TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5006-3p
miRNA Sequence: UUUCCCUUUCCAUCCUGGCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr696794 5970 5609 5409 1459 1322 817 782 255 44925 2046 1206 841 15415 16725
NM_000337chr521365 431 11395 45110 4455 1727 1488 36561 5152 849
NM_000461chr3199 53925 2905 1498 462 115 1121 11742
NM_000486chr1272679 2534 1016 287 271 255 180 32434 840 311 2648 619 1614
NM_000555chrX86538 6089 5472 5312 2468 2460 1798 763 17102 --26761 2810
NM_000599chr283788 3781 3440 3412 3268 3014 1778 1729 44006 1651 1507 1481 64038 4033 4011 2966 299 269 21598 109
NM_000618chr1236078 5138 1324 --1976 35682 1705 1005
NM_000618chr1236078 5138 1324 --1976 35682 1705 1005
NM_000719chr12136596 6585 4759 4368 4307 4284 2696 2571 2230 2066 802 643 486 34381 2585 1784 65843 5572 4517 2431 1789 441 25816 1491
NM_001001669chr592361 2227 884 840 773 765 684 677 556 169 62437 2264 2172 1784 873 101 12309
NM_001005404chr1761363 1302 1003 879 783 414 1383 12746 23270 389
NM_001005473chr576029 6010 5447 1443 1367 1057 1037 1707 71887 1781 1014 973 961 949 108 1138
NM_001007226chr1741452 1332 1167 1037 2185 171 1116 21481 403
NM_001007227chr1741452 1332 1167 1037 2185 171 1116 21481 403
NM_001007228chr1741452 1332 1167 1037 2185 171 1116 21481 403
NM_001007229chr1741452 1332 1167 1037 2185 171 1116 21481 403
NM_001007230chr1741452 1332 1167 1037 2185 171 1116 21481 403
NM_001008220chr5103850 3585 3381 3137 2981 2482 1136 1117 833 772 --53098 2748 467 458 220 23025 95
NM_001008701chr19132266 2122 2072 2065 1992 1967 1938 472 376 269 234 153 42 2282 77 22109 1972 22527 348
NM_001011666chr736382 5933 938 --44381 1946 943 184 14577
NM_001014797chr1097957 7173 6938 6677 6644 6118 5329 2642 2302 36902 6774 5205 46920 5294 811 644 26067 565
NM_001025356chr1212604 32492 2456 772 1750 22658 2227
NM_001031695chr22104727 4368 3682 3665 3505 2170 2157 2127 1652 1502 23412 1105 34446 2002 1668 23548 1014
NM_001037165chr7158913 8679 8184 7964 5446 3419 3235 2820 2622 2614 2511 2332 1613 1585 637 78057 6796 6761 6699 5987 3541 2666 17482 11651
NM_001040712chr952995 2976 2427 1312 861 1464 2469 280 33142 2562 1084
NM_001042537chrX3422 395 378 21932 384 11584 22500 1983
NM_001044385chr243459 1525 1352 1198 1668 3720 540 217 1390
NM_001100108chr198310 7730 7426 6876 6396 2365 1345 259 43 31141 1010 51 18110 26899 1923
NM_001106chr388400 6366 3746 3588 3439 3342 1607 1046 38499 3279 1033 32726 752 640 28904 8221
NM_001416chr175425 417 318 88 74 1362 180 --
NM_001420chr1962766 876 752 572 184 81 --1585 22283 614
NM_001759chr1264134 3750 3600 3445 488 476 24723 761 34241 4109 220 14338
NM_002270chr565081 716 335 163 123 105 182 24217 64 14325
NM_002271chr1311991 ----32238 281 274
NM_002409chr22113194 2458 2320 1295 1028 998 840 549 506 327 98 13025 11978 23127 2824
NM_002839chr952995 2976 2427 1312 861 1464 2469 280 33142 2562 1084
NM_002886chr355129 5075 3177 1773 354 23871 376 34650 3798 797 14615
NM_002959chr194036 3575 3460 3230 2840 1686 321 176 101 --1739 2301 218
NM_003108chr2125232 2682 2380 2363 2297 2219 1687 707 595 525 420 138 37000 6522 660 21790 992 35918 4690 2228
NM_003563chr1741452 1332 1167 1037 2185 171 1116 21481 403
NM_003872chr252808 2609 549 183 55 21085 998 --52864 1851 987 654 166
NM_004050chr1472483 1930 1824 375 263 193 142 22297 432 1199 22411 2271
NM_004093chr1331003 962 121 21163 738 2724 318 32456 2091 1010
NM_004397chr1164150 4093 3829 3375 1212 64 23098 269 63987 3923 3398 1084 304 274 14156
NM_004441chr35834 489 357 53 21 2911 35 1344 11120
