TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5006-5p
miRNA Sequence: UUGCCAGGGCAGGAGGUGGAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1271832 1710 1656 1591 1572 226 193 --22431 434 --
NM_000024chr5--1345 ----
NM_000037chr842289 2271 1787 600 --1189 --
NM_000038chr521810 755 ------
NM_000051chr1142759 1148 332 315 32808 1424 1358 ----
NM_000053chr134679 258 210 179 ------
NM_000061chrX--1364 ----
NM_000068chr193394 261 38 ------
NM_000069chr13263 248 36 ------
NM_000084chrX96888 6180 5877 4557 2259 1523 1278 769 681 25725 1001 --14488
NM_000088chr1721141 22 ------
NM_000092chr254539 4527 3897 1841 1326 21741 741 ----
NM_000093chr941945 1637 741 623 12305 ----
NM_000109chrX11700 ------
NM_000110chr11755 ------
NM_000118chr92707 68 ------
NM_000129chr62352 52 1517 21014 30 --
NM_000138chr1532409 2174 926 ------
NM_000141chr1021252 1040 ------
NM_000142chr421599 1165 ------
NM_000163chr512330 ------
NM_000165chr621284 398 ------
NM_000176chr583886 3854 3410 3257 2983 2789 2547 841 1982 --1171
NM_000178chr201118 ------
NM_000189chr241750 1482 176 97 --1109 --
NM_000192chr1211200 ------
NM_000202chrX33521 2640 728 23092 1466 ----
NM_000214chr202289 223 31608 542 144 --11476
NM_000217chr1245353 3800 1858 795 --12055 --
NM_000232chr432579 2535 2186 --11171 --
NM_000237chr831695 1656 1554 ------
NM_000248chr312723 ------
NM_000255chr61150 ------
NM_000259chr1595804 5602 4300 4293 4261 4146 2261 1132 309 1517 25623 4242 --
NM_000262chr225722 624 614 479 222 --2714 62 --
NM_000264chr952197 2051 1162 1006 567 12161 12059 --
NM_000266chrX3927 259 212 174 ----
NM_000271chr181122 1258 ----
NM_000272chr211284 ------
NM_000278chr1041724 1545 755 373 ------
NM_000304chr171950 1991 ----
NM_000314chr1012997 ------
NM_000330chrX31589 410 40 ------
NM_000332chr676639 6410 5938 4916 2878 2165 1438 ------
NM_000337chr584497 2151 1907 1890 1544 1341 606 29 1557 ----
NM_000346chr171255 --11847 --
NM_000365chr12----1440 --
NM_000368chr9113762 3319 1817 1714 1400 1280 758 669 603 172 41 11209 ----
NM_000369chr141720 1673 ----
NM_000378chr111850 ------
NM_000401chr1131104 1058 957 --1123 --
NM_000408chr222844 2709 1344 ----
NM_000429chr10111811 1736 1678 1657 1574 1393 1182 180 74 44 23 ------
NM_000430chr1742898 2690 598 240 13790 13311 --
NM_000434chr6------1126
NM_000435chr193882 738 291 ----1873
NM_000445chr84944 851 708 378 ------
NM_000448chr1132272 1294 483 ------
NM_000449chr11157 ------
NM_000450chr131519 1227 90 21532 1395 1349 --
NM_000452chr1321925 88 1771 ----
NM_000460chr3----1320 1121
NM_000461chr363332 1681 1645 1435 1099 303 --24293 134 --
NM_000462chr1511510 ------
NM_000476chr961362 495 455 349 234 68 ------
NM_000480chr111316 11260 11204 --
NM_000489chrX33296 3012 867 1751 1803 --
NM_000503chr821807 111 ------
NM_000522chr72905 127 ------
NM_000555chrX127578 6234 5805 5753 5147 5072 4973 3140 701 617 554 409 12235 12480 16480
NM_000599chr263974 3738 2933 1629 1467 422 ----13321
NM_000609chr1022324 359 21253 216 ----
NM_000611chr11206942 6524 6471 6330 6200 6034 5642 5400 4756 2371 2318 2177 2046 1168 816 782 733 532 334 136 --15798 36407 4567 2254
NM_000615chr1142366 2336 2006 395 ------
NM_000618chr1254816 4194 1175 939 361 11114 ----
NM_000618chr1254816 4194 1175 939 361 11114 ----
NM_000619chr121478 ------
NM_000627chr21332 ------
NM_000633chr1894244 3478 3300 3282 1361 1011 611 564 455 ------
NM_000635chr192537 47 --1417 11646
NM_000679chr51158 ------
NM_000682chr261539 1452 1276 1264 747 713 --41574 1478 531 374 --
NM_000701chr1----1105 --
NM_000719chr1256042 5676 5334 4177 1450 11058 12662 --
NM_000720chr32505 29 --2196 166 --
NM_000721chr132450 1051 392 1810 ----
NM_000723chr171589 --21069 507 --
NM_000724chr1021948 461 --21772 210 --
NM_000725chr12294 83 --2252 26 --
NM_000726chr221096 79 ------
NM_000738chr116969 883 789 628 367 107 ------
NM_000767chr1941457 1247 1189 379 ------
NM_000793chr1431901 413 402 ----14946
NM_000801chr202986 959 ------
NM_000806chr51158 ------
NM_000809chr455723 3175 1991 1786 1678 48849 7910 7881 489 ----
NM_000812chr4------1388
NM_000813chr522005 636 23555 1219 ----
NM_000814chr1553732 3667 3598 631 554 ------
NM_000817chr221003 48 ------
NM_000826chr4----1133 1818
NM_000827chr562430 1674 905 862 839 579 12264 22502 987 --
NM_000828chrX32005 1336 513 ------
NM_000829chr1121559 1524 --22316 1914 --
NM_000844chr31281 --165 --
NM_000849chr121222 196 33063 2935 1001 12134 --
NM_000875chr1596119 6105 4832 4803 4642 4575 4421 4411 1999 22710 695 25226 916 --
NM_000891chr1723060 1260 23553 3524 21135 1127 --
NM_000899chr1263017 1243 789 664 416 196 2553 45 1706 --
NM_000901chr431677 576 339 ------
NM_000914chr61143 ------
NM_000933chr2021743 179 ------
NM_000935chr3150 --11025 --
NM_000941chr74347 246 92 56 --199 --
NM_000944chr422296 1774 12155 ----
NM_000945chr211881 ------
NM_000951chr191210 --1148 --
NM_000956chr1421035 226 ------
NM_000958chr52334 134 ------
NM_000959chr142857 549 444 318 31090 875 57 --12827
NM_000960chr194703 256 242 98 --1537 --
NM_000964chr1761185 1162 952 871 352 253 --1878 --
NM_000965chr31311 ----11292
NM_000966chr122782 355 ------
NM_000977chr161358 ------
NM_001001323chr1222275 1955 ------
NM_001001331chr342641 2428 271 169 ----12050
NM_001001394chr21683 ------
NM_001001396chr154122 3571 3203 3171 2874 11038 1581 --
NM_001001481chr82662 331 13348 ----
NM_001001484chr1021873 1670 ------
NM_001001522chr113325 105 47 ------
NM_001001556chr15151 ------
NM_001001557chr881788 803 702 523 227 98 70 24 2727 585 ----
NM_001001560chr222590 118 ------
NM_001001701chr432223 2196 1762 11468 ----
NM_001001706chr63800 194 43 1494 ----
NM_001001711chr111115 176 ----
NM_001001890chr212472 213 --13998 --
NM_001002233chr841986 1828 1807 465 ------
NM_001002252chr122210 59 --1270 --
NM_001002258chr221784 25 ------
NM_001002269chr91172 1107 ----
NM_001002762chr1082070 1880 1792 814 589 265 125 83 --3676 411 69 --
NM_001002838chrX31439 745 650 ------
NM_001002843chr151465 1505 1940 --
NM_001002860chr1464698 4374 3796 2866 1454 258 13998 ----
NM_001002909chr1742102 1746 619 380 ------
NM_001003406chr2293240 2840 2737 2502 2048 949 787 459 390 --23084 2814 --
NM_001003652chr18108024 6972 6926 6863 5385 3474 2713 1542 1375 820 15413 --25301 2033
NM_001003676chr112647 293 ------
NM_001003681chr2251620 1492 788 229 91 --1672 --
NM_001003682chr111222 ----1335
NM_001003688chr41349 ------
NM_001003794chr372585 2336 2263 1906 991 446 335 --12641 --
NM_001003796chr222782 749 --1864 --
NM_001003800chr973065 1454 1277 934 786 730 340 --21498 489 --
NM_001003940chr15123426 2972 2946 2935 2620 2519 2463 2427 837 771 692 602 --13123 --
NM_001003942chr15123426 2972 2946 2935 2620 2519 2463 2427 837 771 692 602 --13123 --
NM_001003943chr15123430 2976 2950 2939 2624 2523 2467 2431 841 775 696 606 --13127 --
NM_001004065chr923381 2527 ------
NM_001004127chr131246 ------
NM_001004128chr14608 475 216 51 ------
NM_001004196chr3136 ------
NM_001004304chr1252615 744 454 332 255 ------
NM_001004317chr664545 4125 3526 1450 998 913 ------
NM_001004329chr12--11146 ----
NM_001004342chr1125675 5267 5040 4801 4686 4518 4380 4204 3810 2211 991 967 25722 4292 21463 122 --
NM_001004419chr1241807 1499 1410 493 1813 ----
NM_001004441chr511401 21055 629 ----
NM_001005209chr25522 514 160 124 82 ------
NM_001005271chr1731106 404 253 ------
NM_001005273chr1731106 404 253 ------
NM_001005335chr19----1298 --
NM_001005375chrY31374 280 71 ------
NM_001005386chr231868 1837 676 12012 ----
NM_001005404chr1754151 2874 1209 638 217 --2670 407 --
NM_001005415chr191462 --1391 --
NM_001005416chr191462 --1391 --
NM_001005463chr1022286 311 ------
NM_001005473chr535975 1214 119 1752 26658 6065 --
NM_001005474chr341349 1109 447 22 192 1189 --
NM_001005505chr331651 740 192 ------
NM_001005609chrX83401 3383 2975 2959 1483 1271 1134 505 12755 1544 --
NM_001005612chrX1295 ------
NM_001005739chr2----1710 --
NM_001005746chr221096 79 ------
NM_001005747chr221096 79 ------
NM_001005753chr21361 22274 2034 --11719
NM_001005782chr2198 1124 ----
NM_001005785chrY31374 280 71 ------
NM_001005786chrY31374 280 71 ------
NM_001005849chr171172 ------
NM_001005861chr31708 1937 ----
NM_001006115chr362573 960 784 656 641 268 --42402 1978 1819 278 --
NM_001006600chr532289 2037 415 ------
NM_001006610chr16124 11039 ----
NM_001006617chr931047 121 112 --1210 --
NM_001006618chr91202 ------
NM_001006619chr931047 121 112 --1210 --
NM_001006620chr931047 121 112 --1210 --
NM_001006621chr931047 121 112 --1210 --
NM_001006623chr262297 1816 719 390 372 206 175 ----
NM_001006636chr22668 119 ------
NM_001006681chrX121 ------
NM_001006682chrX121 ------
NM_001006683chrX121 ------
NM_001006684chrX130 1619 ----
NM_001006932chr642250 535 507 78 --32702 1346 469 --
NM_001006933chrX----163 --
NM_001006946chr231365 416 81 11197 1253 --
NM_001007023chr1431901 413 402 ----14946
NM_001007024chr1793727 3207 2872 2689 1550 1316 1005 734 48 ------
NM_001007025chr1793727 3207 2872 2689 1550 1316 1005 734 48 ------
NM_001007027chr11169 1236 ----
NM_001007067chr82925 201 155 ----
NM_001007068chr82925 201 155 ----
NM_001007069chr82925 201 155 ----
NM_001007070chr82925 201 155 ----
NM_001007102chr631260 445 332 ------
NM_001007156chr1541259 563 426 184 11450 ----
NM_001007246chr2121315 1230 11757 11633 --
NM_001007271chr108957 938 911 794 760 716 162 91 --2173 59 --
NM_001007273chr10252 33 ------
NM_001007466chr674777 4465 1670 1190 971 378 69 ------
NM_001007553chr131039 1003 912 2398 284 ----
NM_001007559chr1811912 ------
NM_001007565chr31328 ------
NM_001008222chrX41141 504 428 146 --1248 --
NM_001008223chr12----3546 503 102 --
NM_001008225chr71214 ------
NM_001008239chr1842359 1403 469 420 --13566 12993
NM_001008408chr795633 5602 5550 5520 4700 4649 3979 980 765 12298 1755 --
NM_001008495chr811634 ------
NM_001008529chr1731266 226 104 ------
NM_001008541chr1011457 ------
NM_001008541chr1011457 ------
NM_001008701chr1942880 2684 2160 2149 --21186 1048 --
NM_001008726chr1431695 1496 1416 ------
NM_001008738chr532810 2754 2666 1619 ----
NM_001008801chr1911753 1301 ----
NM_001009552chr8145 --1125 --
NM_001009555chr4----128 --
NM_001009566chr12227 184 1915 ----
NM_001009567chr10------1169
NM_001009571chr721211 268 ------
NM_001009812chr22288 67 ------
NM_001009899chr396270 5550 4588 2178 2134 2041 1621 1487 1356 ------
NM_001009959chr272440 2398 2333 2109 424 373 287 1470 1538 --
NM_001009960chr731764 1133 889 ----12111
NM_001009993chr294095 3772 3237 3169 2914 1695 1675 1393 573 --11336 1224
NM_001010846chr174058 3989 3060 1017 661 205 32 14387 ----
NM_001010852chr61150 ------
NM_001010888chrX44312 2827 662 638 ------
NM_001010891chr546433 5787 5629 927 --1179 --
NM_001010924chr101429 ------
NM_001010926chr13541 533 129 ------
NM_001010980chr183219 2624 2246 1053 894 713 284 76 --11191 --
NM_001010984chr131002 764 46 ------
NM_001010986chrX41974 1547 944 221 --1361 --
NM_001010989chr161371 ------
NM_001010990chr161371 ------
NM_001011513chr463924 2914 1391 1226 614 191 --13065 --
NM_001011537chr341793 1457 808 377 --11610 --
NM_001011551chrX1125 ------
NM_001011553chr71697 ------
NM_001011666chr735105 1488 246 ------
NM_001011713chr141161 ------
NM_001012264chr143717 708 289 ------
NM_001012329chr1102256 2245 2118 1939 1855 1674 1596 1587 326 163 1921 11987 --
NM_001012337chr31102 ------
NM_001012393chr1154682 2052 1586 1153 1052 ------
NM_001012398chr16147 ------
NM_001012418chr623583 2760 23136 2665 1111 --
NM_001012419chr931302 877 168 ------
NM_001012420chr1542156 977 659 204 --11102 --
NM_001012423chr1542156 977 659 204 --11102 --
NM_001012446chr93384 364 111 ------
NM_001012614chr41544 --197 --
NM_001012755chrX41885 1342 1024 49 13253 --1301
NM_001012968chrX2533 523 ------
NM_001012977chrX51076 1067 1003 421 43 ------
NM_001012990chrX--1295 ----
NM_001013031chr1042488 1165 922 338 --33081 2337 1328 --
NM_001013437chr18160 ------
NM_001013438chr3--154 1731 --
NM_001013439chr3----1577 --
NM_001013615chr12778 130 --1963 --
NM_001013635chr121835 1436 ----
NM_001013690chr1271928 1813 1014 540 523 284 90 12291 11853 --
NM_001013693chr152145 1988 866 470 140 --133 1409
NM_001013693chr152145 1988 866 470 140 --133 1409
NM_001013699chr12----1487 --
NM_001014283chr1351910 1777 1760 1401 1358 1395 ----
NM_001014336chr12126 ------
NM_001014434chr1------1165
NM_001014765chr121489 1333 2405 39 11399 --
NM_001014797chr10128056 7875 7643 7351 7063 6799 6179 3166 2773 2262 857 840 25103 2677 --12694
NM_001014809chr42819 648 ------
NM_001014839chr19926 876 787 777 429 354 312 129 83 ------
NM_001014841chr19926 876 787 777 429 354 312 129 83 ------
NM_001015053chr1711617 ------
NM_001015508chr81136 ------
NM_001015877chrX11114 3729 690 601 ----
NM_001015887chr331342 1270 148 ------
NM_001017395chr342836 1053 707 525 138 ----
NM_001017424chr121242 73 1325 ----
NM_001017425chr121242 73 1325 ----
NM_001017440chr7137496 7082 6557 6358 5358 3054 2938 2774 2399 1172 954 675 502 11707 37904 575 186 16889
NM_001017523chr12--1468 189 --
NM_001017930chrX1464 --11024 --
NM_001017973chr5129 ------
NM_001017974chr5129 ------
NM_001017979chr4132 ------
NM_001018004chr152557 186 1658 ----
NM_001018006chr152557 186 1658 ----
NM_001018007chr152557 186 1658 ----
NM_001018008chr152515 432 ------
NM_001018020chr152557 186 1658 ----
NM_001018041chr6--1371 ----
NM_001018050chr2293473 3378 3239 3178 2805 2619 2438 1041 858 --12258 --
NM_001018052chr2293473 3378 3239 3178 2805 2619 2438 1041 858 --12258 --
NM_001018057chr113965 282 126 ----1415
NM_001018064chr931625 324 200 ------
NM_001018065chr935412 3841 106 14004 ----
NM_001018066chr935412 3841 106 14004 ----
NM_001018067chr174933 4706 3994 3776 1985 945 25 13341 ----
NM_001018068chr174933 4706 3994 3776 1985 945 25 13341 ----
NM_001018069chr174933 4706 3994 3776 1985 945 25 13341 ----
NM_001018072chr12--1468 189 --
NM_001018074chr583886 3854 3410 3257 2983 2789 2547 841 1982 --1171
NM_001018075chr583886 3854 3410 3257 2983 2789 2547 841 1982 --1171
NM_001018076chr583886 3854 3410 3257 2983 2789 2547 841 1982 --1171
NM_001018077chr583886 3854 3410 3257 2983 2789 2547 841 1982 --1171
NM_001018088chr151180 ------
NM_001018108chr152798 287 --11909 --
NM_001020658chr12524 414 155 ----
NM_001020658chr12524 414 155 ----
NM_001020825chr561361 1329 885 458 264 22 ------
NM_001023567chr153985 662 204 --22443 1772 --
NM_001023587chr31395 ----1349
NM_001024094chr583886 3854 3410 3257 2983 2789 2547 841 1982 --1171
NM_001024226chr14826 348 305 209 ------
NM_001024227chr14826 348 305 209 ------
NM_001024228chr14826 348 305 209 ------
NM_001024401chr16102836 2737 2711 2254 1835 1105 395 212 197 143 --2751 413 --
NM_001024455chrX12236 --1235 --
NM_001024649chr51331 --176 --
NM_001024660chr321105 362 ------
NM_001024666chrX2625 205 ------
NM_001024808chr1272704 2596 895 813 601 459 447 --22369 1878 --
NM_001024809chr1761185 1162 952 871 352 253 --1878 --
NM_001024858chr1492643 2598 2223 1826 735 726 450 242 64 ------
NM_001024948chr133132 1159 617 1683 ----
NM_001024959chr34792 766 653 200 ------
NM_001024960chr34792 766 653 200 ------
NM_001025076chr1055747 5409 5050 2240 386 1406 14970 15097
NM_001025077chr1047105 6767 6408 1744 11764 16328 16455
NM_001025079chr331179 380 323 ------
NM_001025201chr22678 455 1266 ----
NM_001025252chr812265 23242 868 --1446
NM_001025253chr812265 23242 868 --1446
NM_001025266chr384270 1919 1739 1647 1548 835 473 401 --13277 14772
NM_001025366chr621499 561 11567 1686 --
NM_001025366chr621499 561 11567 1686 --
NM_001025367chr621499 561 11567 1686 --
NM_001025367chr621499 561 11567 1686 --
NM_001025368chr621499 561 11567 1686 --
NM_001025368chr621499 561 11567 1686 --
NM_001025369chr621515 577 11583 1702 --
NM_001025369chr621515 577 11583 1702 --
NM_001025370chr621499 561 11567 1686 --
NM_001025370chr621499 561 11567 1686 --
NM_001025389chr111316 11260 11204 --
NM_001025390chr111316 11260 11204 --
NM_001025579chr172205 32 ------
NM_001025580chrX23808 1337 ------
NM_001025603chr11157 ------
NM_001025616chr41377 137 1628 --
NM_001025780chr941202 1158 1072 1045 ------
NM_001029858chr631147 1128 522 ------
NM_001029861chr1961000 691 203 124 104 43 ------
NM_001029863chr61895 --1508 --
NM_001029882chr13628 96 44 ------
NM_001029882chr13628 96 44 ------
NM_001029998chr411375 11029 11009 --
NM_001030007chr1663582 2478 1149 1081 712 484 175 21094 577 --
NM_001030055chr1464239 3931 1786 1539 440 389 11796 ----
NM_001030272chr11--122 ----
NM_001030273chr11--122 ----
NM_001031684chr241437 1089 393 213 ------
NM_001031690chr753073 2892 2352 2056 453 --11977 --
NM_001031695chr2294667 4389 4293 3481 1612 1470 1036 667 53 14434 14072 --
NM_001031696chr192248 240 ------
NM_001031710chr72827 296 ------
NM_001031711chr521537 97 ------
NM_001031717chr3142 1832 ----
NM_001031740chr141499 1267 570 53 ------
NM_001031746chr1021250 1049 ------
NM_001031801chr222130 100 ------
NM_001031804chr1653457 3441 3096 266 137 13942 --11266
NM_001031812chr5--12183 ----
NM_001032280chr611302 1641 21430 1238 11483
NM_001032288chr202593 520 ----11313
NM_001032289chrX1700 --155 --
NM_001032290chr13480 449 99 ------
NM_001032291chr13480 449 99 ------
NM_001032296chr1352628 2599 2523 2213 2123 12809 ----
NM_001032363chr172092 2003 1841 1572 703 591 135 --1520 --
NM_001032363chr172092 2003 1841 1572 703 591 135 --1520 --
NM_001032393chrX1550 ------
NM_001033047chr452203 801 784 494 151 1979 11625 12365
NM_001033049chr2111956 --1228 --
NM_001033057chr32668 338 ------
NM_001033087chr2043140 1021 328 31 12704 22076 657 --
NM_001033117chr364578 3971 3382 1429 1089 94 14636 11263 --
NM_001033507chr141690 1564 1482 1382 11752 ----
NM_001033561chr172818 593 ------
NM_001033564chr631508 422 382 21830 72 11450 --
NM_001033578chr832219 1939 729 ------
