TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5007-5p
miRNA Sequence: UAGAGUCUGGCUGAUAUGGUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52919 871 ------
NM_000020chr12101994 1790 1549 1518 962 702 338 296 229 213 11632 ----
NM_000021chr143167 119 106 ------
NM_000038chr521731 115 ------
NM_000041chr191128 ------
NM_000052chrX33457 2901 455 2846 122 ----
NM_000067chr83556 276 139 1426 ----
NM_000081chr111378 --11312 --
NM_000084chrX96124 5948 5482 4926 1585 1015 781 659 513 11869 ----
NM_000088chr171127 --11317 --
NM_000089chr71668 ------
NM_000092chr264120 3068 2986 1140 100 57 --14498 --
NM_000093chr932074 1794 686 --1855 --
NM_000094chr32302 24 ------
NM_000109chrX32615 750 588 ------
NM_000115chr131368 22234 1780 21867 817 --
NM_000117chrX1286 ------
NM_000125chr664097 3985 3786 1532 1112 665 23047 399 ----
NM_000129chr661223 1042 971 378 371 322 1422 ----
NM_000134chr431623 1079 409 --11357 11717
NM_000143chr12222 55 ------
NM_000158chr31244 ------
NM_000161chr1431809 786 474 ------
NM_000163chr52728 561 1124 ----
NM_000165chr631224 1083 26 ------
NM_000167chrX1644 --199 --
NM_000168chr792855 2827 2722 2615 2168 745 653 162 65 ------
NM_000176chr523547 166 --21076 389 --
NM_000192chr121199 1333 ----
NM_000208chr1984428 4227 3326 3167 1476 1367 155 84 23256 94 24024 798 --
NM_000210chr23800 354 32 ------
NM_000214chr202368 264 1471 21627 521 --
NM_000216chrX73735 3711 3684 3074 2665 1449 111 1126 ----
NM_000217chr12135024 3849 3797 3698 3420 1612 1592 953 712 417 272 116 51 ------
NM_000222chr421564 1351 ------
NM_000232chr452391 2350 924 328 46 ------
NM_000233chr2--1648 1624 --
NM_000245chr742144 1817 728 610 1146 ----
NM_000248chr322697 172 --2934 657 1261
NM_000252chrX31172 408 53 ------
NM_000259chr1565842 5713 5130 1903 1523 761 --35188 1585 182 36157 4206 1953
NM_000266chrX7974 752 724 629 262 240 120 --1715 1146
NM_000267chr1742372 624 500 44 ------
NM_000276chrX31403 394 188 12214 32067 1782 343 --
NM_000278chr1092258 2082 1561 1538 804 738 730 511 355 1642 ----
NM_000282chr131225 ------
NM_000301chr61167 ------
NM_000314chr1023136 547 --12587 11114
NM_000332chr6126661 6118 5635 5200 4671 2567 2302 2104 1779 1750 1061 31 --25353 2528 --
NM_000340chr3----11058 21279 1176
NM_000346chr172375 292 ------
NM_000351chrX53878 3458 2926 251 119 --23719 1314 --
NM_000353chr162826 75 --1197 1397
NM_000362chr2273333 3071 2989 2675 840 737 498 --23403 2935 --
NM_000368chr994492 4063 3733 3577 3420 3414 1130 535 402 --43278 1601 991 515 --
NM_000378chr112986 70 1885 ----
NM_000390chrX43275 1199 690 257 --13437 12573
NM_000393chr2--11436 2563 93 --
NM_000408chr232405 2198 942 ----11047
NM_000411chr2152481 2060 819 709 527 --33047 2147 182 --
NM_000423chr12127 --142 --
NM_000430chr1732611 1442 1297 ------
NM_000441chr732235 1913 78 ------
NM_000447chr1----2185 96 --
NM_000449chr151388 1100 952 452 410 ------
NM_000454chr212238 117 ------
NM_000459chr91640 1180 ----
NM_000461chr373363 3110 2838 1163 801 467 312 ------
NM_000474chr7----189 --
NM_000484chr211947 --2880 290 --
NM_000489chrX43278 3188 2400 2155 1991 ----
NM_000492chr721484 1233 ------
NM_000495chrX2255 159 ------
NM_000509chr4--141 ----
NM_000522chr71868 ------
NM_000523chr22182 70 1155 ----
NM_000539chr33293 161 119 ----1644
NM_000554chr1963066 3032 2856 1188 218 179 ----11112
NM_000555chrX107817 7763 7172 6514 5740 5519 5428 5017 3143 996 12954 27332 4802 --