NM_004904chr736382 5933 938 --44381 1946 943 184 14577
NM_004992chrX127542 7530 7293 7265 6125 5152 2390 912 899 856 753 475 28216 3226 28156 2579 15613
NM_004992chrX127542 7530 7293 7265 6125 5152 2390 912 899 856 753 475 28216 3226 28156 2579 15613
NM_005497chr1732362 1400 137 22306 166 11382 33715 393 176
NM_005840chrX97478 7422 5941 5757 2986 2024 2017 1234 448 26753 4947 26998 139 37368 6344 773
NM_005902chr1584407 4400 3527 3382 1561 574 128 22 53781 3488 1668 1376 39 11600 11177
NM_005937chr17163974 3967 3690 3435 3399 3070 3003 2762 2632 1243 893 581 488 176 134 39 31164 416 389 33979 2799 1126 --
NM_006359chrX3422 395 378 21932 384 11584 22500 1983
NM_006371chr364336 4031 1839 1626 1324 1240 44480 1419 1158 1120 34700 4256 123 --
NM_006546chr17116334 5041 4707 4686 4540 4062 2599 2558 2465 1948 1311 25636 5300 21505 946 45743 4477 637 559
NM_006650chr5103850 3585 3381 3137 2981 2482 1136 1117 833 772 --53098 2748 467 458 220 23025 95
NM_006699chr152223 2146 2114 1095 73 1809 --21939 1932
NM_006729chrX55059 4045 1753 1272 949 35507 1237 708 --25467 4804
NM_006807chr172456 441 2973 944 2210 57 3511 466 205
NM_006924chr1773797 3585 3123 2935 1488 1278 324 --12720 23323 1774
NM_006996chr121628 1215 --11502 21497 1468
NM_007050chr20107703 7242 5215 2963 2097 1480 1292 953 772 738 75856 5512 3042 2918 1940 1765 1557 36990 6258 2034 --
NM_007249chr1368809 6263 2703 2582 2293 1082 17429 43145 2587 2497 1246 49154 6240 3526 885
NM_012164chr997406 6076 5640 5128 3017 1693 1623 1230 676 11612 11273 11013
NM_012334chr5114559 4297 1900 1441 492 473 462 452 394 262 134 --23862 348 1660
NM_013286chr383729 3533 2378 1492 1403 1304 1103 576 23762 1222 1204 13065
NM_013411chr151026 721 569 436 110 22692 1881 4590 574 562 82 1214
NM_014112chr835206 4956 3959 21243 277 --34606 3654 1216
NM_014309chr22104717 4358 3672 3655 3495 2160 2147 2117 1642 1492 23402 1095 34436 1992 1658 23538 1004
NM_014586chr2144615 3627 3498 1691 54105 3712 965 407 297 34497 4439 3492 13826
NM_014840chr1272790 2458 1325 1197 546 268 39 22570 887 2590 48 33341 596 168
NM_014877chr1747374 6861 1415 489 ----35108 5026 26
NM_014921chr19132266 2122 2072 2065 1992 1967 1938 472 376 269 234 153 42 2282 77 22109 1972 22527 348
NM_014946chr222523 1217 ----32747 1964 912
NM_015090chr1126119 5900 5021 4701 4144 3847 2303 2150 1312 1264 249 48 1686 32140 2039 56 --
NM_015270chr12112061 1846 1516 913 700 653 317 299 274 182 31 1558 1123 21996 645
NM_015520chr35958 292 226 218 103 32785 333 84 21074 599 11815
NM_015686chrX122057 1949 1660 1555 1014 676 635 389 368 333 194 123 2830 115 21903 281 42156 2039 2015 1666
NM_015879chr1897417 7330 7314 7219 6398 5929 5357 5291 3368 38146 2934 2282 46316 5957 1853 221 13027
NM_016260chr247543 1590 841 202 27064 3008 45439 2040 1293 21 --
NM_017637chr989158 8979 7083 6885 6064 3214 3207 1529 27897 6583 38781 7602 842 21865 424
NM_017709chr12528 63 13562 1780 31204 685 103
NM_018373chr1496334 5904 4939 4538 2292 2183 1649 1210 607 32474 2369 1685 22412 670 --
NM_018452chr6_random43312 2761 256 43 ----33179 2799 1161
NM_019072chr521169 617 11301 12994 23254 401
NM_020133chr686084 6055 5966 5005 4166 307 139 39 16103 35475 332 29 21582 714
NM_020673chr2065892 5467 1378 468 424 221 46718 2532 2162 851 11487 2365 336
NM_020699chr1145130 5117 4560 4350 4178 4105 3932 3716 3689 3672 2061 2026 1598 810 1849 35164 3677 1507 1711
NM_020717chrX83530 3177 1969 1496 926 519 383 183 1941 43600 1317 635 207 1508
NM_020772chr1778320 6628 5828 3106 3068 678 456 26844 632 --36115 2194 1039