NM_001033602chr1352630 2592 2242 1754 164 ------
NM_001033667chr12469 214 ------
NM_001033756chr621433 495 11501 1620 --
NM_001033756chr621433 495 11501 1620 --
NM_001033925chr10--11571 ----
NM_001034025chr124955 899 193 167 ------
NM_001034845chr41179 ------
NM_001034850chr531584 1232 1224 ------
NM_001034954chr1052585 2208 963 862 788 ----11092
NM_001034955chr1052585 2208 963 862 788 ----11092
NM_001034956chr1052585 2208 963 862 788 ----11092
NM_001034957chr1052585 2208 963 862 788 ----11092
NM_001035260chr101408 11435 ----
NM_001037131chr23381 307 111 ------
NM_001037132chr722046 619 --21956 1813 --
NM_001037133chr722046 619 --21956 1813 --
NM_001037174chr22779 572 12306 ----
NM_001037324chr31751 ------
NM_001037339chr11112 --11160 --
NM_001037340chr11112 --11160 --
NM_001037341chr11112 --11160 --
NM_001037341chr11112 --11160 --
NM_001037582chr41295 11745 ----
NM_001037954chr1142472 177 47 36 --1168 --
NM_001038633chr131346 919 880 ------
NM_001038640chr1541050 729 397 272 ------
NM_001038702chr552774 1701 1027 921 126 --11762 --
NM_001038707chr141859 1719 1633 177 ------
NM_001038707chr141859 1719 1633 177 ------
NM_001039199chr20104307 4213 3553 3412 3270 1346 1212 1194 795 706 14156 14749 13304
NM_001039348chr2----1963 --
NM_001039349chr2----1963 --
NM_001039459chr72967 171 ----1151
NM_001039465chr14--187 ----
NM_001039479chr1482358 2282 2022 1888 1815 826 433 206 --11561 --
NM_001039538chr222720 2407 --152 --
NM_001039569chr242978 2613 2524 1221 ------
NM_001039570chr22164256 4158 4133 3954 3830 3748 3684 3485 3439 3353 3270 2971 2890 1440 849 327 --34015 3891 2826 --
NM_001039571chr22164256 4158 4133 3954 3830 3748 3684 3485 3439 3353 3270 2971 2890 1440 849 327 --34015 3891 2826 --
NM_001039574chr15920 896 878 822 757 ------
NM_001039585chr143114 806 701 575 31347 1132 314 --13084
NM_001039590chrX23210 74 1527 ----
NM_001039591chrX23210 74 1527 ----
NM_001039618chr1135978 5082 1166 15334 --1291
NM_001039690chr1662341 2228 2039 929 344 315 --21625 1497 --
NM_001039711chr131033 844 363 ------
NM_001039712chr131033 844 363 ------
NM_001039771chr142812 101 1276 ----
NM_001039802chr11371 ------
NM_001039840chrX25715 4413 ------
NM_001039877chr193130 103 23 --1273 --
NM_001039916chr122104 46 ------
NM_001039917chr122104 46 ------
NM_001039918chr122104 46 ------
NM_001039919chr122104 46 ------
NM_001039920chr122104 46 ------
NM_001039937chr13--12641 ----
NM_001040001chr621659 455 ------
NM_001040100chr311182 ------
NM_001040102chr1072365 2299 1964 1826 920 525 400 --132 --
NM_001040103chr1072365 2299 1964 1826 920 525 400 --132 --
NM_001040108chr1422744 2543 11086 --13118
NM_001040118chr112448 21 ------
NM_001040142chr21922 --11867 --
NM_001040143chr21922 --11867 --
NM_001040144chr1662341 2228 2039 929 344 315 --21625 1497 --
NM_001040146chr1662341 2228 2039 929 344 315 --21625 1497 --
NM_001040152chr753866 3688 1311 1057 607 24017 148 23529 985 21990 894
NM_001040157chr43934 752 300 --1422 --
NM_001040158chr51199 ------
NM_001040167chr73972 432 76 --139 --
NM_001040202chr41518 22190 233 ----
NM_001040260chr431018 806 169 11108 1155 --
NM_001040261chr431018 806 169 11108 1155 --
NM_001040272chr942203 2182 1932 32 --1924 --
NM_001040273chr1031604 598 541 --41996 1443 386 163 --
NM_001040280chr631411 1224 509 ------
NM_001040429chr1343447 2918 70 27 12887 ----
NM_001040441chr144543 1334 866 27 1466 ----
NM_001040624chr832294 2010 1765 --12740 --
NM_001040625chr832294 2010 1765 --12740 --
NM_001040626chr832294 2010 1765 --12740 --
NM_001040627chr832294 2010 1765 --12740 --
NM_001040628chr832294 2010 1765 --12740 --
NM_001040629chr832294 2010 1765 --12740 --
NM_001040630chr832294 2010 1765 --12740 --
NM_001040709chr132297 720 553 ------
NM_001040712chr9--12555 ----
NM_001040715chr165880 869 797 439 387 1216 ----
NM_001040876chr41377 ------
NM_001042353chr202384 196 --1485 --
NM_001042361chr102521 303 ------
NM_001042364chr102521 303 ------
NM_001042365chr102521 303 ------
NM_001042368chr93176 31 22 ------
NM_001042371chr1682104 1872 1675 1572 1547 1382 1333 259 --11368 --
NM_001042387chr102521 303 ------
NM_001042388chr182357 298 ------
NM_001042393chr102521 303 ------
NM_001042396chr102521 303 ------
NM_001042397chr102521 303 ------
NM_001042403chr121695 1926 ----
NM_001042404chr11774 ------
NM_001042410chr21165 1202 ----
NM_001042413chr953267 2695 1418 751 288 ------
NM_001042424chr43727 413 322 --22584 1209 --
NM_001042425chr611302 1641 21430 1238 11483
NM_001042440chr5126 187 ----
NM_001042441chr5126 187 ----
NM_001042442chr5126 187 ----
NM_001042443chr5126 187 ----
NM_001042444chr5126 187 ----
NM_001042445chr5126 187 ----
NM_001042446chr5126 187 ----
NM_001042465chr104909 809 744 297 --3918 182 24 --
NM_001042466chr104909 809 744 297 --3918 182 24 --
NM_001042473chr1021508 1374 ------
NM_001042486chr2031473 1393 1373 --11007 --
NM_001042498chrX2837 95 --1192 --
NM_001042506chrX51086 1077 1003 421 43 ------
NM_001042517chr131732 --1237 --
NM_001042537chrX21626 195 12275 12248 --
NM_001042539chr1641118 1014 964 175 ------
NM_001042555chr1233642 3325 1655 14072 ----
NM_001042599chr276720 6644 5528 5499 5270 4875 2340 17111 11061 --
NM_001042601chr32711 238 ------
NM_001042603chr1244930 4029 3756 3245 --1476 --
NM_001042604chr323689 1362 ------
NM_001042632chr2071895 1039 972 503 394 368 316 1961 2538 337 --
NM_001042633chr2071895 1039 972 503 394 368 316 1961 2538 337 --
NM_001042669chr41377 137 1628 --
NM_001042681chr132163 1760 744 --1806 --
NM_001042682chr132163 1760 744 --1806 --
NM_001042682chr132163 1760 744 --1806 --
NM_001042728chr122782 355 ------
NM_001043318chr1463138 2907 2880 2672 1258 1112 13652 23461 535 --
NM_001043351chr132103 2086 1486 ------
NM_001044305chr611577 ------
NM_001044385chr242584 2528 1517 1309 33628 1299 1236 ----
NM_001044722chr5--12183 ----
NM_001044723chr5--12183 ----
NM_001045478chr141062 907 319 37 ------
NM_001048183chr183693 3002 2750 1255 879 815 516 436 --12380 --
NM_001050chr1721303 99 149 ----
NM_001065chr12----1411 --
NM_001066chr152020 701 399 320 75 --32055 1706 49 --
NM_001068chr3184 ------
NM_001071775chr1321576 239 --11536 --
NM_001078chr11617 ------
NM_001079874chr13840 175 109 ------
NM_001080418chr11251 ------
NM_001083620chr4----1133 1817
NM_001092chr1721883 428 --21907 456 --
NM_001094chr171824 ------
NM_001095chr1221210 624 --1523 --
NM_001099678chr344824 2248 2045 1499 21386 580 14766 --
NM_001106chr366881 6139 3620 3417 2718 867 17504 33738 3626 3292 --
NM_001113490chrX43525 3473 2425 2294 ------
NM_001116chr1652471 2427 1229 1202 411 ------
NM_001117chr181611 ------
NM_001121chr1031827 1462 498 1714 ----
NM_001126chr11172 ------
NM_001128chr1663582 2478 1149 1081 712 484 175 21094 577 --
NM_001144chr161972 11225 ----
NM_001148chr421887 1857 ------
NM_001167chrX66720 6102 5575 5341 2067 1462 21544 149 ----
NM_001173chr1464239 3931 1786 1539 440 389 11796 ----
NM_001177chr1242289 1776 1664 109 --32463 1900 1676 12157
NM_001178chr11--122 ----
NM_001191chr2071374 1347 1140 1095 1027 257 209 ------
NM_001200chr2021156 835 ------
NM_001204chr247081 4910 2033 409 12892 ----
NM_001206chr922835 867 ------
NM_001222chr101386 1309 1343 --
NM_001237chr42988 791 ------
NM_001237chr42988 791 ------
NM_001241chr21454 ------
NM_001241chr21454 ------
NM_001256chr1742175 2093 2002 94 11834 --1629
NM_001259chr776265 2531 2516 1574 1319 903 622 35768 4107 1104 ----
NM_001260chr13----177 --
NM_001265chr135596 361 272 216 122 ------
NM_001267chr17127 --1142 --
NM_001274chr11129 ------
NM_001290chr43900 283 238 ------
NM_001299chr193438 159 54 ------
NM_001304chr1743374 2467 609 156 ----13039
NM_001310chr1231200 1018 83 --12375 --
NM_001313chr42819 648 ------
NM_001315chr612241 --11454 --
NM_001328chr41544 --197 --
NM_001331chr1161886 1843 1058 775 550 312 21772 993 --1565
NM_001346chr342817 1779 917 674 --1513 --
NM_001349chr21483 ------
NM_001351chr321348 273 ------
NM_001356chrX42255 2211 2010 1894 --1427 --
NM_001357chr11276 ------
NM_001364chr1153677 3080 2912 1874 551 --23544 1699 --
NM_001365chr17182 ------
NM_001379chr192121 30 ------
NM_001387chr553201 2533 2456 1203 960 --11047 --
NM_001390chr1863204 2675 2355 1166 646 335 --1127 --
NM_001396chr2132740 1769 1715 ------
NM_001399chrX83401 3383 2975 2959 1483 1271 1134 505 12755 1544 --
NM_001400chr131145 924 149 ------
NM_001402chr622014 1476 11555 ----
NM_001406chr174669 479 353 68 ------
NM_001407chr331282 595 134 ------
NM_001412chrX53508 3187 3161 2392 364 11183 ----
NM_001415chrX61908 1312 447 325 234 205 ------
NM_001419chr1953912 3209 3169 1842 1470 13763 ----
NM_001420chr1963122 2065 1231 1180 707 513 ------
NM_001421chrX51752 1618 333 227 141 --1183 --
NM_001423chr1221408 260 1394 ----
NM_001426chr21528 ------
NM_001430chr232013 1804 1438 --21833 126 --
NM_001431chr611088 2370 116 ----
NM_001432chr463230 2515 1565 455 281 44 --11464 --
NM_001438chr112574 ------
NM_001451chr162179 25 21041 141 ----
NM_001455chr623043 1717 --33755 3221 2995 14398
NM_001463chr2--1713 ----
NM_001482chr152285 138 ------
NM_001483chr72876 798 ------
NM_001493chrX1177 ------
NM_001494chr101192 148 ----
NM_001495chr841189 815 438 290 --1228 --
NM_001497chr952352 1830 1005 969 181 --21014 834 --
NM_001508chr22615 174 ------
NM_001530chr14196 ------
NM_001533chr19----1298 --
NM_001543chr564454 4380 4151 1726 1574 422 14427 1270 --
NM_001552chr1751040 705 429 283 256 ------
NM_001614chr17------167
NM_001614chr17------167
NM_001616chr21295 ------
NM_001618chr1278 39 ------
NM_001619chr113850 728 123 ------
NM_001620chr111129 ------
NM_001642chr111427 11174 127 --
NM_001655chr1161786 1707 1642 833 511 238 ------
NM_001656chr51445 11300 ----
NM_001658chr14826 348 305 209 ------
NM_001659chr1262714 2518 2404 2000 1731 326 --22420 347 --
NM_001664chr32897 182 ------
NM_001668chr121847 140 1911 ----
NM_001670chr222319 118 --1105 --
NM_001677chr12458 298 ------
NM_001678chr1761458 1364 1265 648 540 466 ------
NM_001681chr12--1734 ----
NM_001682chr1221989 1083 ------
NM_001683chr342641 2428 271 169 ----12050
NM_001684chr153839 3288 2920 2888 2591 1755 1298 --
NM_001689chr221784 25 ------
NM_001694chr161307 ------
NM_001701chr921359 583 1289 ----
NM_001707chr74323 139 59 27 --1179 --
NM_001709chr1122799 647 ------
NM_001723chr61239 ------
NM_001730chr131364 --1409 1465
NM_001730chr131364 --1409 1465
NM_001731chr121120 --1949 --
NM_001742chr731633 1263 588 ------
NM_001746chr51331 --176 --
NM_001750chr5126 187 ----
NM_001753chr731581 191 56 --11384 --
NM_001754chr212472 213 --13998 --
NM_001755chr1632080 301 105 --1753 --
NM_001759chr1264610 3462 1892 1102 1096 920 13973 1879 --
NM_001777chr331179 380 323 ------
NM_001788chr71697 ------
NM_001791chr11371 ------
NM_001792chr182725 125 ------
NM_001797chr16140 --1248 --
NM_001806chr1932902 739 345 ------
NM_001810chr204703 570 130 38 ------
NM_001822chr22678 455 1266 ----
NM_001825chr5141 ------
NM_001826chr1--1145 ----
NM_001829chr41350 ------
NM_001851chr62679 43 ------
NM_001854chr111544 ------
NM_001855chr91710 1761 ----
NM_001895chr202859 816 --176 --
NM_001904chr31387 ------
NM_001907chr162134 81 ------
NM_001918chr1159291 8578 8157 8133 7195 7060 6634 2610 2446 2066 1765 1703 1622 403 384 1276 ----
NM_001923chr11186 ------
NM_001924chr11545 ------
NM_001933chr144447 328 168 89 --1879 --
NM_001937chr13865 828 322 2897 129 ----
NM_001939chrX83673 3156 1522 1421 804 448 292 43 ------
NM_001944chr1831757 509 102 --11777 11923
NM_001945chr521409 1052 ------
NM_001946chr12137 --159 --
NM_001949chr652206 1279 376 368 250 --12481 --
NM_001955chr6176 1120 1383 --
NM_001957chr432296 2010 701 12189 ----
NM_001962chr53230 223 106 ------
NM_001964chr5--1359 ----
NM_001968chr41264 --1346 --
NM_001969chr1423581 533 1541 11392 --
NM_001970chr174390 193 83 72 ------
NM_001973chr11369 ------
NM_001981chr122077 243 123 12409 --
NM_001991chr174885 808 250 48 --32175 868 507 --
NM_001999chr521326 175 --1940 --
NM_002006chr422006 468 15468 --1669
NM_002009chr1532545 1042 435 --12235 12616
NM_002010chr132514 454 ------
NM_002013chr142187 51 ------
NM_002015chr1332470 1038 315 --33082 3043 164 --
NM_002024chrX1884 --1565 --
NM_002025chrX178844 8733 8676 8391 7883 6961 6955 6373 6278 6237 6071 3572 2951 2120 1539 963 723 11526 --17321
NM_002031chr6------1224
NM_002035chr1833214 1288 370 ------
NM_002040chr2142628 1948 634 363 1593 ----
NM_002044chr15151 ------
NM_002054chr21374 ------
NM_002063chrX21158 390 --1140 --
NM_002071chr181138 ------
NM_002072chr9137 ------
NM_002074chr121411 586 11584 ----
NM_002077chr931610 1555 336 1726 1223 --
NM_002086chr1732089 368 112 ------
NM_002095chr81291 ------
NM_002103chr194884 832 725 208 --1321 --
NM_002107chr11170 ------
NM_002126chr17--24033 3788 --23102 418
NM_002130chr521663 210 ------
NM_002131chr64436 402 221 119 --2494 471 --
NM_002136chr121588 ------
NM_002137chr711898 --11626 --
NM_002140chr91876 --21175 417 --
NM_002145chr17144 ------
NM_002146chr172155 119 ------
NM_002147chr173745 668 54 ------
NM_002149chr23755 615 198 ------
NM_002158chr211192 1340 ----
NM_002193chr221287 545 ------
NM_002198chr52660 283 --3591 171 48 --
NM_002199chr4139 ------
NM_002202chr511104 ------
NM_002203chr543792 2905 961 877 1920 1123 --
NM_002204chr1771282 1190 1172 345 292 165 32 ------
NM_002205chr122820 673 --1953 --
NM_002206chr122110 21 ------
NM_002210chr253543 2793 846 615 121 ------
NM_002213chr33247 182 169 ------
NM_002214chr735468 4677 4104 21640 429 13495 1882
NM_002221chr1152793 2700 2241 2060 1003 880 838 684 623 578 495 474 467 279 21 12052 52472 2367 2308 1033 377 --
NM_002222chr321305 192 ------
NM_002223chr1231613 1321 1177 ----13581
NM_002229chr19----1314 --
NM_002230chr172948 157 ------
NM_002233chr111375 ------
NM_002241chr152863 2809 2258 1197 928 ----161
NM_002247chr1011594 ------
NM_002254chr232256 136 60 ------
NM_002264chr364197 3163 1299 1033 815 510 23191 1669 --14425
NM_002265chr1741030 921 424 364 ------
NM_002268chr32490 117 11727 ----
NM_002270chr544997 1713 1324 884 14469 ----
NM_002271chr1362310 2157 1926 694 617 609 ------
NM_002293chr122231 914 11943 12738 --
NM_002296chr1--11749 11570 11657
NM_002298chr132625 552 --11451 --
NM_002309chr22112853 2632 2513 2461 2427 1958 1204 1135 581 140 121 --21054 610 --
NM_002312chr13137 ------
NM_002334chr1131619 774 602 ------
NM_002355chr1231383 873 471 ------
NM_002356chr612784 --12412 --
NM_002359chr17124244 3618 3528 3340 3158 2693 1619 1605 1531 1431 1377 1173 --13944 13898
NM_002372chr5193 ------
NM_002373chr1531204 397 290 ------
NM_002374chr222720 2407 --152 --
NM_002382chr1431112 1106 402 --31191 1009 271 --
NM_002383chr163941 837 787 ------
NM_002387chr551955 1761 1598 312 110 --13393 --
NM_002390chr1751895 1602 1307 798 128 --31947 170 29 11932
NM_002398chr221303 983 --1406 --
NM_002402chr73371 237 92 ------
NM_002403chr1268 27 ------
NM_002429chr1221077 573 --1561 --
NM_002430chr2211016 12333 1326 12160
NM_002438chr10------1169
NM_002442chr1231236 600 186 --11160 --
NM_002467chr81101 1452 ----
NM_002469chr12160 --1483 --
NM_002480chr1221402 64 ------
NM_002486chr921739 441 ------
NM_002490chr222610 480 ------
NM_002499chr1552388 2289 1973 367 180 --1920 --
NM_002500chr211213 ------
NM_002501chr1983914 3469 2795 1568 1521 1512 435 27 ------
NM_002505chr6------1171
NM_002508chr12703 89 ------
NM_002515chr1421442 765 ------
NM_002520chr5170 ------
NM_002522chr1773891 3250 2511 1208 1047 397 142 --12643 --
NM_002526chr621631 78 ------
NM_002537chr153890 765 239 ------
NM_002545chr1154682 2052 1586 1153 1052 ------
NM_002547chrX63186 3169 2952 2700 2649 25 12672 ----
NM_002552chr22140 27 ------
NM_002556chr1142015 1521 858 289 ------
NM_002570chr151277 1417 1349 --
NM_002572chr113396 344 59 ------
NM_002581chr955224 5150 2020 1983 1941 35402 4564 2110 ----
NM_002585chr11246 ------
NM_002588chr531353 477 110 ------
NM_002589chr4183 ------
NM_002594chr2032005 1603 862 ----1852
NM_002595chr12--1564 ----
NM_002599chr113959 917 59 ----1278
NM_002600chr11112 --11160 --
NM_002601chr21368 ------
NM_002607chr721095 876 ------
NM_002609chr561910 1701 584 489 325 64 ------
NM_002613chr16155256 4978 4528 4286 4081 3643 1890 1873 1717 1523 1389 636 570 327 59 24854 4814 44780 3701 1398 1005 --
NM_002628chr32925 371 1182 ----
NM_002632chr14180 --1796 --
NM_002633chr11492 ------
NM_002634chr172833 310 ------
NM_002636chr61196 ------
NM_002646chr131639 859 134 ------
NM_002648chr621308 1076 ------
NM_002651chr11225 ------
NM_002655chr833289 576 370 14044 ----
NM_002657chr2083619 3411 2700 2574 727 701 464 279 12407 ----
NM_002660chr201251 1990 ----
NM_002662chr311689 1630 12182 --
NM_002670chr311597 11125 ----
NM_002693chr151315 ------
NM_002698chr1961020 724 181 129 118 55 12853 12739 --
NM_002705chr164854 731 648 92 ------
NM_002709chr233486 865 830 12773 --22309 883
NM_002713chr12934 245 --1125 --
NM_002715chr51246 21146 820 ----
NM_002716chr1153403 3133 2561 2329 862 --12630 --
NM_002717chr82664 474 ------
NM_002718chr33543 343 283 32389 643 633 ----
NM_002719chr1442265 1507 561 194 22083 1544 ----
NM_002729chr101115 ------
NM_002734chr1732089 622 102 ------
NM_002736chr742178 1724 601 515 ----1398
NM_002742chr141548 ------
NM_002746chr161136 --1106 --
NM_002748chr152765 187 ------
NM_002753chr41550 --174 --
NM_002756chr173970 140 97 ------
NM_002763chr1--1133 ----
NM_002768chr1651453 1213 587 504 198 ------
NM_002778chr104909 809 744 297 --3918 182 24 --
NM_002779chr102512 373 ------
NM_002809chr172319 238 ------
NM_002810chr1------1112
NM_002821chr62295 148 --1584 --
NM_002822chr1211737 ------
NM_002825chr71592 ------
NM_002826chr16912 779 713 355 267 100 ------
NM_002833chr1531450 1270 1174 ------
NM_002837chr1254499 4342 3782 3337 3202 1323 ----
NM_002839chr9--12555 ----
