001031732chr433488 2374 1023 13441 ----
NM_001031803chr171306 ------
NM_001031804chr1684120 3578 3245 1641 856 624 220 126 --11567 --
NM_001031812chr532175 1595 211 ------
NM_001032280chr641723 1090 597 161 --1316 --
NM_001032282chr821256 445 --184 --
NM_001032288chr2051554 1161 1110 532 267 ----11473
NM_001032363chr11793 --21499 157 1756
NM_001032363chr11793 --21499 157 1756
NM_001032367chr153425 253 151 ------
NM_001032393chrX1193 --1668 --
NM_001032394chr62865 130 ------
NM_001032999chr2075347 1830 1797 1758 1387 793 693 11681 ----
NM_001033045chr263935 3850 3537 1303 814 164 --11547 --
NM_001033057chr362120 655 618 484 451 392 --12093 --
NM_001033059chr642074 1985 1686 542 21944 1708 11822 --
NM_001033088chr15----1320 --
NM_001033551chr1733950 1363 1079 --13856 --
NM_001033557chr22376 247 ------
NM_001033578chr842232 1991 309 39 ------
NM_001033602chr1332686 823 696 --1987 1200
NM_001033925chr1062082 1680 1405 774 577 184 11805 ----
NM_001034837chr51239 ------
NM_001034838chr51239 ------
NM_001034841chr1685309 4049 3833 3516 1910 1344 1218 416 ------
NM_001034845chr411374 1937 --1887
NM_001034915chr82351 344 --1108 --
NM_001035507chr2158 ------
NM_001037131chr21484 ------
NM_001037163chr72804 698 --173 --
NM_001037164chr742013 1897 770 520 2291 48 ----
NM_001037165chr798917 8838 8220 7598 7560 7004 5698 2396 573 28778 7865 28100 6357 --
NM_001037317chr1194 --174 --
NM_001037339chr141667 1196 308 132 ------
NM_001037340chr141667 1196 308 132 ------
NM_001037341chr141667 1196 308 132 ------
NM_001037341chr141667 1196 308 132 ------
NM_001037954chr112103 95 12879 ----
NM_001038493chr221563 1489 ------
NM_001039199chr2064963 4901 3967 677 458 239 35036 4295 3541 23444 659 13091
NM_001039348chr21848 --1182 --
NM_001039349chr21848 --1182 --
NM_001039538chr262299 2256 1175 1085 1028 474 21284 439 ----
NM_001039618chr1175635 5210 4658 4600 3664 617 361 ----14553
NM_001039709chr2075347 1830 1797 1758 1387 793 693 11681 ----
NM_001039802chr11870 ------
NM_001039840chrX--11082 24316 671 14191
NM_001039916chr12----1362 --
NM_001039917chr12----1362 --
NM_001039918chr12----1362 --
NM_001039919chr12----1362 --
NM_001039920chr12----1362 --
NM_001039937chr1313675 ------
NM_001040033chr12717 570 ------
NM_001040057chr711226 --11184 --
NM_001040101chr421217 1099 11081 ----
NM_001040110chr751560 1383 679 109 87 11781 ----
NM_001040135chr71537 ----1652
NM_001040147chr181700 ------
NM_001040152chr784604 4562 4309 4190 4159 3793 1431 801 14236 44327 3784 3570 1457 --
NM_001040153chr131244 ------
NM_001040159chr42272 249 ------
NM_001040214chr632063 1555 1532 1404 ----
NM_001040284chr1685382 5320 5150 4748 4731 2329 2126 1948 34925 1448 616 ----
NM_001040402chr442859 2832 2558 201 ------
NM_001040440chr52475 145 ------
NM_001040441chr164834 2161 2050 1612 727 81 21709 854 24277 3684 11219
NM_001040446chr592711 2592 2575 1888 1797 1704 840 681 399 --12534 --
NM_001040633chr741011 770 268 46 --1711 --
NM_001040712chr952782 2729 2356 2332 56 --23552 3150 --
NM_001040876chr431852 1237 266 ------
NM_001041chr3153 ------
NM_001042355chr1685081 4870 4255 3965 3507 452 322 233 1489 --1940
NM_001042410chr2----1198 --
NM_001042412chr1685081 4870 4255 3965 3507 452 322 233 1489 --1940
NM_001042413chr984107 3042 2848 2707 2568 1567 1217 342 11255 1676 --
NM_001042414chr131116 ------
NM_001042425chr641723 1090 597 161 --1316 --
NM_001042473chr1052021 1973 578 131 90 12036 ----
NM_001042492chr1733059 2503 445 12322 ----
NM_001042494chr1563870 3288 3155 2387 813 233 ----13381
NM_001042495chr1563870 3288 3155 2387 813 233 ----13381
NM_001042496chr1563870 3288 3155 2387 813 233 ----13381
NM_001042497chr1563870 3288 3155 2387 813 233 ----13381
NM_001042510chr851752 1702 1638 1527 1416 ------
NM_001042511chr851752 1702 1638 1527 1416 ------
NM_001042517chr131903 ------
NM_001042533chr363298 2521 1142 609 235 91 33361 2105 1224 11189 12086
NM_001042537chrX3941 865 188 22127 1759 ----
NM_001042552chr131025 904 476 21119 936 ----
NM_001042555chr12104339 1641 1448 1430 1379 1020 966 920 774 40 ----24745 1585
NM_001042599chr2126955 5991 5197 5157 3093 3027 2545 2300 1876 1685 1082 465 14823 ----
NM_001042601chr332891 2797 84 12991 --12218
NM_001042604chr394132 3908 3872 3327 3117 2951 1498 988 205 ------
NM_001042616chr43584 498 86 ------
NM_001042681chr132557 2331 1901 11719 12202 --
NM_001042682chr132557 2331 1901 11719 12202 --
NM_001042682chr132557 2331 1901 11719 12202 --
NM_001042683chr62748 74 ------
NM_001042728chr122952 143 ------
NM_001042749chrX----1715 --
NM_001042750chrX----1715 --
NM_001042751chrX----1715 --
NM_001043351chr132243 1419 595 ------
NM_001044385chr263802 3213 2859 2840 2804 1129 --23103 443 --
NM_001044722chr532175 1595 211 ------
NM_001044723chr532175 1595 211 ------
NM_001046chr522314 1172 --1237 12914
NM_001066chr1--11860 12150 --
NM_001083620chr431891 894 411 ------
NM_001100108chr1107947 7162 7075 6739 6554 5955 5292 3265 1946 713 27886 6129 ----
NM_001106chr399771 8977 8720 8636 7888 6320 2709 1563 1090 --39028 1685 1593 29624 807
NM_001113490chrX33415 2625 390 ------
NM_001117chr1852250 2051 1828 1736 556 --1972 --
NM_001123chr10--1212 ----
NM_001126chr11356 ----1111
NM_001128chr1663920 3390 2927 2888 1251 324 23203 1292 ----
NM_001144chr1621257 1230 ------
NM_001149chr10131 ------
NM_001160chr1262639 1044 599 547 512 218 12481 ----
NM_001167chrX105378 4472 2586 2322 2294 2263 1878 1620 1434 1376 34822 4630 684 16370 11720
NM_001173chr1444482 4433 3975 3607 11441 13623 --
NM_001174chrX149 12137 ----
NM_001186chr2172783 2556 2435 2373 2020 391 46 1425 1670 --
NM_001187chr21----1497 --
NM_001198chr61411 ------
NM_001204chr295335 5192 5178 4736 2759 2646 2243 341 204 25470 5462 ----
NM_001206chr952920 2912 2155 2039 522 1694 ----
NM_001219chr722249 1851 ------
NM_001237chr441000 912 862 316 ------
NM_001237chr441000 912 862 316 ------
NM_001256chr1772943 2778 2750 2290 1994 1181 77 12320 12743 --
NM_001275chr141268 ------
NM_001329chr1041351 646 417 243 ------
NM_001332chr521133 96 ------
NM_001346chr342558 2416 1765 356 ------
NM_001356chrX42299 1855 823 226 ----1833
NM_001357chr11220 ------
NM_001363chrX2713 327 ------
NM_001364chr1154385 1820 1466 1078 762 --14161 1905
NM_001379chr191214 ------
NM_001391chr1841115 951 262 75 ------
NM_001396chr2132463 1767 21 --22737 599 1806
NM_001399chrX52923 2807 2563 1536 897 --33806 1185 654 --
NM_001419chr1944672 3200 1963 206 ----14268
NM_001432chr483442 3267 1406 1293 1022 584 563 270 12495 --13664
NM_001438chr173038 3007 2997 2236 1171 849 553 --12686 --
NM_001452chr61690 ------
NM_001453chr621647 323 ------
NM_001482chr151784 ------
NM_001494chr10----1503 --
NM_001495chr821113 167 ------
NM_001498chr611062 --11095 --
NM_001514chr1--1472 ----
NM_001530chr141797 ------
NM_001546chr611144 ------
NM_001553chr4278 23 ------
NM_001616chr222757 2713 ----12443
NM_001620chr111585 ------
NM_001621chr732507 2462 45 ----12630
NM_001621chr732507 2462 45 ----12630
NM_001634chr642074 1985 1686 542 21944 1708 11822 --
NM_001650chr1842790 2762 581 307 --13358 --
NM_001655chr1192059 1870 1549 1507 1354 723 709 457 378 --11972 --
NM_001656chr551937 1498 1377 269 28 ------
NM_001660chr3172 ------
NM_001663chr1432678 2638 136 1348 1471 --
NM_001668chr111540 ----1464
NM_001681chr121715 --1248 --
NM_001683chr32720 466 --11721 --
NM_001688chr12237 74 1705 1131 --
NM_001690chr342445 2290 2028 159 ----12165
NM_001695chr8113751 3065 2894 1627 1487 1231 1054 806 766 276 144 1915 2849 211 --
NM_001704chr61413 ------
NM_001706chr33851 802 325 ------
NM_001707chr71857 ------
NM_001714chr12139 2542 531 ----
NM_001729chr42318 144 ----1382
NM_001730chr1321330 590 ------
NM_001730chr1321330 590 ------
NM_001735chr92396 30 ------
NM_001746chr521145 145 12447 21999 433 --
NM_001754chr211639 14317 ----
NM_001755chr1651604 893 826 634 272 ----11526
NM_001759chr1265214 4800 1879 1674 1075 839 ----14251
NM_001777chr354184 3088 1642 997 163 ------
NM_001791chr11870 ------
NM_001796chr161103 ------
NM_001797chr162277 118 ------
NM_001798chr1221127 193 ------
NM_001799chr51100 ------
NM_001800chr191122 ------
NM_001806chr1942915 2466 2174 566 1875 ----
NM_001826chr11462 1298 ----
NM_001827chr9----1265 --
NM_001829chr44854 767 699 42 ------
NM_001854chr131540 1488 79 ------
NM_001856chr1--1329 ----
NM_001858chr684781 4621 4396 3356 3182 3134 1711 391 ------
NM_001859chr953299 3116 2770 1572 598 33640 1595 1128 13868 --
NM_001885chr11141 ------
NM_001894chr221140 ------
NM_001904chr33691 38 23 ------
NM_001924chr13456 347 44 ------
NM_001935chr2------1208
NM_001938chr151663 1463 720 306 142 --1728 --
NM_001946chr1231126 748 463 1800 ----
NM_001951chr82588 520 ------
NM_001957chr412324 31537 687 559 ----
NM_001969chr1483818 3672 2525 2505 976 507 207 147 12679 12804 11226
NM_001977chr431646 534 397 ------
NM_001981chr132213 2146 840 --2754 399 --
NM_001994chr11186 ------
NM_001999chr541452 1183 338 48 --11499 --
NM_002006chr445823 4346 954 102 ------
NM_002009chr1552481 1085 1056 958 800 ------
NM_002015chr13123373 2984 2965 2749 2438 2333 1318 1174 827 667 409 329 ------
NM_002017chr111505 1221 ----
NM_002024chrX52210 2020 1498 1398 409 ----21779 770
NM_002025chrX77607 7175 5748 3011 2691 810 707 36362 3471 2923 32931 2405 878 --
NM_002031chr61608 ----1776
NM_002033chr1174016 3844 3228 3170 2546 1104 920 13128 ----
NM_002040chr2142611 2568 361 30 1114 12816 --
NM_002051chr1021125 362 ----1411
NM_002054chr21176 ------
NM_002061chr131916 1576 145 21302 1194 ----
NM_002087chr17----1295 --
NM_002106chr41139 ------
NM_002107chr1----1500 --
NM_002126chr1793980 3799 3458 3162 2724 1615 896 641 44 ------
NM_002130chr551721 1319 1076 208 169 11089 --11116
NM_002137chr762208 1951 1808 784 387 344 11742 ----
NM_002139chrX----1670 --
NM_002140chr92884 51 ------
NM_002158chr273784 3297 2931 2748 1241 764 566 13267 ----
NM_002166chr21590 ------
NM_002184chr51142 ------
NM_002203chr554086 3898 3768 3180 151 --11386 --
NM_002211chr103999 922 401 ------
NM_002214chr755622 5102 3683 1962 688 11943 ----
NM_002222chr3--11357 11232 --
NM_002226chr141233 ------
NM_002241chr143038 2612 2335 456 --32906 2397 367 1897
NM_002242chr222029 315 --1197 --
NM_002247chr1021614 343 ------
NM_002267chr1332320 914 586 ------
NM_002268chr331834 1656 1184 ------
NM_002270chr585493 3776 2204 1924 1748 982 488 474 13896 --12041
NM_002285chr263693 2744 1294 944 833 594 23169 1520 ----
NM_002293chr162345 2321 2211 1968 939 641 --21876 415 --
NM_002310chr576015 5944 4205 4181 2009 1059 432 26282 5427 12324 --
NM_002313chr1054375 3791 1780 1552 457 --2750 134 13755
NM_002314chr71932 ------
NM_002336chr1264265 3747 1904 1246 669 251 --1224 24666 3110
NM_002355chr122353 126 1540 ----
NM_002356chr632878 2653 567 --22510 854 --
NM_002358chr41645 --1677 --
NM_002374chr262299 2256 1175 1085 1028 474 21284 439 ----
NM_002387chr5104970 4050 3801 3483 3297 3127 1441 1414 1218 310 --14931 13958
NM_002398chr231462 1437 1290 ------
NM_002399chr15----142 --
NM_002408chr143787 741 617 1843 ----
NM_002442chr1211123 ------
NM_002449chr5----11300 --
NM_002465chr12----1270 --
NM_002469chr121505 ------
NM_002480chr1221015 525 --2482 79 --
NM_002481chr177299 3117 2851 2539 1340 419 205 --37925 6383 1522 15595
NM_002486chr952025 963 786 702 255 ------
NM_002487chr153724 302 118 ------
NM_002500chr21245 ------
NM_002501chr1923799 2852 ------
NM_002515chr1461976 1327 580 486 432 87 ------
NM_002519chr111167 1536 ----
NM_002526chr651685 683 515 363 239 ------
NM_002539chr2132 ------
NM_002543chr1221200 33 ------
NM_002545chr1163581 3341 1489 1285 346 253 --1651 14215
NM_002546chr81802 --1568 --
NM_002556chr1122051 633 --1105 --
NM_002581chr994693 4238 1746 1695 1023 926 589 179 128 ----1222
NM_002588chr531736 1216 567 ------
NM_002591chr202642 249 ------
NM_002594chr2032209 1707 768 ------
NM_002600chr141667 1196 308 132 ------
NM_002613chr1675124 4981 3956 3817 3395 1905 1101 1992 11404 --
NM_002628chr31856 ------
NM_002641chrX21857 391 ------
NM_002645chr1132823 2515 1060 ------
NM_002646chr141954 1417 259 252 ------
NM_002655chr854906 1526 1390 1305 193 --24120 416 --
NM_002660chr202763 421 ------
NM_002670chr331002 651 477 ------
NM_002687chr141827 --1326 --
NM_002699chr1----11148 --
NM_002709chr223570 1266 1648 ----
NM_002717chr81581 ------
NM_002720chr161211 ------
NM_002721chr93397 389 183 ------
NM_002731chr142695 2609 821 127 ------
NM_002734chr1722016 844 12227 --1708
NM_002737chr1766670 6611 6292 5886 1700 1400 ------
NM_002738chr161160 ------
NM_002740chr322827 1826 1669 --11867
NM_002742chr141514 ------
NM_002748chr152962 405 11044 ----
NM_002753chr41751 ------
NM_002758chr171371 ------
NM_002775chr101160 1522 ----
NM_002798chr17----163 --
NM_002814chrX4647 285 120 103 ------
NM_002825chr71266 ------
NM_002827chr2011640 ------
NM_002828chr182967 748 ----1637
NM_002837chr1243071 1621 1315 1195 --11418 --
NM_002839chr952782 2729 2356 2332 56 --23552 3150 --
NM_002841chr32222 123 --1540 --