NM_000572chr1171 --1883 130
NM_000599chr274171 4161 3758 3204 3121 963 822 --13971 11810
NM_000610chr1152926 2676 2553 1967 713 --1785 --
NM_000615chr1162999 2369 2185 1092 749 661 12019 32394 2157 594 --
NM_000618chr12106081 5396 4852 4656 2610 2380 1737 1353 1225 585 --14526 --
NM_000618chr12106081 5396 4852 4656 2610 2380 1737 1353 1225 585 --14526 --
NM_000633chr1885050 4691 4203 3784 1922 1398 845 369 --23725 580 --
NM_000635chr1921076 310 ------
NM_000719chr1286468 6189 5777 5501 5294 4763 2254 358 14931 ----
NM_000720chr3126 --1123 --
NM_000726chr241439 1252 593 585 ------
NM_000739chr72710 163 1299 ----
NM_000783chr103424 214 28 175 ----
NM_000788chr431473 1150 497 ------
NM_000793chr1494789 4626 4478 4321 3968 3460 3256 2062 338 24251 406 24092 3774 --
NM_000794chr51913 --2691 96 1702
NM_000801chr203853 754 281 ------
NM_000806chr52737 201 11985 ----
NM_000808chrX2772 96 1411 --1329
NM_000809chr458458 3416 2373 1389 1072 11883 ----
NM_000811chr52213 80 ------
NM_000812chr41103 ------
NM_000813chr5114655 3443 2101 2088 1737 1649 997 655 567 321 35 --44598 4446 2076 526 --
NM_000814chr1553729 3162 1394 1256 28 ------
NM_000816chr51663 ------
NM_000826chr41734 --1259 --
NM_000827chr592520 2211 1801 967 874 739 555 485 35 --32259 2138 1019 --
NM_000829chr113857 317 300 --1705 --
NM_000831chr1115511 5359 5117 5055 3807 1590 960 885 864 681 516 11453 25952 166 13857
NM_000834chr1221096 799 --31153 947 489 11126
NM_000836chr191242 ------
NM_000838chr662245 1781 711 600 582 216 --22513 824 --
NM_000855chr112299 23 ------
NM_000859chr561587 1572 1447 1268 179 144 ------
NM_000864chr12891 88 --1340 --
NM_000866chr311881 ------
NM_000868chrX22615 2227 ------
NM_000870chr531467 1396 160 --21461 246 --
NM_000875chr1596959 6831 6161 5587 5326 4666 2320 1391 1017 15466 11522 14586
NM_000876chr631254 395 67 --11284 --
NM_000891chr1773548 3055 2964 2904 2309 2273 1017 --1368 --
NM_000899chr1223233 718 2243 147 ----
NM_000901chr432295 2201 491 ------
NM_000908chr5----139 --
NM_000919chr5151 ------
NM_000921chr121130 --152 --
NM_000926chr11158464 8407 7931 6758 6709 6703 6147 5823 2234 2193 1527 1225 1097 827 650 23268 1369 38648 7270 2698 28112 5930
NM_000933chr2061674 1640 1373 693 127 31 ----11616
NM_000944chr412292 ------
NM_000958chr511083 ----1367
NM_000965chr321210 351 --1329 --
NM_000966chr123975 358 296 1263 ----
NM_001001132chr212480 295 --11261 --
NM_001001323chr1232907 2161 87 ------
NM_001001331chr31988 --21733 433 --
NM_001001342chr1021423 1286 --21172 262 1432
NM_001001389chr1152926 2676 2553 1967 713 --1785 --
NM_001001390chr1152926 2676 2553 1967 713 --1785 --
NM_001001391chr1152926 2676 2553 1967 713 --1785 --
NM_001001392chr1152972 2722 2599 2013 759 --1831 --
NM_001001395chr1212794 ------
NM_001001396chr153731 3457 449 364 302 11529 32769 1366 1312 --
NM_001001419chr524504 1960 --44106 1621 1567 1207 --
NM_001001420chr524504 1960 --44106 1621 1567 1207 --
NM_001001433chr2063132 2693 2342 1067 836 144 --12118 1929
NM_001001481chr813195 1520 22670 1273 13226
NM_001001484chr1022480 2322 --1492 --
NM_001001549chr762367 2298 2203 2099 677 91 ----1775
NM_001001550chr762367 2298 2203 2099 677 91 ----1775
NM_001001555chr762367 2298 2203 2099 677 91 ----1775
NM_001001556chr1531034 175 58 ------
NM_001001560chr222523 155 ------
NM_001001664chr223998 37 164 ----
NM_001001702chr541725 1642 1605 278 ------