NM_002840chr141223 1065 1011 113 --11175 --
NM_002842chr192331 129 ------
NM_002843chr1143126 2806 2434 1015 1779 ----
NM_002845chr18--1271 ----
NM_002850chr191782 --2228 201 --
NM_002854chr22121 ------
NM_002857chr11931 --2865 441 --
NM_002868chr123919 877 111 ------
NM_002869chr111654 ------
NM_002883chr224737 707 102 26 --1381 --
NM_002886chr31952 11833 ----
NM_002892chr1411119 ------
NM_002895chr202777 747 ------
NM_002918chr191273 ------
NM_002920chr12187 1361 ----
NM_002940chr41377 ------
NM_002941chr31612 ------
NM_002956chr1221318 949 ------
NM_002958chr31708 1937 ----
NM_002959chr12490 481 44408 3141 656 437 13278 --
NM_002968chr161336 ------
NM_002970chrX1305 ------
NM_002971chr3138 --1200 --
NM_002977chr232836 2770 424 11088 ----
NM_002994chr421368 773 1279 ----
NM_002997chr231365 416 81 11197 1253 --
NM_002998chr821695 112 12152 ----
NM_003010chr1711966 --11547 --
NM_003011chr941372 1281 1243 593 ------
NM_003016chr1711670 ------
NM_003026chr92876 194 166 ----
NM_003030chr31463 ------
NM_003031chr1621037 24 ------
NM_003042chr35723 514 336 205 46 11860 1213 --
NM_003043chr394016 3841 3176 1485 844 616 564 521 437 --11260 --
NM_003045chr13114366 3725 3638 3197 1569 1550 1039 1019 604 215 193 --11895 --
NM_003047chr13527 367 219 --11007 --
NM_003051chr141887 1879 617 554 1608 1794 --
NM_003059chr5--1275 ----
NM_003060chr521251 932 1977 ----
NM_003070chr91325 ------
NM_003071chr311439 21811 1670 11574 --
NM_003074chr341692 1458 265 229 12244 1676 --
NM_003076chr1261492 1481 1126 542 444 244 ------
NM_003088chr75827 806 468 282 226 ------
NM_003091chr201185 ------
NM_003108chr252912 2576 2050 1102 503 --11891 --
NM_003112chr722174 115 ------
NM_003113chr22236 183 --1212 --
NM_003128chr221025 553 --22711 2364 --
NM_003130chr721201 873 1526 ----
NM_003131chr62462 276 ------
NM_003133chr111065 1284 ----
NM_003136chr141351 ------
NM_003139chr112796 663 --1830 --
NM_003140chrY1111 ------
NM_003144chr611500 1623 11786 --
NM_003150chr1752276 1661 1573 677 374 21751 953 1445 --
NM_003155chr842649 1778 586 85 ------
NM_003164chr111166 ------
NM_003173chrX21126 930 ------
NM_003179chrX51343 1263 1021 404 260 ------
NM_003185chr2021100 891 1431 ----
NM_003186chr113325 105 47 ------
NM_003189chr173116 2700 2553 2478 2066 1138 566 22866 854 12743 --
NM_003199chr1844982 3900 1497 813 --11741 --
NM_003200chr1962096 1724 460 296 202 51 --11964 --
NM_003203chr231534 821 164 12158 ----
NM_003204chr171464 ------
NM_003214chr61485 --162 --
NM_003215chr421527 1117 ------
NM_003216chr2253149 2722 2696 2455 2184 ------
NM_003220chr611302 1641 21430 1238 11483
NM_003221chr663521 3503 3439 1633 1509 749 ----12730
NM_003224chr206974 867 600 294 198 39 ------
NM_003234chr332416 2206 866 ------
NM_003236chr252235 2197 816 742 114 12837 12475 12457
NM_003238chr11186 ------
NM_003239chr141944 ------
NM_003246chr1551727 757 585 102 46 ------
NM_003250chr17----1448 --
NM_003253chr211121 ------
NM_003255chr1732325 1624 877 --1300 1500
NM_003257chr152909 386 ------
NM_003275chr921058 91 ------
NM_003284chr2124 ------
NM_003291chr132808 225 ------
NM_003292chr132057 1623 97 ------
NM_003305chr4----1379 --
NM_003309chr611737 ----11652
NM_003317chr143758 556 116 ------
NM_003319chr21688 ------
NM_003320chr11114424 3538 3095 2781 1674 1463 1421 1289 624 504 135 ------
NM_003322chr62450 67 --1164 --
NM_003325chr222111 21 ------
NM_003336chrX1396 ------
NM_003342chr1722870 2151 1117 1869 --
NM_003344chr711121 --11111 --
NM_003345chr161370 146 ----
NM_003347chr22102245 2143 2043 2010 1721 1434 830 694 471 386 12132 32004 463 109 --
NM_003348chr1221698 278 11692 ----
NM_003349chr202593 520 ----11313
NM_003350chr811004 1112 ----
NM_003352chr2198 1124 ----
NM_003356chr11123 ------
NM_003360chr41222 ------
NM_003376chr621499 561 11567 1686 --
NM_003376chr621499 561 11567 1686 --
NM_003387chr252782 1156 504 491 395 --12207 11946
NM_003390chr1111127 1793 ----
NM_003392chr323572 1236 1190 ----
NM_003400chr21792 ------
NM_003404chr2071843 1791 1343 1316 473 318 164 ------
NM_003405chr222108 21 ------
NM_003406chr841563 1335 1295 264 --1361 --
NM_003410chrX22289 564 22148 218 ----
NM_003411chrY11705 ------
NM_003412chr322016 1924 2833 218 ----
NM_003413chrX1204 --12011 --
NM_003418chr3184 ------
NM_003427chr61468 --1477 --
NM_003432chr51489 ------
NM_003439chr753541 3000 2332 1020 529 --13165 --
NM_003442chr112600 50 ------
NM_003458chr383055 2926 2744 2639 2569 957 393 130 1121 ----
NM_003463chr612785 22840 156 --1200
NM_003468chr224049 762 1290 ----
NM_003470chr1631716 1583 303 --21296 718 --
NM_003472chr611148 ------
NM_003473chr102765 279 ------
NM_003474chr1041970 591 584 549 ------
NM_003482chr1231735 461 223 --12676 --
NM_003483chr1212246 12475 ----
NM_003488chr174805 796 628 363 --155 --
NM_003502chr16142 ------
NM_003557chr121379 414 --21260 347 --
NM_003559chr1783392 3152 2851 2845 2712 1424 1264 772 --23606 3440 --
NM_003568chr11275 1311 ----
NM_003576chr1352628 2599 2523 2213 2123 12809 ----
NM_003583chr1223223 2672 33446 1303 24 ----
NM_003590chr222834 876 ------
NM_003591chr101105 ------
NM_003592chr71337 ------
NM_003597chr262103 1532 803 564 534 106 ------
NM_003603chr412016 --1457 --
NM_003607chr154113 3933 3794 3442 113 ------
NM_003613chr151164 1244 1603 --
NM_003615chr322538 524 13441 ----
NM_003618chr2--1434 ----
NM_003620chr171146 ------
NM_003629chr183490 2830 2767 2654 2518 2454 426 32 --12582 --
NM_003630chr61158 ------
NM_003633chr542445 2363 1885 641 --12282 --
NM_003635chr102341 92 ------
NM_003653chr17146 ------
NM_003660chr191644 ------
NM_003663chr342297 1072 1047 809 12909 ----
NM_003664chr5298 30 --151 --
NM_003670chr32572 227 --1968 --
NM_003671chr91276 --23247 2659 --
NM_003677chr1232323 1807 698 --1290 --
NM_003679chr153127 2966 2492 2471 852 --12950 --
NM_003680chr11186 1495 2529 259 --
NM_003705chr2----2324 236 --
NM_003711chr5188 ------
NM_003714chr543004 1091 585 202 ----11063
NM_003722chr332668 2234 185 --1167 --
NM_003735chr531353 477 110 ------
NM_003736chr531353 477 110 ------
NM_003749chr131420 1354 ----
NM_003760chr11529 ------
NM_003766chr172455 209 ------
NM_003768chr151568 1474 597 161 112 ------
NM_003774chr1222278 542 --11072 11031
NM_003779chr12455 332 ------
NM_003787chr1811690 ----1394
NM_003791chr16----1172 --
NM_003793chr11296 27 ------
NM_003794chr32882 766 ------
NM_003795chr62149 94 ------
NM_003822chr142591 2015 884 856 --22875 2697 --
NM_003842chr882212 2125 2033 1812 1755 693 465 36 1907 1181 --
NM_003860chr111320 ------
NM_003861chr1421044 862 --22485 2335 --
NM_003872chr222602 2110 12263 12093 --
NM_003873chr1022322 361 21701 922 1724 --
NM_003884chr321842 1615 ------
NM_003887chr252039 1812 1732 1428 350 ------
NM_003893chr101193 1432 ----
NM_003895chr21139 ----11917
NM_003902chr11637 ------
NM_003908chr2021225 1011 ------
NM_003913chr62663 336 11333 ----
NM_003916chrX1383 ------
NM_003919chr7198 ------
NM_003927chr183994 914 860 ------
NM_003930chr71681 ----21753 700
NM_003932chr2221829 337 --1570 --
NM_003934chr91487 ------
NM_003939chr1063731 3604 3421 3005 1456 509 11111 13161 12928
NM_003941chr712335 1983 ----
NM_003946chr162574 164 ------
NM_003947chr331247 1086 105 ------
NM_003949chr1751890 1675 1651 1356 49 ------
NM_003951chrX1404 ------
NM_003972chr101978 --1972 --
NM_003983chr1683562 3506 3350 1649 1434 1096 788 459 --11158 --
NM_003987chr1041724 1545 755 373 ------
NM_003988chr1041801 1622 832 450 ------
NM_003989chr1041660 1481 691 309 ------
NM_003990chr1041660 1481 691 309 ------
NM_003992chr15----1244 --
NM_003994chr1263017 1243 789 664 416 196 2553 45 1706 --
NM_004006chrX11700 ------
NM_004007chrX11700 ------
NM_004009chrX11700 ------
NM_004010chrX11700 ------
NM_004011chrX11700 ------
NM_004012chrX11700 ------
NM_004013chrX11700 ------
NM_004014chrX11700 ------
NM_004015chrX11700 ------
NM_004017chrX11700 ------
NM_004020chrX11700 ------
NM_004035chr1775056 4372 3358 1918 1796 837 450 11330 2800 530 --
NM_004036chr21472 --1559 --
NM_004050chr1412348 2702 210 11770 1512
NM_004055chr1162037 1478 1459 1412 460 432 ------
NM_004056chr8----11012 --
NM_004062chr16239 32 ------
NM_004075chr12------1204
NM_004077chr122467 308 1531 1206 --
NM_004081chrY31374 280 71 ------
NM_004093chr1312709 21060 610 1359 --
NM_004094chr142303 52 23018 2242 23005 1905 --
NM_004098chr101412 ------
NM_004100chr642502 2460 252 77 1625 12623 1312
NM_004105chr2----1963 --
NM_004112chr1741658 1104 599 241 --11727 --
NM_004114chrX2944 459 --11092 --
NM_004132chr1031135 1032 917 --140 --
NM_004134chr51625 ------
NM_004156chr8145 --1125 --
NM_004161chr221329 322 21423 1000 ----
NM_004169chr172622 232 --131 --
NM_004170chr941781 1327 1246 408 1628 ----
NM_004171chr1178749 8389 6536 2100 1075 989 849 37960 6737 2350 --16792
NM_004180chr21555 ------
NM_004199chr5129 ------
NM_004200chr1142958 2878 1218 443 --12280 --
NM_004202chrY2473 189 ------
NM_004208chrX--122 ----
NM_004215chr81516 ------
NM_004225chr821362 1014 --172 --
NM_004227chr752678 2567 2391 1943 1927 ------
NM_004229chrX1606 21678 130 ----
NM_004232chr1833076 2635 786 ------
NM_004233chr631411 1224 509 ------
NM_004235chr91619 ------
NM_004242chr61112 ------
NM_004263chr271567 1539 1533 1386 565 356 278 --11641 --
NM_004272chr51632 ------
NM_004274chr143979 373 53 12573 ----
NM_004279chr71309 11617 ----
NM_004295chr172958 178 11286 ----
NM_004296chr14114025 3807 2919 2865 2604 2584 1498 1220 966 904 811 1397 33229 2781 455 --
NM_004302chr1282424 2249 970 820 754 588 301 121 --132 --
NM_004308chr1161528 689 461 365 256 35 --31898 158 63 --
NM_004309chr174891 323 138 125 --1943 --
NM_004311chr1022866 1948 11069 ----
NM_004321chr293421 3390 3199 3168 2646 2512 2476 1182 813 ------
NM_004326chr12928 853 ------
NM_004330chr151779 ------
NM_004331chr8------11773
NM_004349chr81867 ------
NM_004354chr43224 148 75 ------
NM_004364chr1951258 1251 966 789 137 ------
NM_004370chr62748 360 ------
NM_004378chr151204 ------
NM_004379chr231662 1600 50 ------
NM_004380chr1622322 2095 ------
NM_004384chr5--12183 ----
NM_004385chr51169 ------
NM_004389chr22853 103 ------
NM_004392chr1332603 2299 745 --12039 --
NM_004393chr362010 1972 1766 721 703 359 ------
NM_004395chr56547 499 278 139 127 59 --1103 --
NM_004397chr1144178 2722 1722 929 --13841 --
NM_004405chr21311 ----1206
NM_004415chr61166 1676 ----
NM_004416chr123801 143 41 --177 --
NM_004418chr24505 181 99 39 ------
NM_004420chr1182229 2167 2119 2057 933 904 615 206 2165 154 12241 --
NM_004421chr14743 734 150 44 --1143 --
NM_004422chr173154 57 37 ------
NM_004423chr362460 1848 1790 1670 203 90 ------
NM_004426chr1221481 585 --21971 65 --
NM_004427chr151001 896 829 434 25 ------
NM_004429chrX71279 968 954 477 304 217 125 ------
NM_004430chr822199 105 ------
NM_004432chr922297 924 ------
NM_004436chr11470 ------
NM_004437chr133518 3093 2685 22450 2430 12833 22579 1283
NM_004438chr232609 842 563 ------
NM_004440chr621256 650 ------
NM_004443chr32729 89 ------
NM_004447chr12137 1876 ----
NM_004451chr112108 31 ------
NM_004454chr331945 1492 148 ------
NM_004458chrX143 ------
NM_004459chr171156 ------
NM_004469chrX1165 ------
NM_004475chr1761102 963 926 411 364 146 11200 11059 --
NM_004482chr2------1601
NM_004491chr1984015 3902 2855 2786 1376 1284 495 360 1407 1192 1672
NM_004496chr14242 27 ------
NM_004498chr151282 ------
NM_004499chr5------188
NM_004501chr143454 3344 2688 323 ------
NM_004503chr122325 90 ------
NM_004504chr232957 2644 200 12937 ----
NM_004505chr17------169
NM_004514chr1762542 2535 2344 1990 813 625 ----1858
NM_004521chr101146 ------
NM_004528chr1----198 --
NM_004530chr162460 302 --2411 90 1141
NM_004540chr211237 ------
NM_004554chr1451280 1144 409 183 106 ----127
NM_004560chr92292 217 ------
NM_004566chr1042581 1602 602 131 --3930 206 152 --
NM_004575chr421502 1380 11613 ----
NM_004583chr171633 ------
NM_004586chrX43665 1571 910 112 159 25247 4341 --
NM_004588chr1163666 971 604 438 386 358 24058 3485 2444 364 --
NM_004596chr19161 --1174 --
NM_004598chr521017 550 ------
NM_004599chr222669 201 ------
NM_004603chr7399 69 55 ------
NM_004612chr954663 3452 3405 3209 402 ------
NM_004614chr1682274 1525 907 861 588 462 167 106 11608 ----
NM_004626chr112714 176 --1235 --
NM_004635chr381147 1044 1008 394 299 184 69 26 ------
NM_004637chr31328 --11224 --
NM_004639chr6190 ------
NM_004642chr121132 ------
NM_004646chr192361 168 ------
NM_004654chrY2536 73 ------
NM_004655chr172247 60 ------
NM_004656chr33923 413 279 11178 1828 --
NM_004660chrY52304 2133 1825 927 406 11936 1425 --
NM_004667chr15182 ------
NM_004687chr1741975 1624 1347 315 ----1703
NM_004694chr171253 1336 ----
NM_004698chr11166 ------
NM_004718chr2134 ------
NM_004725chr102978 482 ------
NM_004726chrX32079 698 529 21514 680 13591 --
NM_004733chr32448 240 ------
NM_004734chr1322938 2213 11233 ----
NM_004739chr112508 222 ------
NM_004741chr1021480 379 ------
NM_004745chr8135184 5010 4812 2504 2412 2219 2068 1820 1610 1474 243 232 73 16800 15573 --
NM_004759chr1101802 1684 1464 787 620 506 467 446 213 95 ------
NM_004760chr732092 241 69 1449 1774 --
NM_004772chr531013 588 260 ------
NM_004776chr2042405 1138 1026 400 22618 715 ----
NM_004779chr511282 11189 ----
NM_004783chr163646 435 181 ------
NM_004784chr41136 ------
NM_004788chr1122279 199 22024 1899 12724 --
NM_004796chr1411606 ------
NM_004801chr221545 499 ------
NM_004805chr22296 137 ------
NM_004807chr292214 2001 1963 1657 858 765 624 492 288 1449 12246 --
NM_004808chr1082995 2375 2331 2307 2240 1135 802 462 ------
NM_004815chr164822 4644 4149 3859 1813 748 1541 ----
NM_004821chr52264 26 ------
NM_004822chr1792697 1567 1526 1484 1307 1117 565 88 68 12593 1604 --
NM_004824chr621063 991 ------
NM_004830chr63880 585 296 ------
NM_004834chr252721 2705 2574 680 396 ------
NM_004850chr211507 11246 --11085
NM_004856chr151402 ------
NM_004859chr1722758 452 --12606 --
NM_004862chr1641156 515 91 74 ------
NM_004863chr14135321 4914 4746 4235 1604 1410 1171 972 860 792 410 385 311 ------
NM_004871chr1793727 3207 2872 2689 1550 1316 1005 734 48 ------
NM_004884chr1511718 --1257 --
NM_004893chr51199 ------
NM_004896chr101323 11350 ----
NM_004897chr101771 ------
NM_004898chr422015 144 12349 ----
NM_004902chr201653 ------
NM_004904chr735105 1488 246 ------
NM_004922chr102720 646 ----1312
NM_004924chr192973 965 1235 ----
NM_004926chr1421712 217 1499 ----
NM_004932chr521480 309 ------
NM_004936chr932756 333 195 --12821 --
NM_004938chr921188 983 ------
NM_004952chr13761 315 288 1235 1296 --
NM_004956chr743084 3077 1409 686 13533 ----
NM_004958chr12820 647 ------
NM_004961chrX51410 1316 593 424 179 11088 1469 --
NM_004965chr211617 ------
NM_004966chr101624 ------
NM_004969chr102489 74 ------
NM_004972chr9--1270 1403 --
NM_004975chr201373 ----1686
NM_004976chr1162073 2042 1729 1404 1317 1268 13268 14682 25018 1687
NM_004978chr191583 1559 1541 1485 1420 1136 433 389 338 ------
NM_004979chrX51102 453 399 247 211 ----1874
NM_004985chr1212871 ------
NM_004992chrX117840 7645 6052 5935 5863 5322 3141 2230 1449 651 572 1602 23158 2668 22844 1515
NM_004992chrX117840 7645 6052 5935 5863 5322 3141 2230 1449 651 572 1602 23158 2668 22844 1515
NM_004995chr1461474 1267 1183 486 464 139 1345 ----
NM_004998chr152274 128 ------
NM_005000chr72896 795 11043 ----
NM_005003chr16160 ------
NM_005008chr222782 749 --1864 --
NM_005010chr722046 619 --21956 1813 --
NM_005016chr121230 ------
NM_005020chr71155 ------
NM_005023chr521474 1340 ------
NM_005025chr3160 ------
NM_005030chr161274 ------
NM_005032chrX21073 97 ------
NM_005056chr1245174 4273 4000 3489 --1720 --
NM_005066chr11546 ------
NM_005068chr611302 ------
NM_005072chr163414 112 39 ------
NM_005076chr174200 3687 3618 2960 1510 1435 1111 --23840 1037 14079
NM_005077chr91410 ------
NM_005078chr1531509 1371 247 11691 11300 --
NM_005079chr812265 23242 868 --1446
NM_005080chr222759 752 ------
NM_005087chr3----1577 --
NM_005095chr11204 1396 ----
NM_005096chrX31182 199 156 11062 ----
NM_005099chr121066 166 ------
NM_005103chr111278 ------
NM_005105chr111428 --12066 --
NM_005116chr20123863 3673 2915 1659 1587 1322 846 767 698 689 579 25 23574 1801 11652 --
NM_005121chr1711291 ------
NM_005124chr62694 271 ------
NM_005134chr182357 298 ------
NM_005137chr2262147 1956 1722 1635 590 125 ------
NM_005156chr924548 3566 ------
NM_005160chr2295499 5048 4909 4397 2640 2574 2398 1756 1114 25263 4181 1805 14613
NM_005161chr1151672 1527 1501 1409 433 --126 --
NM_005165chr17128 --1109 --
NM_005169chr113514 262 81 ------
NM_005173chr1771212 973 953 475 307 259 194 11158 ----
NM_005184chr1941425 1303 1110 1074 122 ----
NM_005187chr1641571 1531 94 80 1480 61914 1882 1850 1818 1786 1754 --
NM_005188chr1187746 7087 7003 6547 5052 1841 1487 1049 15936 11803 --
NM_005194chr201106 --1121 --
NM_005197chr1425841 1649 ------
NM_005201chr3----1174 --
NM_005202chr191854 1774 1714 1502 747 410 276 122 28 ------
NM_005206chr1711272 1350 ----
NM_005215chr18--1634 ----
NM_005219chr571534 1436 1351 499 416 235 136 ------
NM_005229chrX2499 381 ------
NM_005230chr121204 ------
NM_005233chr31477 22482 2418 --11792
NM_005235chr276720 6644 5528 5499 5270 4875 2340 17111 11061 --
NM_005238chr1153501 2642 1366 960 271 12207 ----
NM_005240chr11564 ------
NM_005249chr14--1598 ----
NM_005252chr142498 259 ------
NM_005254chr1521336 1169 ------
NM_005259chr21170 ------
NM_005266chr131308 543 106 1635 21536 1198 --
NM_005276chr1231466 677 187 --21453 654 --
NM_005276chr1231466 677 187 --21453 654 --
NM_005277chr421806 542 ------
NM_005284chr61173 ------
NM_005316chr112984 71 ------
NM_005324chr1731986 1915 1829 --1488 --
NM_005336chr252207 296 267 180 150 ----1528
NM_005339chr442989 2936 2767 99 1936 ----
NM_005342chrX2633 320 --12154 --