NM_002843chr1143203 3171 2501 401 ----11273
NM_002844chr621430 1333 ------
NM_002851chr72732 568 ------
NM_002857chr132295 892 184 --32377 490 103 12205
NM_002874chr932155 783 250 --12395 --
NM_002886chr3125051 4699 4207 3406 3237 3188 2077 1856 923 801 471 328 --13876 --
NM_002890chr51345 1721 ----
NM_002892chr143689 603 31 ------
NM_002906chr111822 22085 116 ----
NM_002924chr11439 ------
NM_002938chr431981 1764 282 21547 168 1333 --
NM_002940chr431852 1237 266 ------
NM_002956chr1211029 11150 ----
NM_002971chr32816 450 ------
NM_002973chr122588 423 ----1476
NM_002977chr253398 2978 2638 2331 77 ------
NM_002979chr12775 247 --1686 --
NM_002994chr461460 625 273 65 54 31 ------
NM_002999chr20--11194 1780 --
NM_003017chr641242 562 551 75 ------
NM_003030chr341682 1500 320 278 --11712 --
NM_003031chr161988 --1324 --
NM_003034chr1258092 1450 1339 700 94 16289 1759 47649 7499 7182 4962
NM_003048chr262687 2527 2387 1135 1074 658 --11027 --
NM_003051chr121896 290 --11927 --
NM_003060chr521313 380 1458 ----
NM_003068chr831010 392 216 ------
NM_003070chr91643 ------
NM_003071chr331876 712 45 129 11807 --
NM_003072chr191307 ------
NM_003074chr342240 1981 906 882 ----1569
NM_003090chr152152 45 ------
NM_003099chr15125310 5292 5043 4980 2273 2051 1442 1113 821 801 513 492 --26511 451 1897
NM_003106chr341066 999 732 404 11089 1395 --
NM_003107chr632003 443 337 --12342 --
NM_003108chr267020 6900 6600 6273 1416 315 --21551 474 16867
NM_003112chr7113229 3067 2729 2627 2605 2099 2067 2001 1984 503 325 ------
NM_003115chr1195 --1398 --
NM_003128chr2------1199
NM_003133chr1--1792 ----
NM_003144chr652132 1991 1393 291 136 --11696 --
NM_003149chr31350 11306 11495 --
NM_003151chr2147 ------
NM_003155chr822516 723 --12144 --
NM_003174chr10----1732 --
NM_003182chr71470 ------
NM_003182chr71470 ------
NM_003185chr2011301 ------
NM_003194chr6164 ------
NM_003199chr1843576 2036 1514 1008 --14122 2378 124
NM_003201chr104848 839 289 56 --11053 --
NM_003206chr61415 ------
NM_003211chr1241224 458 169 72 --11096 21743 315
NM_003217chr124795 569 187 180 11467 ----
NM_003220chr641723 1090 597 161 --1316 --
NM_003221chr654037 3280 2995 1605 1254 --13977 --
NM_003222chr203900 304 105 ------
NM_003234chr342303 1804 787 42 ----21895 546
NM_003236chr231167 775 21 ----12168
NM_003242chr342420 2336 1926 1554 ------
NM_003247chr61230 --21490 1372 --
NM_003257chr151107 11221 1342 --
NM_003259chr191151 ------
NM_003262chr344432 3306 1193 239 24198 1161 15090 1852
NM_003269chr61495 --1377 --
NM_003270chrX2932 808 ------
NM_003275chr91192 ------
NM_003291chr13139 ------
NM_003311chr111250 ------
NM_003317chr142763 598 ------
NM_003318chr61300 ------
NM_003319chr23306 277 239 ------
NM_003336chrX1139 ------
NM_003337chr53548 476 373 ------
NM_003338chr1021973 1420 ------
NM_003349chr2051554 1161 1110 532 267 ----11473
NM_003350chr81645 1960 ----
NM_003352chr21399 ------
NM_003362chr1241024 924 839 338 --11014 --
NM_003371chr921775 1612 --21688 63 --
NM_003379chr62731 86 ----1293
NM_003390chr116973 859 834 280 197 77 ------
NM_003392chr393859 3635 3584 3519 3013 1586 1577 1414 478 14194 ----
NM_003400chr21208 ------
NM_003405chr221599 ------
NM_003409chr18--11351 ----
NM_003410chrX4539 469 267 193 ------
NM_003412chr322341 684 ----12583
NM_003418chr32197 185 ------
NM_003423chr1962155 2002 748 637 582 253 ------
NM_003430chr1921129 481 ------
NM_003432chr51388 2503 65 ----
NM_003442chr117874 737 313 303 281 93 37 ------
NM_003453chr13186 ------
NM_003458chr363900 3172 1532 1342 465 428 33323 2944 891 22762 1109 --
NM_003463chr643071 2397 578 90 12180 ----
NM_003467chr21146 ------
NM_003471chr33943 598 528 11682 --12036
NM_003472chr631160 615 165 ------
NM_003477chr111498 ------
NM_003478chr1182976 2795 2735 2367 2326 2190 2061 1002 --22336 69 --
NM_003482chr1222741 2142 --12765 --
NM_003483chr121313 --12988 --
NM_003489chr211401 --12925 1676
NM_003498chr1622528 2191 22289 905 22696 1946 --
NM_003505chr741885 1833 1541 344 ------
NM_003558chr92464 63 --1501 --
NM_003559chr1773636 3417 3207 3012 2441 2402 1237 12449 --13915
NM_003566chr1262710 2456 946 880 245 71 ------
NM_003567chr1139 ------
NM_003569chr62464 248 ----1678
NM_003574chr18105801 4986 4909 4362 2309 2181 2028 1001 814 321 24952 2080 43809 1823 1437 1094 --
NM_003580chr82525 105 ------
NM_003583chr1231319 843 195 12487 ----
NM_003589chr1341219 1183 906 302 --1331 --
NM_003590chr243614 1355 666 349 ------
NM_003592chr71480 --1190 1358
NM_003597chr261851 1628 790 466 296 206 22210 1515 ----
NM_003607chr163200 2970 1641 1583 1160 361 ------
NM_003615chr394032 3410 3384 2994 2886 1306 732 432 138 --22611 1606 --
NM_003630chr62127 86 ------
NM_003658chr11----1559 --
NM_003659chr231041 147 47 --1129 11147
NM_003663chr333416 2374 974 ------
NM_003670chr361063 399 386 367 360 68 ------
NM_003671chr973352 2821 2243 1414 1100 297 174 33531 2253 155 ----
NM_003672chr141986 1322 626 532 ------
NM_003673chr171101 ------
NM_003676chr11644 ------
NM_003710chr153425 253 151 ------
NM_003713chr12481 431 --1518 --
NM_003718chr7----1348 --
NM_003722chr362590 2414 2003 1941 1105 1052 ------
NM_003735chr531736 1216 567 ------
NM_003736chr531736 1216 567 ------
NM_003743chr231934 669 158 ------
NM_003758chr151409 1546 ----
NM_003758chr151409 1546 ----
NM_003759chr434055 3282 2637 --11448 --
NM_003760chr12836 59 ------
NM_003763chr201670 ------
NM_003772chr1121018 903 ------
NM_003777chr71556 ------
NM_003778chr31747 ------
NM_003783chr141220 995 276 88 --11074 --
NM_003784chr181700 ------
NM_003787chr1821653 30 11367 ----
NM_003794chr31681 ------
NM_003800chr652248 2008 1527 578 555 11796 ----
NM_003812chr2----188 --
NM_003816chr821189 239 ------
NM_003821chr81485 ----1180
NM_003822chr132838 2007 893 --21226 931 --
NM_003825chr15181 ----11178
NM_003829chr91135 ------
NM_003860chr112346 45 ------
NM_003884chr331544 1290 493 --11630 --
NM_003887chr222295 2006 ------
NM_003893chr101491 ------
NM_003914chr131159 ------
NM_003916chrX31425 983 246 --11291 --
NM_003929chr15610 578 498 49 40 --21467 1088 --
NM_003939chr1043360 2612 959 171 13173 33038 3003 1453 12581
NM_003941chr732147 1803 219 ------
NM_003947chr341131 872 410 249 --1360 --
NM_003948chr422179 1956 ------
NM_003966chr5107814 6534 2185 2064 2047 1872 1112 839 325 233 --27318 96 --
NM_003971chr17197 ------
NM_003972chr1021104 74 ------
NM_003983chr1673791 3481 3402 3103 3050 693 396 13955 24160 835 --
NM_003994chr1264197 3061 2959 2933 1194 771 23743 594 ----
NM_004006chrX32331 2239 2225 --1233 --
NM_004007chrX32331 2239 2225 --1233 --
NM_004009chrX32331 2239 2225 --1233 --
NM_004010chrX32331 2239 2225 --1233 --
NM_004011chrX32331 2239 2225 --1233 --
NM_004012chrX32331 2239 2225 --1233 --
NM_004013chrX32331 2239 2225 --1233 --
NM_004014chrX32331 2239 2225 --1233 --
NM_004015chrX32331 2239 2225 --1233 --
NM_004016chrX32245 2153 2139 --1147 --
NM_004017chrX32331 2239 2225 --1233 --
NM_004018chrX32245 2153 2139 --1147 --
NM_004020chrX32331 2239 2225 --1233 --
NM_004021chrX32245 2153 2139 --1147 --
NM_004022chrX32245 2153 2139 --1147 --
NM_004023chrX32245 2153 2139 --1147 --
NM_004028chr1842790 2762 581 307 --13358 --
NM_004056chr811090 --124 --
NM_004081chrY3621 417 149 1457 168 --
NM_004089chrX7999 808 356 346 333 191 63 1316 ----
NM_004094chr1472269 2142 1851 1216 1064 992 76 ------
NM_004098chr1011118 ------
NM_004100chr632256 1781 989 12678 22298 621 --
NM_004105chr21848 --1182 --
NM_004109chr1122359 2064 --1618 1653
NM_004124chr1442613 1267 549 105 13088 ----
NM_004126chr72287 43 ------
NM_004128chr132536 160 ------
NM_004132chr1011112 ------
NM_004136chr1562967 2637 2260 1250 725 524 ------
NM_004156chr81229 ------
NM_004161chr21418 ------
NM_004162chr31123 ------
NM_004171chr11129508 9008 8946 7629 7144 6798 2982 2634 2599 1961 1333 797 39357 8547 2611 28324 3068 --
NM_004175chr22----1212 --
NM_004193chr101428 ------
NM_004202chrY--1110 ----
NM_004229chrX32256 2095 1674 --1380 --
NM_004232chr1893337 3195 2594 1546 1282 1007 681 204 137 12366 ----
NM_004235chr94871 839 652 203 ------
NM_004237chr52917 328 ------
NM_004238chr21263 ------
NM_004255chr15--1170 ----
NM_004261chr13936 743 283 ------
NM_004268chr115829 819 423 192 29 ------
NM_004272chr541909 1436 1322 788 ------
NM_004274chr1453185 2559 2457 2040 728 --12395 --
NM_004279chr731881 888 517 --2821 671 --
NM_004291chr5299 77 ------
NM_004316chr1221017 770 ------
NM_004317chr19174 ------
NM_004330chr1521098 813 --11048 --
NM_004331chr822552 476 ----1488
NM_004337chr8134 ------
NM_004338chr18106838 6150 6133 5996 5616 5176 4561 2745 1937 787 1203 16964 --
NM_004342chr762077 2053 1815 1693 1445 325 --11711 11901
NM_004346chr431357 1191 33 ------
NM_004362chr43672 506 85 ------
NM_004365chr51229 ------
NM_004370chr651541 701 631 329 95 2849 37 ----
NM_004374chr8----147 --
NM_004378chr151201 ------
NM_004384chr532175 1595 211 ------
NM_004392chr1342481 1640 165 137 --12239 1300
NM_004397chr1134259 1004 594 ----11371
NM_004407chr43889 663 41 ------
NM_004415chr62765 608 --1664 --
NM_004430chr822807 930 1833 22023 1797 --
NM_004432chr931668 505 484 ------
NM_004443chr31488 --1120 --
NM_004456chr7--196 ----
NM_004457chr23335 296 24 --31477 643 353 --
NM_004458chrX42421 1650 1035 393 1345 22655 998 --
NM_004460chr2165 ------
NM_004480chr141745 ------
NM_004485chr174191 2928 1741 1640 1320 578 308 --1266 --
NM_004494chr111283 ------
NM_004496chr142337 249 --2444 382 --
NM_004501chr183890 3696 3674 3617 2881 2648 1651 498 13423 ----
NM_004504chr231189 597 113 --12215 --
NM_004517chr111249 ------
NM_004521chr101277 ------
NM_004524chr171278 ------
NM_004529chr911460 ------
NM_004535chr203329 320 282 ------
NM_004538chrX3688 263 123 ----1528
NM_004571chr2152785 2130 1207 1053 36 22449 2419 ----
NM_004576chr52372 55 ------
NM_004578chr12831 69 ------
NM_004586chrX55475 5337 5323 3696 2041 11559 13806 --
NM_004591chr21168 ------
NM_004593chr32268 182 1381 ----
NM_004612chr974456 4446 4209 1580 1313 697 522 --11039 13079
NM_004642chr121284 ------
NM_004654chrY3977 386 45 ------
NM_004660chrY42078 1785 507 219 --11897 --
NM_004685chr1352750 2207 883 520 63 --12101 --
NM_004687chr1741619 549 235 66 ------
NM_004707chr5169 --11375 11069
NM_004715chr182648 175 ------
NM_004719chr1242669 2252 2217 719 1685 21942 164 --
NM_004726chrX65573 4754 3864 2297 1727 858 --25701 763 --
NM_004731chr1231602 280 50 ----1705
NM_004740chr17135 ------
NM_004744chr453342 3323 3313 2795 2731 ------
NM_004745chr8106796 6359 5609 4849 4455 2408 1746 1023 867 755 --1988 1666
NM_004748chr1533869 3446 118 13406 1245 --
NM_004774chr1731963 211 56 12476 11053 196
NM_004775chr1832254 1767 1488 ----12187
NM_004779chr53487 212 190 ----1311
NM_004788chr1142526 2351 1060 237 --1542 --
NM_004789chr9----1433 --
NM_004792chr21196 ----148
NM_004798chr2063587 3161 2799 2507 1253 1241 12837 1759 --
NM_004801chr221093 490 ------
NM_004808chr1042980 2867 2272 2247 11172 22504 626 --
NM_004815chr174720 4117 4011 3496 3034 1440 836 ------
NM_004817chr93658 539 209 ------
NM_004824chr621428 1268 11396 1364 --
NM_004831chr191692 ------
NM_004834chr272803 2708 2081 1158 908 896 38 12551 --11071
NM_004835chr31728 1699 ----
NM_004835chr31728 1699 ----
NM_004840chrX72113 1730 845 335 281 111 76 ----11681
NM_004842chr661513 599 418 235 98 61 ------
NM_004850chr241480 1443 1406 680 ------
NM_004857chr1474686 3731 1504 887 613 409 158 14546 23695 357 --
NM_004859chr1722955 933 ------
NM_004863chr14125205 4744 2042 1956 1825 1432 1389 1189 542 521 468 459 1689 1980 --
NM_004865chr6----1443 --
NM_004866chr594833 4698 4676 3763 1744 1531 1505 1342 745 --23203 724 --
NM_004871chr1774299 3037 2916 2895 642 335 51 24067 3279 --13508
NM_004873chr1432690 536 324 22979 2913 --1908
NM_004898chr42779 744 12685 ----
NM_004905chr13791 675 156 ------
NM_004906chr6----1452 --
NM_004912chr721364 547 ------
NM_004921chr162113 1937 1756 1574 930 137 11725 ----
NM_004949chr1861984 1876 851 438 226 107 --1457 11892
NM_004956chr7104164 3434 3061 2881 1684 1492 1484 458 299 158 --13008 --
NM_004966chr103768 260 111 ------
NM_004973chr621765 61 11641 1372 --
NM_004985chr1294151 3643 3397 1763 1311 1120 907 501 166 14012 --11384
NM_004993chr1421500 356 ------
NM_005011chr751560 1383 679 109 87 11781 ----
NM_005012chr11132 ------
NM_005016chr121104 ------
NM_005023chr551498 1118 348 103 55 ----1197
NM_005053chr193584 475 55 ------
NM_005054chr221405 189 --11621 --
NM_005056chr1265311 4964 3997 1729 993 263 23477 2108 190 --
NM_005065chr1455020 3841 1485 750 430 --14359 1450
NM_005066chr13246 140 30 1532 ----
NM_005079chr843190 2402 850 139 22507 345 1457 --
NM_005093chr2075347 1830 1797 1758 1387 793 693 11681 ----
NM_005104chr61596 ------
NM_005121chr1773499 3274 3249 3149 1399 793 456 ------
NM_005125chr111149 ------
NM_005126chr322070 781 ------
NM_005128chr211668 ------
NM_005135chr1563870 3288 3155 2387 813 233 ----13381
NM_005156chr9125311 5177 5154 4941 4644 4225 4063 2151 954 907 880 323 34857 4025 117 --1463
