TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5007-3p
miRNA Sequence: AUCAUAUGAACCAAACUCUAAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX86115 5331 5142 4550 2595 2581 1642 1028 14834 25315 2122 15633
NM_000109chrX32628 2144 685 1350 --2984 546
NM_000138chr154824 660 231 206 --32064 2020 1071 12086
NM_000216chrX133778 2921 2890 2680 2577 2493 1503 1287 1277 1267 1031 751 121 1439 ----
NM_000217chr1264489 4426 1531 1054 479 310 34475 1904 396 15031 11354
NM_000332chr6116889 6704 5196 4506 2777 2562 1814 1427 1350 388 172 24707 1332 ----
NM_000408chr262997 1071 972 463 395 281 --1929 12850
NM_000793chr14135024 5013 4376 4020 3852 3483 1682 1657 1502 1205 884 476 273 24687 230 13746 --
NM_000809chr4148295 7833 7807 7225 6582 6527 6416 6319 2334 2017 1916 1398 1005 419 58539 7680 7617 1979 659 --37694 6192 2313
NM_000813chr5125068 4977 4454 3929 3536 3478 3468 3428 1880 1596 1390 1263 21421 1318 ----
NM_000814chr1593932 1662 1103 1030 868 802 226 196 178 24195 142 ----
NM_000831chr1136287 4599 4583 4568 2497 2375 2363 2193 2142 2080 2070 1944 496 36278 4528 2122 11750 12355
NM_000926chr1198663 6121 3302 2994 2905 2785 2494 592 378 37320 6773 2898 18621 16743
NM_001001396chr194326 4023 3997 3989 2888 2827 1231 1152 194 34008 2795 919 ----
NM_001001484chr1082370 2282 2220 2204 2164 2158 2073 444 --11878 --
NM_001001709chr92844 478 62470 2303 1831 1090 865 461 12753 1693
NM_001003407chr1094748 4661 4640 3740 3385 3113 1669 1473 1213 14887 1242 24348 1508
NM_001003408chr1094748 4661 4640 3740 3385 3113 1669 1473 1213 14887 1242 24348 1508
NM_001003712chr1253559 2838 2496 1621 396 23609 561 1256 22613 1631
NM_001004317chr674219 3911 3731 1307 1139 657 231 ----1395
NM_001004328chr1242237 1487 445 331 --1800 2316 36
NM_001007023chr14135024 5013 4376 4020 3852 3483 1682 1657 1502 1205 884 476 273 24687 230 13746 --
NM_001007246chr2191600 1370 692 591 581 570 563 545 260 ------
NM_001008539chr82620 274 64818 4382 4360 3316 2165 2148 --14193
NM_001009554chr473530 3509 3013 2919 1171 1002 240 13092 34726 4305 3245 --
NM_001009554chr473530 3509 3013 2919 1171 1002 240 13092 34726 4305 3245 --
NM_001009899chr366334 5559 4952 3965 1055 63 46511 1227 1138 1108 ----
NM_001010891chr5106646 5855 5361 4736 4254 2643 2380 2255 1287 1014 15073 12360 --
NM_001012755chrX114982 4963 4948 4146 4055 3393 3090 2027 1702 1155 905 --24269 1550 23745 3281
NM_001012761chr562448 893 344 175 110 93 22651 2054 ----
NM_001013620chr12128329 8051 7917 6376 6116 5874 5170 1771 1645 673 587 153 48150 7454 6470 665 47583 7565 7547 1236 --
NM_001014797chr10118117 6528 6184 6046 5940 5244 5189 1746 1527 1127 190 26374 6163 15039 --
NM_001018065chr9125984 5949 5703 5495 5314 4852 4232 4027 2354 923 903 738 15530 25562 5092 --
NM_001018066chr9125984 5949 5703 5495 5314 4852 4232 4027 2354 923 903 738 15530 25562 5092 --
NM_001018067chr174904 4877 1458 957 603 523 190 23700 3542 --11771
NM_001018068chr174904 4877 1458 957 603 523 190 23700 3542 --11771