NM_005359chr18146488 6277 5903 5318 4833 4517 4297 4174 2372 2328 2238 1928 1283 1193 16188 26065 2204 --
NM_005382chr8161 ------
NM_005385chr341971 1916 945 843 145 ----
NM_005386chr201738 ----1128
NM_005387chr11--1102 ----
NM_005388chr931437 611 83 ------
NM_005392chr93638 567 411 11766 ----
NM_005398chr101129 1898 ----
NM_005399chr132889 879 400 1849 ----
NM_005400chr262896 2494 2061 1921 281 178 22378 274 22415 305 --
NM_005402chr73685 544 482 --1705 --
NM_005406chr181150 ------
NM_005407chr1461260 1071 545 377 350 277 ------
NM_005415chr22683 526 1655 ----
NM_005418chr112649 479 ------
NM_005430chr122765 280 ------
NM_005433chr1832093 2081 1109 12557 ----
NM_005435chr7----1564 --
NM_005436chr1082854 2691 737 485 327 306 247 81 14011 21007 976 13754
NM_005443chr42385 72 ------
NM_005456chr112712 271 ------
NM_005458chr921640 87 1671 1175 --
NM_005461chr2041680 449 350 191 21421 1359 11347 --
NM_005474chr1711617 ------
NM_005475chr1242864 869 322 198 13209 ----
NM_005476chr951129 1084 485 120 97 ------
NM_005477chr1532474 2411 705 12057 --11827
NM_005477chr1532474 2411 705 12057 --11827
NM_005487chr2251620 1492 788 229 91 --1672 --
NM_005494chr7--2591 522 ----
NM_005497chr17115557 5466 5215 4853 4787 4311 3885 2463 2450 827 459 13835 ----
NM_005499chr19----1545 --
NM_005502chr91975 1478 --1797
NM_005504chr1236328 2030 1295 16559 --14008
NM_005505chr124735 675 347 35 --1170 --
NM_005506chr462808 2519 2270 1943 285 146 1127 ----
NM_005507chr114456 320 197 33 ------
NM_005509chr5--11435 ----
NM_005520chr51546 ------
NM_005522chr721196 137 ------
NM_005523chr721439 249 ------
NM_005530chr151124 ----1232
NM_005537chr131834 ------
NM_005550chr162565 517 --1219 --
NM_005563chr11543 ------
NM_005578chr323877 3341 ------
NM_005587chr151268 ------
NM_005595chr11317 ------
NM_005596chr966041 4935 4692 2316 2297 502 12383 ----
NM_005604chr63668 427 56 12089 --1342
NM_005614chr71727 ------
NM_005619chr19154 ------
NM_005625chr82925 201 155 ----
NM_005626chr11534 --1170 --
NM_005637chr1811912 ------
NM_005638chrX31595 1386 1173 ------
NM_005647chrX103310 3253 2758 2605 1356 1338 1180 1138 829 134 --11299 --
NM_005660chrX253 28 ------
NM_005665chr144000 3864 654 221 ------
NM_005668chr53950 906 816 11693 --23444 3271
NM_005669chr542118 2083 1998 670 ------
NM_005670chr61370 12092 ----
NM_005678chr151276 1202 1771 --
NM_005686chr161022 1007 516 470 373 21 ------
NM_005717chr12442 47 ------
NM_005718chr34792 766 653 200 ------
NM_005721chr21757 ------
NM_005722chr231868 1837 676 12012 ----
NM_005724chr151133 ------
NM_005730chr1253151 2654 2232 1138 818 33307 3004 1248 ----
NM_005731chr2--2318 32 ----
NM_005735chr22220 76 --1268 --
NM_005736chr1041590 1065 282 249 ------
NM_005737chr242847 1982 718 685 ------
NM_005740chr222764 83 --1678 --
NM_005746chr71251 ------
NM_005748chr1242339 748 491 327 1801 ----
NM_005749chr171278 ------
NM_005754chr521047 38 ----1831
NM_005759chr234593 4214 1477 --13484 --
NM_005766chr13----1204 179
NM_005778chr32476 183 ----1400
NM_005779chr543277 3171 3022 759 22934 324 ----
NM_005782chr17158 ------
NM_005786chr1831107 976 65 --1376 --
NM_005789chr1741679 501 276 37 ------
NM_005795chr21193 ------
NM_005801chr171535 --1231 --
NM_005813chr222533 404 ------
NM_005814chr191174 1143 1113 505 295 248 237 224 60 ----21086 166
NM_005819chr173446 3035 2676 2325 728 362 215 ----13051
NM_005828chr17114298 4085 3917 3672 1827 1049 824 731 615 602 152 ------
NM_005839chr11282 ------
NM_005840chrX57680 7358 6406 1620 158 ----15461
NM_005842chr13----192 --
NM_005851chr11167 --1342 --
NM_005852chr1731106 404 253 ------
NM_005853chr16----155 --
NM_005857chr11458 --151 --
NM_005864chr141605 ------
NM_005868chr752522 2145 684 614 603 --22116 2069 --
NM_005876chr22694 126 ------
NM_005898chr113683 588 455 ------
NM_005899chr1741551 1290 568 478 ------
NM_005900chr41349 ------
NM_005901chr18108024 6972 6926 6863 5385 3474 2713 1542 1375 820 15413 --25301 2033
NM_005902chr1543592 3276 3123 1029 11623 13027 --
NM_005909chr5--11519 13805 --
NM_005911chr221341 1280 1418 ----
NM_005920chr172862 2769 1274 1224 1206 1144 584 --12637 --
NM_005922chr6--1427 ----
NM_005937chr1783742 3117 1350 1117 669 192 151 51 11585 ----
NM_005938chrX21362 1173 ------
NM_005941chr811509 23100 1236 ----
NM_005943chr631481 1401 186 ------
NM_005944chr3136 ------
NM_005955chr1115157 3769 2136 2002 1913 1888 1003 987 762 664 639 --24050 3775 --
NM_005962chr1011457 ------
NM_005962chr1011457 ------
NM_005964chr17--183 ----
NM_005966chr21136 1495 ----
NM_005969chr1111058 --194 1396
NM_005984chr225402 370 334 205 126 ------
NM_005985chr202733 125 ------
NM_005990chr562514 1063 963 827 727 25 --12339 --
NM_006007chr964263 3939 3786 3737 556 419 11150 13159 --
NM_006011chr1573944 3358 3143 3111 1686 691 344 --13051 --
NM_006016chr611678 --1343 --
NM_006022chr131829 --1256 --
NM_006030chr331651 740 192 ------
NM_006033chr1822211 2134 --1466 --
NM_006037chr254379 3221 1832 808 277 --1799 --
NM_006038chr2051855 1726 1574 556 505 ------
NM_006039chr174998 812 251 66 --1428 --
NM_006047chr2033403 1108 233 --13496 --
NM_006048chr11503 ------
NM_006064chrX1276 1270 ----
NM_006070chr31328 ------
NM_006079chr6------1333
NM_006089chrX31348 265 251 ------
NM_006095chr423315 867 --1255 --
NM_006100chr32441 122 ------
NM_006113chr13840 175 109 ------
NM_006121chr12------165
NM_006133chr11122111 1921 1777 1644 1623 1553 756 544 445 307 200 61 ------
NM_006135chr121108 407 11166 ----
NM_006145chr193354 294 252 --1748 --
NM_006148chr1762959 2906 2437 1959 1044 187 ------
NM_006153chr31208 ------
NM_006154chr1532399 1855 260 ------
NM_006156chr142261 239 ------
NM_006164chr22449 323 1424 ----
NM_006166chr1232555 2209 2124 ------
NM_006177chr142894 756 ------
NM_006180chr931625 324 200 ------
NM_006185chr115448 174 162 150 56 ------
NM_006191chr122922 848 ------
NM_006195chr92567 319 ------
NM_006203chr544331 1905 1830 1741 --15512 --
NM_006224chr1742317 2069 1683 707 ------
NM_006237chr1321897 885 --12294 --
NM_006243chr11865 1121 ----
NM_006251chr533127 1039 109 ------
NM_006264chr41420 ------
NM_006265chr82990 620 1461 ----
NM_006266chr93176 31 22 ------
NM_006268chr1151112 939 296 179 142 11006 ----
NM_006275chr202336 77 ------
NM_006285chr91272 ------
NM_006293chr154408 266 243 218 --1201 --
NM_006301chr122615 179 ------
NM_006302chr2268 44 ------
NM_006306chrX75118 5035 4521 3874 2240 205 95 22195 1202 --11158
NM_006307chrX------123
NM_006310chr172522 469 ------
NM_006312chr121235 ------
NM_006313chr1211259 --11575 --
NM_006321chr342030 1805 746 397 1134 11826 --
NM_006329chr14139 --1541 --
NM_006330chr8--11232 ----
NM_006333chr21644 --1554 --
NM_006335chr12736 337 ------
NM_006336chr931325 397 277 --31458 1396 1064 --
NM_006352chr11439 ------
NM_006354chr3132 ------
NM_006359chrX21626 195 12275 12248 --
NM_006366chr61150 ------
NM_006367chr11763 ------
NM_006379chr72786 600 ----12333
NM_006380chr1763599 3507 3409 2674 1439 220 1884 ----
NM_006382chr171244 ------
NM_006387chr1961038 1020 859 455 68 59 ------
NM_006390chr1231807 1535 126 ------
NM_006393chr1041155 593 227 89 ------
NM_006400chr121282 ------
NM_006403chr6----1447 --
NM_006411chr63906 822 184 ------
NM_006420chr2052773 2619 941 100 64 11160 ----
NM_006421chr841215 1007 293 25 1119 ----
NM_006422chr12132 ------
NM_006434chr1052585 2208 963 862 788 ----11092
NM_006454chr462996 1065 876 644 247 23 1774 2483 143 --
NM_006457chr463924 2914 1391 1226 614 191 --13065 --
NM_006458chr11267 22 --190 --
NM_006460chr1721752 128 ------
NM_006469chr111422 --11249 --
NM_006475chr131263 1506 ----
NM_006480chr52373 100 ------
NM_006482chr1223223 2672 33446 1303 24 ----
NM_006489chr1421442 765 ------
NM_006492chr12336 117 ------
NM_006500chr1141191 994 326 168 ------
NM_006510chr63848 344 334 ------
NM_006517chrX21567 253 12217 ----
NM_006520chrX31678 1528 170 1631 ----
NM_006526chr2031543 1403 666 ------
NM_006527chr4193 ------
NM_006532chr193551 246 145 --1152 --
NM_006534chr2032400 787 248 ------
NM_006538chr274081 4008 3752 3123 1160 1121 81 --13036 --
NM_006540chr841091 408 140 134 11002 ----
NM_006544chr1435353 5271 3765 --11310 --
NM_006546chr17106242 6063 5892 5256 4789 4048 2368 2036 1896 732 11163 14165 --
NM_006547chr732016 720 531 ------
NM_006559chr11171 ------
NM_006561chr1055747 5409 5050 2240 386 1406 14970 15097
NM_006566chr183453 368 362 1404 --1426
NM_006570chr92390 266 ------
NM_006572chr1722956 793 ------
NM_006595chr1111578 ------
NM_006599chr1687594 6800 6575 6456 2022 1442 837 256 37346 6479 2937 11332 --
NM_006601chr122907 887 1440 ----
NM_006609chr2--11164 ----
NM_006614chr322681 1349 12272 ----
NM_006618chr121312 92 11124 1532 --
NM_006621chr131929 1752 1265 ------
NM_006624chr1022084 1927 --11588 --
NM_006625chr11470 1410 ----
NM_006625chr11470 1410 ----
NM_006625chr11470 1410 ----
NM_006628chr1544618 3501 3020 1870 ------
NM_006629chr1832394 1804 899 ------
NM_006646chr1352711 1151 541 356 269 ------
NM_006651chr41512 --11126 --
NM_006654chr1233642 3325 1655 14072 ----
NM_006690chr2081997 1975 547 428 354 203 78 35 --12085 --
NM_006698chr2031259 306 248 11241 ----
NM_006699chr122652 2249 22033 598 --1972
NM_006703chr63344 338 72 ------
NM_006704chr13----1360 --
NM_006708chr62946 870 ------
NM_006711chr162217 108 ----1673
NM_006717chr932423 1155 490 ------
NM_006722chr312723 ------
NM_006724chr6--1427 ----
NM_006727chr5----1459 --
NM_006732chr1951712 1548 811 715 119 12106 ----
NM_006734chr621323 216 --11060 --
NM_006736chr261605 1393 589 468 366 201 --21660 320 --
NM_006749chr82230 93 ------
NM_006750chr16127443 6943 5823 5732 5713 5212 2241 2197 1147 1136 594 182 16356 ----
NM_006756chr821387 398 ----1267
NM_006761chr17--1581 ----
NM_006766chr821935 910 ------
NM_006772chr621549 1122 --11194 --
NM_006775chr6--178 ----
NM_006777chrX52804 2423 967 779 623 --22343 2023 --
NM_006788chr1881994 1958 1856 769 622 549 535 440 21732 1503 11844 --
NM_006791chr151500 ------
NM_006801chr191578 1588 ----
NM_006805chr541607 1372 1102 422 ------
NM_006807chr1711024 ------
NM_006815chr122978 195 ------
NM_006823chr831114 402 325 ------
NM_006826chr23287 190 181 ------
NM_006827chr1432643 2353 67 ------
NM_006832chr141429 ------
NM_006836chr122498 427 ------
NM_006838chr121558 11876 11670 --
NM_006852chr1722610 1127 ------
NM_006854chr721874 749 1455 11780 --
NM_006856chr12----1333 1788
NM_006861chr1251892 1716 804 618 334 ----1246
NM_006874chr42928 817 --1859 --
NM_006875chrX2350 22 ------
NM_006876chr112527 39 ------
NM_006884chr31463 ------
NM_006888chr1453184 3136 2640 594 536 --33512 2532 2454 12690
NM_006896chr73836 406 290 ------
NM_006898chr22784 590 1277 ----
NM_006906chr111138 2864 634 ----
NM_006910chr16------1311
NM_006920chr211731 ------
NM_006922chr222311 2061 ------
NM_006924chr1731173 522 274 13699 --1645
NM_006925chr14--187 ----
NM_006927chr1642233 1851 1373 865 --1156 --
NM_006937chr171172 ------
NM_006940chr1221566 1254 ------
NM_006941chr223894 146 82 ------
NM_006943chr2053178 2593 2295 1216 90 12978 12701 --
NM_006950chrX2291 173 --1791 --
NM_006981chr942796 2028 937 150 12120 ----
NM_006997chr101484 ------
NM_006999chr531952 1854 760 --1777 --
NM_007005chr9--1401 139 --
NM_007006chr1613445 ------
NM_007008chr2------1322
NM_007011chr15116512 6479 5470 4478 4244 2337 2307 2289 1948 1858 936 15145 ----
NM_007017chr51879 ------
NM_007033chr162309 1920 1742 1428 731 169 11482 11896 --
NM_007034chr1159 ------
NM_007047chr652393 1903 950 254 36 11811 ----
NM_007050chr2077652 5805 5598 2977 2582 495 288 12260 11340 21017 334
NM_007052chrX----1127 --
NM_007064chr321105 362 ------
NM_007067chr173489 374 141 195 ----
NM_007073chr653799 3506 1544 1522 816 --33759 3611 3555 --
NM_007078chr1032940 2615 660 154 --1404
NM_007084chr131498 11110 ----
NM_007099chr22829 173 ------
NM_007106chr1352383 1954 1808 567 376 12015 ----
NM_007114chr333011 1339 977 ------
NM_007124chr621457 104 ------
NM_007137chrX64875 4586 3831 3722 1436 802 21547 1341 14914 --
NM_007144chr1731300 989 493 --11103 --
NM_007146chr1752755 2683 2655 2151 2113 1259 12088 --
NM_007150chrX4612 447 411 291 --11804 --
NM_007158chr131039 1003 912 2398 284 ----
NM_007159chr321397 46 ------
NM_007174chr1221695 112 21787 1490 11948 --
NM_007185chr12732 201 ------
NM_007191chr121276 ------
NM_007203chr923381 2527 ------
NM_007212chr121681 71 ------
NM_007214chr61544 ------
NM_007216chr112448 389 --1154 --
NM_007219chr201886 ------
NM_007236chr1582365 1940 1894 1877 1541 799 578 468 --2558 519 11801
NM_007245chr162295 113 ------
NM_007246chr42843 704 ------
NM_007249chr1377421 6893 2736 1450 909 753 730 28871 2343 33383 2319 743 --
NM_007282chr31155 ------
NM_007283chr372585 2336 2263 1906 991 446 335 --12641 --
NM_007286chr582097 1998 1899 1479 1371 1346 482 79 1504 1578 --
NM_007292chr1775056 4372 3358 1918 1796 837 450 11330 2800 530 --
NM_007294chr1751074 1038 363 154 111 ------
NM_007295chr1751074 1038 363 154 111 ------
NM_007296chr1751074 1038 363 154 111 ------
NM_007297chr1751074 1038 363 154 111 ------
NM_007298chr1751074 1038 363 154 111 ------
NM_007299chr1751074 1038 363 154 111 ------
NM_007300chr1751074 1038 363 154 111 ------
NM_007302chr1751074 1038 363 154 111 ------
NM_007303chr1751074 1038 363 154 111 ------
NM_007304chr1751074 1038 363 154 111 ------
NM_007305chr1751074 1038 363 154 111 ------
NM_007325chrX32005 1336 513 ------
NM_007331chr452728 1702 961 506 133 12548 ----
NM_007345chr1821702 1482 1702 ----
NM_007358chr121573 75 ------
NM_007359chr1751768 1320 619 600 407 ------
NM_007365chr171406 1395 880 824 809 781 548 ------
NM_007373chr10--1632 11598 --
NM_007375chr11893 12743 ----
NM_012069chrX32238 691 61 1267 --22142 613
NM_012074chr141722 1374 --1830
NM_012081chr523516 1152 --13315 --
NM_012082chr81899 ------
NM_012090chr1------1201
NM_012095chr1063086 2930 2665 2250 2230 268 12749 1562 --
NM_012096chr311210 --1678 --
NM_012097chr22779 572 12306 ----
NM_012098chr921069 52 --1574 --
NM_012102chr132163 1760 744 --1806 --
NM_012104chr1163752 3662 1002 384 363 226 1162 1408 --
NM_012104chr1163752 3662 1002 384 363 226 1162 1408 --
NM_012110chr4173 ------
NM_012124chr111221 ------
NM_012141chr13--12641 ----
NM_012154chr81668 ------
NM_012156chr2093000 2654 2463 2382 1373 1305 773 416 222 21218 989 21286 22 --
NM_012160chr6------1409
NM_012180chr41593 1753 ----
NM_012193chr1194954 4217 3993 3686 3339 3285 2028 1962 713 34395 3504 1277 --24640 988
NM_012197chr92599 562 ------
NM_012199chr1104147 3318 3230 3082 2946 1642 1383 1141 1049 244 ------
NM_012215chr1041886 1838 1780 1251 ------
NM_012223chr21453 1121 ----
NM_012224chr431078 992 446 ------
NM_012229chr10--1540 145 --
NM_012232chr1742201 1421 558 249 --11433 1842
NM_012234chr333668 3059 153 ------
NM_012238chr1021668 515 ------
NM_012244chr1431725 1480 1301 ------
NM_012249chr21326 23258 718 ----
NM_012257chr7--1904 ----
NM_012261chr204704 502 273 140 ------
NM_012262chr143548 448 207 165 14705 ----
NM_012264chr2271687 1547 1425 807 723 94 30 --11370 --
NM_012264chr2271687 1547 1425 807 723 94 30 --11370 --
NM_012268chr192248 240 ------
NM_012285chr172113 75 ------
NM_012288chr6104647 4543 3780 2279 1447 1232 1110 472 299 167 ----14257
NM_012290chr21470 ------
NM_012297chr432476 2182 421 2931 876 127 --
NM_012300chr532509 2157 350 ------
NM_012301chr721925 231 --21860 578 --
NM_012304chr542481 2165 634 132 --1763 --
NM_012306chr1283294 3241 3160 3129 2308 1096 552 48 ------
NM_012307chr181162 ------
NM_012308chr111378 --21738 1705 --
NM_012309chr1144079 804 507 180 44341 3942 3172 1368 34206 651 125 --
NM_012319chr182836 253 ------
NM_012320chr164998 440 366 293 11378 11310 --
NM_012324chr222283 25 186 ----
NM_012325chr2021612 1302 11025 ----
NM_012326chr21718 --1630 --
NM_012329chr1721157 246 11495 1455 --
NM_012330chr101121 11413 ----
NM_012333chr111253 --11393 --
NM_012384chr2032074 1501 544 --12454 --
NM_012392chr1146 --1276 --
NM_012398chr1972889 2552 815 757 686 560 262 --11932 --
NM_012399chr2221828 441 ------
NM_012402chr1191280 1216 1127 1078 281 210 122 103 22 ------
NM_012410chr164381 349 106 90 ------
NM_012412chr72769 728 --1859 --
NM_012414chr11164 ------
NM_012428chr15--1341 ----
NM_012464chr421182 81 ------
NM_012470chr7----1371 --
NM_012471chrX--11775 ----
NM_012473chr223154 98 21 ------
NM_012479chr752043 1102 1005 227 202 ------
NM_012482chr1----1669 --
NM_013230chrY11430 ------
NM_013231chr1473547 2932 2754 1370 1243 704 371 23340 1457 11544 --
NM_013233chr2--1361 ----
NM_013236chr221413 ------
NM_013240chr2153673 1469 1356 1027 932 23800 277 14105 --
NM_013246chr112313 113 ------
NM_013253chr113965 282 126 ----1415
NM_013255chr7118678 8548 6599 6485 6169 3067 2533 1917 1567 1249 630 ------
NM_013257chr832219 1939 729 ------
NM_013269chr1241734 1426 1337 420 1740 ----
NM_013275chr162526 133 ------
NM_013279chr1142007 943 712 626 11989 ----
NM_013283chr52783 222 ------
NM_013286chr393710 3227 2401 2361 1470 810 710 500 344 11528 23216 2581 --
NM_013304chr16152 ------
NM_013305chr183251 205 58 --199 --
NM_013309chr1512173 ------
NM_013316chr71994 ------
NM_013336chr381763 1756 1478 748 616 501 466 406 1191 1184 --
NM_013351chr173248 179 105 ------
NM_013365chr222590 118 ------
NM_013372chr1532201 1287 83 --32592 1317 125 --
NM_013374chr353072 2990 2365 859 539 2882 828 ----
NM_013376chr192242 28 ------
NM_013377chr121175 ----1147
NM_013382chr1482133 1848 1690 1491 877 846 622 405 --12265 --
NM_013392chr21144 ------
NM_013399chr1681727 1721 1325 1274 1154 641 571 40 1172 1689 --
NM_013403chr193130 103 23 --1273 --
NM_013423chrX2264 81 ------
NM_013427chrX2264 81 ------
NM_013433chr1931768 282 91 11638 1186 --
NM_013434chr291944 1841 1726 1667 1637 1290 445 212 177 ------
NM_013434chr291944 1841 1726 1667 1637 1290 445 212 177 ------