NM_005160chr22126349 5787 5658 4863 4787 4237 2262 1899 1450 841 765 592 --35604 1142 931 --
NM_005164chr1232629 2552 813 ----11962
NM_005171chr122888 521 ------
NM_005188chr11158352 7829 6876 6090 5574 5383 2648 2532 2497 2408 1492 998 944 581 107 17255 18243 --
NM_005190chr62432 148 1908 ----
NM_005192chr141129 ------
NM_005197chr1436176 3949 1163 ------
NM_005201chr31338 ------
NM_005215chr181257 ------
NM_005233chr3----1544 --
NM_005235chr2126955 5991 5197 5157 3093 3027 2545 2300 1876 1685 1082 465 14823 ----
NM_005238chr1133120 2344 931 --2661 424 --
NM_005241chr32466 124 ------
NM_005256chr111620 ------
NM_005257chr182506 481 --21246 1035 --
NM_005259chr23352 337 204 ------
NM_005277chr431816 1737 767 ------
NM_005295chr71197 ------
NM_005302chr72175 59 ------
NM_005316chr111445 ------
NM_005324chr1731905 589 434 --11596 1380
NM_005329chr1622344 849 --1672 --
NM_005339chr464031 3780 3711 3066 2841 317 13789 --11225
NM_005342chrX22836 404 --11062 --
NM_005359chr1875183 2406 2104 1920 1765 1731 1023 34892 4533 4240 26497 1907 --
NM_005376chr151072 1027 329 220 62 ------
NM_005378chr22665 299 ------
NM_005381chr21293 ------
NM_005382chr81418 ------
NM_005385chr381913 1080 971 717 596 442 297 74 --12765 --
NM_005392chr971876 1854 1789 1666 1623 721 546 ----1253
NM_005397chr783873 3660 3107 3061 2868 2574 752 549 13919 23796 772 --
NM_005399chr173757 3703 3130 863 822 700 655 --23191 3056 --
NM_005400chr253107 2538 2438 1900 82 22603 756 22383 634 --
NM_005406chr182467 441 --1647 --
NM_005418chr112463 285 ------
NM_005430chr121720 ------
NM_005433chr1831039 482 456 1703 11880 --
NM_005455chr131605 1531 1191 ------
NM_005480chr121106 ------
NM_005493chr61664 ------
NM_005494chr71534 ------
NM_005497chr1786007 4829 4537 3778 1810 1340 1104 805 35203 4299 3951 ----
NM_005499chr192533 525 ------
NM_005501chr1711214 ------
NM_005502chr933153 576 509 --11167 1523
NM_005504chr12106239 5924 5895 5661 5013 4664 4126 2330 1260 116 ----11746
NM_005517chr121341 72 150 ----
NM_005522chr721131 506 ------
NM_005524chr31338 ------
NM_005537chr1351130 1103 841 252 199 ------
NM_005540chr121547 1267 11407 ----
NM_005542chr771909 1828 1704 741 690 651 191 ------
NM_005573chr51161 ------
NM_005578chr355027 4393 3789 1496 373 13166 --15168
NM_005585chr151140 ------
NM_005596chr986307 5515 4745 4414 4377 3943 2497 1858 2761 697 ----
NM_005599chr121335 589 ------
NM_005604chr621786 545 --11730 --
NM_005607chr82982 158 ------
NM_005610chr12307 240 1846 ----
NM_005634chrX1140 ------
NM_005638chrX21321 432 ------
NM_005639chr1231435 1264 309 --11845 --
NM_005647chrX93242 3121 2858 2300 2287 892 487 176 145 ------
NM_005655chr821256 445 --184 --
NM_005665chr194945 4753 4707 4677 4399 4064 3248 950 527 13396 13063 --
NM_005667chr2188 ------
NM_005668chr554106 4057 3845 3491 970 41845 491 429 238 --13839
NM_005711chr541003 849 432 335 ------
NM_005715chr642520 2311 2192 1769 22681 553 ----
NM_005717chr11283 ------
NM_005722chr21128 --11675 --
NM_005725chr121749 665 ------
NM_005738chr742013 1897 770 520 2291 48 ----
NM_005744chr151149 ------
NM_005746chr752775 2716 1864 1010 405 ------
NM_005748chr1213072 13180 ----
NM_005749chr171579 --1732 --
NM_005751chr71452 ------
NM_005752chr1651214 1068 904 380 295 ------
NM_005759chr284680 4296 3723 3546 1312 997 657 43 23830 171 13036 --
NM_005765chrX----1584 --
NM_005779chr573274 2575 2539 1046 954 867 183 --12833 --
NM_005785chr1241327 639 236 159 --11624 --
NM_005795chr263022 2891 2298 1897 1071 417 --11129 --
NM_005802chr91654 ------
NM_005810chr1221006 910 ------
NM_005819chr143032 2777 2131 537 ------
NM_005822chr61793 --1597 12301
NM_005826chr12446 159 ------
NM_005828chr1784382 4333 1714 1675 1470 1097 930 630 14532 13455 --
NM_005832chr321314 94 11415 2338 80 --
NM_005836chr8124 1110 ----
NM_005840chrX47030 5936 5840 5705 --26814 2355 --
NM_005842chr132634 273 ------
NM_005843chr251726 1296 529 381 190 ------
NM_005853chr162401 124 ------
NM_005862chr321061 878 --11096 --
NM_005863chr102919 552 11152 ----
NM_005871chr10----1216 --
NM_005876chr21740 ------
NM_005880chr162541 268 --31635 1422 358 --
NM_005895chr1293991 3752 2884 2752 1673 1654 573 358 105 ----13260
NM_005896chr23594 143 48 ------
NM_005898chr1122677 2361 12191 ----
NM_005900chr42434 377 11066 ----
NM_005901chr18128046 7562 6304 6285 6148 6071 3162 2192 1325 923 367 125 21353 1104 ----
NM_005903chr544063 1950 514 382 11372 15054 13584
NM_005909chr544121 1007 598 562 31104 699 581 1515 11532
NM_005923chr62566 476 ------
NM_005935chr454917 3229 1740 1674 945 --21805 770 13581
NM_005941chr873350 3076 1309 1044 901 336 40 13754 --1364
NM_005955chr154686 4400 3664 1375 879 --13535 --
NM_005962chr1021793 337 12047 --1874
NM_005962chr1021793 337 12047 --1874
NM_005966chr242324 2041 948 146 --11932 --
NM_005967chr121511 ------
NM_005975chr201802 ------
NM_005977chr132894 357 1119 ----
NM_005986chr1382483 2384 2322 2106 1848 1133 1121 480 ------
NM_005994chr171718 ------
NM_005999chr141494 1252 1219 537 --2331 198 11003
NM_006007chr934082 2981 2837 ------
NM_006024chr73367 262 145 ------
NM_006030chr321559 138 1443 ----
NM_006037chr283944 3652 1835 1796 670 555 424 172 13448 34395 3848 1422 23465 726
NM_006038chr2011565 11438 11572 --
NM_006048chr141173 321 298 283 2937 875 ----
NM_006080chr752405 2322 2316 2250 379 ------
NM_006085chr131320 1091 336 197 ----
NM_006090chr12721 510 ------
NM_006095chr474178 908 835 595 225 87 69 13512 ----
NM_006106chr1151386 1351 1265 1100 394 22645 454 22339 2110 --
NM_006107chr172506 336 ------
NM_006108chr1142054 2037 489 477 --2961 905 --
NM_006110chr16121 ------
NM_006135chr11323 --21337 549 --
NM_006136chr71281 1132 ----
NM_006152chr122246 41 --1186 --
NM_006156chr141198 ------
NM_006157chr112128 79 ------
NM_006166chr125914 752 453 245 44 22112 869 ----
NM_006180chr91402 ------
NM_006186chr23957 475 305 ------
NM_006187chr1222958 910 ------
NM_006197chr821957 617 2489 105 1296 --
NM_006203chr5105469 4991 4931 3448 1957 1333 873 694 501 319 ------
NM_006206chr452566 2446 1838 1792 1098 1766 1238 --
NM_006210chr1921141 295 ------
NM_006223chrX126 ------
NM_006246chr1411255 --2455 190 --
NM_006252chr1117603 6065 5657 4948 4626 2687 2223 1597 1536 698 529 --16489 22617 1073
NM_006256chr162645 2337 1914 981 792 513 --12555 --
NM_006265chr841471 951 408 114 ------
NM_006275chr202663 621 12433 1481 --
NM_006282chr2074620 4223 4167 3662 3059 1689 294 --14512 14675
NM_006283chr894307 3971 3843 3814 3009 1447 442 298 274 --33489 1263 870 --
NM_006306chrX85871 4801 4102 2295 2006 1876 1130 497 --23718 169 --
NM_006313chr1211484 --1268 193
NM_006315chr464401 4370 3836 3560 3324 330 13622 ----
NM_006328chr111671 ------
NM_006330chr81180 --1669 --
NM_006334chr9--1202 ----
NM_006353chr631441 507 73 ----11124
NM_006357chr21451 ------
NM_006359chrX3941 865 188 22127 1759 ----
NM_006366chr611250 ------
NM_006369chr11434 ------
NM_006379chr72828 697 --12208 --
NM_006380chr1773810 3359 3078 1480 1110 940 218 --1880 --
NM_006393chr1084386 4321 4184 3948 3064 1431 660 507 33008 2785 1536 ----
NM_006420chr2063411 3067 2542 718 225 79 ------
NM_006421chr831248 1162 135 ------
NM_006439chr41463 ------
NM_006451chr52798 340 21060 419 ----
NM_006457chr443843 3615 1594 969 23181 602 --1151
NM_006459chr1041972 1850 1474 1360 ----1259
NM_006460chr172487 233 ------
NM_006469chr141484 1188 638 623 --1196 --
NM_006478chr221279 ------
NM_006482chr1231319 843 195 12487 ----
NM_006489chr1461976 1327 580 486 432 87 ------
NM_006534chr2073310 2467 2456 2250 2117 1054 759 ------
NM_006544chr1485951 5859 5530 5049 4908 4551 2130 688 13691 55382 5162 3886 1046 179 14892
NM_006546chr1776582 6214 5884 5808 4036 970 911 35439 4772 2526 14076 --
NM_006547chr731694 1349 106 ------
NM_006559chr131235 1223 394 1823 11176 --
NM_006561chr10156181 5073 4754 4654 4470 4290 3816 1497 1423 965 851 823 547 500 110 2474 190 21231 511 --
NM_006572chr1743410 2369 1034 618 1639 ----
NM_006575chr1421439 1140 --1212 --
NM_006595chr1111430 11406 11364 11868
NM_006599chr1698146 6702 6572 6354 5288 2983 2103 1916 1067 22659 1206 ----
NM_006603chrX----1715 --
NM_006618chr131561 1405 470 ------
NM_006620chr664114 3265 1325 945 557 203 21639 642 14206 14607
NM_006624chr1041940 1701 1432 178 --1725 --
NM_006626chr962290 1859 1724 320 223 53 --131 --
NM_006628chr1574341 3936 3461 3159 1717 423 292 13286 ----
NM_006633chr51507 ------
NM_006644chr13----1154 1432
NM_006646chr1362828 2776 2682 1957 365 293 ------
NM_006654chr12104339 1641 1448 1430 1379 1020 966 920 774 40 ----24745 1585
NM_006667chrX3998 120 100 ------
NM_006670chr61156 ------
NM_006696chr51237 ------
NM_006699chr13822 688 645 168 1306 --
NM_006700chr12----1800 --
NM_006717chr953198 1371 1084 1035 995 1354 2245 214 --
NM_006720chr1054375 3791 1780 1552 457 --2750 134 13755
NM_006721chr10--1212 ----
NM_006722chr341080 1004 671 376 ------
NM_006726chr41247 11171 ----
NM_006729chrX93970 3475 2047 1906 1846 1792 1362 1227 688 11074 15183 --
NM_006731chr9115822 5757 5227 4561 4476 3762 3564 2051 1195 1161 852 25046 474 11170 1120
NM_006734chr62213 114 --11576 --
NM_006738chr1594637 4286 3848 3458 3260 2820 1662 478 80 --21579 1220 1350
NM_006744chr101181 ------
NM_006750chr16157880 7862 7629 7508 7432 6580 6549 6488 6077 5409 3149 2647 1985 1492 739 15811 26338 2621 --
NM_006751chr2--1124 ----
NM_006754chr7----1392 --
NM_006756chr841530 1220 1101 1002 ------
NM_006777chrX102278 2037 2005 1097 1014 641 575 455 171 25 1295 ----
NM_006807chr1721051 180 ------
NM_006811chr204956 719 674 42 1940 2628 76 1115
NM_006815chr1221305 326 ------
NM_006823chr811320 ------
NM_006826chr231091 879 822 ------
NM_006838chr1211259 11892 ----
NM_006857chr21333 ------
NM_006873chr262776 2765 1255 1074 892 142 22718 1203 --1121
NM_006874chr421029 986 --1776 --
NM_006884chr341682 1500 320 278 --11712 --
NM_006885chr1653615 2754 1466 805 276 13475 13888 --
NM_006887chr21231 ------
NM_006910chr161401 ------
NM_006912chr132552 1787 333 ------
NM_006914chr911330 1149 ----
NM_006915chrX2293 119 ------
NM_006918chr1131949 1065 270 --11779 --
NM_006920chr221283 464 ------
NM_006922chr252124 1877 729 657 614 ------
NM_006924chr1794051 3986 3835 3683 3278 3168 2699 1235 980 13958 --13449
NM_006930chr541967 1801 1325 609 --11568 --
NM_006939chr14148 ------
NM_006965chr185862 311 256 220 37 ----1415
NM_006988chr211292 ------
NM_006993chr10160 ------
NM_007006chr1693481 3424 3108 2951 2689 1304 1044 369 88 --23514 2462 --
NM_007007chr1294518 4479 4318 3912 3599 3132 484 340 76 14764 ----
NM_007008chr21375 ------
NM_007011chr15126639 6317 5856 5172 2292 1966 1609 1366 1289 672 551 73 --11739 --
NM_007013chr8----1725 --
NM_007038chr2185658 4984 4781 4479 2349 972 819 75 13768 1486 11393
NM_007042chr32788 176 21977 1828 1352 --
NM_007050chr20147811 7755 7119 6844 6721 6561 6159 5746 3177 2150 2004 1311 514 319 25621 967 ----
NM_007054chr553874 3626 3588 2665 892 33802 2949 662 ----
NM_007084chr1321425 375 ----2992 487
NM_007106chr1342722 2181 989 99 ------
NM_007107chr311797 11839 ----
NM_007111chr133821 310 298 --1604 --
NM_007125chrY2978 451 --11037 --
NM_007129chr132216 157 --1414 --
NM_007146chr1711874 ------
NM_007157chrX52983 2546 853 266 162 --1135 --
NM_007159chr331343 1230 1187 1449 ----
NM_007166chr1121366 517 11387 ----
NM_007175chr853548 2874 2433 2326 459 11012 --23118 929
NM_007191chr121166 ------
NM_007197chr1211046 ------
NM_007198chr811589 21612 194 ----
NM_007200chr1594637 4286 3848 3458 3260 2820 1662 478 80 --21579 1220 1350
NM_007207chr11322 --1111 --
NM_007214chr62421 342 --21212 929 --
NM_007217chr3------175
NM_007218chr81901 ------
NM_007249chr1399476 9029 7295 6329 3031 2176 2055 1730 721 23211 161 36614 5833 2240 --
NM_007274chr11125 ------
NM_007276chr721015 776 ----1112
NM_007282chr3--1996 ----
NM_007294chr1731273 393 192 ----1909
NM_007295chr1731273 393 192 ----1909
NM_007296chr1731273 393 192 ----1909
NM_007297chr1731273 393 192 ----1909
NM_007298chr1731273 393 192 ----1909
NM_007299chr1731273 393 192 ----1909
NM_007300chr1731273 393 192 ----1909
NM_007302chr1731273 393 192 ----1909
NM_007303chr1731273 393 192 ----1909
NM_007304chr1731273 393 192 ----1909
NM_007305chr1731273 393 192 ----1909
NM_007315chr221487 513 ------
NM_007325chrX42170 2002 1451 1421 ------
NM_007358chr141982 1719 788 72 ------
NM_007373chr1041396 717 249 194 1556 ----
NM_007374chr141382 ------
NM_007375chr132719 1887 191 ------
NM_009585chr31728 1699 ----
NM_009585chr31728 1699 ----
NM_012062chr122305 206 --1235 --
NM_012081chr543494 2587 954 108 ------
NM_012093chr131167 997 316 --11057 --
NM_012096chr322942 433 --23325 466 --
NM_012102chr132557 2331 1901 11719 12202 --
NM_012115chr61620 --1579 --
NM_012124chr111154 ------
NM_012141chr1313675 ------
NM_012155chr191223 ------
NM_012164chr956079 5996 5100 2634 1404 11730 1543 --
NM_012183chr11453 --1546 --
NM_012193chr1185454 4918 1958 1433 980 958 499 77 32018 1857 99 ----
NM_012210chr9--1525 --1251