NM_001018069chr174904 4877 1458 957 603 523 190 23700 3542 --11771
NM_001025580chrX84225 4206 4176 3926 3733 2890 1146 606 32860 2745 966 ----
NM_001030055chr1494588 4295 4151 4040 3916 3596 3454 3289 1868 1358 23712 179 --
NM_001032395chr632621 2488 2042 21013 39 11026 11858
NM_001037132chr752215 1826 1570 1520 303 31415 407 176 188 --
NM_001037133chr752215 1826 1570 1520 303 31415 407 176 188 --
NM_001039618chr1185143 4614 4512 2027 1032 809 742 157 11065 44047 3659 886 189 --
NM_001040110chr751613 1480 384 317 311 2415 390 --1329
NM_001040142chr282428 1993 1521 822 800 794 786 454 11766 21965 328 --
NM_001040143chr282428 1993 1521 822 800 794 786 454 11766 21965 328 --
NM_001040429chr1353580 3545 3103 2655 2431 13036 11051 12367
NM_001040665chr774445 4215 4051 4008 1718 1361 559 53228 3124 568 550 189 14395 --
NM_001042355chr1674205 3326 1977 1689 1274 1244 1238 23427 387 21252 285 --
NM_001042412chr1674205 3326 1977 1689 1274 1244 1238 23427 387 21252 285 --
NM_001042555chr1284589 4350 4114 3358 1575 1455 505 131 23924 3917 14295 --
NM_001042599chr256800 6452 5819 1394 1296 57889 7206 1515 1409 1151 22689 504 --
NM_001042603chr12114490 4315 4087 3981 3854 3644 3265 2082 2047 1874 1426 45292 4880 3949 1221 11261 13841
NM_001113490chrX73497 3179 2398 1233 1061 829 682 12857 --23259 165
NM_001167chrX46450 5496 5473 5253 34654 1024 62 11383 16610
NM_001173chr1494588 4295 4151 4040 3916 3596 3454 3289 1868 1358 23712 179 --
NM_001204chr287460 6640 6238 2964 2652 1857 1383 264 15723 12997 --
NM_001259chr7105713 4277 4124 3940 1897 1891 1292 781 449 414 ------
NM_001438chr173595 3127 2651 2439 2259 1384 1093 23034 610 23074 1353 --
NM_001684chr184043 3740 3714 3706 2605 2544 948 869 23725 636 ----
NM_001821chr1154733 4557 4445 4283 3811 3748 3405 3164 1523 1359 1314 525 274 223 105 13760 24064 82 14807
NM_001839chr11548 ----2791 233
NM_001858chr684238 3648 2013 1841 1363 755 360 210 23730 256 ----
NM_001918chr1119149 7629 7524 6331 6095 5891 5884 3397 2454 634 239 38459 3544 747 29117 114 --
NM_001977chr431166 490 134 ----21327 553
NM_002025chrX99066 8306 8164 8023 7638 5669 2713 2705 1844 28407 7365 --17946
NM_002040chr2172775 2310 2258 2026 1204 1075 461 --12111 22564 1128
NM_002210chr243090 2922 1388 1351 1606 33604 2474 524 1798
NM_002214chr795525 4585 4460 3834 3782 1680 1656 591 162 55722 5085 4752 4236 1825 1409 --
NM_002247chr1062283 2199 2072 866 148 130 1701 --1816
NM_002270chr545651 5370 1673 1521 45671 4532 1700 268 24150 3990 11737
NM_002310chr5126267 5998 5598 4967 4910 4089 2366 2089 905 853 364 153 46309 5525 2228 1628 ----
NM_002313chr1094748 4661 4640 3740 3385 3113 1669 1473 1213 14887 1242 24348 1508
NM_002351chrX21581 48 11426 --21661 1279
NM_002838chr151118 961 950 261 193 21130 942 --1900
NM_003034chr12117619 7134 5674 4998 2955 2891 2516 1917 1653 819 57 37793 1470 663 11202 --
NM_003046chr82620 274 64818 4382 4360 3316 2165 2148 --14193
NM_003108chr2117076 6582 6332 6263 6166 6103 5775 5019 4976 1284 816 ------