NM_001001715chr13----1399 --
NM_001001852chr223774 752 74 ------
NM_001001890chr2163602 3465 1546 1083 663 310 ----13669
NM_001001924chr821572 201 --31445 181 25 --
NM_001001925chr821572 201 --31445 181 25 --
NM_001001931chr821572 201 --31445 181 25 --
NM_001001933chr1122 ------
NM_001001936chr102822 784 --3338 157 25 --
NM_001001995chrX31442 665 519 ------
NM_001002255chr61275 ------
NM_001002257chr2103184 3075 3023 2902 2856 2819 2604 644 452 322 --32989 2292 664 --
NM_001002265chr102774 766 ------
NM_001002266chr102774 766 ------
NM_001002295chr10--1318 ----
NM_001002755chr2138 ------
NM_001002756chr2138 ------
NM_001002757chr2138 ------
NM_001002814chr863867 3428 2960 545 296 98 --32529 1322 1287 --
NM_001002838chrX31246 690 437 ----11690
NM_001002843chr1521213 967 ------
NM_001002860chr1444405 3870 3749 3727 14680 --1786
NM_001003407chr1064735 3897 3176 2011 1465 1093 23499 941 11451 --
NM_001003408chr1064735 3897 3176 2011 1465 1093 23499 941 11451 --
NM_001003652chr1877802 7496 7399 2656 2206 237 32 --35707 5508 2339 --
NM_001003674chr18136521 6441 6181 5774 2761 2736 2714 2659 2549 2380 2292 1882 1195 26261 1417 35574 827 342 16198
NM_001003675chr18136521 6441 6181 5774 2761 2736 2714 2659 2549 2380 2292 1882 1195 26261 1417 35574 827 342 16198
NM_001003681chr222250 74 --11447 --
NM_001003682chr151361 1014 971 408 236 --21000 474 --
NM_001003683chr22208 56 ------
NM_001003688chr41265 --2336 253 --
NM_001003694chr32641 585 ------
NM_001003712chr1242986 1167 918 142 --13385 --
NM_001003792chr31765 ------
NM_001003793chr31765 ------
NM_001003800chr963384 2906 1433 1364 1121 386 --12367 --
NM_001003945chr911380 ------
NM_001004023chr11217 ------
NM_001004065chr933607 2855 219 --33285 3104 187 --
NM_001004317chr61687 23794 1454 13614 --
NM_001004329chr1221017 172 2449 59 ----
NM_001004346chr421236 1178 ------
NM_001004419chr1264432 4124 4017 3737 1186 593 --14272 --
NM_001005217chr4----171 --
NM_001005266chr154714 596 241 205 ------
NM_001005267chr154714 596 241 205 ------
NM_001005268chr154714 596 241 205 ------
NM_001005269chr154714 596 241 205 ------
NM_001005353chr111232 2807 426 ----
NM_001005353chr111232 2807 426 ----
NM_001005375chrY21570 406 --1223 21415 648
NM_001005386chr252206 1935 1878 809 231 ------
NM_001005404chr1733500 1219 714 1616 43389 2829 1637 1189 --
NM_001005463chr101426 12177 2901 137 --
NM_001005473chr536074 1770 1331 --12431 --
NM_001005474chr31296 ------
NM_001005476chr21184 --1227 --
NM_001005526chr2------187
NM_001005609chrX103628 3565 3297 3157 1336 1054 736 275 173 57 --33102 2468 374 --
NM_001005743chr1411145 --178 --
NM_001005744chr1411145 --178 --
NM_001005745chr1411145 --178 --
NM_001005746chr241439 1252 593 585 ------
NM_001005747chr241439 1252 593 585 ------
NM_001005781chr21457 ------
NM_001005782chr23906 380 325 ------
NM_001005861chr32847 165 ------
NM_001006600chr522430 1676 --11619 --
NM_001006605chr1--1259 1805 --
NM_001006605chr1--1259 1805 --
NM_001006623chr251849 1822 686 461 86 11992 21908 70 --
NM_001006626chr72710 163 1299 ----
NM_001006627chr72710 163 1299 ----
NM_001006628chr72710 163 1299 ----
NM_001006629chr72710 163 1299 ----
NM_001006630chr72710 163 1299 ----
NM_001006631chr72710 163 1299 ----
NM_001006632chr72710 163 1299 ----
NM_001006944chr11--1703 ----
NM_001007023chr1494789 4626 4478 4321 3968 3460 3256 2062 338 24251 406 24092 3774 --