NM_012214chr266407 5038 4562 2311 1582 106 24984 788 ----
NM_012215chr1061806 1407 286 236 67 33 --21761 1600 --
NM_012216chrX----1101 --
NM_012218chr191312 ------
NM_012234chr353586 3513 3480 2884 425 ------
NM_012238chr1021761 352 --11590 --
NM_012243chr11134 187 ----
NM_012259chr651430 892 497 421 259 ------
NM_012262chr184896 4826 3458 760 719 282 184 76 --11473 --
NM_012281chr731592 1573 1508 1189 ----
NM_012287chr324457 1574 11183 13175 33845 3770 3697
NM_012297chr452297 1873 1852 567 22 ------
NM_012301chr731939 1798 755 ------
NM_012302chr131237 482 326 ------
NM_012309chr1164065 3263 1689 1338 846 665 --21627 87 --
NM_012322chr71105 ------
NM_012328chr721079 214 ------
NM_012330chr1051829 1822 1648 1509 533 ------
NM_012333chr1157 2549 275 11493 --
NM_012334chr5124773 4543 4162 3143 1827 1501 1290 1266 1165 957 688 205 21180 130 1833 --
NM_012338chr72838 162 ------
NM_012388chr1533189 2055 198 ------
NM_012402chr11--11112 ----
NM_012419chr6----1176 --
NM_012420chr1052287 2015 701 526 31 --22183 542 --
NM_012449chr7----164 --
NM_012461chr14--2239 165 --1518
NM_012464chr472712 2513 1128 1011 708 493 157 2651 106 ----
NM_013229chr1262639 1044 599 547 512 218 12481 ----
NM_013253chr1151258 350 236 192 116 ------
NM_013257chr842232 1991 309 39 ------
NM_013261chr452591 1481 860 842 275 ------
NM_013280chr11----1139 --
NM_013281chr201167 ------
NM_013282chr19----11139 --
NM_013283chr51742 1238 ----
NM_013293chr73604 594 485 ------
NM_013316chr7------1402
NM_013320chr121120 ------
NM_013322chr721291 1112 ------
NM_013341chr21575 22700 2207 ----
NM_013354chr82960 305 ------
NM_013357chr83753 689 81 ----1145
NM_013361chr193600 490 475 1150 --1446
NM_013374chr352998 2713 2647 2362 378 ------
NM_013390chr92394 352 1110 --1703
NM_013391chr52463 119 ------
NM_013396chr2141518 585 420 328 ------
NM_013436chr2195 ------
NM_013438chr911710 ------
NM_013448chr142727 520 ----1206
NM_013449chr1242588 2427 2387 888 12182 ----
NM_013450chr221184 827 ------
NM_013937chr61431 ------
NM_013960chr8------1228
NM_013996chr71470 ------
NM_013996chr71470 ------
NM_013997chr71470 ------
NM_013997chr71470 ------
NM_013998chr71470 ------
NM_013998chr71470 ------
NM_014011chr242534 2428 1851 248 ------
NM_014021chr173242 3185 3158 2936 540 367 44 1109 ----
NM_014023chr1042847 1114 662 621 198 22668 1973 11901
NM_014034chr631365 382 128 ------
NM_014043chr31199 ------
NM_014089chr133873 108 55 1587 ----
NM_014141chr7105093 4994 4978 4928 4839 3843 3295 1622 1486 342 1707 ----
NM_014154chr331197 1115 404 ------
NM_014155chr1175848 2828 1951 1930 1808 1441 111 ------
NM_014178chr14148 ------
NM_014217chr111370 --11933 --
NM_014233chr1732165 861 839 1349 ----
NM_014241chr102280 60 ------
NM_014243chr421915 1615 ------
NM_014248chr221119 ------
NM_014253chrX52412 2377 2232 1767 1652 ------
NM_014264chr4290 28 ------
NM_014279chr91705 ------
NM_014290chr91157 ------
NM_014315chr141163 ------
NM_014319chr122239 135 ----11938
NM_014331chr4106988 6179 2854 1031 984 850 790 711 238 79 25675 748 ----
NM_014332chrX1312 ------
NM_014345chr621039 79 ------
NM_014382chr331355 543 304 145 ----
NM_014392chr421217 1099 11081 ----
NM_014394chr1041196 293 98 74 --2273 158 --
NM_014410chr181353 ------
NM_014423chr5125633 5468 4757 4439 4428 4273 3857 3561 1765 1648 1472 1360 ------
NM_014432chr63181 104 93 ------
NM_014445chr35980 552 400 284 171 ------
NM_014447chr411092 1274 ----
NM_014452chr61277 ------
NM_014456chr1051229 1209 686 292 73 ------
NM_014482chr21130 ------
NM_014494chr1621709 1590 2636 151 ----
NM_014500chrX----1286 --
NM_014517chr341881 1710 386 78 11449 ----
NM_014554chr121873 ------
NM_014574chr1451383 1185 596 308 53 1292 ----
NM_014575chr31544 ------
NM_014577chr221148 ------
NM_014583chr31511 ------
NM_014588chr20--199 ----
NM_014592chr51239 ------
NM_014607chr221873 812 11714 ----
NM_014612chr91273 ------
NM_014613chr543077 2527 895 510 1922 ----
NM_014614chr261238 479 307 256 148 85 --1572 --
NM_014615chr1653072 2624 1219 815 410 11086 12229 11394
NM_014616chr353486 3090 3000 2300 290 12729 2946 423 --
NM_014620chr12--1627 ----
NM_014635chr221373 153 --11599 --
NM_014637chr8----2162 60 --
NM_014670chr221542 421 --11406 --
NM_014676chr141345 621 608 424 195 --1496
NM_014677chr821095 857 ------
NM_014682chr812253 22075 516 21970 362 --
NM_014683chr1742069 2035 1459 255 1433 1450 --
NM_014685chr161574 ------
NM_014689chr2195 --1527 --
NM_014699chr162372 347 ------
NM_014701chr1573407 2795 2417 1307 1222 1100 853 ------
NM_014702chr673347 3331 2676 1187 1107 680 431 13322 ----
NM_014705chr711734 ------
NM_014707chr782305 2283 1886 1687 1679 1638 466 129 2834 353 ----
NM_014709chr23423 94 66 ------
NM_014711chr1651798 817 794 239 128 ------
NM_014713chr22501 189 ------
NM_014720chr10----21636 1381 --
NM_014721chr6147285 7259 7151 6590 6075 5070 5024 2568 2360 2142 1792 1517 1299 1278 26339 2991 12603 22756 643
NM_014733chr541884 1401 1388 466 --21746 424 --
NM_014735chrX2429 163 --1848 1834
NM_014746chr244353 2878 1715 373 ----14304
NM_014747chr175397 4951 4236 1821 1680 744 337 25831 1690 --11433
NM_014751chr832071 1446 293 ------
NM_014755chr253999 3349 3208 2695 364 23914 2844 11055 --
NM_014756chr112455 377 --1472 --
NM_014765chr132517 2120 1691 --11837 --
NM_014774chr142537 2496 1244 760 --22216 885 --
NM_014779chr341156 1117 922 420 --1253 --
NM_014781chr81509 ------
NM_014787chr152759 2636 2090 896 772 --12611 --
NM_014793chr153398 234 46 1489 ----
NM_014819chr532423 2406 587 ----1884
NM_014820chr331850 1325 39 --1181 11752
NM_014822chr42636 273 --1468 --
NM_014824chr1141626 1596 283 53 --22001 1671 --
NM_014826chr163200 2970 1641 1583 1160 361 ------
NM_014827chr131726 1410 477 1402 ----
NM_014830chr1263816 3712 3518 3288 2397 1297 ------
NM_014838chr224285 275 181 66 --22748 2253 --
NM_014839chr122028 86 --12473 --
NM_014841chr621074 50 ------
NM_014848chr1542344 2060 902 240 --22756 704 1817
NM_014869chr321462 1416 --11068 --
NM_014873chr164485 1530 1226 1099 526 503 13363 ----
NM_014877chr17237672 7364 7349 6633 6545 5928 5695 5661 5608 5542 5417 5339 5308 5256 4959 4927 4864 3075 2972 2664 1946 1625 510 35437 5411 5397 21975 328 --
NM_014883chr421911 1748 1812 11636 --
NM_014893chrY1863 1689 11618 --
NM_014897chr1752628 2487 2178 606 259 --12332 --
NM_014899chr523191 2776 --1930 12929
NM_014903chr1242307 2209 1752 336 ----1153
NM_014904chr1073753 3513 2840 1536 860 742 388 ----11364
NM_014912chr1033368 2241 991 ------
NM_014913chr1821024 982 1203 ----
NM_014914chr21484 ------
NM_014920chr663838 3768 3594 1439 1198 162 ------
NM_014923chr1322377 700 11790 --1435
NM_014924chr1462985 2946 641 590 392 226 23170 1181 ----
NM_014932chr321970 528 ------
NM_014935chr133815 3089 2869 --33897 1042 687 13103
NM_014936chr61490 ----12477
NM_014939chr1831214 496 288 --21036 295 11390
NM_014946chr2103044 2805 2566 2455 2028 1122 558 481 114 95 ----12402
NM_014949chr12926 357 1946 ----
NM_014951chr1022616 2386 ------
NM_014962chr2021913 454 1855 ----
NM_014982chr1453567 3461 2022 474 284 --25106 4483 1588
NM_015002chr1252132 859 295 271 148 ----11824
NM_015008chr352341 1350 993 193 85 1981 --13108
NM_015009chr33657 158 81 ------
NM_015017chr141181 1125 247 216 1897 ----
NM_015018chr61176 ------
NM_015026chr12103990 3958 3563 3046 1896 1605 1449 378 304 63 --23590 883 --
NM_015035chr20146240 6128 5776 4756 4704 4687 4157 2509 2263 1837 1722 1235 1165 36 1761 ----
NM_015042chr1594362 3983 3617 2975 1627 1287 985 588 355 ----1427
NM_015045chr1022212 2051 1734 --1320
NM_015046chr962490 1993 1693 627 583 101 --11817 12053
NM_015051chr972846 2295 1366 1188 873 466 261 12275 --12763
NM_015056chr2152685 2178 1809 1673 449 --12448 --
NM_015057chr133720 180 68 ----1603
NM_015068chr773456 3414 3161 3042 3011 2645 283 13088 43179 2636 2422 309 --
NM_015071chr524749 1725 --14682 --
NM_015074chr164662 3774 3619 1819 1448 551 --11795 24476 3918
NM_015076chr674241 991 925 784 576 504 197 --11724 --
NM_015092chr1664312 3525 3084 2933 1294 23 ----23046 812
NM_015093chr641187 655 74 57 ------
NM_015097chr341506 373 173 27 1581 ----
NM_015101chr162387 704 667 531 423 330 12261 12192 --
NM_015110chr972334 1924 1884 1850 1590 561 194 ------
NM_015115chr442859 2832 2558 201 ------
NM_015125chr192400 113 ------
NM_015137chr82872 156 1671 ----
NM_015139chr1138 ------
NM_015143chr431397 523 469 1168 --11480
NM_015144chr1683674 2666 2650 2579 2430 1364 939 74 23501 354 11208 --
NM_015149chr132204 1981 1625 ----11356
NM_015151chr21----1325 --
NM_015153chr61231 ------
NM_015155chr1033303 1097 398 ----1246
NM_015156chr1463150 2837 1240 1106 453 242 --23755 2737 11551
NM_015163chr1451626 1487 1476 688 567 11815 ----
NM_015176chr11358 ------
NM_015185chrX52283 1972 939 654 290 1897 --11218
NM_015192chr2032447 614 533 1386 2770 204 --
NM_015200chr421022 459 12385 --11586
NM_015203chr1158 ------
NM_015206chr1562849 2682 2660 1537 1068 893 12467 --12482
NM_015208chr1853757 2969 2911 2782 491 ----11408
NM_015225chr963131 2979 2817 1034 435 414 --32775 992 149 --
NM_015233chr1332686 823 696 --1987 1200
NM_015238chr52253 149 ------
NM_015239chr91131 ------
NM_015247chr1685081 4870 4255 3965 3507 452 322 233 1489 --1940
NM_015251chr1622328 1923 ----1193
NM_015260chr1921232 1201 ------
NM_015265chr242301 952 81 69 --12335 --
NM_015271chr434079 3747 3092 13425 14046 --
NM_015272chr1642046 644 281 150 11445 ----
NM_015275chr12----12109 --
NM_015282chr2103058 2519 2201 1948 1866 1223 820 727 528 440 1545 ----
NM_015296chr132899 339 ------
NM_015308chr112146 59 ------
NM_015310chr8118093 7785 7011 5456 2594 1870 1529 1391 980 810 301 15680 198 17072
NM_015313chr1143907 1707 1415 1037 --21891 1523 --
NM_015314chr732189 2129 2096 ------
NM_015317chr262736 2575 1043 796 393 385 --12019 --
NM_015344chr821609 451 11492 ----
NM_015349chr632588 2399 919 1238 ----
NM_015358chr2111072 ------
NM_015361chr21822 ------
NM_015365chrX64244 3579 2994 2953 1709 497 14146 13337 --
NM_015382chr142613 150 ------
NM_015384chr51131 ------
NM_015387chr231982 1590 261 ------
NM_015396chr3--1514 ----
NM_015397chr92602 583 11302 2403 121 --
NM_015412chr332206 606 290 --1467 1905
NM_015428chr1951713 1706 1623 520 80 --21393 121 --
NM_015435chr82419 79 ------
NM_015436chr463003 2383 2251 1354 559 547 ----12103
NM_015441chr13429 410 295 ------
NM_015455chr543790 3156 2735 1508 ----12771
NM_015465chr5------2515 143
NM_015485chr1199 ------
NM_015508chr331343 589 170 ----1353
NM_015520chr332818 1795 1090 --22791 1847 --
NM_015525chr63829 75 43 ------
NM_015530chr2190 ------
NM_015532chr1572693 2161 2123 1089 749 181 144 1247 12314 --
NM_015534chr15961 899 762 434 76 ------
NM_015548chr62295 219 ----152
NM_015550chr743047 937 439 140 2923 522 ----
NM_015554chr1552948 2499 2386 2176 1006 --11060 22520 733
NM_015555chr631354 427 66 ------
NM_015556chr141233 ------
NM_015569chr174485 4088 3901 1268 1255 578 311 --1593 --
NM_015571chr612602 --1169 --
NM_015576chr341996 1950 1846 940 --22432 1817 1844
NM_015578chr1911864 ------
NM_015622chr71281 ------
NM_015634chr10--1113 ----
NM_015640chr174249 4219 3992 3974 3636 3244 1345 ----13256
NM_015646chr122223 158 ----136
NM_015668chr8------1144
NM_015678chr1341554 1439 674 348 ------
NM_015693chr4188 1280 ----
NM_015702chr2178 ------
NM_015713chr852827 2247 1441 904 266 22609 1327 11362 --
NM_015859chr14--164 ----
NM_015866chr11387 ------
NM_015878chr842075 679 367 225 --11475 --
NM_015881chr1151258 350 236 192 116 ------
NM_015885chr111642 ------
NM_015886chr8145604 5367 5342 4866 3967 3950 3942 2054 1970 1802 1495 1260 1166 1074 11445 ----
NM_015888chr133161 2829 1009 1968 ----
NM_015891chr622042 485 1254 ----
NM_015902chr8177 ------
NM_015904chr2----1276 --
NM_015906chr174862 4701 4155 3692 3257 3105 218 13608 23749 207 --
NM_015920chr152556 165 ------
NM_015976chr11361 ------
NM_015982chr171331 ------
NM_015990chr431024 1001 962 --1886 --
NM_016018chr832876 2494 777 1878 ----
NM_016021chr62808 134 13022 ----
NM_016039chr141168 ------
NM_016040chr152478 812 405 336 147 ------
NM_016048chr52877 328 ------
NM_016071chr71107 ------
NM_016072chr1282240 2141 2070 2045 796 712 694 668 ------
NM_016073chr1531029 956 126 ------
NM_016078chr174998 434 376 162 ------
NM_016083chr663067 2758 289 245 147 67 ----12770
NM_016096chr851752 1702 1638 1527 1416 ------
NM_016107chr52505 127 ------
NM_016120chrX11036 --21216 1152 --
NM_016129chr4------1272
NM_016131chr252267 1931 1670 858 691 --11561 --
NM_016132chr1563199 3066 2349 1062 1014 448 --2203 180 --
NM_016152chr341284 862 318 134 --11189 --
NM_016156chr1152142 1787 832 276 72 --12358 --
NM_016201chr342198 1446 929 640 --1467 --
NM_016203chr741011 770 268 46 --1711 --
NM_016206chr3158149 7412 6649 6556 6428 6292 5439 2954 2378 1559 1411 1206 852 734 282 12695 48889 8430 420 377 16897
NM_016231chr1751451 638 301 111 53 ------
NM_016239chr171775 --2713 238 1690
NM_016248chr1353895 2616 1177 750 267 1426 ----
NM_016255chr662148 1340 1172 759 657 572 --22201 1182 --