NM_003184chr86997 964 853 840 768 318 ----1943
NM_003199chr1854164 3784 3615 3504 963 33804 1506 773 --15514
NM_003463chr663160 2874 2319 2274 2217 1053 ----13338
NM_003574chr1865720 5308 4025 862 662 384 24457 2136 --24974 1168
NM_003590chr273429 3258 3193 3066 2998 1183 1039 43466 1472 273 241 ----
NM_003615chr363319 3146 1240 1063 351 42 43911 3336 3266 2812 --13191
NM_003622chr1232161 509 395 2702 343 --22652 786
NM_003672chr181805 1781 1765 1756 1474 1332 569 333 ----11258
NM_003677chr12101415 895 710 236 216 194 154 118 100 49 --11868 --
NM_003759chr454303 2858 1701 1326 1003 13939 --21458 1420
NM_003772chr1141041 867 851 59 --1843 11239
NM_003966chr5107834 7227 6269 6222 6098 5842 3060 1884 1863 1629 26698 3130 11522 --
NM_004006chrX32628 2144 685 1350 --2984 546
NM_004007chrX32628 2144 685 1350 --2984 546
NM_004009chrX32628 2144 685 1350 --2984 546
NM_004010chrX32628 2144 685 1350 --2984 546
NM_004011chrX32628 2144 685 1350 --2984 546
NM_004012chrX32628 2144 685 1350 --2984 546
NM_004013chrX32628 2144 685 1350 --2984 546
NM_004014chrX32628 2144 685 1350 --2984 546
NM_004015chrX32628 2144 685 1350 --2984 546
NM_004016chrX32542 2058 599 1264 --2898 460
NM_004017chrX32628 2144 685 1350 --2984 546
NM_004018chrX32542 2058 599 1264 --2898 460
NM_004020chrX32628 2144 685 1350 --2984 546
NM_004021chrX32542 2058 599 1264 --2898 460
NM_004022chrX32542 2058 599 1264 --2898 460
NM_004023chrX32542 2058 599 1264 --2898 460
NM_004171chr11159458 9178 9063 8876 8865 8272 8141 6960 3746 3615 2929 2845 2764 1904 561 37602 2966 1594 19168 --
NM_004464chr4114339 4329 4237 4073 4049 3943 3721 1702 753 486 142 1551 23132 1448 --
NM_004586chrX75129 4656 4644 4538 4283 3829 772 34187 2123 1088 11429 1274
NM_004726chrX95784 4763 3964 3523 2233 2202 1072 1030 551 55752 4623 4225 3788 880 1134 --
NM_005010chr752215 1826 1570 1520 303 31415 407 176 188 --
NM_005011chr751613 1480 384 317 311 2415 390 --1329
NM_005056chr12114734 4559 4331 4225 4098 3888 3509 2118 1670 57 21 45536 5124 4193 1465 11505 14085
NM_005233chr362470 2233 1771 1614 1590 127 1696 12368 --
NM_005235chr256800 6452 5819 1394 1296 57889 7206 1515 1409 1151 22689 504 --
NM_005578chr384945 4608 4017 3998 3729 3305 1990 1196 33691 3532 1984 ----
NM_005665chr184898 3239 1279 994 634 305 225 86 44517 3918 1751 1092 33016 982 53 --
NM_005668chr594037 4029 4002 3964 3758 3589 1818 1603 1368 21415 1223 1593 13551
NM_005840chrX137133 7017 6938 5890 5804 5384 5370 4884 4852 2882 423 272 265 66155 5836 5638 4874 4749 2811 ----
NM_006154chr1542640 2184 411 297 32299 2200 2174 --21879 700
NM_006203chr585033 4559 4227 4013 3678 2109 950 563 14188 --14548
NM_006206chr432645 2374 1150 1156 --11959
NM_006239chr42191 116 ----2699 85
NM_006251chr593365 2500 2176 1359 1335 1327 1297 1159 1068 12312 12890 --
NM_006252chr167417 5677 5239 4819 2429 1851 12102 11617 27520 7447
NM_006287chr261979 1051 965 772 610 334 42564 2060 2053 48 --22469 2003