NM_020983chr12112061 1846 1516 913 700 653 317 299 274 182 31 1558 1123 21996 645
NM_021116chr7178364 8170 8141 6885 5799 2905 2834 2501 2490 1975 1808 1631 1300 1276 283 207 107 11088 46718 2786 2740 1330 19105
NM_021202chr2072823 2531 2385 2052 751 695 685 21031 674 1767 --
NM_022143chr791508 1491 1409 1034 631 370 273 215 204 --11531 21194 567
NM_022648chr2184225 4016 3947 3583 3443 3285 3215 3194 3163 3076 2995 1217 732 371 161 143 55 36 24432 169 13154 1415
NM_024408chr122779 1221 23428 2798 32541 2416 729 12785
NM_024947chr377023 6974 6946 3632 2918 752 696 18721 12786 29049 1617
NM_025054chr823005 1396 24141 610 --23638 364
NM_025160chr133121 2936 1705 --24146 1710 23417 1695
NM_025179chr1114642 4270 4112 3851 3375 3049 1960 1729 1262 136 32 34312 1025 343 --1383
NM_025191chr132503 2159 355 2807 271 --23448 758
NM_032281chr1962766 876 752 572 184 81 --1585 22283 614
NM_033224chr755771 2916 2477 319 97 26436 120 1106 --
NM_033274chr5153354 2893 2733 2670 2618 2486 2417 2315 1389 1248 1117 1087 540 248 190 --12462 22478 2456
NM_052885chr12--11956 23295 1905 23231 1121
NM_052906chr22204650 4485 4347 4209 4138 4109 4022 4007 3704 3273 3240 3109 2039 1903 1465 1152 1048 700 405 58 44642 3525 521 430 1541 1826
NM_130391chr952995 2976 2427 1312 861 1464 2469 280 33142 2562 1084
NM_130392chr952995 2976 2427 1312 861 1464 2469 280 33142 2562 1084
NM_130393chr952995 2976 2427 1312 861 1464 2469 280 33142 2562 1084
NM_130446chr3113762 3725 3674 3049 2774 2738 2687 343 212 141 117 53899 3527 3286 3142 897 13542 --
NM_133170chr20107703 7242 5215 2963 2097 1480 1292 953 772 738 75856 5512 3042 2918 1940 1765 1557 36990 6258 2034 --
NM_133445chr922910 99 --22312 663 33364 3053 1248
NM_138468chr235215 4414 863 1932 24046 1055 26229 673
NM_138473chr1274788 4689 4185 3282 1553 874 138 34172 3866 3774 23871 1406 24402 1401
NM_152388chr243459 1525 1352 1198 1668 3720 540 217 1390
NM_152424chrX134750 4497 4440 4247 4177 4146 3986 3978 3365 1798 1481 548 209 13387 44568 3242 1138 1031 32913 1186 1093
NM_153188chr565081 716 335 163 123 105 182 24217 64 14325
NM_153456chr1396233 4590 4501 3874 2188 1641 779 702 677 14912 43998 2277 1718 1353 14619
NM_173642chr1159250 9002 8305 8219 8190 8001 7991 7184 7016 6437 6418 6399 6040 1076 542 13072 16598 23505 3498
NM_175624chr1277209 6521 6049 5798 839 829 793 32919 2418 2294 15705 11910
NM_175625chr1277209 6521 6049 5798 839 829 793 32919 2418 2294 15705 11910
NM_175736chr12105702 4908 3062 1852 1841 1448 1441 719 420 326 25749 1020 45760 2445 1059 784 22732 2718
NM_175907chr1862617 2221 1750 842 537 285 2223 177 --2736 30
NM_178151chrX86538 6089 5472 5312 2468 2460 1798 763 17102 --26761 2810
NM_178152chrX86538 6089 5472 5312 2468 2460 1798 763 17102 --26761 2810
NM_178153chrX86538 6089 5472 5312 2468 2460 1798 763 17102 --26761 2810
NM_181504chr594040 3551 3367 3280 1569 1289 1276 1270 554 --1162 --
NM_181523chr594040 3551 3367 3280 1569 1289 1276 1270 554 --1162 --
NM_181524chr594040 3551 3367 3280 1569 1289 1276 1270 554 --1162 --
NM_182898chr736382 5933 938 --44381 1946 943 184 14577
NM_182899chr736382 5933 938 --44381 1946 943 184 14577
NM_194071chr754033 4024 4014 1609 610 24992 4283 1206 24635 1063
NM_198900chr12105702 4908 3062 1852 1841 1448 1441 719 420 326 25749 1020 45760 2445 1059 784 22732 2718
NM_199436chr222523 1217 ----32747 1964 912
NM_201266chr252808 2609 549 183 55 21085 998 --52864 1851 987 654 166
NM_201279chr252808 2609 549 183 55 21085 998 --52864 1851 987 654 166