NM_016260chr2116264 6053 5578 5275 2880 2805 2779 1379 1357 1140 1131 16425 27667 1846 25687 5013
NM_016261chr172768 78 ------
NM_016269chr4--11148 ----
NM_016270chr191485 ------
NM_016271chr1872325 2192 1991 1889 1841 1793 942 ------
NM_016289chr221494 500 ----12106
NM_016290chr52197 96 ------
NM_016300chr31533 ------
NM_016303chrX2451 177 ------
NM_016308chr131733 384 281 1670 ----
NM_016319chr121717 ------
NM_016322chr953116 2657 2218 758 425 --11166 --
NM_016357chr121442 11237 ----
NM_016376chr1774089 3978 3791 3561 1191 513 366 11732 11630 24007 1467
NM_016377chr661513 599 418 235 98 61 ------
NM_016395chr152280 84 134 ----
NM_016396chr152671 215 1303 1911 --
NM_016401chr111103 ------
NM_016410chr91120 ------
NM_016422chr1133238 652 413 22875 1022 ----
NM_016424chr1732011 1841 549 ------
NM_016436chr2052477 732 517 329 264 11687 1600 --
NM_016441chr262351 2101 566 552 295 225 --11607 --
NM_016442chr532178 2025 911 --1238 --
NM_016462chr62450 355 ------
NM_016472chr1421440 1341 ----11506
NM_016475chr1431134 1018 399 1448 ----
NM_016485chr63872 864 565 1704 ----
NM_016486chr1----1192 --
NM_016507chr1732428 652 387 --12450 --
NM_016513chr663838 3768 3594 1439 1198 162 ------
NM_016529chr132140 44 ------
NM_016530chr1583224 3203 3153 2898 1171 1010 631 450 12664 ----
NM_016545chr1----1249 --
NM_016575chr1244857 1130 1121 783 175 11935 15503
NM_016584chr122292 237 ------
NM_016586chr141172 ------
NM_016587chr721015 776 ----1112
NM_016588chr61901 ------
NM_016607chrX11476 ------
NM_016612chr83685 659 472 ------
NM_016620chr121272 218 2494 31 ----
NM_016621chr1154532 1289 1169 1021 162 ------
NM_016623chr81508 --1516 --
NM_016626chr1821289 199 ------
NM_016631chr214933 786 188 73 ------
NM_016645chr15----1320 --
NM_016651chr142389 316 --21150 26 --
NM_016950chr42272 249 ------
NM_016952chr11104103 3983 3549 3290 3209 3105 1178 934 888 464 ------
NM_016953chr275859 5849 5238 4044 3800 994 709 11448 --15343
NM_017415chr583345 3228 1726 1573 1538 1036 512 103 13047 11191 --
NM_017420chr1443664 1116 801 522 ------
NM_017423chr41828 3349 337 134 11533 --
NM_017440chr12186 --1534 --
NM_017447chr2163905 3816 3799 3588 3151 974 13850 14296 172
NM_017450chr1721504 348 ----1357
NM_017519chr621015 854 ------
NM_017520chr133143 97 67 ------
NM_017544chrX1660 1246 ----
NM_017563chr396218 5504 4290 2024 1541 855 824 595 99 1735 25992 5682 1235
NM_017580chr1061945 1880 769 675 466 209 --11704 --
NM_017583chr11--11816 --1709
NM_017594chr933329 3270 2115 12568 12370 12388
NM_017599chr1232012 1643 90 11757 ----
NM_017628chr4125241 5029 4428 4187 3869 3372 1907 1665 1260 1156 1039 441 ------
NM_017629chr121833 538 ------
NM_017633chr673025 2564 2556 2451 2386 421 372 --1143 --
NM_017635chr1131439 1102 81 ----1166
NM_017637chr997274 5838 2831 2455 1779 1361 1008 938 642 --29130 2575 --
NM_017641chr1221074 465 ------
NM_017643chr172948 319 12290 1259 --
NM_017644chr375045 3288 1889 1269 1147 755 268 31520 1064 941 ----
NM_017645chr963123 3111 2540 2284 2173 812 ------
NM_017650chr765916 4607 4320 2102 1421 520 --26103 1172 15772
NM_017658chr1432903 1580 134 --14293 --
NM_017666chrX51990 567 452 356 110 ------
NM_017667chr71512 ------
NM_017672chr1511111 ------
NM_017679chr171582 ------
NM_017693chr1331652 1022 498 ------
NM_017697chr82351 344 --1108 --
NM_017699chr3------11490
NM_017704chr1141037 407 208 25 ------
NM_017709chr123138 1718 24296 3163 24197 1228 --
NM_017714chr202830 661 1648 ----
NM_017719chr321805 952 12064 1610 --
NM_017736chr1652743 2284 2152 451 334 12044 22208 1278 --
NM_017737chr131912 1706 764 ------
NM_017752chrX51988 1947 1351 785 32 160 ----
NM_017753chr91804 ------
NM_017761chr131500 1019 228 156 ----
NM_017769chr1422997 2825 22505 2167 ----
NM_017780chr81816 ------
NM_017784chr31864 ----1337
NM_017786chr83597 544 463 ------
NM_017789chr21278 ------
NM_017798chr201793 11004 ----
NM_017799chr1441930 1471 245 63 --3549 174 56 --
NM_017811chr962519 2485 2374 2087 328 156 --1877 --
NM_017813chr855715 1654 1180 551 287 --13815 14111
NM_017824chr10--1830 ----
NM_017864chr8172 ------
NM_017915chr122430 191 ------
NM_017919chr934795 921 691 ----1236
NM_017925chr931404 1318 69 2348 285 31906 1525 733 --
NM_017938chrX1107 ------
NM_017944chr1153118 2965 2343 1996 1182 12002 --1998
NM_017958chr232856 1894 89 1712 ----
NM_017987chr1011893 --11387 --
NM_017994chr752559 2494 713 554 418 --1368 --
NM_017998chr931359 355 246 ------
NM_018000chr241924 1745 144 101 ------
NM_018027chr1053032 2564 2417 2016 923 12777 ----
NM_018030chr183692 179 44 --1889 --
NM_018036chr1444341 3874 3542 711 13892 12779 --
NM_018061chr11258 ----1199
NM_018062chr22448 322 ------
NM_018084chr222882 891 ----11241
NM_018085chr1107481 6426 6411 6024 5738 2989 2588 2028 1119 1113 32837 1246 796 18005 --
NM_018089chr2----1198 --
NM_018098chr321093 476 1762 ----
NM_018120chr841444 937 381 105 ------
NM_018121chr1042092 857 824 233 13221 1633 --
NM_018128chr174584 395 171 81 1452 ----
NM_018133chr332139 327 162 1226 --12000
NM_018155chr3102797 2549 2424 2297 2250 970 919 661 130 100 --12399 --
NM_018164chr121218 ------
NM_018169chr122478 110 ------
NM_018171chr122672 226 ----1285
NM_018172chr1111041 ----11131
NM_018178chr131795 698 387 12004 ----
NM_018181chr1821397 197 --21539 70 --
NM_018182chr1741974 866 663 86 ------
NM_018195chr111871 ------
NM_018211chr131732 1630 1382 --11483 1322
NM_018214chr631195 1020 850 11121 ----
NM_018221chr21406 ------
NM_018227chr453207 1039 576 370 254 --12295 --
NM_018230chr1----185 --
NM_018243chr4103682 3676 3607 3592 1534 1159 857 739 595 405 ------
NM_018246chr852101 2077 570 542 143 32894 1879 1113 ----
NM_018254chr12406 290 ------
NM_018257chr2082331 2268 2261 2197 2133 2057 1682 980 --22284 309 1476
NM_018293chr342395 1917 1879 77 11104 11846 --
NM_018299chr833356 1047 381 ----11010
NM_018302chr442101 1636 847 711 --12286 --
NM_018313chr332688 2261 2091 --21897 459 --
NM_018314chr111762 --123 --
NM_018315chr4--11464 1987 --
NM_018323chr431167 148 113 --11720 --
NM_018339chr921163 651 21834 299 ----
NM_018351chr1274677 3333 3100 1248 1021 1006 372 ----13200
NM_018354chr20----1269 --
NM_018362chr1183547 3188 1462 1242 654 588 352 49 --13819 --
NM_018364chr173932 3870 2946 2815 2691 220 83 --13611 14137
NM_018367chr111306 --12405 --
NM_018372chr1------1276
NM_018373chr1466038 5441 5277 4569 1955 295 ----14011
NM_018374chr784492 4485 3771 3518 1555 806 399 109 11463 24697 4275 11441
NM_018383chr271534 1261 619 365 346 273 148 ------
NM_018393chr111211 ------
NM_018398chr31225 ------
NM_018403chr364140 3571 2702 1645 1496 445 23253 90 1800 --
NM_018429chr572833 2652 2268 1970 726 485 37 11812 --12585
NM_018440chr8118430 7702 7188 6544 5990 5548 5503 3077 2846 1069 653 16214 13367 --
NM_018448chr121517 ------
NM_018452chr6_random62720 714 534 441 315 191 11466 12419 --
NM_018464chr101368 ------
NM_018475chr4--1125 ----
NM_018482chr82728 628 --11860 12230
NM_018486chrX2372 78 ------
NM_018489chr132364 2187 1621 --1525 --
NM_018534chr21586 ------
NM_018557chr211334 ------
NM_018566chr1134764 4561 4145 3705 3527 1477 1382 1181 946 683 544 516 177 13137 11694 --
NM_018569chr41642 --11497 --
NM_018590chr1021672 1436 11080 1596 --
NM_018593chr63669 493 54 1195 ----
NM_018638chr12105407 4926 4352 4341 4086 3460 1498 664 387 378 34232 1384 1029 11333 --
NM_018652chr151335 ------
NM_018660chr882988 2830 2696 2605 2078 1250 946 116 ------
NM_018672chr173335 237 73 1729 ----
NM_018686chr12152 ------
NM_018695chr552458 2386 2136 2015 1990 ------
NM_018696chr182723 394 188 ----
NM_018703chr161401 ------
NM_018704chr142033 1803 842 173 12138 ----
NM_018712chr1131412 1393 1188 ------
NM_018724chr12646 520 ------
NM_018834chr52838 332 ------
NM_018844chr771988 1873 1786 1748 1466 368 322 --21690 187 21819 1796
NM_018846chr74931 110 82 70 --1386 --
NM_018898chr551994 923 396 371 252 --2650 191 11946
NM_018899chr551994 923 396 371 252 --2650 191 11946
NM_018900chr551994 923 396 371 252 --2650 191 11946
NM_018901chr551994 923 396 371 252 --2650 191 11946
NM_018902chr551994 923 396 371 252 --2650 191 11946
NM_018903chr551994 923 396 371 252 --2650 191 11946
NM_018904chr551994 923 396 371 252 --2650 191 11946
NM_018905chr551994 923 396 371 252 --2650 191 11946
NM_018906chr551994 923 396 371 252 --2650 191 11946
NM_018907chr551994 923 396 371 252 --2650 191 11946
NM_018908chr551994 923 396 371 252 --2650 191 11946
NM_018909chr551994 923 396 371 252 --2650 191 11946
NM_018910chr551994 923 396 371 252 --2650 191 11946
NM_018911chr551994 923 396 371 252 --2650 191 11946
NM_018912chr531736 1216 567 ------
NM_018913chr531736 1216 567 ------
NM_018914chr531736 1216 567 ------
NM_018915chr531736 1216 567 ------
NM_018916chr531736 1216 567 ------
NM_018917chr531736 1216 567 ------
NM_018918chr531736 1216 567 ------
NM_018919chr531736 1216 567 ------
NM_018920chr531736 1216 567 ------
NM_018921chr531736 1216 567 ------
NM_018922chr531736 1216 567 ------
NM_018923chr531736 1216 567 ------
NM_018924chr531736 1216 567 ------
NM_018925chr531736 1216 567 ------
NM_018926chr531736 1216 567 ------
NM_018927chr531736 1216 567 ------
NM_018928chr531736 1216 567 ------
NM_018929chr531736 1216 567 ------
NM_018932chr54664 637 248 232 ------
NM_018948chr12210 201 164 --1481
NM_018951chr71929 ------
NM_018955chr17191 ------
NM_018959chr19--1733 ----
NM_018970chr772929 2088 1270 1262 747 705 240 ----1415
NM_018999chr10134923 4787 4611 4156 3860 3650 3273 1928 1284 1274 1222 1180 872 13104 21075 946 13435
NM_019001chr394132 3908 3872 3327 3117 2951 1498 988 205 ------
NM_019004chr761992 1957 1557 1527 516 403 --12224 --
NM_019006chr15----1569 --
NM_019018chr53637 289 62 ------
NM_019022chr1861258 1206 643 437 190 51 --13154 --
NM_019027chr432485 2414 154 ------
NM_019045chrX3733 269 38 ------
NM_019050chr492306 2120 1824 1803 1754 1543 1520 892 689 --11726 --
NM_019063chr231409 184 177 ------
NM_019071chr71802 ------
NM_019072chr583170 2880 2674 1518 1353 1290 717 387 ------
NM_019079chr1----1906 --
NM_019091chr21180 1374 ----
NM_019116chr1632467 1302 1012 ----13792
NM_019555chr341560 1528 1347 1324 ----1615
NM_019590chr10----11053 --
NM_019592chr93920 648 624 ------
NM_019597chrX1193 --1668 --
NM_019605chr11614 ------
NM_019610chr121947 1570 --1679 --
NM_019617chr21130 ------
NM_019842chr61287 ------
NM_020066chr12803 235 ------
NM_020116chr431510 1480 90 11212 11757 --
NM_020122chr264409 4068 1752 1407 957 779 --1101 14611
NM_020141chr121830 1590 ------
NM_020148chr1863082 2904 2184 2045 746 692 32411 2303 232 1797 --
NM_020151chr261773 1313 1280 1143 714 423 11221 ----
NM_020178chr175946 835 321 305 290 ------
NM_020180chr1811022 --1953 --
NM_020189chr8--1189 1195 --
NM_020193chr1131190 1046 413 ------
NM_020200chr101986 --178 --
NM_020205chr153477 3291 2580 742 357 1698 12947 --
NM_020228chr1122416 1877 ----3532 446 57
NM_020243chr22------142
NM_020311chr21648 ------
NM_020336chr2073625 3510 3250 2990 932 499 36 164 21538 728 --
NM_020337chr422953 713 12761 ----
NM_020341chr20--1540 ----
NM_020342chr262174 2048 1709 1023 959 118 ------
NM_020346chr111113 --11585 --
NM_020348chr1062727 1972 889 820 263 150 ----1492
NM_020357chr321418 1346 1155 ----
NM_020390chr364819 4375 3152 1822 943 727 ------
NM_020420chrY3621 417 149 1457 168 --
NM_020429chr731237 1217 25 1749 ----
NM_020443chr1116637 6214 5759 5600 5324 2757 2313 1854 1640 1275 963 24729 1424 26149 1501 --
NM_020445chr71537 ----1652
NM_020449chrX1700 ------
NM_020455chr62865 130 ------
NM_020457chr161647 ------
NM_020463chr221145 1098 ------
NM_020466chr664812 4561 3918 1628 654 33 11264 ----
NM_020473chrX21857 391 ------
NM_020475chr832336 2311 2274 ------
NM_020476chr832336 2311 2274 ------
NM_020477chr832336 2311 2274 ------
NM_020478chr832399 2374 2337 ------
NM_020480chr832336 2311 2274 ------
NM_020482chr63786 125 89 ------
NM_020529chr14154 ------
NM_020532chr21375 ------
NM_020546chr532815 2727 649 23006 893 --11135
NM_020647chr812226 --12184 --
NM_020651chr261694 1626 1426 1233 1182 364 11389 ----
NM_020654chr311500 ----11277
NM_020655chr161159 ------
NM_020666chr55889 820 757 598 581 ------
NM_020696chr31105 ------
NM_020698chr1252500 600 341 328 36 --22036 1042 --
NM_020699chr185196 4957 4482 2085 1665 1630 889 569 ------
NM_020708chr2032061 2020 215 1673 11746 --
NM_020711chr222234 1632 1173 22650 421 12262
NM_020715chr1421671 661 ------
NM_020718chr1675316 4300 2166 1664 1465 1409 1340 25626 2199 36142 2599 1728 --
NM_020724chr472352 2199 2135 1975 498 199 158 12566 12656 --
NM_020726chr51253 ------
NM_020727chr2174006 3801 3487 3432 3233 1456 445 23312 1156 ----
NM_020732chr621015 854 ------
NM_020734chr1223152 501 ------
NM_020739chr1533869 3446 118 13406 1245 --
NM_020755chr61206 ------
NM_020760chr231984 599 81 ------
NM_020766chrX41719 1610 920 830 --13427 --
NM_020768chr5--12605 1411 --
NM_020772chr17138699 8415 8380 7864 7734 7203 6775 6670 2602 2209 1989 1958 1706 --12120 --