NM_006306chrX55558 5201 1865 696 355 55169 3857 2369 1871 1598 35020 1752 364 --
NM_006654chr1284589 4350 4114 3358 1575 1455 505 131 23924 3917 14295 --
NM_006720chr1094748 4661 4640 3740 3385 3113 1669 1473 1213 14887 1242 24348 1508
NM_006777chrX52537 2248 2144 1806 434 22820 1943 --12307
NM_006915chrX82561 2533 2442 955 740 707 656 509 --1258 --
NM_006996chr141228 1184 692 345 ----1615
NM_007038chr21115559 5530 5387 5104 4699 4397 4108 2214 2095 1928 945 12402 11332 11616
NM_007125chrY3905 894 216 --1232 11419
NM_007231chrX6928 414 281 184 37 23 4840 599 495 162 ----
NM_012158chr1331842 299 127 1243 11544 11216
NM_012252chr794996 4259 3593 1900 1359 806 784 565 78 34423 741 589 --12097
NM_012262chr185195 5098 4975 4150 3824 3193 620 100 11576 --11365
NM_013255chr778209 7939 7689 7377 6424 2765 2477 38899 2908 1286 --28852 8155
NM_013447chr1963746 3319 3227 2810 2659 1267 43815 3466 3375 129 13560 2490 224
NM_013989chr14135024 5013 4376 4020 3852 3483 1682 1657 1502 1205 884 476 273 24687 230 13746 --
NM_014112chr864839 4584 3720 3446 1565 1089 14535 --35276 4774 1930
NM_014155chr1157284 6193 2986 1826 49 37228 6833 1795 11578 12130
NM_014331chr4147744 7698 7665 6413 6403 6358 5424 5230 5044 2719 1653 863 362 309 27500 5963 17492 --
NM_014705chr782046 1707 1655 1593 1570 1538 1400 59 11824 ----
NM_014721chr6107434 7092 6894 6645 4844 2810 2672 2509 1398 833 16258 25005 1391 --
NM_014877chr17187176 7149 7073 6491 6414 4953 2815 2804 2794 2772 2435 2025 1872 1316 1003 877 583 259 22136 674 26363 4992 --
NM_014893chrY32135 838 222 32228 2005 213 --1206
NM_014904chr10104044 3988 3770 3430 3381 2564 1271 984 535 466 ----23632 1432
NM_014982chr1495269 4702 4469 4283 3769 2158 1541 1234 883 23901 3416 ----
NM_015025chr242189 1911 1897 582 ----22432 668
NM_015051chr963392 2314 1252 1236 1226 355 12573 1377 22386 685
NM_015055chr1162747 2432 2402 1904 1058 874 22771 2208 --12852
NM_015149chr182222 1973 1934 1839 1405 1388 291 268 21501 590 --11598
NM_015192chr2082651 2452 1072 1014 850 228 186 179 21191 686 ----
NM_015216chr561389 1344 603 505 242 229 31439 1256 1058 ----
NM_015247chr1674205 3326 1977 1689 1274 1244 1238 23427 387 21252 285 --
NM_015265chr242411 999 414 408 12563 --1986
NM_015285chr18102558 2445 2383 2371 1837 1685 1571 946 935 439 12438 ----
NM_015310chr8118386 7830 6305 6212 6088 5140 1913 913 801 546 532 26054 444 22807 2289 --
NM_015317chr231013 702 262 32843 1956 1896 --22768 41
NM_015365chrX84225 4206 4176 3926 3733 2890 1146 606 32860 2745 966 ----
NM_015446chr151492 1157 323 226 217 11150 --1155
NM_015455chr574095 3929 3005 1063 829 562 461 21329 149 11615 11217
NM_015569chr1164691 4230 4190 4181 3937 3409 3377 3267 3261 3117 3103 3057 657 360 217 94 34834 4751 3033 14354 --
NM_015640chr174904 4877 1458 957 603 523 190 23700 3542 --11771
NM_015852chr783184 2720 2582 1321 908 647 152 143 101398 1233 1152 1068 900 816 732 396 312 228 12555 23209 2546
NM_015886chr8114912 4442 1899 1850 1650 1591 428 404 382 360 235 31309 1106 66 ----