NM_013436chr21655 ------
NM_013438chr91415 21734 1172 ----
NM_013441chr13440 45 35 ------
NM_013444chrX----1838 --
NM_013446chr721322 926 ------
NM_013943chr133293 2173 204 ------
NM_013960chr81576 --1541 --
NM_013989chr1431901 413 402 ----14946
NM_014002chr12250 122 ------
NM_014011chr21507 ------
NM_014016chr3127 ------
NM_014023chr1031852 1167 958 22158 436 ----
NM_014028chr632783 2633 313 1777 ----
NM_014038chr7184 ------
NM_014043chr321304 651 ------
NM_014057chr91369 1652 ----
NM_014106chr1532069 728 388 ------
NM_014110chr12934 245 --1125 --
NM_014112chr821605 259 --1881 --
NM_014117chr161479 --12584 --
NM_014149chr72606 212 1131 ----
NM_014153chr162196 172 ------
NM_014154chr33599 496 161 ----11574
NM_014155chr1177099 6786 5341 5132 1406 1026 167 12811 16997 --
NM_014157chr16103806 3436 2977 2800 1412 1282 1222 956 177 100 --33941 1521 399 21549 1395
NM_014159chr33411 253 205 --1664 --
NM_014181chr212803 --12794 --
NM_014182chr121627 1158 ----
NM_014216chr1431438 1052 536 --11155 --
NM_014217chr121242 73 1325 ----
NM_014230chr17--2447 203 ----
NM_014231chr1271798 844 795 457 407 399 227 ------
NM_014232chr1721175 393 ------
NM_014232chr1721175 393 ------
NM_014233chr1751988 1607 516 267 102 ------
NM_014240chr323421 1373 11416 23556 1068 --
NM_014246chr224912 611 397 183 --11662 --
NM_014250chr2251620 1492 788 229 91 --1672 --
NM_014253chrX2929 372 ----11816
NM_014268chr184386 345 250 199 ------
NM_014275chr54877 619 592 309 --1117 --
NM_014278chr4170 ------
NM_014284chr19926 876 787 777 429 354 312 129 83 ------
NM_014286chr9103486 3358 2773 2587 1289 1278 710 549 519 282 --22733 2691 --
NM_014288chr11218 ------
NM_014294chr811434 ------
NM_014299chr1981939 1825 1619 1385 701 268 246 209 ------
NM_014305chr131179 ------
NM_014309chr2294657 4379 4283 3471 1602 1460 1026 657 43 14424 14062 --
NM_014317chr10123 ------
NM_014323chr222853 309 ------
NM_014331chr477554 7253 7023 6682 6144 5793 2340 22308 1502 --125
NM_014333chr1122233 1941 ------
NM_014368chr942168 1773 1523 156 ------
NM_014372chr12460 415 11914 ----
NM_014381chr1422744 2543 11086 --13118
NM_014382chr32700 159 ------
NM_014391chr10140 ------
NM_014415chr31152 ------
NM_014417chr193710 211 70 ------
NM_014426chr201470 ------
NM_014454chr641073 887 185 165 1731 ----
NM_014456chr101610 ------
NM_014458chr11929 21302 1124 ----
NM_014460chr22101715 1504 1104 525 489 444 400 365 239 90 11749 1692 --
NM_014489chr116726 573 312 243 95 68 --1809 --
NM_014498chr31329 ------
NM_014504chr721997 281 ------
NM_014507chr2241189 1114 1081 1014 --2898 293 --
NM_014515chr122971 105 1129 ----
NM_014517chr321913 271 ------
NM_014554chr1212215 ----1134
NM_014567chr163325 123 57 ------
NM_014573chr1721441 114 --11259 --
NM_014574chr141107 ------
NM_014577chr223704 664 245 ------
NM_014583chr31487 ------
NM_014584chr14--1605 11636 --
NM_014588chr20153 ------
NM_014612chr931059 383 337 ------
NM_014621chr21260 ------
NM_014623chr6171 ------
NM_014630chr152943 854 11257 ----
NM_014636chr963594 2852 1109 795 544 58 22785 2680 ----
NM_014637chr841176 500 482 30 ------
NM_014649chr19152 ------
NM_014660chr7--1383 ----
NM_014661chr10103939 3848 3480 3240 1325 1200 432 362 169 38 23659 3493 ----
NM_014663chr13806 369 315 ------
NM_014665chr853573 2751 2333 293 76 --13351 --
NM_014667chr362426 2185 2171 1729 1591 950 ------
NM_014670chr221109 71 ------
NM_014676chr12524 414 155 ----
NM_014677chr81867 ----179
NM_014678chr224544 134 67 33 --2637 602 --
NM_014680chr172139 42 ------
NM_014682chr81730 1845 ----
NM_014683chr1721718 1677 ------
NM_014685chr161371 ------
NM_014686chr193235 178 156 12383 12404 --
NM_014690chr753073 2892 2352 2056 453 --11977 --
NM_014693chr31751 ------
NM_014700chr1621489 1456 ------
NM_014701chr1513343 22564 2140 ----
NM_014702chr623249 527 12432 ----
NM_014703chr331161 1076 283 --31228 846 33 --
NM_014705chr712011 ------
NM_014707chr721550 922 1185 ----
NM_014709chr2----1490 --
NM_014711chr1611432 ------
NM_014717chr192346 138 ----1714
NM_014720chr1021628 583 1208 ----
NM_014721chr696962 5676 5638 5430 5405 2605 2250 1872 142 24862 944 27306 5051 --
NM_014726chr173222 180 158 ------
NM_014729chr8--1529 1805 --
NM_014730chr12165149 4976 4935 4772 4738 4518 4484 4408 4316 3767 2012 1493 1478 1163 793 182 --34533 1397 632 --
NM_014730chr12165149 4976 4935 4772 4738 4518 4484 4408 4316 3767 2012 1493 1478 1163 793 182 --34533 1397 632 --
NM_014731chr2031314 613 515 11402 21189 1149 11583
NM_014739chr623774 1059 ------
NM_014742chr2011248 --1117 --
NM_014743chr42955 212 22856 2216 ----
NM_014747chr1204994 4985 4718 4633 4370 4313 4233 3865 1871 1786 1537 1161 947 763 640 434 390 384 241 143 ------
NM_014748chr23370 311 131 ------
NM_014751chr81680 ------
NM_014754chr81170 ------
NM_014755chr243810 1353 1114 434 --2876 231 1464
NM_014757chr562335 1991 1818 232 220 142 --1762 --
NM_014759chr851550 563 386 232 196 --1141 --
NM_014761chr162780 288 --1239 --
NM_014767chr10133255 3148 2902 2865 2846 2749 2460 2389 1356 1034 516 462 440 --1266 --
NM_014771chr162783 147 ------
NM_014772chr18123286 2883 2752 2611 2242 1317 1004 998 479 260 251 47 11048 31308 363 93 --
NM_014774chr122539 2219 --21302 629 --
NM_014776chr1242970 2683 2453 451 12497 ----
NM_014779chr31266 ------
NM_014786chr114904 875 446 203 ------
NM_014798chr1771871 1659 753 588 511 280 188 ----1641
NM_014800chr72967 171 ----1151
NM_014802chr121899 ------
NM_014806chr93419 130 85 ------
NM_014807chr113702 536 293 ------
NM_014810chr123524 1486 12264 1163 13418
NM_014811chr9------1173
NM_014812chr11774 ------
NM_014813chr11529 1504 ----
NM_014820chr32591 326 ------
NM_014824chr11----1145 --
NM_014826chr154113 3933 3794 3442 113 ------
NM_014828chr1431922 743 88 ------
NM_014829chr52683 137 ------
NM_014830chr1253410 2442 1418 1394 596 --33097 2732 1407 --
NM_014839chr112231 21777 1743 ----
NM_014840chr12103057 2733 2472 1106 638 523 442 226 131 117 1458 ----
NM_014841chr611111 --11169 --
NM_014849chr13525 371 28 --11098 --
NM_014850chr364578 3971 3382 1429 1089 94 14636 11263 --
NM_014859chr172367 139 ----11344
NM_014871chr121523 ------
NM_014873chr193782 3581 3572 2999 1622 1360 939 599 453 13319 ----
NM_014876chr2241890 819 729 662 --11780 --
NM_014877chr1746954 5945 896 687 ----16198
NM_014897chr1752641 2529 2163 937 360 --12316 --
NM_014901chr561899 1862 1465 1421 349 299 ------
NM_014902chr2031473 1393 1373 --11007 --
NM_014904chr1031586 993 267 ------
NM_014905chr23798 741 84 ------
NM_014906chr1742567 1557 1394 188 ----14137
NM_014912chr1013113 ------
NM_014914chr23381 307 111 ------
NM_014915chr102955 151 21039 892 ----
NM_014917chr12893 214 ------
NM_014921chr1942880 2684 2160 2149 --21186 1048 --
NM_014923chr1371774 1618 1434 924 655 165 102 ------
NM_014925chr125813 391 326 211 162 ------
NM_014926chr321142 854 ------
NM_014927chrX138 ------
NM_014932chr341693 722 539 67 ------
NM_014935chr1123158 3140 3059 2872 2791 2723 2450 1050 326 104 91 21 1811 13487 --
NM_014944chr12227 184 1915 ----
NM_014945chr511962 11427 1669 --
NM_014947chr162739 2577 2559 1206 1071 762 12406 12069 --
NM_014949chr11310 --1859 --
NM_014952chr1591978 1893 1819 1689 1285 707 578 529 221 ------
NM_014962chr2042555 2300 1151 1144 11917 ----
NM_014964chr1772231 1680 1667 749 731 329 196 --1236 --
NM_014974chr1031538 593 169 11169 11529 --
NM_014982chr1424461 1997 25376 5110 ----
NM_014989chr611281 ------
NM_014990chr143931 154 90 11242 ----
NM_014991chr432379 2090 774 ------
NM_014996chr3178 ------
NM_014999chr121193 ------
NM_015000chr1233071 173 64 --12170 --
NM_015008chr342836 1053 707 525 138 ----
NM_015009chr31590 ------
NM_015017chr12976 515 ------
NM_015020chr1632844 1240 496 --12982 --
NM_015023chr171378 1166 632 619 417 371 290 --1691 --
NM_015025chr2----1732 --
NM_015027chr163819 717 127 1700 ----
NM_015032chr131698 ------
NM_015033chr91611 --1341 --
NM_015035chr20106139 5739 5264 4978 4808 4578 4294 2220 2064 1167 21419 689 32421 1653 1126 11833
NM_015037chr103242 231 81 ------
NM_015039chr164176 3528 3163 1646 953 426 ------
NM_015042chr15113928 3840 3797 3722 3684 1613 1462 927 516 217 149 ------
NM_015044chr1663207 3189 2534 1279 467 42 --12695 --
NM_015045chr101271 11832 ----
NM_015051chr943171 2542 2206 603 ------
NM_015052chr7132 --11039 --
NM_015053chr192332 1776 1486 807 491 477 459 331 53 --2656 225 --
NM_015063chr193364 144 75 ------
NM_015068chr752718 2540 1593 1486 163 12869 1982 1842
NM_015069chr161472 ------
NM_015071chr576471 5874 5022 4659 4643 4387 1446 14893 ----
NM_015073chr1942087 1700 1600 1413 ------
NM_015074chr174565 3930 1766 1161 942 701 519 --13544 --
NM_015075chrX42142 1465 1440 1383 --1890 --
NM_015076chr663611 3387 2895 2803 1585 307 ------
NM_015087chr1342002 998 379 190 --12558 --
NM_015090chr184083 4004 2332 680 649 601 312 256 35049 4419 1909 ----
NM_015092chr1634146 3585 1600 --11221 1491
NM_015093chr61507 ------
NM_015097chr3--11606 12031 --
NM_015100chr131659 1529 795 ------
NM_015101chr11618 --12606 --
NM_015102chr13404 134 117 ------
NM_015107chrX21622 914 --22477 854 --
NM_015129chrX21762 185 11232 ----
NM_015130chr41114 ------
NM_015132chr731776 733 433 --11422 --
NM_015138chr1542748 1014 965 405 11038 1878 --
NM_015143chr421368 542 ------
NM_015149chr132213 2110 1906 1773 ----
NM_015150chr34757 275 116 87 1878 ----
NM_015155chr1022995 2885 13118 1454 --
NM_015156chr1452920 2508 1076 1026 828 1867 ----
NM_015163chr1441780 665 365 97 11632 ----
NM_015170chr812325 134 11666 --
NM_015171chr162396 104 ------
NM_015172chr121514 73 ------
NM_015176chr11715 1597 ----
NM_015185chrX62406 2252 2225 2145 2112 1089 12102 ----
NM_015187chr42738 53 ------
NM_015196chr41104 ------
NM_015198chr71265 ------
NM_015200chr422185 927 ------
NM_015202chr1621203 559 ------
NM_015208chr1833890 262 254 --1436 --
NM_015213chr111610 ------
NM_015215chr132938 1952 961 ------
NM_015221chr10161 ------
NM_015225chr921950 111 ------
NM_015226chr1652846 2766 2274 459 43 22345 69 23051 2603 13473
NM_015233chr1352630 2592 2242 1754 164 ------
NM_015236chr4--11100 ----
NM_015242chr112448 21 ------
NM_015245chr6101944 1084 1009 990 770 318 229 188 142 134 ------
NM_015246chr16121929 1916 1437 1373 1274 807 783 728 651 557 502 209 ------
NM_015250chr931367 257 23 ------
NM_015254chr8112936 2473 1258 852 677 592 579 537 485 451 293 --22171 1132 --
NM_015265chr222054 673 ----1235
NM_015268chr32487 98 ------
NM_015270chr1271908 1693 1608 1535 1501 723 713 ------
NM_015271chr4--12726 ----
NM_015277chr1841715 1422 1177 167 --11858 --
NM_015285chr1842344 2229 1761 409 ------
NM_015288chr553307 3177 2789 285 35 23881 1303 13193 --
NM_015291chr142288 2264 737 363 23423 2451 12462 --
NM_015292chr122747 307 ------
NM_015293chr6295 33 ------
NM_015296chr13--1327 1834 --
NM_015299chr14133733 3718 3692 3636 3543 3315 3275 2889 2851 989 972 526 378 1963 23519 458 --
NM_015310chr877927 7822 7755 7390 5858 2597 964 26771 67 ----
NM_015313chr1164708 4129 3480 3108 917 71 ------
NM_015315chr543246 3092 2949 376 ------
NM_015317chr252854 2749 2621 2393 388 2671 241 ----
NM_015326chr162702 2559 2051 1030 545 526 1294 ----
NM_015327chr131319 451 248 --159 --
NM_015328chr772351 2048 1950 1197 824 640 413 --12601 --
NM_015335chr1222552 26 ------
NM_015336chr1211780 ------
NM_015339chr202761 85 ------
NM_015346chr1421614 103 ------
NM_015347chr1242709 2674 1972 765 ------
NM_015349chr641893 1098 606 344 12734 21141 225 181
NM_015365chrX23808 1337 ------
NM_015375chr1114868 4824 3487 3331 3124 1881 1797 1496 779 620 272 ----14207
NM_015382chr142666 528 1311 ----
NM_015385chr1052585 2208 963 862 788 ----11092
NM_015386chr163129 88 23 ------
NM_015393chr453292 852 534 176 152 13638 ----
NM_015397chr92302 235 ------
NM_015401chr124415 356 275 45 1901 --165
NM_015404chr92490 43 ------
NM_015443chr175558 468 448 259 41 1225 2356 266 --
NM_015455chr523622 3423 ------
NM_015470chr231210 1078 32 ------
NM_015472chr31156 ------
NM_015472chr31156 ------
NM_015475chr21960 --1123 --
NM_015481chr121995 ----1390
NM_015483chr721124 1017 ------
NM_015484chr11717 ------
NM_015485chr11319 ------
NM_015488chr221359 1143 ----11535
NM_015492chr1521041 664 1971 1764 --
NM_015493chr1952048 1779 1712 199 83 1316 ----
NM_015497chr1521016 1009 1738 ----
NM_015508chr321421 1014 --1344 11248
NM_015534chr12219 200 ------
NM_015535chr253813 3215 2638 1377 507 ------
NM_015537chr921074 901 --1854 --
NM_015548chr61903 ------
NM_015550chr743204 3110 2666 2390 11109 ----
NM_015557chr1103183 3060 3026 2831 2705 2443 2230 1375 981 644 13455 1449 --
NM_015565chr2121654 1647 ------
NM_015567chr1311159 --1117 --
NM_015568chr2043951 1471 239 72 13424 ----
NM_015569chr124310 854 13837 14720 --
NM_015575chr233477 1180 143 --1715 --
NM_015576chr31542 ------
NM_015578chr1911819 1348 11533 --
NM_015589chr141120 ------
NM_015605chr102521 303 ------
NM_015609chr152740 2563 2106 316 210 --11166 12765
NM_015640chr174933 4706 3994 3776 1985 945 25 13341 ----
NM_015642chr3----1250 --
NM_015651chr961919 1774 1562 1503 758 723 --21749 124 --
NM_015657chr221044 796 ------
NM_015678chr1311366 ------
NM_015686chrX42118 1858 966 357 ------
NM_015695chr61340 --1182 --
NM_015713chr813352 ----1304
NM_015719chr193785 235 182 ------
NM_015833chr2111956 --1228 --
NM_015845chr183506 153 74 ------
NM_015850chr872297 2088 1925 1781 1692 731 106 --1545 --
NM_015872chr141396 1114 454 112 --1475 --
NM_015878chr811850 1111 ----
NM_015879chr18148256 7342 7325 7170 6753 6345 3245 2748 2309 1711 1445 1397 1094 372 26709 2954 26624 3189 --
NM_015881chr113965 282 126 ----1415
NM_015885chr111108 ------
NM_015886chr824523 4337 ----14267
NM_015891chr61760 21428 245 ----
NM_015892chr1051718 814 703 405 331 ------
NM_015897chr192135 28 --1143 --
NM_015898chr1931928 655 242 ------
NM_015902chr81108 ------
NM_015904chr21259 ----1776
NM_015906chr143354 1862 1396 1002 1917 ----
NM_015912chr842230 2031 1948 1708 ------
NM_015913chr11742 ------
NM_015955chr2188 ------
NM_015960chr10193 ------
NM_015963chr22147 35 ------
NM_015976chr11237 ------
NM_015981chr572879 2692 2334 2291 2257 2010 1935 --11972 --
NM_015982chr172304 42 ------
NM_015984chr1--1111 ----
NM_015986chr171249 ------
NM_015995chr15165432 5426 5024 5001 4871 4759 4550 2071 2021 912 743 609 542 522 400 50 13686 11354 --
NM_016018chr822190 394 ------
NM_016022chr11826 ------
NM_016025chr162797 512 1372 ----
NM_016032chrX41141 504 428 146 --1248 --
NM_016037chr12938 464 ------
NM_016039chr14160 ------
NM_016059chr61378 --1127 --
NM_016061chr221180 567 ------
NM_016062chr16242 35 ------
NM_016072chr12------12084
NM_016076chr13505 171 37 ------
NM_016078chr171206 --1805 --
NM_016079chr21361 22274 2034 --11719
NM_016083chr623075 3051 23781 3713 ----
NM_016107chr511256 ------
NM_016120chrX11155 --11113 --
NM_016131chr242330 1707 748 621 ------
NM_016132chr1533050 2752 2284 ------
NM_016147chr11----2925 397 --
NM_016152chr31311 ----11292
NM_016166chr15----151 --
NM_016172chr9145 ------
NM_016173chr3163921 3821 3792 3752 3642 3497 3430 1787 1756 1730 1478 1218 763 534 524 430 11179 43595 1022 1005 453 --
NM_016205chr41515 11345 11178 --
NM_016206chr397873 7634 7234 5600 2975 2416 1750 1231 825 1522 ----
NM_016223chr113331 101 40 ------
NM_016230chr61164 ------
NM_016231chr1711142 ------
NM_016240chr821346 524 --11319 --
NM_016250chr14----1714 --
NM_016256chr166422 386 235 165 87 56 ------
NM_016257chr182929 2504 1245 460 233 112 70 27 ------
NM_016260chr266898 6844 2332 1042 719 230 22884 1204 1738 --
NM_016264chr191196 ------
NM_016275chr31181 12623 1126 --
NM_016277chr631426 551 490 ------
NM_016281chr121222 1783 ----
NM_016289chr252327 1958 1833 1814 1717 --1395 --
NM_016300chr31123 ------
NM_016308chr1--11882 1649 --
NM_016315chr211772 ------
NM_016319chr124660 654 564 89 ------
NM_016320chr1151148 726 375 278 75 ------
NM_016322chr931268 865 732 1330 ----
NM_016333chr161198 --1113 --
NM_016339chr1751705 1608 1255 411 374 21134 534 31233 1209 46 --
NM_016364chr10252 33 ------
NM_016374chr131287 1202 1126 1235 1139 21309 548
NM_016374chr131287 1202 1126 1235 1139 21309 548
NM_016396chr1511017 ------
NM_016406chr11364 ------
NM_016424chr171413 ------
NM_016431chr222283 25 186 ----
NM_016433chr122500 96 --11453 --
NM_016436chr2032237 521 411 --1423 --
NM_016441chr21349 --22407 2091 1368
NM_016453chr32509 62 --1240 --
NM_016470chr20----1140 --
NM_016485chr621796 34 --12203 --
NM_016488chr1241713 1360 692 450 ------
NM_016496chr191462 --1391 --
NM_016506chr11198 ------
NM_016507chr1742589 1951 528 185 ------
NM_016516chr2----1710 --
NM_016519chr41449 ------
NM_016522chr11--11166 ----
NM_016529chr1331013 509 86 ------
NM_016530chr1531346 1340 1117 --22947 1509 --
NM_016538chr172187 28 ------
NM_016559chr321438 620 1566 ----
NM_016575chr1283946 3444 3374 1937 1544 1500 984 547 ------
NM_016577chr3114241 3546 3477 3275 3011 2791 1641 1452 1378 776 509 23403 815 12990 --
NM_016596chr124415 356 275 45 1901 --165
NM_016603chr542219 2105 1475 71 1771 11595 --
NM_016605chr552054 1902 1869 1757 1729 11989 ----
NM_016621chr1194267 4155 3640 3598 3582 3553 3294 1791 601 --34060 3568 3007 13351
NM_016626chr1831103 640 278 --1394 --
NM_016644chr5------1142
NM_016654chr1521336 1169 ------
NM_016656chrX1276 1270 ----
NM_016823chr1711142 1220 ----
NM_016824chr1031827 1462 498 1714 ----
NM_016829chr33313 288 257 ----146
NM_016830chr121160 ------
NM_016929chr674324 1576 708 668 652 181 129 21535 518 --1959
NM_016952chr1183439 2848 2627 1161 797 721 504 338 ------
NM_017409chr12167 ------
NM_017412chr82965 371 1259 ----
NM_017413chrX52374 2344 447 232 175 ------
NM_017415chr541691 1521 554 203 --33411 1168 138 --
NM_017420chr1422949 30 ------
NM_017424chr2261632 627 584 545 218 136 ------
NM_017440chr12138 ------