NM_020774chr1895846 5370 5065 4920 4559 3970 3884 1942 1520 15808 ----
NM_020783chr1841748 943 533 466 ------
NM_020791chr1721409 404 --11455 --
NM_020794chr11275 ------
NM_020800chr321137 403 ----11023
NM_020801chr522314 1963 ------
NM_020810chr1422931 1231 33655 3559 2912 --1620
NM_020830chr263072 2733 2548 2103 1062 852 --1199 --
NM_020839chr3----1460 --
NM_020841chr1253341 1097 627 617 432 ------
NM_020843chr151436 --1305 --
NM_020854chr1851385 1102 514 292 219 ------
NM_020858chr1532141 1607 481 ------
NM_020859chr452520 1526 1468 1433 415 --23873 3141 --
NM_020860chr4--11134 ----
NM_020861chr621364 362 ------
NM_020871chrX2919 99 --1977 --
NM_020873chr32207 108 --1750 --
NM_020890chr31191 1167 1478 --
NM_020921chr1433686 2959 705 1165 12634 1365
NM_020922chrX61605 1436 608 480 187 72 ------
NM_020927chr1612246 22112 685 1347 1570
NM_020935chr274186 3905 3407 3076 1796 575 392 24084 1626 1502 --
NM_020948chr172884 2375 1057 1005 799 558 120 3486 383 103 22603 2464 11247
NM_020987chr10131 ------
NM_020993chr121120 ------
NM_021005chr1541127 1038 474 366 --1111 --
NM_021025chr52505 346 ------
NM_021033chr1353415 3236 2629 1356 667 12180 ----
NM_021035chr2021001 356 --178 --
NM_021090chr2234404 3573 3084 33396 1810 1668 14324 15057
NM_021097chr212982 1661 ----
NM_021109chrX2407 109 ------
NM_021109chrX2407 109 ------
NM_021110chr81752 ------
NM_021111chr9--11136 ----
NM_021116chr768134 3287 2998 1033 979 696 18334 35863 5571 1242 --
NM_021132chr1031224 530 298 ------
NM_021140chrX21018 423 ------
NM_021141chr23809 294 205 ------
NM_021144chr91556 ------
NM_021145chr73820 398 296 ----1469
NM_021163chr793555 2726 2715 2359 1060 842 759 450 236 --1557 13835
NM_021174chr8--1715 ----
NM_021183chrX31031 610 165 --11875 --
NM_021190chr131044 869 428 21354 88 ----
NM_021191chr1252575 2286 1591 882 637 --12019 --
NM_021194chr1----177 --
NM_021204chr42800 175 1764 ----
NM_021227chr42192 55 ------
NM_021239chr1431275 1054 553 ------
NM_021252chr1041589 1282 189 96 --1318 --
NM_021255chr1454053 3787 1053 832 299 --1215 --
NM_021622chr1032168 812 762 ------
NM_021627chr331242 990 979 --11110 --
NM_021629chr333587 1396 1348 --31459 852 824 --
NM_021633chr131426 1111 437 ------
NM_021639chr13766 707 321 --1204 --
NM_021643chr22553 118 ------
NM_021738chr10----1732 --
NM_021813chr6115787 4641 4573 4195 3873 3768 1270 1173 1108 592 408 15311 14225 --
NM_021814chr6197 --1477 --
NM_021818chr1431426 384 25 11469 ----
NM_021911chr535114 4953 3403 --24515 4479 12199
NM_021912chr1553464 3081 2795 758 69 ------
NM_021914chr1432468 555 525 ------
NM_021934chr121299 ------
NM_021935chr32805 53 ------
NM_021956chr611510 ------
NM_021960chr152046 1892 1049 1034 716 ------
NM_021961chr11106865 5174 4619 2850 2673 2524 2370 1658 1277 307 ------
NM_021964chr386419 4851 4208 1914 1862 801 444 374 ------
NM_021979chr141111 --2293 176 --
NM_021988chr2051554 1161 1110 532 267 ----11473
NM_021998chrX31215 1042 502 ------
NM_021999chr132695 89 ------
NM_022037chr22351 232 ------
NM_022048chr15106153 6132 5079 4734 4610 2439 2340 1917 1834 1709 44965 1894 1064 913 --11560
NM_022049chr12612 333 1732 ----
NM_022058chr232020 1469 407 1549 21593 841 --
NM_022063chr1021687 1633 ------
NM_022066chr171990 1141 ----
NM_022117chrX1136 ------
NM_022130chr521213 206 ------
NM_022131chr351325 1106 529 479 291 ----11121
NM_022133chr851490 1347 744 143 129 ------
NM_022166chr1696215 6100 5946 4761 4653 2070 2041 1386 803 1525 ----
NM_022167chr17--1266 --1824
NM_022173chr22351 232 ------
NM_022336chr252354 1897 1578 822 376 --32332 1550 616 --
NM_022351chr853889 3158 1169 753 454 12807 13826 --
NM_022442chr2051554 1161 1110 532 267 ----11473
NM_022454chr82308 173 ----1544
NM_022459chr1395868 5722 4929 4502 4061 551 510 347 73 25761 1272 16285 --
NM_022473chr1553375 3362 3021 1777 358 1322 31671 422 143 --
NM_022476chr161837 ------
NM_022566chr151587 ------
NM_022574chr71542 ------
NM_022650chr51345 1721 ----
NM_022652chr1231126 748 463 1800 ----
NM_022716chr162362 1248 1131 678 500 330 12022 22848 1016 --
NM_022726chr62637 187 21642 340 ----
NM_022745chr142792 1171 639 356 --1857 --
NM_022766chr2232074 1715 437 22572 1845 2889 734 12614
NM_022771chr121924 ------
NM_022776chr331420 397 382 ----1295
NM_022778chr121430 103 --11261 --
NM_022780chr241685 1189 661 404 11838 --1457
NM_022781chr962583 2385 2346 1073 963 28 --13224 --
NM_022802chr1041351 646 417 243 ------
NM_022826chr221183 1168 ----11094
NM_022832chr461872 745 695 329 125 115 2225 192 1506 --
NM_022841chr1532209 2203 433 11016 --11093
NM_022845chr1651558 847 780 588 226 ----11480
NM_022893chr221006 696 ------
NM_022912chr223086 301 --22605 2220 12247
NM_022913chr5155 ------
NM_022977chrX42421 1650 1035 393 1345 22655 998 --
NM_023000chr143689 603 31 ------
NM_023001chr143689 603 31 ------
NM_023012chr12----124 --
NM_023016chr222826 2770 --12893 1852
NM_023037chr1321105 843 ------
NM_023076chr1622264 329 1879 ----
NM_023929chr83997 563 418 --12416 --
NM_024007chr532829 967 960 --12046 --
NM_024052chr1732684 982 226 23079 2894 22299 344 --
NM_024090chr431939 659 170 --11251 --
NM_024094chr84848 840 343 252 --1273 --
NM_024311chr171162 1700 ----
NM_024334chr331863 745 692 --1542 --
NM_024344chr15----1493 --
NM_024345chr955840 5806 5788 4084 609 --199 --
NM_024408chr14891 853 816 610 12808 1222 --
NM_024423chr1882910 1617 1080 955 887 621 447 238 12660 11425 --
NM_024429chr741011 770 268 46 --1711 --
NM_024523chr741345 1166 1090 127 1425 11242 1494
NM_024524chr352947 2778 2485 2214 1068 --3421 396 309 --
NM_024529chr12231 200 ------
NM_024539chrX2848 214 --11285 11030
NM_024569chr141063 647 636 47 --1709 --
NM_024594chr541789 1757 1305 734 11517 1371 --
NM_024613chr8----21421 651 11486
NM_024615chr5----1242 --
NM_024624chr251547 1167 645 325 243 ----21302 366
NM_024632chr5------1111
NM_024646chr133915 2716 120 --21547 296 --
NM_024665chr353563 1825 461 415 258 14205 ----
NM_024692chr221329 1254 ------
NM_024705chr131257 ------
NM_024721chr842535 995 974 663 ------
NM_024740chr1194201 4025 3637 3371 2951 1430 161 149 102 --13510 --
NM_024744chr222452 1794 2282 112 ----
NM_024755chr151295 ------
NM_024798chr1532162 1132 956 12362 --1965
NM_024803chr101305 ------
NM_024824chr144171 124 43 36 1534 1164 --
NM_024837chr151691 21656 76 11720 --
NM_024920chr431420 1244 644 --159 --
NM_024927chr172199 152 ------
NM_024930chr532045 693 408 --1417 12786
NM_024949chr484853 4758 4410 3327 3219 1809 1459 1185 21965 1860 14029 --
NM_024989chr2116888 6248 3073 3022 2720 2203 1588 1325 441 284 111 17653 35760 1617 727 1310
NM_025027chr193913 487 371 ------
NM_025040chr1952032 1536 489 452 356 ------
NM_025047chr32325 21 ------
NM_025054chr844125 3929 2854 291 ------
NM_025077chr11232 ----1213
NM_025126chr121501 ------
NM_025133chr221186 851 ------
NM_025134chr1672568 2415 2146 1867 612 553 183 12475 1810 --
NM_025141chr152507 482 ------
NM_025146chr342687 2508 1767 607 11858 ----
NM_025147chr23974 952 43 ------
NM_025160chr173943 2633 1583 1549 1086 617 358 23202 425 ----
NM_025179chr174967 4278 3478 3067 3054 165 60 --11973 --
NM_025181chr22224 68 2115 100 ----
NM_025184chrX--1681 ----
NM_025187chr16------1248
NM_025191chr162881 2817 2707 1321 1300 365 --13473 --
NM_025205chr41243 ------
NM_025211chr9132 ------
NM_025235chr1021523 139 ------
NM_025236chr6----124 --
NM_025260chr6130 ------
NM_030621chr1464184 3727 3558 1569 1322 1190 --1127 --
NM_030625chr1042098 2054 284 218 --1303 1114
NM_030627chr544089 2628 229 109 ------
NM_030637chr142192 163 1215 ----
NM_030647chr776115 5690 4864 3995 547 515 94 --21678 959 21823 1502
NM_030648chr455195 4190 1463 643 271 --11568 --
NM_030660chr1421500 356 ------
NM_030674chr1275030 4563 3864 2103 1437 1055 88 1797 14321 13840
NM_030751chr1021434 679 --1263 --
NM_030751chr1021434 679 --1263 --
NM_030752chr61208 ------
NM_030755chr1463001 2166 1083 774 607 136 --2991 433 3646 287 174
NM_030758chr2211091 ------
NM_030762chr1251671 1359 1252 378 101 11319 ----
NM_030806chr159376 8315 5853 3154 1419 19360 38520 8281 6209 16179
NM_030816chr111340 3904 777 234 12752 --
NM_030817chr1243610 2810 2380 1157 --11457 13328
NM_030820chr621054 693 --1723 --
NM_030885chr342307 1450 911 601 --12275 --
NM_030920chr152002 1698 1495 373 169 1453 ----
NM_030949chr61370 ------
NM_030953chr511397 21153 546 ----
NM_030958chr81393 ------
NM_030969chr61450 ------
NM_030978chr91380 ------
NM_031216chr1852176 1916 1387 701 627 ------
NM_031217chr113218 117 53 ------
NM_031243chr762208 1951 1808 784 387 344 11742 ----
NM_031262chr91827 ------
NM_031263chr92884 51 ------
NM_031267chr7----1348 --
NM_031268chr1675124 4981 3956 3817 3395 1905 1101 1992 11404 --
NM_031271chr821374 40 ------
NM_031284chr15--1862 ----
NM_031291chr41682 ------
NM_031296chr432604 2168 809 --1159 --
NM_031411chr551994 923 396 371 252 --2650 191 11946
NM_031419chr321390 1302 ------
NM_031427chr1465125 4403 3859 884 341 104 14501 22031 413 --
NM_031435chr1243275 2314 490 97 12338 ----
NM_031442chrX53145 2239 2229 1974 111 ------
NM_031443chr71375 ------
NM_031461chr82499 151 ------
NM_031463chr1652316 2019 1571 330 25 ------
NM_031476chr1652718 2076 1101 1064 909 ------
NM_031483chr2042608 1354 1205 306 1498 1188 1650
NM_031844chr183890 3696 3674 3617 2881 2648 1651 498 13423 ----
NM_031845chr262299 2256 1175 1085 1028 474 21284 439 ----
NM_031847chr262299 2256 1175 1085 1028 474 21284 439 ----
NM_031849chr551994 923 396 371 252 --2650 191 11946
NM_031850chr31728 1699 ----
NM_031850chr31728 1699 ----
NM_031857chr551994 923 396 371 252 --2650 191 11946
NM_031860chr551994 923 396 371 252 --2650 191 11946
NM_031942chr261213 978 914 861 497 56 ------
NM_031953chr4--1471 ----
NM_031989chr121104 ------
NM_032012chr954770 4748 4383 4214 257 11592 ----
NM_032042chr53906 728 587 ------
NM_032049chr31728 1699 ----
NM_032049chr31728 1699 ----
NM_032088chr531736 1216 567 ------
NM_032092chr531736 1216 567 ------
NM_032102chr112552 478 21913 144 1920 --
NM_032105chr177432 3250 2984 2672 1473 552 338 --38058 6516 1655 15728
NM_032109chr521502 1018 ------
NM_032132chr12129 111 ------
NM_032145chr611645 11257 1547 --
NM_032153chr352402 2319 2091 1107 512 21030 568 ----
NM_032160chr18104230 3635 3301 3130 672 644 451 306 242 75 13670 11340 --
NM_032175chr541859 1610 701 582 ------
NM_032186chr121272 218 2494 31 ----
NM_032189chr1334944 4747 1990 --15073 --
NM_032208chr243332 1250 901 59 --13367 --
NM_032217chr421256 366 ------
NM_032221chr2032051 304 40 --11578 11467
NM_032228chr1111355 11156 ----
NM_032229chr132762 200 ------
NM_032233chr141788 1569 ----
NM_032246chr1521169 361 ------
NM_032288chr332178 847 725 11777 22272 1834 --
NM_032291chr161744 1732 1559 1327 792 747 ------
NM_032315chr1------184
NM_032321chr263220 2461 794 779 465 343 144 --12037
NM_032361chr54362 331 58 38 ------
NM_032364chr121133 167 1924 --
NM_032373chr10105119 4610 4527 4369 4160 1672 1269 1252 1228 1000 ------
NM_032403chr531736 1216 567 ------
NM_032438chr641587 452 262 94 --11388 --
NM_032439chr1011557 ------
NM_032440chr1032821 1989 1066 --12107 --
NM_032456chr4133 --1663 1478
NM_032457chr421085 316 ------
NM_032458chrX53391 1228 1202 1042 543 1515 1670 --
NM_032466chr821535 648 ------
NM_032505chr352407 1124 1051 937 624 2770 582 ----
NM_032507chr61227 ------
NM_032509chr872406 2044 1745 1692 1685 544 451 1985 11852 --
NM_032521chr2072605 2463 2271 1264 1078 897 442 1152 --1399
NM_032539chrX2683 169 ------
NM_032552chr911841 ------
NM_032558chr921228 945 ----1122
NM_032575chr1612040 ------
NM_032590chr1231155 768 127 ------
NM_032632chr1421958 1839 ------
NM_032682chr373608 2611 2456 2296 1463 690 105 ------
NM_032704chr12197 ------
NM_032765chr51189 ------
NM_032778chr363298 2521 1142 609 235 91 33361 2105 1224 11189 12086
NM_032801chr1142362 978 948 310 ----22333 691
NM_032810chr1021416 38 ------
NM_032818chr931789 963 533 11924 11040 --
NM_032859chr1361159 1137 904 838 713 275 --13041 --
NM_032870chr61101 ------
NM_032884chr1----2338 91 --
NM_032900chr1013836 --1930 --
NM_032905chr101349 ------
NM_032906chr43898 812 660 ------
NM_032918chr124894 381 318 152 --1947 --
NM_032932chr1736472 4652 4186 36366 1616 454 24870 278 12485
NM_032978chr1841115 951 262 75 ------
NM_032979chr1841115 951 262 75 ------
NM_032981chr1841115 951 262 75 ------
NM_032991chr431357 1191 33 ------
NM_033020chr174862 4701 4155 3692 3257 3105 218 13608 23749 207 --
NM_033030chr221586 1504 ------
NM_033067chr12623 164 1665 ----
NM_033082chr12--1159 ----
NM_033083chr393332 2734 1295 1008 495 400 368 214 150 22481 121 ----
NM_033132chr1322148 1992 ------
NM_033138chr762077 2053 1815 1693 1445 325 --11711 11901
NM_033139chr762077 2053 1815 1693 1445 325 --11711 11901
NM_033140chr762077 2053 1815 1693 1445 325 --11711 11901
NM_033143chr484626 4475 4115 3961 3357 3197 3042 319 --33503 1205 1180 --
NM_033157chr762077 2053 1815 1693 1445 325 --11711 11901
NM_033177chr62111 26 ----140
NM_033181chr663067 2758 289 245 147 67 ----12770