NM_016206chr388203 6561 6347 5654 1999 1673 717 562 56882 6751 6387 5667 1932 17305 15874
NM_016217chr653113 1310 1298 1263 416 21365 674 --1618
NM_016260chr2167416 7410 7398 7391 7117 6748 6171 4781 2693 2586 1805 1524 1388 1075 911 894 24647 2378 24832 799 --
NM_016531chr484144 3804 3784 3092 3007 3001 1322 922 33610 2858 217 23792 154 1608
NM_017420chr14103595 3243 2775 2414 2378 1134 699 564 484 115 23821 2682 13509 --
NM_017644chr375206 3612 3523 2049 1426 377 97 54333 3563 3399 1395 275 ----
NM_017658chr14104499 4458 4187 3731 3375 3271 1703 1213 984 685 14132 --13361
NM_017742chr184709 627 596 214 --1371 1694
NM_018184chr35695 497 488 246 134 11952 --21915 536
NM_018247chr692924 1183 788 730 489 404 364 177 33 12051 1296 1354
NM_018374chr795230 4463 4418 3674 1933 1879 1839 1141 465 25022 3332 13821 --
NM_018566chr175108 5059 4887 4549 4438 3474 765 64757 4392 3743 3517 1473 1458 ----
NM_019050chr451858 670 358 236 224 31484 886 879 1600 12254
NM_020337chr492972 2530 2136 1134 855 338 321 113 71 23002 359 ----
NM_020390chr3113972 3723 3105 3087 3079 1761 1549 1410 735 598 281 34335 3692 1375 1542 --
NM_020640chr341929 1858 564 552 11556 --1386
NM_020654chr361138 1083 663 295 287 265 1460 11063 --
NM_020673chr20106522 4828 2308 2045 1786 1157 997 877 746 647 35830 2368 1625 27550 1858 --
NM_020772chr1758064 7043 5714 2668 584 47086 6545 5526 1222 --17533
NM_020774chr1865395 4887 4529 2327 2086 1393 35080 4238 1516 --15798
NM_020794chr161466 446 377 185 175 131 11064 1606 --
NM_020841chr1253559 2838 2496 1621 396 23609 561 1256 22613 1631
NM_020844chr856968 4775 1292 1015 64 12634 55703 5147 1902 618 481 --
NM_020921chr1433612 3087 2308 12850 23055 976 23368 259
NM_020935chr274295 4040 4031 3152 2966 2877 1164 24657 1073 --13612
NM_020940chr1072800 2582 2574 1978 1788 693 599 32514 1083 478 ----
NM_021007chr282428 1993 1521 822 800 794 786 454 11766 21965 328 --
NM_021116chr7118877 8270 7793 7661 5823 5650 5631 1829 1664 1249 952 19023 15742 15566
NM_021647chr473530 3509 3013 2919 1171 1002 240 13092 34726 4305 3245 --
NM_021648chr6102730 2525 2493 2402 2294 2272 1888 1064 959 877 22437 723 1266 --
NM_021911chr5125068 4977 4454 3929 3536 3478 3468 3428 1880 1596 1390 1263 21421 1318 ----
NM_021912chr1593932 1662 1103 1030 868 802 226 196 178 24195 142 ----
NM_021914chr1451953 980 476 290 257 52414 1809 1759 901 303 1709 --
NM_022459chr1384866 4718 1530 382 304 285 270 216 53903 3845 1647 1151 371 21630 1545 25304 1375
NM_022763chr363182 3152 2681 2586 866 379 22406 24 --12766
NM_022900chr721128 148 31172 1164 186 --2302 245
NM_024345chr965718 5669 4718 4348 3839 878 35528 1123 714 --14651
NM_024548chr341743 1108 448 236 ----1653
NM_024686chr13142 134 120 1184 ----
NM_024947chr3189525 9334 8597 7213 6829 3714 3655 3041 2999 2964 2687 2230 2147 2070 1165 961 512 87 59340 6913 6763 5861 549 --26773 472
NM_024953chr1292734 2263 1897 1786 912 849 562 238 45 --1245 --