NM_017447chr2143761 1422 1410 751 13075 ----
NM_017450chr1741220 1057 546 56 ------
NM_017451chr174917 900 285 63 21123 117 1931 --
NM_017455chr15--1341 ----
NM_017459chr1268 27 ------
NM_017488chr211343 --11357 11517
NM_017519chr611289 ------
NM_017548chr322164 1438 11570 ----
NM_017549chr731224 1094 479 --21165 349 --
NM_017551chr1011720 --22504 451 --
NM_017578chr31104 ------
NM_017582chr131745 692 622 ------
NM_017589chr11----134 --
NM_017594chr92558 306 ------
NM_017596chr1104212 4175 4023 4006 3164 1837 1459 944 720 144 11105 44163 3647 1508 848 --
NM_017599chr121135 ------
NM_017602chrX3659 323 145 --2940 880 --
NM_017610chr15----151 --
NM_017612chr121227 ------
NM_017622chr175517 453 201 77 29 ------
NM_017628chr455247 4313 4284 4197 362 14356 24800 1436 --
NM_017632chr4135 ------
NM_017633chr632990 1356 133 1147 33063 2726 2402 --
NM_017634chr81272 ------
NM_017635chr1111177 ------
NM_017637chr978730 7867 6102 6054 6038 2702 753 --37932 6672 3771 --
NM_017643chr171548 ----12132
NM_017649chr103893 471 201 1786 ----
NM_017650chr744872 4284 948 350 45445 2022 1978 840 ----
NM_017655chr1--11304 ----
NM_017658chr1423710 3579 --13775 --
NM_017661chr151465 1505 1940 --
NM_017664chr13----144 1361
NM_017668chr162681 219 1127 ----
NM_017670chr112604 194 ------
NM_017672chr1531014 365 198 ------
NM_017679chr172614 437 ------
NM_017680chr911020 ------
NM_017686chr12153 125 1948 ----
NM_017694chr21177 ------
NM_017704chr112670 281 ------
NM_017709chr153408 3141 2889 1324 1230 13746 33074 2952 2695 --
NM_017719chr3--32337 1822 900 ----
NM_017724chr3----1318 --
NM_017737chr121841 640 --1796 --
NM_017739chr1193 ------
NM_017742chr181195 ------
NM_017744chr142139 2093 1529 913 11829 21669 838 --
NM_017763chr1721066 992 --161 --
NM_017772chr641499 445 425 146 ------
NM_017778chr83441 140 126 ------
NM_017779chr122255 937 ------
NM_017780chr8--1680 ----
NM_017784chr32430 83 --1476 --
NM_017786chr81191 ------
NM_017790chr91213 133 ----
NM_017799chr1421853 1507 21777 639 ----
NM_017801chr322178 905 --164 --
NM_017811chr922400 72 --12190 12790
NM_017812chr72775 693 ------
NM_017813chr855076 4355 4090 1477 598 24493 1858 --14464
NM_017848chrX43809 3775 3674 1684 ------
NM_017849chr282571 2527 1067 1014 939 678 554 98 --12609 --
NM_017851chr1521088 845 --1356 --
NM_017857chr114674 641 634 511 ------
NM_017873chr952915 1239 1212 893 620 11056 ----
NM_017880chr21380 --1410 --
NM_017893chr1021076 542 ------
NM_017902chr1084744 4332 4225 3973 1937 1665 1210 168 --15330 15748
NM_017907chr112205 63 ------
NM_017910chr2188 ------
NM_017913chr9158 ------
NM_017919chr935180 5157 600 25285 3980 ----
NM_017921chr1762231 2225 2202 427 413 196 ------
NM_017933chr221062 563 ----11353
NM_017938chrX2490 392 --1356 --
NM_017954chr721211 268 ------
NM_017964chr22743 42 ------
NM_017983chr172180 148 ------
NM_017993chr13147 ------
NM_018014chr241364 1322 1132 283 ------
NM_018026chr111376 --2104 33 --
NM_018027chr1022567 927 --1310 --
NM_018028chr192294 160 11332 ----
NM_018053chr14725 670 339 66 ------
NM_018061chr121179 294 --11601 --
NM_018064chr61291 ------
NM_018072chr11158 ------
NM_018080chr151180 ------
NM_018084chr222430 520 ----13191
NM_018086chr231868 1782 39 11709 ----
NM_018089chr21165 1202 ----
NM_018092chr161594 ------
NM_018095chr11198 ------
NM_018110chr1631005 897 465 ------
NM_018116chr11514 ------
NM_018121chr1052085 894 798 779 636 22362 148 --12327
NM_018126chr42363 53 --1156 --
NM_018128chr1751472 1234 1225 1139 1003 ------
NM_018131chr102773 655 --1173 --
NM_018133chr332157 1483 1378 22047 271 131 --
NM_018155chr34501 392 369 169 --1474 --
NM_018181chr18--11891 ----
NM_018182chr1731630 674 268 11505 ----
NM_018184chr331633 765 33 12043 ----
NM_018195chr111197 ------
NM_018198chr151239 1160 336 273 225 ------
NM_018201chr9102183 1882 1864 1726 873 840 379 290 275 56 11746 ----
NM_018202chr1166 ------
NM_018206chr161308 ------
NM_018208chr161139 1133 885 789 440 119 ------
NM_018210chr1321208 554 21445 991 ----
NM_018214chr61437 ------
NM_018222chr1111204 ------
NM_018223chr122945 213 ------
NM_018227chr41435 12429 ----
NM_018229chr14--1872 ----
NM_018241chr41946 --152 --
NM_018243chr484006 3627 3246 3064 2661 1192 675 655 22938 1126 ----
NM_018244chr202848 130 ------
NM_018246chr822733 1762 ------
NM_018286chr17198 --1338 --
NM_018293chr312554 ------
NM_018299chr82662 331 13348 ----
NM_018325chr931120 629 392 148 ----
NM_018351chr1254269 3828 3463 1362 605 --13992 --
NM_018354chr20122 ------
NM_018362chr1173643 3549 3444 3210 2817 2761 1364 13940 12853 --
NM_018364chr153826 3024 2564 1279 478 --33903 926 788 --
NM_018371chr831538 1130 1123 ------
NM_018381chr192638 199 --1376 --
NM_018383chr231814 1516 185 ------
NM_018387chr91395 ------
NM_018388chrX11006 ------
NM_018398chr3----145 --
NM_018409chr432646 2026 1262 ------
NM_018427chr161600 11481 ----
NM_018433chr21466 ------
NM_018436chr2181 ------
NM_018440chr897797 7001 6626 6226 5982 2021 1615 683 501 --15558 --
NM_018448chr121471 1521 ----
NM_018469chr1721365 60 1221 ----
NM_018482chr811809 --1236 --
NM_018489chr11290 ------
NM_018490chr111107 ------
NM_018509chr1741630 1321 659 536 ------
NM_018557chr231163 121 87 ------
NM_018566chr134577 4032 3642 11856 ----
NM_018569chr421555 1528 ------
NM_018584chr12416 139 160 ----
NM_018602chr1521726 58 --1437 --
NM_018638chr1235467 2220 666 ------
NM_018644chr1141990 1827 419 43 12100 ----
NM_018650chr142235 1794 809 629 21848 71 ----
NM_018652chr1541052 729 397 272 ------
NM_018657chr3--156 ----
NM_018660chr872276 1883 1148 1010 503 470 31 --12270 --
NM_018679chr6----124 --
NM_018682chr71236 ------
NM_018683chr2031701 1077 445 11562 ----
NM_018684chrX21205 861 ----11131
NM_018689chr1581977 1811 1652 1032 557 454 346 162 --155 --
NM_018695chr532289 2037 415 ------
NM_018696chr182679 389 1344 ----
NM_018699chr41287 ------
NM_018703chr16------1311
NM_018711chr1241545 628 555 55 1285 1506 --
NM_018715chr162243 2130 2010 636 601 575 --11787 --
NM_018717chr451811 829 782 746 316 12399 ----
NM_018718chr732089 1741 737 ------
NM_018834chr51749 ------
NM_018846chr72827 296 ------
NM_018898chr51218 11717 ----
NM_018899chr51218 11717 ----
NM_018900chr51218 11717 ----
NM_018901chr51218 11717 ----
NM_018902chr51218 11717 ----
NM_018903chr51218 11717 ----
NM_018904chr51218 11717 ----
NM_018905chr51218 11717 ----
NM_018906chr51218 11717 ----
NM_018907chr51218 11717 ----
NM_018908chr51218 11717 ----
NM_018909chr51218 11717 ----
NM_018910chr51218 11717 ----
NM_018911chr51218 11717 ----
NM_018912chr531353 477 110 ------
NM_018913chr531353 477 110 ------
NM_018914chr531353 477 110 ------
NM_018915chr531353 477 110 ------
NM_018916chr531353 477 110 ------
NM_018917chr531353 477 110 ------
NM_018918chr531353 477 110 ------
NM_018919chr531353 477 110 ------
NM_018920chr531353 477 110 ------
NM_018921chr531353 477 110 ------
NM_018922chr531353 477 110 ------
NM_018923chr531353 477 110 ------
NM_018924chr531353 477 110 ------
NM_018925chr531353 477 110 ------
NM_018926chr531353 477 110 ------
NM_018927chr531353 477 110 ------
NM_018928chr531353 477 110 ------
NM_018929chr531353 477 110 ------
NM_018931chr52268 178 ------
NM_018945chr643687 2862 2774 2714 --1657 13030
NM_018948chr11492 ------
NM_018952chr171267 ------
NM_018953chr122309 293 --2705 152 --
NM_018957chr22153 1334 ----
NM_018959chr193740 487 77 ------
NM_018970chr722908 1240 12572 12497 --
NM_018976chr1222118 304 22847 1925 ----
NM_018992chr162379 79 ------
NM_018993chr2011390 2980 210 ----
NM_018994chr11552 ------
NM_018999chr1054941 4329 3743 1196 895 21565 203 ----
NM_019000chr531584 1232 1224 ------
NM_019001chr323689 1362 ------
NM_019003chrX121 ------
NM_019004chr7--12228 ----
NM_019027chr41561 1818 ----
NM_019042chr731112 998 52 ------
NM_019058chr101667 --1619 --
NM_019063chr21868 12130 ----
NM_019066chr153326 80 38 ------
NM_019071chr72571 204 ------
NM_019074chr154648 371 212 200 ------
NM_019084chr1021732 244 ------
NM_019096chr62241 59 --1715 1261
NM_019098chr83398 384 323 1642 11645 --
NM_019106chr2222591 109 ------
NM_019114chr942538 2359 1998 145 ------
NM_019593chr2033057 2618 175 ------
NM_019597chrX1550 ------
NM_019605chr11619 ------
NM_019606chr72446 177 ------
NM_019610chr121752 1511 ------
NM_019884chr193598 432 90 ------
NM_019885chr272840 2537 2308 1012 656 488 194 11895 12198 2860 141
NM_019903chr1031827 1462 498 1714 ----
NM_020039chr1221210 624 --1523 --
NM_020119chr763774 3598 2922 1313 553 504 21015 627 --11236
NM_020122chr265718 4785 4018 2419 1947 1076 15620 15116 --
NM_020123chr10----1400 --
NM_020130chr8--1922 11195 --
NM_020137chrX2454 340 ------
NM_020145chr93469 424 31 ------
NM_020148chr1863039 2391 2343 2299 663 409 ------
NM_020150chr102242 110 ------
NM_020155chr11121 --147 --
NM_020178chr172864 826 ------
NM_020180chr1821258 443 ------
NM_020182chr2032931 2240 761 --13420 --
NM_020184chr272364 1962 1811 1635 785 736 150 --11494 --
NM_020193chr112521 254 ------
NM_020204chr1------1165
NM_020205chr122312 119 1166 ----
NM_020211chr154632 602 592 508 --3993 542 91 --
NM_020231chr31121 --181 --
NM_020239chr141859 1719 1633 177 ------
NM_020240chr552774 1701 1027 921 126 --11762 --
NM_020243chr222121 99 ------
NM_020248chr1102256 2245 2118 1939 1855 1674 1596 1587 326 163 1921 11987 --
NM_020309chr19157 ------
NM_020310chr1772245 1756 1711 878 871 772 480 --1980 --
NM_020336chr2023691 3148 --13568 --
NM_020337chr42943 680 --1590 --
NM_020341chr2012033 1359 ----
NM_020342chr221772 962 ------
NM_020343chr20145 1490 ----
NM_020345chr3--1874 ----
NM_020357chr31395 ------
NM_020362chr12254 148 ------
NM_020364chrY31374 280 71 ------
NM_020381chr61690 ------
NM_020403chr13----11302 --
NM_020405chr1784018 3980 3104 1281 1050 959 863 81 13278 ----
NM_020410chr192162 34 ------
NM_020418chr31186 ------
NM_020420chrY31374 280 71 ------
NM_020429chr732154 676 84 ------
NM_020432chr7--1294 --1273
NM_020440chr143033 2360 2117 129 ------
NM_020443chr1106966 6333 4985 4816 4384 2611 1042 1013 500 44 22621 1505 25285 4265 --
NM_020444chr52192 64 126 ----
NM_020449chrX1619 ------
NM_020452chr131558 619 595 21486 523 11854 --
NM_020457chr161199 2667 480 1145 --
NM_020465chr1661499 1421 733 684 537 408 ------
NM_020467chr122367 33 ------
NM_020474chr181420 11467 ----
NM_020475chr842226 2208 1724 537 --1126 --
NM_020476chr842226 2208 1724 537 --1126 --
NM_020477chr842226 2208 1724 537 --1126 --
NM_020478chr842289 2271 1787 600 --1189 --
NM_020480chr842226 2208 1724 537 --1126 --
NM_020532chr2------1322
NM_020640chr322287 367 ----1542
NM_020647chr821607 700 --1319 --
NM_020649chr17----158 --
NM_020651chr211135 ------
NM_020654chr321350 376 ------
NM_020673chr2087437 5654 5085 1949 1459 1448 1235 672 ------
NM_020689chr2011530 ------
NM_020699chr175072 4472 4307 3747 1875 1812 1567 --13864 --
NM_020708chr2051700 1635 771 415 114 12009 ----
NM_020711chr272440 2398 2333 2109 424 373 287 1470 1538 --
NM_020713chr20143105 2749 2597 2265 2182 2017 1127 953 837 568 460 396 370 21 --1440 --
NM_020717chrX104770 4224 4196 3520 3305 3060 1766 1308 1097 657 --21594 471 --
NM_020724chr452587 2521 2344 1954 357 1379 22093 210 1107
NM_020726chr5--1426 ----
NM_020728chr722694 2242 --1473 --
NM_020732chr611289 ------
NM_020734chr1223212 627 --13027 --
NM_020742chrX11888 ------
NM_020747chr51862 1952 ----
NM_020748chr1741473 1429 1405 185 ------
NM_020752chr101703 ------
NM_020760chr21372 11714 ----
NM_020766chrX64098 4088 3485 3438 3356 2790 23989 2987 ----
NM_020769chrX3793 379 153 --1395 --
NM_020772chr1747345 7285 1403 736 ------
NM_020774chr1874307 4247 1924 1906 1578 1545 1462 ----14784
NM_020791chr1731365 497 186 ------
NM_020794chr12452 218 ------
NM_020795chr1751799 1703 1623 490 40 --1606 22021 76
NM_020796chr542844 2569 983 971 ------
NM_020801chr552257 2077 1804 1787 229 ------
NM_020805chr18--1504 ----
NM_020807chr1641399 1267 1179 588 --1187 --
NM_020808chr12295 222 --1358 1248
NM_020814chr22485 262 --31214 962 118 --
NM_020818chr14------1406
NM_020824chr101288 ------
NM_020825chr1683694 3546 2775 2698 2407 1466 922 521 ----1196
NM_020830chr2--1934 1506 --
NM_020831chr227841 803 716 339 308 217 167 ------
NM_020836chr143729 326 21 ------
NM_020839chr311108 ------
NM_020845chr12112335 2052 1725 1668 983 919 834 725 314 207 71 ------
NM_020850chr16113094 2911 2810 2716 2673 2363 2094 830 795 125 24 --13215 --
NM_020856chr1931475 1412 360 1192 2986 90 --
NM_020858chr1511610 1142 ----
NM_020870chr411855 --12041 11535
NM_020873chr3125 ------
NM_020886chr1151038 971 859 466 36 ------
NM_020888chr161454 273 242 221 158 21 11344 21687 788 --
NM_020896chr113859 274 25 ------
NM_020899chr1731861 1731 72 ------
NM_020918chr1063399 3178 1026 958 726 67 31092 707 23 12853 --
NM_020920chr143336 320 56 --1391 --
NM_020922chrX31439 745 650 ------
NM_020925chr111175 ------
NM_020935chr254460 4365 4161 1129 22 11024 ----
NM_020946chr971651 1611 1476 1458 1409 529 171 --11422 --
NM_020948chr121210 1187 ------
NM_020951chr1911624 --1250 --
NM_020956chr1964739 4713 4146 1218 660 505 --24357 1484 --
NM_020962chr1572120 1525 1004 656 607 556 464 --1499 --
NM_020964chr1844436 3909 3115 682 11640 ----
NM_020967chr2041018 940 805 42 --1480 --
NM_020971chr191749 ------
NM_020972chr43812 430 243 --1270 --
NM_020977chr421887 1857 ------
NM_020983chr1271908 1693 1608 1535 1501 723 713 ------
NM_020993chr1272704 2596 895 813 601 459 447 --22369 1878 --
NM_021005chr152992 783 ------
NM_021007chr21922 --11867 --
NM_021020chr863195 3138 2815 1195 483 225 --136 --
NM_021033chr1363035 2535 2444 2354 948 669 12467 ----
NM_021044chr121139 ------
NM_021069chr412016 --1457 --
NM_021072chr521701 563 11709 ----
NM_021079chr1793259 3204 3059 2534 1057 758 635 467 289 ----32201 1160 105
NM_021096chr2293240 2840 2737 2502 2048 949 787 459 390 --23084 2814 --
NM_021106chr93673 655 256 --1240 --
NM_021132chr101503 ------
NM_021133chr11696 --1136 156
NM_021135chr642250 535 507 78 --32702 1346 469 --
NM_021140chrX--1258 ----
NM_021155chr1973015 2495 1079 865 636 170 150 12635 12871 --
NM_021159chr411213 1350 --1605
NM_021161chr141467 ------
NM_021174chr82652 500 ------
NM_021200chr113810 766 386 --11125 --
NM_021222chr121308 111 1909 1979 --
NM_021224chr91149 ------
NM_021238chr121144 ------
NM_021239chr1421161 229 ------
NM_021245chr10141 ------
NM_021249chr1411083 11504 --1466
NM_021253chr631086 960 906 ------
NM_021255chr1433161 2637 1318 11488 11263 --
NM_021259chr164961 877 453 73 ----1367
NM_021260chr1431290 529 482 --1156 --
NM_021267chr1981147 1114 1015 961 923 500 322 69 --1917 --
NM_021625chr122420 159 --1331 --
NM_021627chr331244 1062 793 ------
NM_021629chr343531 3276 3187 747 13089 ----
NM_021638chr4105015 5007 4965 4201 3389 3244 3036 1228 1086 514 --13448 --
NM_021643chr241426 1337 612 87 1462 1364 --
NM_021705chr6------1171
NM_021722chr71212 ------
NM_021728chr141992 ------
NM_021783chrX32398 1501 361 --129 --
NM_021784chr202614 34 ------
NM_021809chr2062342 2047 1583 1551 310 154 ------
NM_021814chr6199 ------
NM_021911chr522005 636 23555 1219 ----
NM_021912chr1553732 3667 3598 631 554 ------
NM_021914chr1442479 2260 1575 402 --11971 1457
NM_021931chr2061070 712 306 86 65 37 ------
NM_021935chr31879 ------
NM_021940chr611577 ------
NM_021943chr641779 793 492 186 --1144 --
NM_021947chr1731051 390 294 ------
NM_021956chr611405 ------
NM_021959chr63882 303 37 ------
NM_021961chr1187144 5620 2651 2403 2346 987 212 121 --27098 5880 --
NM_021962chr1721883 428 --21907 456 --
NM_021964chr346479 4583 1078 31 25008 1037 ----
NM_021969chr13121 61 43 ------
NM_021984chrX51410 1316 593 424 179 11088 1469 --
NM_021987chrX51410 1316 593 424 179 11088 1469 --
NM_021988chr202593 520 ----11313
NM_021990chrX51410 1316 593 424 179 11088 1469 --
NM_022039chr101491 --1422 --
NM_022048chr1596327 6196 3921 2492 2109 2086 1220 351 260 1976 25877 513 --
NM_022060chr1441343 1277 1264 958 ------
NM_022075chr11668 ------
NM_022085chr631324 1105 1099 ------
NM_022114chr174330 4083 3764 2912 1479 1214 1042 --23491 3245 --
NM_022123chr141607 ------
NM_022130chr52222 169 ------
NM_022133chr821753 1248 ------
NM_022165chr19----161 --
NM_022166chr1695255 4940 4747 4300 3872 2354 1716 599 122 21549 189 24160 1397 --
NM_022169chr1171366 1357 1207 1166 557 456 125 --1102 --
NM_022337chr11125 ------
NM_022340chr363534 3189 2661 1469 861 40 22301 1178 12327 --
NM_022343chr93856 135 74 --1983 --
NM_022356chr12415 85 ------
NM_022368chrX124 ------
NM_022442chr202593 520 ----11313
NM_022454chr81129 ------
NM_022459chr1356208 5870 4404 2503 1428 --1171 16191
NM_022465chr1222700 1920 --1549 --
NM_022469chr172691 964 892 500 473 369 103 ------
NM_022474chr1422382 1986 142 ----
NM_022476chr16147 ------
NM_022484chr721316 983 11024 ----
NM_022497chr353025 445 424 240 88 13596 23470 2518 --
NM_022550chr51195 ------
NM_022553chr62509 181 1404 ----
NM_022557chr171183 ------
NM_022572chr221359 1143 ----11535
NM_022574chr751633 760 702 646 473 ------
NM_022644chr173453 178 89 ------
NM_022648chr2114546 3865 3400 3257 2933 1842 1836 1296 886 776 442 --14135 --
NM_022652chr12137 --159 --
NM_022658chr1231329 381 325 ------
NM_022716chr11657 --23040 2086 --
NM_022719chr22113194 3049 2891 2816 1325 951 752 742 665 414 162 --22487 1340 --
NM_022728chr7185 ------
NM_022730chr25927 841 727 714 21 ----1968
NM_022733chr131172 263 140 --1239 --
NM_022742chr72130 43 ------
NM_022748chr732402 1918 923 --1338 --
NM_022749chr841395 941 497 297 --2907 66 --
NM_022753chr132723 2427 363 1526 22186 1958 --
NM_022756chr131121 417 314 ------
NM_022758chr642643 2496 2037 108 --22135 845 12305
NM_022763chr332870 2141 1123 --12744 --
NM_022771chr122801 705 ------
NM_022781chr942739 1274 809 263 12364 12046 --
NM_022810chrX1404 ------
NM_022823chr21353 --2492 131 --