NM_033208chr16--1127 ----
NM_033211chr531332 749 241 11697 ----
NM_033222chr921296 76 --21027 40 --
NM_033224chr7127924 6933 6209 6041 5540 5474 4980 2880 2288 1622 1147 491 12627 ----
NM_033225chr812596 22435 2274 --12233
NM_033285chr823906 1608 --12776 --
NM_033331chr973352 2821 2243 1414 1100 297 174 33531 2253 155 ----
NM_033360chr1284272 3764 3518 1432 1241 1028 622 287 14133 --11505
NM_033380chrX2367 193 ------
NM_033381chrX2367 193 ------
NM_033407chr11531 ------
NM_033425chr112103 95 12879 ----
NM_033427chr71698 --1632 --
NM_033430chr431581 967 29 ------
NM_033437chr431581 967 29 ------
NM_033505chr286218 6108 5962 4359 2389 1997 1435 910 --26362 1272 --
NM_033512chr862705 2285 2134 752 563 509 --33065 2627 2336 --
NM_033516chr921616 342 --31367 1150 371 --
NM_033624chr1252132 859 295 271 148 ----11824
NM_033632chr4--11464 1987 --
NM_033637chr1043360 2612 959 171 13173 33038 3003 1453 12581
NM_033656chr2156032 5694 4409 4049 1196 34341 3848 267 ----
NM_048368chr182767 294 ------
NM_052827chr1221127 193 ------
NM_052832chr862851 2591 2170 2018 1947 669 ------
NM_052851chr1342026 1814 1605 925 11635 ----
NM_052879chr1263733 3369 1515 1391 1261 640 33594 722 629 22544 451 --
NM_052896chr141010 798 655 254 --42316 884 859 823 --
NM_052905chr211213 ------
NM_052913chr611043 ------
NM_052917chr253038 1232 681 515 94 ------
NM_052918chr1053519 3375 3021 2272 1155 1633 --12896
NM_052927chr532254 1568 341 --11402 --
NM_052951chr201212 ------
NM_052966chr173142 3021 2733 1433 1138 416 23 --23809 3572 --
NM_053002chr311206 ------
NM_053016chr977512 7022 5492 5164 5152 959 513 ------
NM_053023chr1133016 2486 889 ----1870
NM_053035chr71107 ------
NM_053043chr7105848 5803 5776 4856 1499 1044 737 436 247 97 1309 34424 2184 1758 --
NM_053046chr191554 ------
NM_053064chr1432595 2376 807 ------
NM_054016chr131829 186 54 ------
NM_054016chr131829 186 54 ------
NM_054016chr131829 186 54 ------
NM_057175chr41643 ------
NM_057749chr831251 1238 74 ------
NM_058170chr111355 ------
NM_058172chr421788 566 --1293 --
NM_078474chr152507 482 ------
NM_078625chr6--1324 1377 21037 79
NM_079421chr191122 ------
NM_080546chr942029 1714 829 388 ------
NM_080597chr183692 179 44 --1889 --
NM_080629chr131540 1488 79 ------
NM_080630chr131540 1488 79 ------
NM_080645chr651541 701 631 329 95 2849 37 ----
NM_080654chr1141095 944 73 21 --2212 161 --
NM_080678chr22635 43 ------
NM_080732chr191554 ------
NM_080759chr1342481 1640 165 137 --12239 1300
NM_080760chr1342481 1640 165 137 --12239 1300
NM_080832chrX296 51 ------
NM_080867chr1484716 4355 4218 3585 3293 1838 1140 739 1481 13500 --
NM_080911chr1241024 924 839 338 --11014 --
NM_130391chr952782 2729 2356 2332 56 --23552 3150 --
NM_130392chr952782 2729 2356 2332 56 --23552 3150 --
NM_130393chr952782 2729 2356 2332 56 --23552 3150 --
NM_130434chr152798 370 ------
NM_130436chr2132463 1767 21 --22737 599 1806
NM_130438chr2143040 2344 598 546 --23314 1176 --
NM_130439chr1021793 337 12047 --1874
NM_130439chr1021793 337 12047 --1874
NM_130798chr15181 ----11178
NM_133170chr20147811 7755 7119 6844 6721 6561 6159 5746 3177 2150 2004 1311 514 319 25621 967 ----
NM_133265chrX33415 2625 390 ------
NM_133334chr466217 5851 5099 5091 3892 351 --15392 --
NM_133370chr433488 2374 1023 13441 ----
NM_133378chr23306 277 239 ------
NM_133432chr23306 277 239 ------
NM_133433chr52748 307 ------
NM_133437chr23306 277 239 ------
NM_133445chr983769 3136 1518 1366 1233 188 115 109 --32396 1465 133 --
NM_133468chr72692 354 --12242 --
NM_133476chr12----1362 --
NM_133478chr2------21024 719
NM_133493chr654580 3586 3295 1673 908 ------
NM_133638chr531289 1004 288 ------
NM_133646chr253768 1474 1204 326 70 22137 1717 ----
NM_133647chr1563870 3288 3155 2387 813 233 ----13381
NM_134428chr91364 ------
NM_138270chrX73458 3397 3361 1232 1156 627 100 --12779 1510
NM_138274chr6130 ------
NM_138277chr61200 ------
NM_138285chr21523 ------
NM_138288chr1432102 1589 438 --12029 --
NM_138300chr111070 ------
NM_138346chr11159 ------
NM_138348chr5166307 6299 5947 5850 5435 5356 4619 4529 4041 1553 1290 926 802 508 436 181 --14721 16255
NM_138370chr2--1734 ----
NM_138391chr17939 816 803 783 353 268 65 ------
NM_138395chr211188 ------
NM_138426chr722268 524 --11787 --
NM_138444chr1384796 4115 1462 1344 859 693 615 321 --24054 1082 --
NM_138459chr683635 3265 3213 2445 1420 1174 893 314 13336 1651 --
NM_138468chr296306 6156 5899 4777 2513 2021 1936 547 260 ------
NM_138473chr12115194 5163 5040 4829 4667 4609 4215 3605 1175 1026 972 --14771 --
NM_138569chr6139 ------
NM_138633chr661513 599 418 235 98 61 ------
NM_138635chr742885 2815 2630 555 ----1333
NM_138638chr1432468 555 525 ------
NM_138713chr1698146 6702 6572 6354 5288 2983 2103 1916 1067 22659 1206 ----
NM_138714chr1698146 6702 6572 6354 5288 2983 2103 1916 1067 22659 1206 ----
NM_138731chr1474104 2888 2605 1592 1199 761 21 1727 ----
NM_138735chr221093 490 ------
NM_138771chr7----21502 200 --
NM_138779chr131255 ------
NM_138782chr53453 336 257 1842 --21762 415
NM_138799chr231695 1661 82 ------
NM_138811chr741071 830 317 200 ------
NM_138927chr211937 1958 --1744
NM_138931chr33851 802 325 ------
NM_138962chr17169 ------
NM_138981chr41751 ------
NM_139045chr91643 ------
NM_139048chr311039 --1970 --
NM_139053chr11102 ------
NM_139056chr531151 1138 968 ------
NM_139072chr24577 327 311 151 ------
NM_139157chr112463 285 ------
NM_139168chr52495 266 1430 1321 --
NM_139321chr2043995 3044 1653 842 --14175 --
NM_144567chr132619 2085 505 ----12767
NM_144571chr485594 5464 5246 4440 2422 1370 961 736 --1933 16700
NM_144595chr131244 ------
NM_144599chr1595490 5347 4737 4560 4185 3926 1883 451 128 --34971 4810 3823 --
NM_144604chr162492 125 ------
NM_144632chr252362 1898 1785 348 246 --11738 11510
NM_144645chr41197 ------
NM_144668chr121139 ------
NM_144721chr452680 2623 2132 1087 610 --11929 --
NM_144728chr11322 --1111 --
NM_144729chr11322 --1111 --
NM_144767chr1594637 4286 3848 3458 3260 2820 1662 478 80 --21579 1220 1350
NM_144777chr13159 ------
NM_144778chr1342696 740 574 272 --12406 22425 999
NM_144949chr242534 2428 1851 248 ------
NM_144979chr41190 ------
NM_145000chr52251 121 ------
NM_145012chr10--153 ----
NM_145055chr1872811 2690 2659 1106 1096 577 555 13342 23816 3121 --
NM_145117chr1122782 2513 ------
NM_145159chr141233 ------
NM_145174chr2241474 1147 1086 173 ------
NM_145175chr231069 1018 178 ------
NM_145247chr103599 576 523 ------
NM_145251chr1421327 249 --1388 --
NM_145259chr286806 5814 5337 4874 2727 1983 1845 313 ----12101
NM_145284chrX62502 2310 2227 1798 303 99 ------
NM_145292chr7142 --181 --
NM_145307chr1044589 4230 3249 1665 13392 ----
NM_145320chr743047 937 439 140 2923 522 ----
NM_145321chr743047 937 439 140 2923 522 ----
NM_145322chr743047 937 439 140 2923 522 ----
NM_145341chr1051229 1209 686 292 73 ------
NM_145686chr272803 2708 2081 1158 908 896 38 12551 --11071
NM_145687chr272803 2708 2081 1158 908 896 38 12551 --11071
NM_145698chr1052021 1973 578 131 90 12036 ----
NM_145719chr111377 ----1149
NM_145735chr1322143 1864 12479 ----
NM_145753chr321666 1146 ------
NM_145808chr763124 2556 2413 2066 708 699 ----1351
NM_145810chr261213 978 914 861 497 56 ------
NM_145859chr3------175
NM_145860chr3------175
NM_145891chr1641740 1387 1332 221 ------
NM_145892chr1641740 1387 1332 221 ------
NM_145893chr1641862 1509 1454 343 ------
NM_147156chr1011206 --1241 --
NM_147171chr71452 ------
NM_147175chrX32200 124 111 ------
NM_147185chr71452 ------
NM_147189chr852372 1485 346 215 66 ------
NM_147223chr232117 852 341 ------
NM_147233chr231934 669 158 ------
NM_148174chr842075 679 367 225 --11475 --
NM_148894chr41218 ------
NM_148955chr15125310 5292 5043 4980 2273 2051 1442 1113 821 801 513 492 --26511 451 1897
NM_152221chr221140 ------
NM_152236chr221279 ------
NM_152237chr2211773 ------
NM_152238chr11361 ------
NM_152261chr1242289 1950 518 279 22322 289 12168 --
NM_152265chr121291 65 1227 ----
NM_152271chr851135 926 799 460 438 1854 1953 --
NM_152275chr252265 1514 675 540 128 ------
NM_152281chr11903 ------
NM_152283chr52712 21 ------
NM_152332chr143666 439 371 12720 2530 275 --
NM_152342chr16188 ------
NM_152344chr1731252 1189 334 ------
NM_152352chr1872677 2517 2439 2411 1005 373 275 ------
NM_152380chr131487 1343 50 ------
NM_152381chr2----143 --
NM_152387chr22761 728 1227 ----
NM_152388chr263802 3213 2859 2840 2804 1129 --23103 443 --
NM_152400chr43737 692 411 --192 --
NM_152409chr532865 871 350 --13154 --
NM_152414chr831523 1219 665 ------
NM_152437chr1222256 1650 ----11772
NM_152512chr222461 427 ------
NM_152519chr241722 1653 1503 623 --1149 --
NM_152520chr2181 ------
NM_152522chr22955 746 ------
NM_152529chr263935 3850 3537 1303 814 164 --11547 --
NM_152534chr31136 ------
NM_152549chr52475 145 ------
NM_152556chr742097 939 188 130 ------
NM_152563chr1111041 ----11131
NM_152594chr1562362 2063 1949 1888 1498 891 ------
NM_152622chr533381 3076 1139 13330 --189
NM_152624chr5126602 6463 6053 5563 5461 4813 2906 2529 2211 1794 226 164 --36227 5683 620 12175
NM_152629chr984107 3042 2848 2707 2568 1567 1217 342 11255 1676 --
NM_152630chrX160 ------
NM_152641chr123713 457 79 1603 ----
NM_152672chr31197 ------
NM_152678chr332341 2261 587 ------
NM_152680chr421742 50 --1662 12334
NM_152694chrX--1319 1880 --
NM_152699chr342707 2640 530 193 ----21359 28
NM_152705chr132304 212 --1465 --
NM_152707chr103734 329 255 ------
NM_152713chr11194 ------
NM_152716chr1121618 115 --11011 --
NM_152722chr1141599 1446 1410 37 ------
NM_152756chr533884 3473 2856 --1924 --
NM_152758chr882835 2800 2726 2518 2245 2208 2073 486 ------
NM_152773chr3199 ------
NM_152787chrX52860 2417 1393 1257 173 22723 2536 ----
NM_152789chr711226 --11184 --
NM_152793chr7114725 4671 4319 3368 1423 1372 952 913 699 415 292 13735 ----
NM_152826chr15125310 5292 5043 4980 2273 2051 1442 1113 821 801 513 492 --26511 451 1897
NM_152836chr851490 1347 744 143 129 ------
NM_152837chr851490 1347 744 143 129 ------
NM_152857chr62674 338 1374 1346 --
NM_152858chr62674 338 1374 1346 --
NM_152890chr121126 940 ------
NM_152924chr15126639 6317 5856 5172 2292 1966 1609 1366 1289 672 551 73 --11739 --
NM_152996chr142011 1809 1507 369 ------
NM_152998chr7--196 ----
NM_153020chr621211 1122 ------
NM_153050chr2234404 3573 3084 33396 1810 1668 14324 15057
NM_153051chr2234404 3573 3084 33396 1810 1668 14324 15057
NM_153182chr363298 2521 1142 609 235 91 33361 2105 1224 11189 12086
NM_153183chrX11276 --11137 --
NM_153184chr351859 1515 1428 1220 383 ------
NM_153188chr585493 3776 2204 1924 1748 982 488 474 13896 --12041
NM_153207chr1254081 3900 3042 2922 1344 --23074 2514 --
NM_153223chr521020 36 --21436 295 1493
NM_153262chr132919 1126 725 21079 410 ----
NM_153343chr432099 1783 487 --11721 1671
NM_153362chr63904 731 670 ------
NM_153371chr1311964 11922 12021 1878
NM_153456chr1386283 5936 4422 4192 1883 1424 478 322 15338 ----
NM_153490chr171255 ------
NM_153498chr101134 ------
NM_153607chr532287 960 784 ----12191
NM_153616chr1532141 1607 481 ------
NM_153617chr1532141 1607 481 ------
NM_153618chr1532141 1607 481 ------
NM_153619chr1553379 2845 2400 344 157 ------
NM_153633chr12--1627 ----
NM_153634chr121107 11567 ----
NM_153649chr132243 1419 595 ------
NM_153682chr21148 ------
NM_153686chr462337 1985 1850 1773 299 256 --1577 --
NM_153687chr1211453 --11316 --
NM_153695chr92278 201 ------
NM_153702chr41244 ------
NM_153704chr83466 388 72 1408 ----
NM_153706chr51220 ------
NM_153715chr71929 ------
NM_153764chr117984 970 817 346 311 115 33 ------
NM_153765chr117984 970 817 346 311 115 33 ------
NM_153766chr117984 970 817 346 311 115 33 ------
NM_153767chr117984 970 817 346 311 115 33 ------
NM_153810chr1064899 3994 3544 3453 1188 524 --11055 11829
NM_153828chr21375 ------
NM_153831chr82982 158 ------
NM_170606chr711550 ------
NM_170665chr1264550 4292 3611 1244 1059 487 --14083 --
NM_170674chr15----142 --
NM_170677chr15----142 --
NM_170679chr551272 1106 374 208 186 1156 1873 --
NM_170709chr842232 1991 309 39 ------
NM_170710chr462622 2267 621 541 527 287 ------
NM_170711chr19--1909 ----
NM_170721chr1721042 945 --1108 --
NM_170750chrX3793 266 249 ------
NM_170751chr621428 1268 11396 1364 --
NM_170752chr621428 1268 11396 1364 --
NM_170769chr6----124 --
NM_172058chr841799 1554 1485 1202 ------
NM_172059chr841799 1554 1485 1202 ------
NM_172060chr841799 1554 1485 1202 ------
NM_172070chr21569 11778 ----
NM_172071chr1127458 6996 6731 6209 5759 5698 5640 4785 2515 2219 1047 44 11117 ----
NM_172103chr632256 1781 989 12678 22298 621 --
NM_172105chr632256 1781 989 12678 22298 621 --
NM_172127chr42544 336 --11954 --
NM_172128chr42500 292 --11910 --
NM_172159chr33943 598 528 11682 --12036
NM_172160chr33943 598 528 11682 --12036
NM_172193chr1421201 862 ------
NM_172232chr173335 237 73 1729 ----
NM_172315chr15----142 --
NM_172316chr15----142 --
NM_173082chr61485 ------
NM_173087chr15----1493 --
NM_173088chr15----1493 --
NM_173089chr15----1493 --
NM_173090chr15----1493 --
NM_173171chr23957 475 305 ------