NM_024989chr2148015 7986 6099 5475 5233 5067 2683 2661 1976 1857 1787 1725 315 240 1678 ----
NM_030647chr775932 4450 2435 1581 1385 624 484 65639 5494 1772 1266 596 444 14131 --
NM_030664chr1082370 2282 2220 2204 2164 2158 2073 444 --11878 --
NM_030816chr162401 2274 1422 1026 613 329 52500 1217 934 412 267 ----
NM_032373chr1085676 3729 2321 2106 1472 1424 910 679 11290 ----
NM_032446chr573700 3548 3015 1196 1100 556 205 1524 --190
NM_033224chr786738 6557 6123 5925 5061 2732 2665 2644 47897 7486 958 928 ----
NM_033495chrX4964 828 704 87 1753 --1238
NM_033505chr2136516 6175 6158 6083 6074 5484 5163 4414 4081 1386 1052 710 205 25767 2383 1782 --
NM_052832chr873041 2654 2572 2353 998 128 57 2790 515 --1936
NM_052834chr18102558 2445 2383 2371 1837 1685 1571 946 935 439 12438 ----
NM_052851chr1382320 2111 1788 1771 1528 385 354 346 1784 175 --
NM_052879chr1273617 3585 3507 1556 1539 706 480 ------
NM_052885chr1294763 4655 4334 4225 3815 3436 3039 1943 372 11517 ----
NM_053016chr986002 5414 2656 2638 2253 1372 302 183 36503 4999 2519 11557 --
NM_053024chr311274 21225 114 --2962 289
NM_080546chr982186 709 573 477 119 113 97 91 --11940 --
NM_080921chr151118 961 950 261 193 21130 942 --1900
NM_130773chr26962 896 884 874 610 275 ------
NM_133265chrX73497 3179 2398 1233 1061 829 682 12857 --23259 165
NM_133468chr76742 735 724 715 192 123 1171 1825 --
NM_138444chr1394945 4570 4277 3595 3583 3460 3392 3220 1103 --11964 --
NM_138638chr1451953 980 476 290 257 52414 1809 1759 901 303 1709 --
NM_138731chr1433321 3076 2767 33131 2758 1637 23439 352 11022
NM_144571chr4106960 5444 5182 2628 2435 2233 2180 1464 1131 880 46803 4261 2322 1500 ----
NM_144973chr12105333 4270 4214 4159 4006 3872 3841 3777 208 109 24151 804 11576 --
NM_145011chr1052127 1813 1503 809 763 2876 681 --12242
NM_145259chr285796 5497 5458 5258 5245 2511 2010 562 46647 2225 2198 65 ----
NM_152624chr5107143 6746 2569 2226 2201 1660 1615 1299 1276 1064 16803 15887 --
NM_152835chr172543 2113 1137 1122 1033 425 407 1437 1769 1463
NM_152919chr1963746 3319 3227 2810 2659 1267 43815 3466 3375 129 13560 2490 224
NM_152999chr774445 4215 4051 4008 1718 1361 559 53228 3124 568 550 189 14395 --
NM_153188chr545651 5370 1673 1521 45671 4532 1700 268 24150 3990 11737
NM_153207chr1293621 3115 2935 2581 2494 1457 822 530 393 13854 12775 --
NM_153456chr13105963 4994 4118 4045 3899 2461 2023 861 811 533 56311 6217 4580 4347 3944 16001 35610 5076 1935
NM_153607chr582682 2631 2547 935 773 645 450 235 32283 995 987 --11967
NM_153619chr1563387 3337 2805 2449 1263 1019 33080 2777 1003 12505 12367
NM_170710chr473181 2812 2771 2735 2506 2058 1290 42801 2532 2459 710 1321 --
NM_173468chr4106009 5635 4961 4678 4437 3769 2218 2208 2114 927 21869 155 ----
NM_173531chr19103061 2654 1379 1192 1183 1117 326 255 177 93 22379 247 23553 1092 11083
NM_173582chr1154323 2240 2099 2090 1332 12313 11826 140
NM_173632chr1993363 3332 3189 2097 1043 1011 981 752 435 2600 177 1327 11340
NM_173642chr1128260 5909 3213 1340 1292 1243 957 530 396 377 226 82 15796 ----