NM_001007024chr1783774 3283 3192 2699 546 349 139 21 --24096 1475 --
NM_001007025chr1783774 3283 3192 2699 546 349 139 21 --24096 1475 --
NM_001007027chr111225 ------
NM_001007094chr1044505 3534 1585 825 ------
NM_001007097chr994848 4414 4142 3965 3863 3396 1947 526 72 ----11036
NM_001007102chr61595 ------
NM_001007156chr1561928 1847 1542 1254 552 429 --1745 --
NM_001007189chr5162 ------
NM_001007226chr1721243 22 --1142 --
NM_001007227chr1721243 22 --1142 --
NM_001007228chr1721243 22 --1142 --
NM_001007229chr1721243 22 --1142 --
NM_001007230chr1721243 22 --1142 --
NM_001007237chr132021 543 120 --2469 47 --
NM_001007255chr11322 1197 ----
NM_001007466chr623444 24 14094 1671 --
NM_001007527chr5--1258 ----
NM_001007538chr1331399 408 57 ------
NM_001007565chr32266 57 ------
NM_001008222chrX1934 --3997 498 21 --
NM_001008239chr1841409 1303 393 275 ------
NM_001008393chr441991 1835 885 664 12674 22464 356 1733
NM_001008408chr7126100 5853 5573 5486 5409 2388 2010 1884 1414 1371 868 339 34257 1536 314 42266 2105 598 485 --
NM_001008528chr1761249 1146 492 387 258 79 ------
NM_001008539chr855323 4829 4794 4049 2029 24396 2108 44043 1548 987 559 --
NM_001008541chr1021469 592 ------
NM_001008541chr1021469 592 ------
NM_001008564chr1322286 219 ------
NM_001008660chr111393 --21554 975 11289
NM_001008701chr1953036 2761 2510 2251 62 21949 158 1314 --
NM_001008707chr14150 ----21183 604
NM_001008738chr541906 752 188 99 --182 --
NM_001008801chr1942126 1791 501 146 11691 ----
NM_001008895chr1351429 406 162 155 83 ------
NM_001008925chr442168 1311 573 356 12420 1860 --
NM_001009555chr421264 291 1218 11685 --
NM_001009814chr13126 ------
NM_001009880chr2264202 3564 1483 1274 977 743 --44675 3720 1312 450 --
NM_001009881chr11540 ----1408
NM_001009882chr11540 ----1408
NM_001009909chr1153171 2483 1501 1087 152 --22841 1297 --
NM_001009960chr732350 1946 448 ------
NM_001009993chr263463 1654 1637 496 178 94 --13794 --
NM_001010861chr152268 2085 2054 886 447 12075 22654 2614 --
NM_001010862chrX62996 2908 2640 2115 1013 994 22100 335 --3859 812 37
NM_001010888chrX54246 3958 3737 3198 1793 1517 --11055
NM_001010891chr576248 5632 5546 5320 5185 1595 1319 --12144 45983 1973 1672 109
NM_001010895chr941974 1749 1408 705 ------
NM_001010922chr153903 3542 3043 1180 1122 --11116 24002 2716
NM_001010924chr1041196 341 257 194 ------
NM_001010986chrX31007 676 124 ------
NM_001010989chr162476 462 ------
NM_001010990chr162476 462 ------
NM_001011513chr453978 3170 1413 1406 77 13514 1797 --
NM_001011537chr32514 35 --1359 --
NM_001011658chrX1355 ------
NM_001011666chr745085 2375 634 98 11081 25138 4793 15856
NM_001011708chr222866 2143 --1914 --
NM_001011885chr1521321 55 1699 1523 --
NM_001012393chr1175066 4993 4559 3930 3198 1833 1139 13620 --154
NM_001012421chr92637 135 ------
NM_001012446chr9----1295 --
NM_001012643chr192368 150 --1391 --
NM_001012751chr1051899 1726 1419 1205 535 1770 3423 409 28 --
NM_001012755chrX54781 4736 4628 1287 418 ------
NM_001012761chr542545 1838 828 556 --1780 --
NM_001012968chrX1526 11083 ----
NM_001012980chrX1226 ------
NM_001012989chrX2581 50 ------
NM_001013031chr1053217 2878 2374 1409 105 1342 32561 1255 884 --
NM_001013399chr611018 1166 ----
NM_001013406chr721177 357 11520 ----
NM_001013415chr421482 440 --2359 271 --
NM_001013635chr1281137 981 802 755 262 233 167 134 ------
NM_001013674chr12319 235 ------
NM_001013699chr12167 ------
NM_001013839chr1742585 2493 1051 553 --12467 --