NM_022824chr51681 ------
NM_022826chr21895 1230 ----
NM_022828chr51241 ------
NM_022831chr121225 585 --11627 --
NM_022832chr44616 610 290 127 21026 893 ----
NM_022841chr151380 ------
NM_022843chr1321320 1081 --1400 --
NM_022845chr1632034 255 59 --1707 --
NM_022893chr253139 3069 2405 1137 968 ------
NM_022894chr21591 ------
NM_022898chr1431529 1037 257 14492 14281 --
NM_022901chr931680 1263 95 ------
NM_022910chr1661499 1421 733 684 537 408 ------
NM_022912chr212716 12430 12847 --
NM_022965chr421599 1165 ------
NM_022970chr1021252 1040 ------
NM_022977chrX143 ------
NM_023000chr1411119 ------
NM_023001chr1411119 ------
NM_023003chr15154 ------
NM_023009chr14716 264 84 76 ------
NM_023011chr131848 ------
NM_023012chr12--1541 ----
NM_023015chr14752 636 302 149 ------
NM_023016chr232794 1763 904 ------
NM_023037chr132724 37 1353 ----
NM_023067chr341237 1083 380 246 ------
NM_023076chr1672676 2462 1041 956 289 165 39 --11090 --
NM_023079chr1731919 1771 1744 1281 1190 --
NM_023105chr872297 2088 1925 1781 1692 731 106 --1545 --
NM_023106chr872297 2088 1925 1781 1692 731 106 --1545 --
NM_023110chr872297 2088 1925 1781 1692 731 106 --1545 --
NM_023111chr872297 2088 1925 1781 1692 731 106 --1545 --
NM_023923chr183693 3002 2750 1255 879 815 516 436 --12380 --
NM_023927chr521168 1157 ------
NM_023929chr842770 2087 1836 865 12189 ----
NM_023931chr1631508 1415 1193 1352 1145 --
NM_023932chr6121 ------
NM_024007chr522965 2797 ------
NM_024015chr17----1833 --
NM_024016chr172579 94 ------
NM_024019chr41169 ------
NM_024046chr32517 89 ----11307
NM_024052chr1721085 425 --2973 698 142
NM_024060chr11--1281 ----
NM_024085chr25842 813 242 135 100 ------
NM_024087chrX2668 620 ------
NM_024090chr411731 ------
NM_024094chr81593 ------
NM_024107chr172743 63 ------
NM_024117chr931047 121 112 --1210 --
NM_024294chr642643 2496 2037 108 --22135 845 12305
NM_024295chr831269 317 79 11516 ----
NM_024297chr171468 ------
NM_024306chr164753 743 95 42 --1183 --
NM_024312chr1211448 ------
NM_024328chr143517 224 168 ------
NM_024345chr962346 854 509 459 388 114 --16109 --
NM_024408chr131335 878 551 --13298 --
NM_024416chr91369 1652 ----
NM_024424chr111850 ------
NM_024425chr111850 ------
NM_024426chr111850 ------
NM_024430chr1831789 1457 390 ------
NM_024490chr151574 ------
NM_024491chr31440 ----1427
NM_024503chr13349 326 28 ------
NM_024511chr443382 2247 817 382 ----1221
NM_024513chr353239 2859 2619 1487 649 --12480 --
NM_024519chr163235 65 24 ------
NM_024523chr7----21037 332 --
NM_024524chr31736 ------
NM_024529chr11986 ------
NM_024539chrX1979 ------
NM_024551chr1221643 241 1887 1955 1288
NM_024551chr1221643 241 1887 1955 1288
NM_024554chr131207 155 95 ------
NM_024558chr1431001 813 798 ------
NM_024595chr121062 421 ------
NM_024612chr172823 291 ------
NM_024613chr811782 ------
NM_024617chr91885 ------
NM_024631chr111677 ------
NM_024659chr22668 119 ------
NM_024665chr313804 ------
NM_024666chr1531265 1212 331 ------
NM_024670chr1021604 529 ------
NM_024686chr11494 ------
NM_024702chr172588 84 ------
NM_024713chr151624 ------
NM_024721chr8--1155 12101 1469
NM_024742chr1681919 1588 1582 1284 1274 1249 343 230 11759 ----
NM_024749chr141807 1443 1402 569 1641 ----
NM_024757chr92975 276 --1953 --
NM_024766chr21439 ------
NM_024770chr266448 6345 1823 1798 1449 1201 26333 2420 26635 5650 --
NM_024779chr1231428 484 379 --1602 --
NM_024780chr161906 1759 --1372
NM_024783chr111378 ------
NM_024811chr111278 --31436 739 173 --
NM_024828chr9--11387 ----
NM_024830chr572123 2078 1687 825 419 311 234 --1457 --
NM_024834chr1021862 1453 ----1137
NM_024837chr1511947 1657 ----
NM_024873chr42791 127 --1251 --
NM_024874chr121269 1191 ------
NM_024884chr1454517 4066 3946 1081 989 ------
NM_024887chr151846 1482 780 530 119 11559 31603 1580 1465 --
NM_024899chr181104 1145 ----
NM_024900chr442148 2059 852 728 1134 1616 11525
NM_024900chr442148 2059 852 728 1134 1616 11525
NM_024911chr11229 ------
NM_024933chr21591 --1631 --
NM_024939chr164377 296 268 101 --188 --
NM_024948chr102527 93 166 ----
NM_024949chr463826 3055 1972 829 678 556 1439 1237 --
NM_024953chr122557 507 11021 ----
NM_024954chr103610 576 511 ------
NM_024989chr276908 6513 6307 4982 2336 1561 522 --1774 --
NM_024991chr1052585 2208 963 862 788 ----11092
NM_025054chr842921 1280 719 545 12623 ----
NM_025057chr14136 1191 ----
NM_025073chr184153 4109 3350 1865 1632 550 536 407 ------
NM_025074chr441138 1095 543 64 --1705 --
NM_025079chr11176 ------
NM_025083chr1531741 1676 1623 --21404 1260 --
NM_025099chr173991 372 63 11278 --1171
NM_025134chr161772 1686 ----
NM_025147chr221128 265 ------
NM_025151chr841986 1828 1807 465 ------
NM_025160chr123993 319 ------
NM_025179chr184494 3869 3779 3696 3304 1988 1975 746 --34566 4345 977 33930 3150 1137
NM_025182chr92840 404 --11041 --
NM_025191chr11136 --12954 --
NM_025195chr831924 1811 1600 11682 142 --
NM_025201chr1571866 1589 1362 223 215 178 34 12095 1157 --
NM_025219chr2061593 1502 726 454 109 42 --2553 433 --
NM_025222chr332044 762 401 ------
NM_025238chr1521038 24 ------
NM_025244chr2------1101
NM_025248chr1792883 2485 2368 1980 1304 1248 1236 1198 1148 ----11085
NM_025250chr772776 2505 2488 2275 856 430 308 --21927 1919 12981
NM_025251chr86867 419 361 211 163 134 ------
NM_030594chr1531368 230 44 182 ----
NM_030621chr1424020 598 ------
NM_030622chr1921041 335 ------
NM_030625chr101497 ------
NM_030627chr533877 1654 89 ------
NM_030629chr162104 96 --1651 --
NM_030640chr121644 ----1822
NM_030645chr131420 1033 22 --21125 166 --
NM_030647chr775778 4899 4766 2485 1293 1050 191 14316 ----
NM_030648chr434490 4333 2163 14683 ----
NM_030650chr283882 2845 1143 905 843 592 586 529 13346 12762 13798
NM_030661chr721603 1389 11102 ----
NM_030664chr1021873 1670 ------
NM_030665chr1711240 ------
NM_030674chr1245214 4021 1682 629 1665 33967 1368 595 1771
NM_030751chr101353 --11314 --
NM_030751chr101353 --11314 --
NM_030758chr2221468 42 ----1487
NM_030759chr101766 --1220 --
NM_030763chrX------1881
NM_030766chr121286 ------
NM_030786chr1------1115
NM_030791chr14--11594 ----
NM_030796chr742089 2024 1606 49 ------
NM_030798chr72622 46 --156 --
NM_030806chr1128837 8340 7459 6424 6358 6315 3567 2970 2913 2687 2281 487 29202 6735 78883 8237 7994 6573 5793 5754 1176 --
NM_030810chr631324 1105 1099 ------
NM_030816chr112380 ------
NM_030817chr1282651 2607 2583 1361 1035 534 342 334 ------
NM_030906chr11----1221 --
NM_030912chr101606 ------
NM_030914chr92622 304 --1897 --
NM_030915chr232189 1961 500 ------
NM_030918chr1125164 4555 4257 3875 3812 3387 3347 2054 1982 1739 1666 496 --33638 1610 258 --
NM_030937chr121189 330 --1321 --
NM_030948chr6169 ------
NM_030949chr641192 1148 1106 965 11452 ----
NM_030958chr8----1376 --
NM_030964chr553289 2926 2757 1116 42 ----32852 2605 2322
NM_030978chr91462 ------
NM_031157chr121588 ------
NM_031216chr1831865 1700 1460 ------
NM_031231chr204637 283 242 117 ------
NM_031232chr204637 283 242 117 ------
NM_031243chr711898 --11626 --
NM_031262chr91819 --21118 360 --
NM_031263chr91876 --21175 417 --
NM_031266chr5------188
NM_031268chr16155256 4978 4528 4286 4081 3643 1890 1873 1717 1523 1389 636 570 327 59 24854 4814 44780 3701 1398 1005 --
NM_031272chr17250 30 ------
NM_031283chr21742 1127 ----
NM_031299chr12141 ------
NM_031305chr41377 137 1628 --
NM_031371chr131287 1202 1126 1235 1139 21309 548
NM_031371chr131287 1202 1126 1235 1139 21309 548
NM_031372chr431447 1282 1256 11342 ----
NM_031411chr51218 11717 ----
NM_031417chr1962770 2281 1757 754 480 226 ----12721
NM_031418chr111475 --1711 199
NM_031419chr341349 1109 447 22 192 1189 --
NM_031424chr202384 196 --1485 --
NM_031433chr112497 59 ------
NM_031434chr71158 --121 --
NM_031435chr1232746 445 349 ------
NM_031438chr51446 ------
NM_031442chrX33086 1292 354 22836 584 ----
NM_031444chr227929 728 712 626 157 130 74 12000 ----
NM_031445chr273390 2855 861 840 689 299 83 --1414 --
NM_031459chr121428 360 ------
NM_031461chr812231 11577 --1766
NM_031468chr7137496 7082 6557 6358 5358 3054 2938 2774 2399 1172 954 675 502 11707 37904 575 186 16889
NM_031469chr621059 537 --149 --
NM_031477chr162282 41 ------
NM_031483chr2063411 2784 2279 2258 1421 524 ------
NM_031844chr143454 3344 2688 323 ------
NM_031845chr222720 2407 --152 --
NM_031847chr222720 2407 --152 --
NM_031849chr51218 11717 ----
NM_031857chr51218 11717 ----
NM_031858chr1741551 1290 568 478 ------
NM_031860chr51218 11717 ----
NM_031862chr1741551 1290 568 478 ------
NM_031866chr103821 336 326 --1189 --
NM_031892chrX2625 205 ------
NM_031935chr1----1100 --
NM_031936chr13696 493 190 ------
NM_031966chr5146 ------
NM_031989chr121230 ------
NM_032012chr983657 3310 1413 684 396 281 274 130 14097 ----
NM_032041chr832294 2010 1765 --12740 --
NM_032042chr522218 275 --135 --
NM_032047chr311915 1491 ----
NM_032050chr222853 309 ------
NM_032052chr2221238 253 ------
NM_032088chr531353 477 110 ------
NM_032092chr531353 477 110 ------
NM_032108chr19----126 --
NM_032109chr531212 351 310 ------
NM_032120chr72431 94 ------
NM_032121chrX32814 2613 1034 12730 --11740
NM_032122chr6124 ------
NM_032147chr121695 1926 ----
NM_032153chr322519 1068 ----12082
NM_032160chr1863841 3769 3413 3367 1454 701 ----13904
NM_032175chr511301 2545 419 ----
NM_032182chr1011435 1256 ----
NM_032195chr211208 ------
NM_032199chr1063556 3427 3200 2847 1174 1061 22995 392 --11495
NM_032208chr243121 2234 515 427 1128 ----
NM_032233chr142857 848 ------
NM_032236chr1----1791 --
NM_032256chr121787 ------
NM_032268chr1652931 2336 2313 666 547 12234 43236 2462 2107 1985 12188
NM_032271chr1641346 1104 339 124 ------
NM_032281chr1963122 2065 1231 1180 707 513 ------
NM_032288chr341793 1457 808 377 --11610 --
NM_032289chr541785 1599 776 216 --1785 --
NM_032294chr1771772 1456 682 504 414 313 247 ------
NM_032298chr192445 124 ------
NM_032316chr341916 1560 1548 211 1299 32338 1854 186 --
NM_032320chr111310 ------
NM_032325chr1151645 1554 1418 159 46 1636 ----
NM_032352chr1411119 ------
NM_032353chr171428 --1479 --
NM_032364chr122366 266 1992 ----
NM_032373chr101724 ------
NM_032376chr171673 --1206 --
NM_032389chr1131161 950 905 ------
NM_032403chr531353 477 110 ------
NM_032408chr721071 279 --199 --
NM_032434chr211502 21604 1135 ----
NM_032438chr631260 445 332 ------
NM_032440chr1012328 ------
NM_032452chr1441432 1234 85 25 ------
NM_032457chr432519 1171 426 12972 ----
NM_032466chr82367 158 ------
NM_032468chr82367 158 ------
NM_032491chr121518 1320 ----
NM_032492chr32182 108 ------
NM_032497chr191190 ------
NM_032499chr1511412 --11642 184
NM_032505chr3131 --1229 --
NM_032514chr203447 363 70 ------
NM_032538chr662644 2607 2137 2056 1963 355 ------
NM_032557chr41264 ------
NM_032560chr141769 ------
NM_032562chr10123 ------
NM_032569chr163680 654 347 --11641 --
NM_032573chr12------1196
NM_032575chr1651957 1506 1385 256 187 1773 31746 1370 319 --
NM_032580chr171182 ------
NM_032582chr172258 31 169 ----
NM_032595chr1741084 616 610 280 ------
NM_032596chr91105 ------
NM_032600chr3123 ------
NM_032622chr411428 ------
NM_032632chr141342 ------
NM_032636chr13480 449 99 ------
NM_032682chr333490 2639 2409 --12280 --
NM_032701chr191563 ------
NM_032711chr17124244 3618 3528 3340 3158 2693 1619 1605 1531 1431 1377 1173 --13944 13898
NM_032737chr1942608 600 473 444 11657 21057 157 --
NM_032741chr63906 822 184 ------
NM_032781chr111138 2864 634 ----
NM_032786chr12----126 --
NM_032788chr221435 1092 ------
NM_032800chr132516 1683 532 ------
NM_032801chr1132532 2127 269 --22086 1707 --
NM_032804chr1012103 --1210 --
NM_032808chr152723 55 ------
NM_032818chr932437 1936 891 ------
NM_032828chr19113880 3714 3625 3408 3274 1932 1793 1486 1001 426 200 ------
NM_032829chr1251071 1032 1023 904 277 ------
NM_032833chr1----175 --
NM_032837chr1721982 1822 ------
NM_032859chr13--1576 ----
NM_032873chr1134469 2917 1737 --1605 --
NM_032875chr17123 ------
NM_032876chr143771 431 387 --1103 --
NM_032880chr11113 ------
NM_032905chr10--1813 1461 --
NM_032918chr121131 ------
NM_032926chrX----163 --
NM_032940chr163721 310 227 1869 1120 --
NM_032947chr52931 92 ------
NM_032961chr4187 11200 ----
NM_032975chr1863204 2675 2355 1166 646 335 --1127 --
NM_032980chr1863204 2675 2355 1166 646 335 --1127 --
NM_032983chr743182 2537 2469 28 --33021 725 612 --
NM_032995chr2101721 1613 1393 1375 1055 636 616 585 578 124 ----11606
NM_032998chr131033 844 363 ------
NM_033008chr31186 ------
NM_033009chr31186 ------
NM_033010chr31186 ------
NM_033014chr91369 1652 ----
NM_033020chr143354 1862 1396 1002 1917 ----
NM_033025chr196750 631 366 330 111 68 ------
NM_033027chr31131 --1308 --
NM_033044chr1------1201
NM_033055chr11786 ------
NM_033058chr82148 92 1840 ----
NM_033071chr6295 33 ------
NM_033116chr142230 87 ------
NM_033129chr2051964 1621 1452 641 534 ------
NM_033133chr1752471 1193 1026 904 858 11032 ----
NM_033136chr541285 1158 582 239 ------
NM_033137chr541285 1158 582 239 ------
NM_033161chr991808 1666 1341 1258 756 475 279 198 26 11891 21467 229 --
NM_033181chr623075 3051 23781 3713 ----
NM_033182chr121489 1333 2405 39 11399 --
NM_033207chr1072365 2299 1964 1826 920 525 400 --132 --
NM_033211chr541984 1407 1301 47 ------
NM_033222chr911141 ------
NM_033224chr72411 49 22804 1285 --13189
NM_033225chr862817 2315 1995 230 132 97 ------
NM_033226chr16199 ------
NM_033251chr161358 ------
NM_033255chr13123 ------
NM_033259chr31722 --1623 --
NM_033267chr52203 41 ------
NM_033274chr572943 2302 782 552 455 275 89 ------
NM_033278chr11267 22 --190 --
NM_033290chrX53654 3095 2755 1387 1374 23250 2802 ----
NM_033309chr164970 903 867 139 --2445 147 --
NM_033310chr11162 ------
NM_033315chr1761983 1886 1432 1392 378 332 --1508 --
NM_033326chr1121699 642 ------
NM_033331chr91276 --23247 2659 --
NM_033343chr13343 295 35 ------
NM_033375chr1731327 1196 450 --21346 481 --
NM_033389chr1764765 4229 3724 3246 3054 801 --14519 --
NM_033420chr192948 244 ------
NM_033425chr1142472 177 47 36 --1168 --
NM_033426chr1462662 2649 2066 2052 1968 150 21144 805 ----
NM_033449chr561683 1632 804 790 330 308 ------
NM_033495chrX--1107 ----
NM_033503chr15123426 2972 2946 2935 2620 2519 2463 2427 837 771 692 602 --13123 --
NM_033540chr3--1141 1324 --
NM_033551chr543246 3092 2949 376 ------
NM_033626chrX51623 1372 684 179 156 --11770 --
NM_033631chr1113867 3367 2919 2901 2399 1496 774 611 604 276 110 22686 1358 22813 1240 12966
NM_033637chr1063731 3604 3421 3005 1456 509 11111 13161 12928
NM_033642chrX2944 459 --11092 --
NM_033644chr532509 2157 350 ------
NM_033645chr532509 2157 350 ------
NM_044472chr11286 ------
NM_052834chr1842344 2229 1761 409 ------
NM_052845chr1262690 1232 836 612 252 81 22425 1171 --11069
NM_052849chr153796 291 209 ------
NM_052850chr19----137 --
NM_052868chr11186 ------
NM_052876chr19102518 2192 1914 1869 1763 1737 911 752 614 251 12680 11750 11924
NM_052877chr12468 46 ------
NM_052879chr1233375 3314 2583 13388 ----
NM_052885chr1233902 1677 1272 ----14726
NM_052886chr821451 439 12121 ----
NM_052898chr821878 1708 ------
NM_052900chr821574 1476 ------
NM_052904chr611073 --11368 --
NM_052905chr231791 1174 336 ----1505
NM_052907chr1244126 2732 1193 402 --1252 --
NM_052910chr1331898 1671 1653 ------
NM_052911chr18--1112 1766 --
NM_052918chr1042687 1364 1121 537 --23280 2536 --
NM_052934chr182101 1624 1582 829 817 525 490 257 --2315 41 --
NM_052936chrX141 ------
NM_052950chr1342151 1797 248 160 ------
NM_052978chr143625 478 253 11545 ----
NM_053002chr31935 ------
NM_053016chr9107600 7101 6220 5901 2818 2101 2012 1701 1082 341 ------
NM_053023chr1131301 493 430 --1506 --
NM_053024chr311247 1504 ----
NM_053025chr331173 651 201 ----11118
NM_053026chr331173 651 201 ----11118
NM_053027chr331173 651 201 ----11118
NM_053028chr331173 651 201 ----11118
NM_053031chr331173 651 201 ----11118
NM_053032chr331173 651 201 ----11118
NM_053043chr795633 5602 5550 5520 4700 4649 3979 980 765 12298 1755 --
NM_053046chr191122 1374 ----
NM_053056chr1122890 2308 13185 12797 --
NM_053064chr14------12912
NM_053279chr852545 860 714 636 580 1122 ----
NM_053281chrX1287 ------
NM_054013chr54877 619 592 309 --1117 --
NM_054025chr1141990 1827 419 43 12100 ----
NM_057169chr1242970 2683 2453 451 12497 ----
NM_057170chr1242970 2683 2453 451 12497 ----
NM_057749chr82157 54 ------
NM_058170chr11565 11129 ----
NM_058172chr411448 --11624 --
NM_058240chr1431453 1220 641 ----1152
NM_058241chr21354 ------
NM_058241chr21354 ------
NM_058243chr191113 138 ----
NM_078485chr62679 43 ------
NM_078625chr641296 380 280 141 ------
NM_079834chr1981434 1068 615 458 383 295 223 65 --21619 667 --
NM_080391chr11569 --1399 --
NM_080392chr11618 --1448 --
NM_080415chr173395 276 97 ------
NM_080422chr181319 ------
NM_080423chr181319 ------
NM_080594chr162217 108 ----1673
NM_080604chr62619 600 --2479 63 --
NM_080616chr203627 601 61 ------
NM_080617chr20--1342 ----
NM_080618chr201834 1348 ----
NM_080629chr111544 ------
NM_080630chr111544 ------
NM_080645chr62748 360 ------
NM_080654chr11156 ------
NM_080664chr14136 21832 1759 ----
NM_080666chr1431695 1496 1416 ------
NM_080669chr17173606 1822 1767 1678 1657 1585 1579 1256 1195 1103 1045 1015 738 580 557 457 362 --23947 3483 --
NM_080676chr2043140 1021 328 31 12704 22076 657 --
NM_080679chr63676 635 208 1801 ----
NM_080680chr63676 635 208 1801 ----
NM_080681chr63676 635 208 1801 ----
NM_080682chr11617 ------
NM_080683chr41420 ------
NM_080684chr41420 ------
NM_080685chr41420 ------
NM_080686chr61127 ------
NM_080702chr6190 ------
NM_080703chr6190 ------
NM_080717chr1211200 ------
NM_080732chr191122 1374 ----
NM_080737chrX31213 546 383 ----135
NM_080738chr171853 1729 1669 1345 748 642 137 --11429 --
NM_080759chr1332603 2299 745 --12039 --
NM_080760chr1332603 2299 745 --12039 --
NM_080764chr2252602 1208 804 760 217 --21141 588 --