NM_173172chr231265 1081 613 ------
NM_173173chr23957 475 305 ------
NM_173214chr1698146 6702 6572 6354 5288 2983 2103 1916 1067 22659 1206 ----
NM_173355chr211064 --140 --
NM_173468chr4105910 5328 5073 4729 4298 2410 2125 1031 968 666 11236 1853 --
NM_173469chr1511563 ------
NM_173470chrX31046 197 56 ------
NM_173503chr171140 ------
NM_173510chr2252144 2130 872 618 91 12616 ----
NM_173511chr243200 2567 1092 237 1803 23983 715 --
NM_173515chr63869 800 661 --1157 --
NM_173519chr81438 21956 160 2578 561 --
NM_173536chr485043 4968 4315 4210 3602 3484 1076 79 ----136
NM_173546chr31654 ------
NM_173552chr341980 1709 412 348 1303 1747 --
NM_173576chr101757 ------
NM_173582chr1156327 4766 2155 836 719 11312 --21932 175
NM_173595chr12104471 4292 4270 3997 3911 3881 3506 1540 183 65 13739 11645 --
NM_173602chr1273697 3295 3205 3122 2912 2359 1312 32944 1344 361 --11242
NM_173607chr1452109 1581 1517 351 36 ------
NM_173609chr152752 36 1654 ----
NM_173644chr2031660 1489 589 --11799 --
NM_173645chr22546 35 --1491 --
NM_173654chr362322 2281 2085 1604 771 306 11632 ----
NM_173683chr821446 363 --139 --
NM_173698chrX2425 29 ------
NM_173797chr53532 406 294 --1419 --
NM_173808chr144234 1174 314 74 11521 ----
NM_173814chr151424 ------
NM_173829chr553759 2028 1032 995 623 --35617 5365 729 --
NM_173854chr112241 --1168 --
NM_174858chr131167 997 316 --11057 --
NM_174887chr171322 ------
NM_174890chr101188 ------
NM_174938chr91171 ------
NM_175056chr331583 1555 162 --12014 12176
NM_175061chr741485 1455 883 392 ----12106
NM_175607chr331397 1193 190 21549 418 ----
NM_175610chr151107 11221 1342 --
NM_175612chr331397 1193 190 21549 418 ----
NM_175736chr12137512 7423 7113 5678 5200 3076 2888 2374 2240 1935 1407 609 214 1940 36499 4737 170 11553
NM_175748chr1451820 1570 1319 605 488 ----21686 279
NM_175767chr561826 1773 1541 1439 1273 1256 ------
NM_175768chr611714 ------
NM_175854chr1382441 2183 2140 2014 1806 1014 920 861 ------
NM_175863chr621015 854 ------
NM_175910chr1912333 ------
NM_175924chr3--1161 --197
NM_177414chr12481 431 --1518 --
NM_177424chr161916 1391 626 571 414 58 ------
NM_177438chr1464184 3727 3558 1569 1322 1190 --1127 --
NM_177452chr1411687 ----12059
NM_177553chr111620 ------
NM_177925chr1252872 2606 1937 820 454 ------
NM_177947chrX11476 ------
NM_177948chrX11476 ------
NM_177966chr311902 11393 --21820 28
NM_177967chr1311080 --1182 --
NM_177990chr20--1540 ----
NM_178006chr1342026 1814 1605 925 11635 ----
NM_178007chr1342026 1814 1605 925 11635 ----
NM_178011chr1073301 2865 2363 2195 2139 327 178 ------
NM_178120chr221385 1311 ----1480
NM_178123chr22275 108 ------
NM_178151chrX96767 6156 5891 4931 4775 2499 2186 753 104 15941 17721 1908
NM_178152chrX96767 6156 5891 4931 4775 2499 2186 753 104 15941 17721 1908
NM_178153chrX96767 6156 5891 4931 4775 2499 2186 753 104 15941 17721 1908
NM_178154chr141745 ------
NM_178155chr141745 ------
NM_178156chr141745 ------
NM_178157chr141745 ------
NM_178423chr711282 ----2822 301
NM_178425chr711282 ----2822 301
NM_178426chr111640 ----1564
NM_178427chr111540 ----1464
NM_178454chr12670 312 --1788 --
NM_178498chr1173892 3801 3514 3425 3152 772 298 ------
NM_178507chr111791 ------
NM_178509chr1753025 2687 1466 1215 684 ------
NM_178539chr1211579 11359 ----
NM_178566chr921413 196 ------
NM_178812chr821588 225 ------
NM_178818chr1612116 --22266 55 1212
NM_178864chr111707 ------
NM_178868chr3----1297 --
NM_181054chr141943 ------
NM_181077chr1532201 268 145 ------
NM_181265chr462622 2267 621 541 527 287 ------
NM_181349chr731237 1217 25 1749 ----
NM_181354chr821430 118 ------
NM_181358chr163109 3005 2854 2748 1224 819 --1205 --
NM_181361chr321314 94 11415 2338 80 --
NM_181443chr2021913 454 1855 ----
NM_181453chr221373 153 --11599 --
NM_181481chr18106838 6150 6133 5996 5616 5176 4561 2745 1937 787 1203 16964 --
NM_181482chr18106838 6150 6133 5996 5616 5176 4561 2745 1937 787 1203 16964 --
NM_181483chr18106838 6150 6133 5996 5616 5176 4561 2745 1937 787 1203 16964 --
NM_181521chr16116897 6186 4511 2795 2578 2018 1485 1273 442 247 56 26107 4761 37047 4836 1786 14993
NM_181552chr72742 678 ------
NM_181642chr153425 253 151 ------
NM_181655chr173525 297 66 ------
NM_181659chr2073310 2467 2456 2250 2117 1054 759 ------
NM_181659chr2073310 2467 2456 2250 2117 1054 759 ------
NM_181674chr52372 55 ------
NM_181675chr52372 55 ------
NM_181676chr52372 55 ------
NM_181677chr52372 55 ------
NM_181678chr52372 55 ------
NM_181698chr101516 153 ----
NM_181714chr651742 1531 1432 277 177 --1407 --
NM_181762chrX1139 ------
NM_181777chrX1139 ------
NM_181780chr321534 1379 ------
NM_181836chr542531 2311 1860 1638 12196 ----
NM_181839chr811320 ------
NM_181861chr1262639 1044 599 547 512 218 12481 ----
NM_181864chr11125 ------
NM_181865chr11125 ------
NM_181866chr11125 ------
NM_181868chr1262639 1044 599 547 512 218 12481 ----
NM_181869chr1262724 1129 684 632 597 303 12566 ----
NM_182398chr14170 ------
NM_182485chr453692 3651 3321 902 316 ------
NM_182493chr1664796 4466 3981 3285 1545 1332 --1686 --
NM_182503chr654928 3567 1496 1387 373 14502 11655 24362 176
NM_182540chrX3763 677 33 ------
NM_182551chr233497 3216 1357 1686 ----
NM_182559chr121246 ------
NM_182565chr171206 ------
NM_182569chr171242 ------
NM_182646chr453692 3651 3321 902 316 ------
NM_182648chr142727 520 ----1206
NM_182664chr152242 960 682 271 79 ----1595
NM_182678chr21451 ------
NM_182689chr11316 ------
NM_182715chr7----1392 --
NM_182757chr683320 2974 2744 2603 2310 2169 728 392 11304 ----
NM_182763chr152035 1881 1038 1023 705 ------
NM_182765chr1052293 1847 740 282 127 ------
NM_182789chr52798 340 21060 419 ----
NM_182796chr51742 1238 ----
NM_182797chr203673 472 451 ------
NM_182811chr202763 421 ------
NM_182830chr143728 387 58 12111 ----
NM_182848chr133486 332 33 ------
NM_182907chr61411 ------
NM_182920chr331160 922 225 ------
NM_182948chr142695 2609 821 127 ------
NM_182964chr1122782 2513 ------
NM_182976chr11807 1739 1770 --
NM_183004chr1483818 3672 2525 2505 976 507 207 147 12679 12804 11226
NM_183043chr132894 357 1119 ----
NM_183044chr132894 357 1119 ----
NM_183049chr42402 109 ------
NM_183078chr61768 22665 1542 ----
NM_183238chr1243740 3300 3068 164 --1903 --
NM_183323chr52798 340 21060 419 ----
NM_183353chrX11036 --21216 1152 --
NM_183380chr62295 219 ----152
NM_183381chr3--1996 ----
NM_183383chr3--1996 ----
NM_183384chr3--1996 ----
NM_183416chr131577 551 156 --21934 310 --
NM_183419chr82419 79 ------
NM_194247chr263755 2798 1556 1100 270 208 11311 ----
NM_194250chr21176 ------
NM_194271chr121501 ------
NM_194285chr1143409 2162 1244 693 --12699 --
NM_194286chr1264677 4584 4271 4209 958 307 25550 5224 11444 --
NM_194291chr822918 784 --12939 11027
NM_194292chr12666 94 ------
NM_194298chr1011716 ----21859 281
NM_194314chr174321 2001 1850 1532 1517 1469 1399 --1712 1383
NM_194317chr232745 1739 185 --1633 12236
NM_194328chr962583 2385 2346 1073 963 28 --13224 --
NM_194329chr962583 2385 2346 1073 963 28 --13224 --
NM_194330chr962583 2385 2346 1073 963 28 --13224 --
NM_194332chr962583 2385 2346 1073 963 28 --13224 --
NM_194358chr1241327 639 236 159 --11624 --
NM_194359chr1241327 639 236 159 --11624 --
NM_194434chr18105801 4986 4909 4362 2309 2181 2028 1001 814 321 24952 2080 43809 1823 1437 1094 --
NM_194454chr721364 547 ------
NM_194455chr721364 547 ------
NM_194456chr721364 547 ------
NM_194463chrX2848 214 --11285 11030
NM_197968chr13186 ------
NM_197970chr221586 1504 ------
NM_198057chrX7999 808 356 346 333 191 63 1316 ----
NM_198128chr1872325 2192 1991 1889 1841 1793 942 ------
NM_198158chr341080 1004 671 376 ------
NM_198159chr341080 1004 671 376 ------
NM_198177chr341080 1004 671 376 ------
NM_198178chr341080 1004 671 376 ------
NM_198181chr1532585 2050 354 11924 ----
NM_198215chr1041176 334 148 50 --2944 522 --
NM_198217chr1351130 1103 841 252 199 ------
NM_198218chr1351130 1103 841 252 199 ------
NM_198219chr1351130 1103 841 252 199 ------
NM_198240chr1211029 11150 ----
NM_198261chr12----124 --
NM_198262chr12----124 --
NM_198268chr163109 3005 2854 2748 1224 819 --1205 --
NM_198269chr163109 3005 2854 2748 1224 819 --1205 --
NM_198270chrX43403 2312 2298 87 1238 --13479
NM_198279chrX51069 495 485 341 232 ------
NM_198336chr771821 1740 1616 653 602 563 103 ------
NM_198391chr201167 ------
NM_198465chrX62880 2739 1922 1863 281 52 ------
NM_198489chr111131 ------
NM_198503chr12520 59 --12038 --
NM_198504chr32889 322 ------
NM_198513chr841957 1896 507 371 ------
NM_198531chr181665 ------
NM_198549chr132841 483 376 23129 657 ----
NM_198566chr52205 34 ------
NM_198581chr2107510 6937 6929 6450 5491 4862 2976 2718 2463 879 --24771 4738 26234 2134
NM_198793chr354180 3084 1638 993 159 ------
NM_198794chr1421439 1140 --1212 --
NM_198889chr421256 366 ------
NM_198900chr12137512 7423 7113 5678 5200 3076 2888 2374 2240 1935 1407 609 214 1940 36499 4737 170 11553
NM_198904chr541933 1303 573 43 ------
NM_198935chr2022415 391 13218 ----
NM_198995chr182553 546 --1394 --
NM_199039chr431024 1001 962 --1886 --
NM_199132chr1941485 798 547 193 11405 ----
NM_199144chr2051554 1161 1110 532 267 ----11473
NM_199167chr181353 ------
NM_199188chr1263733 3369 1515 1391 1261 640 33594 722 629 22544 451 --
NM_199189chr52838 332 ------
NM_199190chr1263733 3369 1515 1391 1261 640 33594 722 629 22544 451 --
NM_199203chr2051554 1161 1110 532 267 ----11473
NM_199205chr8--1715 ----
NM_199282chr172314 174 21405 351 ----
NM_199320chr41427 --1176 --
NM_199320chr41427 --1176 --
NM_199324chr443333 3312 847 336 --22353 262 21363 346
NM_199351chr1--1198 ----
NM_199421chr1484716 4355 4218 3585 3293 1838 1140 739 1481 13500 --
NM_199436chr2103044 2805 2566 2455 2028 1122 558 481 114 95 ----12402
NM_199437chr1122416 1877 ----3532 446 57
NM_199438chr1122416 1877 ----3532 446 57
NM_199439chr1122416 1877 ----3532 446 57
NM_199459chr10----1460 --
NM_199461chr1043301 2746 392 223 --23078 56 --
NM_199482chr231982 1590 261 ------
NM_201267chr21586 ------
NM_201269chr121272 218 2494 31 ----
NM_201278chr1152142 1787 832 276 72 --12358 --
NM_201280chr62653 140 11260 ----
NM_201281chr1152142 1787 832 276 72 --12358 --
NM_201437chr841530 1220 1101 1002 ------
NM_201570chr1051519 650 565 75 42 1631 11783 --
NM_201571chr1051519 650 565 75 42 1631 11783 --
NM_201572chr1051519 650 565 75 42 1631 11783 --
NM_201590chr1051519 650 565 75 42 1631 11783 --
NM_201591chr431816 1737 767 ------
NM_201592chr431816 1737 767 ------
NM_201593chr1051519 650 565 75 42 1631 11783 --
NM_201595chr14--164 ----
NM_201596chr1051519 650 565 75 42 1631 11783 --
NM_201597chr1051519 650 565 75 42 1631 11783 --
NM_201613chr12--2727 111 ----
NM_201624chr141181 1125 247 216 1897 ----
NM_201629chr93658 539 209 ------
NM_201999chr421029 986 --1776 --
NM_203301chr1421455 1327 ------
NM_203341chr131009 816 356 ------
NM_203350chr141500 1426 1086 671 ------
NM_203372chr23335 296 24 --31477 643 353 --
NM_203394chr1252459 2276 1673 1665 517 --11890 --
NM_203403chr92981 934 ----1361
NM_203406chr552162 1966 1131 1124 1074 --12464 --
NM_203458chr153439 3123 3070 1368 786 11199 ----
NM_203459chr122042 928 --22311 2141 12227
NM_203504chr452297 1873 1852 567 22 ------
NM_203505chr452297 1873 1852 567 22 ------
NM_205833chrX179 ------
NM_205836chr52677 603 1584 ----
NM_205842chr2195 ------
NM_205860chr132838 2007 893 --21226 931 --
NM_206594chr173038 3007 2997 2236 1171 849 553 --12686 --
NM_206595chr173038 3007 2997 2236 1171 849 553 --12686 --
NM_206819chr12----1280 --
NM_206820chr12----1280 --
NM_206821chr12----1280 --
NM_206853chr653690 3542 2692 1590 167 --13577 --
NM_206854chr674951 4803 3953 3426 1428 1193 515 --14838 --
NM_206855chr6115916 5768 4918 4391 4048 4002 3944 2393 2158 1480 199 1400 25803 80 --
NM_206866chr2172783 2556 2435 2373 2020 391 46 1425 1670 --
NM_206876chr223570 1266 1648 ----
NM_206909chr8118093 7785 7011 5456 2594 1870 1529 1391 980 810 301 15680 198 17072
NM_207015chr332002 1794 527 --128 --
NM_207043chr14846 573 355 169 12132 ----
NM_207044chr14846 573 355 169 12132 ----
NM_207047chr14846 573 355 169 12132 ----
NM_207299chr91804 ------
NM_207304chr1342583 627 461 159 --12293 22312 886
NM_207322chr15--11822 ----
NM_207344chr1221394 496 ------
NM_207361chr1366257 5164 4087 2121 486 449 1145 12166 --
NM_207371chr102488 387 --1439 --
NM_207387chr1711764 ------
NM_207406chr4106573 6418 6218 5714 5633 4770 4376 1560 1500 1466 15819 1170 12059
NM_207418chr1_random21009 747 1163 ----
NM_207520chr21375 ------
NM_207521chr21375 ------
NM_207647chr932361 891 533 22329 1752 12443 --
NM_207660chr144171 124 43 36 1534 1164 --
NM_207661chr144171 124 43 36 1534 1164 --
NM_207662chr144171 124 43 36 1534 1164 --
NM_212460chr742013 1897 770 520 2291 48 ----
NM_212465chr15----1493 --
NM_212471chr1722016 844 12227 --1708
NM_212472chr1722016 844 12227 --1708
NM_212543chr31747 ------
NM_213589chr294571 4278 3758 3705 3446 1898 1877 1735 1367 12052 11584 --
NM_213608chr21132 ------
NM_213618chr112463 285 ------
NM_213654chr331197 1115 404 ------