NM_001013843chr151679 1350 1111 --
NM_001014283chr1321961 1875 --21818 1449 --
NM_001014434chr11636 --188 --
NM_001014797chr10127616 7164 7001 5643 5318 3280 2956 2203 1045 962 482 194 17370 12899 --
NM_001014809chr43924 323 36 ------
NM_001014812chr151488 ------
NM_001015045chr422569 2341 1422 1780 --
NM_001015072chr7----126 --
NM_001015877chrX63128 2598 2154 1954 588 496 ------
NM_001015887chr33511 224 194 --1668 --
NM_001017368chr1782767 2593 2162 1949 1772 1091 711 687 ------
NM_001017395chr332478 2335 1431 13399 13637 --
NM_001017405chr42827 374 ------
NM_001017415chr11599 ------
NM_001017416chr11599 ------
NM_001017424chr131457 1281 549 --11828 --
NM_001017425chr131457 1281 549 --11828 --
NM_001017440chr7147777 7689 7672 7522 6976 6512 6420 6001 5778 2924 2735 2235 1647 1346 --67375 6334 5060 1183 423 66 --
NM_001017920chr2--1138 ----
NM_001017926chr8----1303 --
NM_001017928chr31220 ------
NM_001017970chr1432033 564 305 ----11704
NM_001018064chr93837 298 131 11528 ----
NM_001018065chr965683 5602 1289 978 789 24 ------
NM_001018066chr965683 5602 1289 978 789 24 ------
NM_001018067chr144972 4897 3997 3515 --25275 1835 --
NM_001018068chr144972 4897 3997 3515 --25275 1835 --
NM_001018069chr144972 4897 3997 3515 --25275 1835 --
NM_001018074chr523547 166 --21076 389 --
NM_001018075chr523547 166 --21076 389 --
NM_001018076chr523547 166 --21076 389 --
NM_001018077chr523547 166 --21076 389 --
NM_001018090chr151163 --154 --
NM_001018091chr151273 --1164 --
NM_001018100chr151572 --2317 131 --
NM_001018102chr151163 --154 --
NM_001018108chr153487 386 365 --32120 1850 1459 --
NM_001020818chr1951749 1345 558 386 307 ------
NM_001020819chr1951749 1345 558 386 307 ------
NM_001020820chr1951749 1345 558 386 307 ------
NM_001020821chr1951749 1345 558 386 307 ------
NM_001023567chr1521903 346 --12279 --
NM_001024094chr523547 166 --21076 389 --
NM_001024372chr821965 1807 ----11758
NM_001024401chr1642446 2395 1953 383 ------
NM_001024460chr66980 291 199 145 67 40 ------
NM_001024593chr103846 802 371 --1663 1904
NM_001024647chr1236661 6020 5848 --1104 15671
NM_001024649chr552648 2589 2426 1136 127 ------
NM_001024666chrX148 1503 ----
NM_001024688chr832121 642 155 ------
NM_001024847chr342307 2161 697 538 ------
NM_001024855chr33418 271 67 11510 ----
NM_001024858chr1472682 2595 2298 1064 837 652 568 12184 1882 --
NM_001024934chr61279 ------
NM_001024935chr61279 ------
NM_001024936chr61279 ------
NM_001024948chr122651 1376 1360 13211 --
NM_001025068chr311122 1337 21441 91 --
NM_001025069chr311122 1337 21441 91 --
NM_001025076chr10116254 6108 5737 5116 4884 3827 2136 1857 1765 1473 362 --15020 --
NM_001025077chr10117612 7466 7095 6474 6242 5185 2831 1720 1292 1223 1124 --26378 1367 --
NM_001025105chr541281 621 549 156 --1575 --
NM_001025108chr254050 3412 2749 1077 30 1657 23593 3191 14063
NM_001025233chr1242633 1770 719 455 --12085 1727
NM_001025266chr364833 3576 1684 1650 1534 606 13681 1384 --
NM_001025356chr124939 783 495 311 ------
NM_001025366chr631620 758 203 --2558 169 --
NM_001025366chr631620 758 203 --2558 169 --
NM_001025367chr631620 758 203 --2558 169 --
NM_001025367chr631620 758 203 --2558 169 --
NM_001025368chr631620 758 203 --2558 169 --
NM_001025368chr631620 758 203 --2558 169 --
NM_001025369chr621636 219 --2574 185 --
NM_001025369chr621636 219 --2574 185 --
NM_001025370chr631620 758 203 --2558 169 --