NM_173829chr596045 5715 4833 4135 2420 2279 1555 1180 945 15082 26143 5234 --
NM_175607chr371692 1554 1176 1096 266 256 232 ------
NM_175612chr371692 1554 1176 1096 266 256 232 ------
NM_175624chr12147799 7765 7424 7247 2608 2040 2016 1993 1664 1348 1312 1085 874 764 24827 1600 ----
NM_175625chr12147799 7765 7424 7247 2608 2040 2016 1993 1664 1348 1312 1085 874 764 24827 1600 ----
NM_175910chr1992382 2372 2346 2097 1822 968 546 378 303 8960 799 715 631 463 295 211 127 ----
NM_175921chr563146 3034 2771 711 324 96 23692 1180 11470 --
NM_177966chr331419 1240 80 21455 66 11190 --
NM_178006chr1382320 2111 1788 1771 1528 385 354 346 1784 175 --
NM_178007chr1382320 2111 1788 1771 1528 385 354 346 1784 175 --
NM_178509chr1763460 3265 3246 1260 309 39 33709 1590 373 11239 13950
NM_181265chr473181 2812 2771 2735 2506 2058 1290 42801 2532 2459 710 1321 --
NM_181504chr5154002 3907 3893 3883 3869 3855 3833 3767 3350 3037 3031 2985 2820 1331 186 22790 1162 12639 12968
NM_181523chr5154002 3907 3893 3883 3869 3855 3833 3767 3350 3037 3031 2985 2820 1331 186 22790 1162 12639 12968
NM_181524chr5154002 3907 3893 3883 3869 3855 3833 3767 3350 3037 3031 2985 2820 1331 186 22790 1162 12639 12968
NM_181672chrX21366 434 ----21360 425
NM_181673chrX21366 434 ----21360 425
NM_181723chr841841 1668 739 608 11925 --1302
NM_181782chr672288 2113 757 739 721 465 285 ------
NM_182515chr1964335 2574 2551 700 590 267 44968 1696 1089 259 --11659
NM_182756chr24589 540 484 135 --1656 1445
NM_182762chr7116211 5921 5901 5776 4932 4569 4332 4263 1335 1087 809 14200 --11532
NM_183050chr672115 1912 1685 878 848 541 535 12200 ----
NM_194314chr1114897 4573 4189 3571 2187 2055 1834 1146 847 758 40 ------
NM_194434chr1865720 5308 4025 862 662 384 24457 2136 --24974 1168
NM_198270chrX62600 1403 1251 628 510 449 33299 708 656 ----
NM_198281chr463145 3126 2892 1151 1094 283 32933 585 578 ----
NM_198400chr1542640 2184 411 297 32299 2200 2174 --21879 700
NM_198569chr632621 2488 2042 21013 39 11026 11858
NM_198581chr256363 6353 367 343 290 44641 2730 2170 1591 26842 1434 1711
NM_198715chr1116274 5986 5572 5537 4630 4599 2452 2368 260 248 24 44196 1929 1700 643 22225 1850 15244
NM_199188chr1273617 3585 3507 1556 1539 706 480 ------
NM_199190chr1273617 3585 3507 1556 1539 706 480 ------
NM_203282chr1931633 1620 1256 3707 166 157 --1485
NM_206594chr173595 3127 2651 2439 2259 1384 1093 23034 610 23074 1353 --
NM_206595chr173595 3127 2651 2439 2259 1384 1093 23034 610 23074 1353 --
NM_206853chr673983 3593 3159 1635 1536 1239 449 23781 2763 --13339
NM_206854chr685244 4854 4420 3399 1710 1153 720 131 25042 4024 --14600
NM_206855chr696209 5819 5385 4364 4136 3861 2118 1685 1096 26007 4989 --15565
NM_206907chr593365 2500 2176 1359 1335 1327 1297 1159 1068 12312 12890 --
NM_206909chr8118386 7830 6305 6212 6088 5140 1913 913 801 546 532 26054 444 22807 2289 --
NM_213589chr2145400 4283 3977 3801 1835 1414 1165 1042 402 341 195 183 126 98 33485 2094 1015 ----