NM_080792chr2071902 1793 1686 1660 901 579 162 ----12128
NM_080865chr33702 576 119 ------
NM_080872chr82426 395 13556 21589 1396 --
NM_080881chr56547 499 278 139 127 59 --1103 --
NM_130391chr9--12555 ----
NM_130392chr9--12555 ----
NM_130393chr9--12555 ----
NM_130436chr2132740 1769 1715 ------
NM_130438chr2143317 2346 2292 425 1306 ----
NM_130439chr1011457 ------
NM_130439chr1011457 ------
NM_130440chr141223 1065 1011 113 --11175 --
NM_130442chr72967 171 ----1151
NM_130459chr951631 1386 1355 1327 663 ------
NM_130468chr153705 697 86 --1566 --
NM_130469chr141335 --1663 --
NM_130795chr93673 655 256 --1240 --
NM_130830chr373963 3909 2806 1552 1283 603 113 13757 12587 --
NM_130838chr1511510 ------
NM_130839chr1511510 ------
NM_133170chr2077652 5805 5598 2977 2582 495 288 12260 11340 21017 334
NM_133265chrX43525 3473 2425 2294 ------
NM_133330chr43727 413 322 --22584 1209 --
NM_133331chr43727 413 322 --22584 1209 --
NM_133334chr4116012 4907 4896 4634 4030 1858 1622 1079 971 745 114 12281 24305 4167 --
NM_133335chr43727 413 322 --22584 1209 --
NM_133369chr53924 200 42 ------
NM_133372chr532810 2754 2666 1619 ----
NM_133378chr21688 ------
NM_133432chr21688 ------
NM_133437chr21688 ------
NM_133444chr1971513 1152 601 441 291 123 95 ------
NM_133452chr192806 200 ------
NM_133476chr122104 46 ------
NM_133477chr472974 2822 2126 825 600 280 106 ------
NM_133496chr124119 48 ----12843
NM_133499chrX2361 243 --1861 --
NM_133507chr12--1613 --1213
NM_133631chr31612 ------
NM_133634chr2161654 1476 1208 678 213 186 ------
NM_133638chr521423 1356 ----136
NM_133646chr275126 3875 2133 2119 1292 533 296 ------
NM_133650chr6295 33 ------
NM_134268chr1741101 972 853 282 --129 --
NM_134325chr171636 1159 1117 364 352 60 25 ----1568
NM_134421chr23755 615 198 ------
NM_134427chr93673 655 256 --1240 --
NM_134442chr231662 1600 50 ------
NM_138270chrX33296 3012 867 1751 1803 --
NM_138288chr1421915 1384 ------
NM_138292chr1142759 1148 332 315 32808 1424 1358 ----
NM_138300chr131112 617 436 --11391 --
NM_138317chr141467 ------
NM_138318chr141467 ------
NM_138319chr151277 1417 1349 --
NM_138338chr2293473 3378 3239 3178 2805 2619 2438 1041 858 --12258 --
NM_138356chr152285 57 1465 ----
NM_138357chr1011523 1691 127 --
NM_138395chr21341 ------
NM_138413chr1021051 984 ------
NM_138415chr222324 290 ------
NM_138426chr711820 --1147 --
NM_138444chr1333659 1648 92 1811 21186 886 --
NM_138453chr51222 ------
NM_138459chr652481 703 662 654 632 ------
NM_138468chr295345 5153 5128 4908 4743 4250 2274 1445 1019 1887 14538 --
NM_138473chr12104195 3988 3587 3211 3160 1643 1569 1018 911 590 14851 ----
NM_138479chr131516 773 233 ------
NM_138492chr541327 462 130 73 ------
NM_138494chr731764 1133 889 ----12111
NM_138555chr151402 ------
NM_138558chr12934 245 --1125 --
NM_138559chr241354 1312 1122 273 ------
NM_138569chr61293 ------
NM_138576chr1431529 1037 257 14492 14281 --
NM_138578chr2071374 1347 1140 1095 1027 257 209 ------
NM_138609chr51199 ------
NM_138610chr51199 ------
NM_138621chr274081 4008 3752 3123 1160 1121 81 --13036 --
NM_138638chr1442479 2260 1575 402 --11971 1457
NM_138689chr111100 ------
NM_138713chr1687594 6800 6575 6456 2022 1442 837 256 37346 6479 2937 11332 --
NM_138714chr1687594 6800 6575 6456 2022 1442 837 256 37346 6479 2937 11332 --
NM_138727chr142139 2093 1529 913 11829 21669 838 --
NM_138728chr142139 2093 1529 913 11829 21669 838 --
NM_138730chr61137 ------
NM_138731chr1424163 3755 ------
NM_138735chr221527 499 ------
NM_138768chr112890 665 ------
NM_138774chr194934 827 292 178 --1161 --
NM_138775chr11----1595 --
NM_138782chr51968 ------
NM_138795chr151101 630 595 523 292 --1606 --
NM_138799chr221918 1594 ------
NM_138819chrX--133 ----
NM_138927chr21--2897 234 ----
NM_138959chr1185574 5562 4945 4884 4836 4748 4724 2671 2655 2502 2457 2100 1305 956 739 726 699 117 11061 11356 --
NM_138967chr15112436 2389 2319 2167 2046 1790 1781 1647 1549 376 361 --21953 199 --
NM_138969chr82587 469 1945 ----
NM_138970chr1411606 ------
NM_138971chr1163752 3662 1002 384 363 226 1162 1408 --
NM_138971chr1163752 3662 1002 384 363 226 1162 1408 --
NM_138972chr1163752 3662 1002 384 363 226 1162 1408 --
NM_138972chr1163752 3662 1002 384 363 226 1162 1408 --
NM_138973chr1163752 3662 1002 384 363 226 1162 1408 --
NM_138973chr1163752 3662 1002 384 363 226 1162 1408 --
NM_138981chr41550 --174 --
NM_138983chr2111281 ------
NM_139012chr612241 --11454 --
NM_139014chr622321 89 --11534 --
NM_139015chr1241490 1353 634 135 --185 11445
NM_139045chr91325 ------
NM_139057chr1551803 1109 898 279 138 --11063 12026
NM_139062chr17140 ------
NM_139071chr1261492 1481 1126 542 444 244 ------
NM_139126chr61908 --1751 --
NM_139131chr11--1102 ----
NM_139132chr1151148 726 375 278 75 ------
NM_139136chr121323 1740 ----
NM_139157chr112649 479 ------
NM_139168chr5--11848 ----
NM_139181chr112448 21 ------
NM_139201chr121540 --1151 --
NM_139246chr972001 1665 1575 852 358 275 113 12274 12199 --
NM_139276chr1752276 1661 1573 677 374 21751 953 1445 --
NM_139279chr273095 2692 2639 1033 606 543 23 ------
NM_139283chr1242359 1730 689 73 ----12139
NM_139320chr152121 58 --1219 --
NM_139321chr20103931 3827 3711 3655 2832 2803 2676 1608 1552 640 1896 ----
NM_139323chr2071843 1791 1343 1316 473 318 164 ------
NM_144488chr93673 655 256 --1240 --
NM_144489chr93673 655 256 --1240 --
NM_144499chr33922 377 103 11182 21028 42 --
NM_144563chr2--1336 ----
NM_144563chr2--1336 ----
NM_144568chr143434 39 28 ------
NM_144571chr445193 4891 2792 172 --16192 --
NM_144576chr122608 500 ------
NM_144578chr1485349 4153 3402 1875 1384 1000 610 488 1359 11373 --
NM_144579chr2132842 2770 2763 2735 2595 2582 2385 2199 2191 2051 1065 834 515 1468 1811 --
NM_144582chr2102610 2214 2197 1686 992 973 851 296 166 108 --42623 2495 1655 393 --
NM_144590chr1032201 1905 404 1724 ----
NM_144599chr1564219 3598 3452 625 414 55 --1214 --
NM_144609chr1711210 11076 ----
NM_144628chr2083050 2571 2419 2331 1183 1061 1008 264 13100 1206 --
NM_144636chr33664 636 558 ------
NM_144660chr101290 ------
NM_144685chr194276 220 206 51 ------
NM_144691chr194262 156 123 95 --175 --
NM_144703chr205832 820 761 432 387 --1447 --
NM_144723chr51618 ------
NM_144778chr13--12623 ----
NM_144949chr21507 ------
NM_144963chr811787 ----12303
NM_144967chrX21059 275 2891 200 ----
NM_144982chr12184 ------
NM_144998chr174399 352 313 44 ------
NM_145008chr111109 --1614 --
NM_145010chr1042331 2191 2017 1948 ----12124
NM_145011chr1031716 528 473 ------
NM_145055chr1842359 1403 469 420 --13566 12993
NM_145068chr17140 ----1216
NM_145071chr35382 344 311 120 103 ------
NM_145109chr173970 140 97 ------
NM_145112chr1431112 1106 402 --31191 1009 271 --
NM_145113chr1431384 1378 85 --31463 1281 543 --
NM_145119chrX124 ------
NM_145166chr382796 2348 2012 1070 959 879 828 174 22733 2156 11913 --
NM_145173chr1932485 2454 2171 1297 12260 --
NM_145201chr82295 114 --197 --
NM_145206chr1043272 2851 2256 2154 1735 1749 --
NM_145259chr265816 5076 4919 4883 4380 721 --15923 --
NM_145260chr24705 573 224 75 --1142 --
NM_145261chr31621 1349 ----
NM_145274chr172760 649 1360 ----
NM_145279chr12238 59 --21745 474 --
NM_145284chrX22009 141 ------
NM_145296chr191825 1927 ----
NM_145307chr1024310 1840 11532 ----
NM_145313chr101162 --1655 --
NM_145320chr743204 3110 2666 2390 11109 ----
NM_145321chr743204 3110 2666 2390 11109 ----
NM_145322chr743204 3110 2666 2390 11109 ----
NM_145341chr101610 ------
NM_145349chr1742044 1909 580 152 --11547 --
NM_145350chr1771396 1261 641 603 497 485 338 ------
NM_145638chr113859 274 25 ------
NM_145686chr252721 2705 2574 680 396 ------
NM_145687chr252721 2705 2574 680 396 ------
NM_145690chr841563 1335 1295 264 --1361 --
NM_145695chr71593 ----1174
NM_145698chr1021508 1374 ------
NM_145733chr221380 ------
NM_145799chrX33093 488 205 12563 ----
NM_145808chr732381 2063 799 --22312 496 --
NM_145861chr171853 1729 1669 1345 748 642 137 --11429 --
NM_145899chr64436 402 221 119 --2494 471 --
NM_145901chr64436 402 221 119 --2494 471 --
NM_145902chr64436 402 221 119 --2494 471 --
NM_145903chr64436 402 221 119 --2494 471 --
NM_145904chr64436 402 221 119 --2494 471 --
NM_145905chr64436 402 221 119 --2494 471 --
NM_146388chr1931113 965 118 ------
NM_147147chr653799 3506 1544 1522 816 --33759 3611 3555 --
NM_147150chr923381 2527 ------
NM_147156chr1021472 138 ------
NM_147161chr131035 1005 483 --1413 --
NM_147168chr91105 ------
NM_147175chrX11517 ------
NM_147189chr832239 188 158 ------
NM_147190chr12167 152 ----
NM_147202chr932461 2241 369 --22403 1078 1553
NM_147204chr122420 159 --1331 --
NM_147223chr231525 96 66 ------
NM_148174chr811850 1111 ----
NM_148571chr1741883 485 294 226 --1243 --
NM_148894chr4--1344 ----
NM_148911chr152121 58 --1219 --
NM_148918chr172622 232 --131 --
NM_148921chr1772231 1680 1667 749 731 329 196 --1236 --
NM_152227chr201470 ------
NM_152233chr1411083 11504 --1466
NM_152238chr11237 ------
NM_152253chr2283575 3263 2786 1331 1308 552 510 28 13307 23683 1242 11562
NM_152261chr1222420 777 2494 217 12122 --
NM_152264chr112996 951 ------
NM_152265chr141389 1127 253 24 11221 ----
NM_152267chr2262165 1493 714 690 81 66 --2699 226 --
NM_152271chr82362 41 ------
NM_152272chr81293 31374 1136 468 1891 --
NM_152278chrX--1608 ----
NM_152284chr8--1948 ----
NM_152305chr31121 --181 --
NM_152335chr153619 192 107 ------
NM_152342chr164486 386 222 195 ------
NM_152344chr1711288 ------
NM_152345chr173358 218 209 --1821 --
NM_152350chr172124 27 1202 ----
NM_152371chr131563 654 497 --21455 1442 --
NM_152380chr131178 654 131 133 11087 --
NM_152388chr242584 2528 1517 1309 33628 1299 1236 ----
NM_152407chr51974 12412 --11035
NM_152409chr543331 1356 985 507 ------
NM_152420chr92720 672 ------
NM_152422chr921593 706 ------
NM_152424chrX84582 3782 3613 3149 1877 1791 1612 732 --33761 1389 623 --
NM_152442chr1221107 552 11261 ----
NM_152447chr141266 ------
NM_152470chr18113444 3411 1339 1332 1265 1147 980 815 722 243 219 23190 2537 ----
NM_152487chr121334 239 11445 168 --
NM_152493chr13561 157 37 ------
NM_152520chr22427 350 ------
NM_152523chr2--1550 ----
NM_152538chr331342 1270 148 ------
NM_152542chr41668 ------
NM_152545chr4174 ------
NM_152553chr6--140 ----
NM_152556chr732187 1961 95 ------
NM_152586chr101147 ----1315
NM_152594chr1532220 298 148 2736 79 1102 --
NM_152608chr11772 22017 410 ----
NM_152622chr523491 788 22259 1085 ----
NM_152624chr546673 5709 5296 1923 11766 11801 --
NM_152629chr953267 2695 1418 751 288 ------
NM_152636chr1132398 738 188 ------
NM_152641chr1242759 2061 2042 291 --22141 1963 --
NM_152660chr12164 67 ------
NM_152663chr11315 ------
NM_152665chr121310 841 ------
NM_152666chr11226 ------
NM_152678chr331785 864 316 ------
NM_152682chr441141 500 312 81 ------
NM_152692chrX1125 ------
NM_152695chrX------1529
NM_152699chr383680 3578 2977 2643 2632 2391 1453 1111 ------
NM_152707chr101121 ------
NM_152745chr7----1812 --
NM_152754chr743735 2346 870 564 ------
NM_152756chr52494 136 ------
NM_152758chr812455 --1982 --
NM_152765chr832393 2282 545 ------
NM_152773chr3--123 ----
NM_152787chrX42648 2612 2485 413 22735 722 ----
NM_152835chr121071 245 31114 672 371 ----
NM_152836chr821753 1248 ------
NM_152837chr821753 1248 ------
NM_152838chr2033403 1108 233 --13496 --
NM_152860chr125531 493 274 135 51 ------
NM_152862chr2--2318 32 ----
NM_152902chr1149 ------
NM_152903chr1322912 613 11821 12294 --
NM_152924chr15116512 6479 5470 4478 4244 2337 2307 2289 1948 1858 936 15145 ----
NM_152989chr1221566 1254 ------
NM_153000chr182552 213 ------
NM_153029chr1654022 3002 2787 2761 828 ------
NM_153038chr21646 ------
NM_153040chr151137 ------
NM_153042chr6--21473 659 ----
NM_153183chrX11258 --1211 --
NM_153188chr544997 1713 1324 884 14469 ----
NM_153207chr1224111 1485 22671 270 ----
NM_153228chr17--198 ----
NM_153234chr522126 276 ------
NM_153260chr1521006 465 11420 --1329
NM_153273chr362573 960 784 656 641 268 --42402 1978 1819 278 --
NM_153321chr171950 1991 ----
NM_153322chr171950 1991 ----
NM_153331chr32653 156 ------
NM_153333chrX130 1619 ----
NM_153334chr222758 182 --1579 --
NM_153335chr1741340 1241 981 112 ------
NM_153338chr1741001 778 748 21 ------
NM_153347chr1132654 2452 899 12574 --11797
NM_153354chr52290 247 ------
NM_153367chr1063491 3427 1386 858 685 589 ------
NM_153371chr1322114 108 ------
NM_153453chr61701 ------
NM_153456chr1355826 1697 1012 498 101 12527 25629 4706 --
NM_153499chr1252737 2654 2026 1928 1883 1871 ----
NM_153500chr1252737 2654 2026 1928 1883 1871 ----
NM_153607chr522151 215 22307 633 12757 --
NM_153616chr1511610 1142 ----
NM_153617chr1511610 1142 ----
NM_153618chr1511610 1142 ----
NM_153619chr1512848 11380 ----
NM_153620chr721587 528 ------
NM_153631chr721603 1389 11102 ----
NM_153632chr721603 1389 11102 ----
NM_153634chr122667 65 ------
NM_153649chr132103 2086 1486 ------
NM_153675chr202614 34 ------
NM_153685chr1231131 828 110 ------
NM_153693chr122325 90 ------
NM_153748chr121323 1740 ----
NM_153756chr191361 1269 770 491 402 301 162 143 101 --11658 --
NM_153757chr42166 49 ------
NM_153810chr1074216 3647 3395 3125 1998 876 769 11722 1387 --
NM_153812chr142165 888 589 550 ----11948
NM_153813chr16----1158 --
NM_153825chr421580 1363 ------
NM_153828chr2------1322
NM_153836chr211844 1719 ----
NM_170606chr711515 21805 1359 ----
NM_170607chr1741031 566 535 443 ------
NM_170665chr1253091 2954 2789 596 341 14569 22779 1073 --
NM_170706chr164176 3528 3163 1646 953 426 ------
NM_170707chr12838 369 1896 ----
NM_170708chr12838 369 1896 ----
NM_170709chr832219 1939 729 ------
NM_170711chr193916 663 253 ------
NM_170731chr1122799 647 ------
NM_170732chr1122799 647 ------
NM_170733chr1122799 647 ------
NM_170734chr1122799 647 ------
NM_170735chr1122799 647 ------
NM_170751chr621063 991 ------
NM_170752chr621063 991 ------
NM_170768chr1131527 1421 39 ------
NM_171825chr572879 2692 2334 2291 2257 2010 1935 --11972 --
NM_171998chrX22163 1017 --22154 777 --
NM_171999chr181559 ------
NM_172016chr631086 960 906 ------
NM_172020chr741702 1550 450 118 --2709 55 --
NM_172058chr821807 111 ------
NM_172059chr821807 111 ------
NM_172060chr821807 111 ------
NM_172069chr22926 689 21922 339 22163 82 --
NM_172071chr135765 2618 1686 16984 ----
NM_172103chr642502 2460 252 77 1625 12623 1312
NM_172105chr642502 2460 252 77 1625 12623 1312
NM_172127chr42515 504 1268 ----
NM_172128chr42471 460 1224 ----
NM_172169chr101386 1309 1343 --
NM_172170chr101386 1309 1343 --
NM_172171chr101386 1309 1343 --
NM_172173chr101386 1309 1343 --
NM_172206chr1771772 1456 682 504 414 313 247 ------
NM_172226chr1252737 2654 2026 1928 1883 1871 ----
NM_172337chr141992 ------
NM_172373chr1311026 ------
NM_172375chr1421088 264 ------
NM_173060chr5126 187 ----
NM_173061chr5126 187 ----
NM_173063chr5126 187 ----
NM_173076chr221044 796 ------
NM_173078chrX1354 ------
NM_173163chr161437 ------
NM_173165chr161318 1167 ----
NM_173177chr21644 --1554 --
NM_173198chr942796 2028 937 150 12120 ----
NM_173199chr93469 399 183 ------
NM_173200chr942796 2028 937 150 12120 ----
NM_173201chr161263 ------
NM_173214chr1687594 6800 6575 6456 2022 1442 837 256 37346 6479 2937 11332 --
NM_173354chr2131533 720 72 --121 --
NM_173465chr531017 859 264 ------
NM_173468chr4----32258 1766 390 --
NM_173469chr1521482 1303 11529 ----
NM_173470chrX12799 ----22317 1913
NM_173474chr16261 35 ------
NM_173475chr1621655 236 11088 ----
NM_173476chr1642154 2024 773 273 --1219 --
NM_173495chrX2970 363 --3888 839 171 --
NM_173508chr11131 ------
NM_173510chr2212835 12199 ----
NM_173515chr62296 30 ------
NM_173542chr123583 485 465 ------
NM_173543chr32680 39 ------
NM_173547chr1731517 1256 1167 --126 --
NM_173552chr31750 ------
NM_173561chr63874 211 87 ------
NM_173576chr1011835 ------
NM_173582chr1145498 1324 577 105 1437 15821 --
NM_173584chr111127 ------
NM_173587chr112247 101 --1171 --
NM_173595chr12124731 4430 4414 4120 3494 1365 823 742 665 473 270 169 --24592 175 --
NM_173602chr1263750 3326 1321 941 713 62 12629 ----
NM_173624chr17----175 --
NM_173642chr1118974 8798 8775 8596 6671 6102 6052 5954 3232 2793 2495 37439 7056 618 36472 2995 2312 --
NM_173647chr2--1360 ----
NM_173670chr521043 745 ------
NM_173672chr662558 2409 2250 1684 450 246 ----1618
NM_173681chr751586 1358 772 623 291 --22018 457 --
NM_173683chr821566 1333 ------
NM_173694chrX42040 1613 1010 287 --1427 --
NM_173698chrX11425 1122 ----
NM_173794chrX------1166
NM_173808chr1167 ----14006
NM_173828chr52345 36 ------
NM_173829chr575122 5096 4754 2400 2191 1847 803 26040 153 11497 --
NM_173854chr132288 648 343 ------
NM_173872chr41282 ------
NM_174869chrX3147 66 53 --1349 --
NM_174911chr853685 3045 1346 915 236 --32892 409 288 --
NM_174921chr421009 324 ------
NM_174934chr11103577 3407 3260 3127 2727 2589 860 671 655 107 --1875 12195
NM_174938chr92333 70 ------
NM_174953chr1771212 973 953 475 307 259 194 11158 ----
NM_174957chr1771212 973 953 475 307 259 194 11158 ----
NM_175061chr721765 352 ------
NM_175610chr152909 386 ------
NM_175630chr21354 1247 ----
NM_175634chr81867 ------
NM_175635chr81867 ------
NM_175636chr81867 ------
NM_175709chr2282129 2064 885 767 651 622 436 373 13065 12687 --
NM_175736chr12117518 5684 4807 4739 2963 2879 2107 1366 741 714 182 --17634 --
NM_175748chr1432080 719 485 ------
NM_175767chr511604 2340 150 ----
NM_175852chr193000 2787 1960 924 888 327 125 114 55 --21197 533 --
NM_175854chr1311017 ------
NM_175856chr52628 125 1767 ----
NM_175863chr611289 ------
NM_175866chr12439 171 ------
NM_175873chr52303 24 ------
NM_175884chr71930 ------
NM_175895chr1241154 1051 803 425 21093 891 1231 --
NM_175898chr1551546 1446 1240 1058 293 ------
NM_175907chr18--11919 11093 --
NM_175913chr201820 --4899 882 394 67 --
NM_175931chr1641571 1531 94 80 1480 61914 1882 1850 1818 1786 1754 --
NM_176814chr7--1423 ----
NM_176815chr332109 945 145