NM_001025370chr631620 758 203 --2558 169 --
NM_001025595chr42432 113 --21145 600 --
NM_001025603chr151388 1100 952 452 410 ------
NM_001025616chr461790 1309 679 53 43 32 --1535 --
NM_001025777chr261609 1070 1029 237 142 128 --11499 --
NM_001025780chr931556 1017 142 ------
NM_001029858chr61717 13226 12562 22861 182
NM_001029859chr1132123 837 766 22374 2327 ----
NM_001029863chr643054 2641 2490 238 ----1364
NM_001029875chr521883 201 --21843 1024 --
NM_001029997chr19--1545 134 1142
NM_001030007chr1673579 3563 3338 2976 1446 1345 571 --33046 989 757 --
NM_001030055chr1444714 3348 1429 1422 --24736 1074 --
NM_001031679chr1233149 2267 1031 12877 ----
NM_001031684chr21412 ------
NM_001031692chr7----1274 --
NM_001031695chr2294902 4604 4456 4419 4125 3849 3669 1976 895 --14014 --
NM_001031709chr101284 ------
NM_001031710chr73852 718 22 ----2348 35
NM_001031712chr61305 ------
NM_001031716chr21925 11009 ----
NM_001031732chr453607 3150 1129 1093 267 12620 ----
NM_001031746chr1021282 250 ------
NM_001031804chr1683543 3397 3333 3178 3153 1104 1061 698 ----1946
NM_001032290chr14445 194 60 26 --196 --
NM_001032291chr14445 194 60 26 --196 --
NM_001032293chr171541 1102 ----
NM_001032380chr102441 211 ------
NM_001032393chrX1125 ------
NM_001033045chr264353 4003 3996 3517 3328 290 11125 --1622
NM_001033047chr432289 974 514 ----1704
NM_001033059chr631779 1712 1642 --11440 --
NM_001033081chr171481 1430 1268 733 691 516 463 1769 1667 --
NM_001033082chr171481 1430 1268 733 691 516 463 1769 1667 --
NM_001033085chr21298 172 ----
NM_001033117chr354649 4373 4024 662 577 13527 13644 --
NM_001033503chr5----190 --
NM_001033507chr161719 1485 803 587 300 30 --1259 --
NM_001033518chr772765 2603 1927 718 609 487 58 --22207 1135 1115
NM_001033519chr772765 2603 1927 718 609 487 58 --22207 1135 1115
NM_001033520chr772765 2603 1927 718 609 487 58 --22207 1135 1115
NM_001033561chr17146 ----1886
NM_001033578chr822125 1935 ----12185
NM_001033602chr1332735 1890 853 ------
NM_001033723chr862558 2236 1725 959 680 285 ------
NM_001033756chr631554 692 137 --2492 103 --
NM_001033756chr631554 692 137 --2492 103 --
NM_001033925chr101307 --12041 --
NM_001034025chr123906 282 77 ------
NM_001034837chr5----1148 --
NM_001034838chr5----1148 --
NM_001034845chr41261 --1959 --
NM_001034850chr51622 --11457 --
NM_001035chr121236 299 ------
NM_001035235chr51437 --1457 --
NM_001035511chr122200 658 ------
NM_001035512chr122307 765 ------
NM_001035513chr122307 765 ------
NM_001037164chr721643 1490 ------
NM_001037317chr152268 2085 2054 886 447 12075 22654 2614 --
NM_001037334chr1821521 338 1569 ----
NM_001037339chr141485 1458 510 245 --11865 --
NM_001037340chr141485 1458 510 245 --11865 --
NM_001037341chr141485 1458 510 245 --11865 --
NM_001037341chr141485 1458 510 245 --11865 --
NM_001037533chr13755 719 168 ----1209
NM_001038633chr131029 1006 906 1507 11189 --
NM_001038707chr142324 2142 1592 160 ------
NM_001038707chr142324 2142 1592 160 ------
NM_001039350chr72345 32 11342 1714 --
NM_001039372chr71590 --1421 --
NM_001039459chr71193 ------
NM_001039538chr253282 1465 679 513 64 --13407 --
NM_001039570chr2264474 3693 3681 2980 514 224 --41624 1033 689 90 --
NM_001039571chr2264474 3693 3681 2980 514 224 --41624 1033 689 90 --
NM_001039577chr1134373 4306 3979 3628 3168 2803 1812 1775 1350 1242 873 827 673 21189 95 22796 76 --
NM_001039590chrX43927 3921 3678 302 --13350 --
NM_001039591chrX43927 3921 3678 302 --13350 --
NM_001039618chr11105357 5085 4666 4640 4591 3874 891 521 447 244 14008 ----
NM_001039693chr233943 2790 983 2487 135 ----
NM_001039711chr11438 ----11086
NM_001039712chr11438 ----11086
NM_001039762chr1032264 2248 656 11604 ----
NM_001039802chr11332 --31231 1218 1188 --
NM_001039840chrX115629 5570 5480 5177 4573 4538 4230 3876 1496 986 554 ------
NM_001039937chr1363159 2969 2854 1082 768 271 --23255 2751 --
NM_001040057chr711103 1370 ----
NM_001040100chr31320 1226 ----
NM_001040101chr43621 587 53 11555 ----
NM_001040107chr121139 ------
NM_001040110chr761835 1408 1251 625 607 96 11737 21568 1529 --
NM_001040118chr111560 125 ----
NM_001040152chr774035 3129 1865 1602 422 134 87 ------
NM_001040153chr13------11000
NM_001040157chr42789 32 --2563 403 --
NM_001040172chr531467 1396 160 --21461 246 --
NM_001040173chr531467 1396 160 --21461 246 --
NM_001040181chr321179 252 --1327 --
NM_001040182chr321179 252 --1327 --
NM_001040183chr321179 252 --1327 --
NM_001040199chr321179 252 --1327 --
NM_001040200chr321179 252 --1327 --
NM_001040202chr4180 ------
NM_001040214chr621936 1721 ------
NM_001040272chr92746 46 11853 --21685 625
NM_001040284chr1675628 4172 2009 1553 919 428 69 --21585 1047 13966
NM_001040409chr22939 706 --1989 --
NM_001040429chr1342381 1040 993 867 12835 12732 --
NM_001040446chr52467 150 1170 ----
NM_001040450chr1522917 709 --22496 159 --
NM_001040453chr1522917 709 --22496 159 --
NM_001040610chr15122 ------
NM_001040624chr862403 2127 2077 304 221 53 22578 351 11838 --
NM_001040625chr862403 2127 2077 304 221 53 22578 351 11838 --
NM_001040626chr862403 2127 2077 304 221 53 22578 351 11838 --
NM_001040627chr862403 2127 2077 304 221 53 22578 351 11838 --
NM_001040628chr862403 2127 2077 304 221 53 22578 351 11838 --
NM_001040629chr862403 2127 2077 304 221 53 22578 351 11838 --
NM_001040630chr862403 2127 2077 304 221 53 22578 351 11838 --
NM_001040633chr71180 ------
NM_001040665chr734162 1838 921 14332 24042 1802 11141
NM_001040709chr172272 2098 2084 1942 1608 853 651 --12144 12405
NM_001040712chr91408 13043 12286 --
NM_001042355chr1665154 5017 4490 4028 1203 641 11257 33350 1852 1527 14101
NM_001042361chr1061435 1135 1054 408 40 24 ------
NM_001042364chr1061435 1135 1054 408 40 24 ------
NM_001042365chr1061435 1135 1054 408 40 24 ------
NM_001042383chr352928 2692 2629 1234 1094 --33304 2939 236 --
NM_001042387chr1061435 1135 1054 408 40 24 ------
NM_001042388chr181329 1211 ----
NM_001042393chr1061435 1135 1054 408 40 24 ------
NM_001042396chr1061435 1135 1054 408 40 24 ------
NM_001042397chr1061435 1135 1054 408 40 24 ------
NM_001042403chr12------1381
NM_001042404chr1------11449
NM_001042412chr1665154 5017 4490 4028 1203 641 11257 33350 1852 1527 14101
NM_001042413chr943188 2560 1556 630 1354 13515 --
NM_001042414chr131108 1229 ----
NM_001042476chr1631983 1953 391 --22104 44 --
NM_001042479chrX31974 1347 94 1395 ----
NM_001042480chrX31974 1347 94 1395 ----
NM_001042492chr1742372 624 500 44 ------
NM_001042494chr1533462 2610 1212 13302 ----
NM_001042495chr1533462 2610 1212 13302 ----
NM_001042496chr1533462 2610 1212 13302 ----
NM_001042497chr1533462 2610 1212 13302 ----
NM_001042510chr832011 193 37 1634 11956 --
NM_001042511chr832011 193 37 1634 11956 --
NM_001042537chrX21657 607 --32299 2022 1920 1666
NM_001042543chr421319 1113 1221 21313 186 1574
NM_001042550chr9--2677 286 ----
NM_001042555chr1234608 706 415 ------
NM_001042599chr277718 7399 6246 3121 2825 2524 2440 15328 --15661
NM_001042601chr312329 1788 12947 --
NM_001042603chr1255386 4176 1495 695 158 --14912 --
NM_001042604chr384888 4735 2967 1595 1379 1327 1071 505 23810 1027 24648 3190 --
NM_001042669chr461790 1309 679 53 43 32 --1535 --
NM_001042681chr132060 2026 62 --22279 791 --
NM_001042682chr132060 2026 62 --22279 791 --
NM_001042682chr132060 2026 62 --22279 791 --
NM_001042683chr621656 1395 129 1205 --
NM_001042728chr123975 358 296 1263 ----
NM_001042749chrX11581 ------
NM_001042750chrX11581 ------
NM_001042751chrX11581 ------
NM_001043351chr13484 395 48 --22335 1498 --
NM_001044305chr611634 --21677 1565 --
NM_001044385chr243952 3035 1202 713 ------
NM_001046chr55867 738 216 174 105 ------
NM_001068chr3----172 --
NM_001071775chr1351742 1687 1522 1273 510 ------
NM_001078chr13656 553 101 ------
NM_001079874chr141736 1709 1540 1523 1781 ----
NM_001083620chr421753 733 --1258 --
NM_001083621chr163534 3166 3060 3041 1707 941 ------
NM_001087chr21119 ------
NM_001092chr1772102 1938 1572 877 628 112 68 12428 ----
NM_001096chr172780 241 --1815 --
NM_001100108chr1117890 6571 5680 5396 3328 3117 2480 2005 1677 374 96 12419 ----
NM_001106chr3159149 8924 7999 6840 6419 6408 6124 3875 3869 3412 2756 2697 685 130 29 --48357 7415 3262 1192 --
NM_001113490chrX83358 2697 2393 2311 925 836 643 126 --12300 --
NM_001116chr1622248 331 --12769 --
NM_001117chr1832478 649 600 12226 1682 --
NM_001121chr1031506 531 164 1122 ----
NM_001122679chr52919 871 ------
NM_001126chr1----152 --
NM_001128chr1673579 3563 3338 2976 1446 1345 571 --33046 989 757 --
NM_001167chrX66282 4753 2672 2425 1956 502 171 32525 1664 1351 26352 2310
NM_001172chr141796 ------
NM_001173chr1444714 3348 1429 1422 --24736 1074 --
NM_001174chrX2514 86 ----11502
NM_001198chr632215 884 430 11876 11649 --
NM_001200chr20------1121
NM_001202chr14--1193 ----
NM_001204chr256453 5983 5096 1548 129 47466 5393 1165 727 26930 2530 --
NM_001206chr953111 1104 647 448 389 ------
NM_001218chr1542397 2024 1908 65 12521 21940 1082 --
NM_001222chr1061609 1577 1483 1225 63 28 ------
NM_001227chr102527 268 --1180 --
NM_001248chr32957 806 --1268 --
NM_001256chr1752389 1049 972 578 201 --21814 883 --
NM_001259chr745811 4960 1268 516 11682 34891 457 136 --
NM_001262chr12228 65 --1306 --
NM_001270chr531100 443 31 ------
NM_001271chr1533256 3116 2313 22373 2025 ----
NM_001280chr19----1187 --
NM_001290chr42917 406 ------
NM_001293chr11----127 --
NM_001304chr1722722 853 13739 22360 88 --
NM_001313chr43924 323 36 ------
NM_001319chr19----1198 --
NM_001329chr1021310 106 11482 ----
NM_001331chr1142803 661 463 427 --22343 821 --
NM_001351chr31551 --1135 --
NM_001356chrX31845 211 118 --22145 877 11698
NM_001364chr1194032 3921 3642 3216 3049 2962 1707 1415 914 --44363 3674 1610 1356 13091
NM_001379chr19------1268
NM_001396chr212850 696 --22653 973 --
NM_001399chrX103628 3565 3297 3157 1336 1054 736 275 173 57 --33102 2468 374 --
NM_001400chr111321 ------
NM_001401chr951552 1458 1300 636 163 --2302 268 --
NM_001407chr341132 395 152 66 --1213 11101
NM_001408chr181482 1433 1380 1368 1065 643 443 31 ------
NM_001412chrX53664 3040 2876 2709 718 --12995 --
NM_001417chr1211897 ------
NM_001419chr1944500 3683 880 534 --24110 3987 --
NM_001420chr1942689 2576 2406 647 --13138 --
NM_001423chr122257 160 --22072 1461 --
NM_001426chr23656 542 194 ------
NM_001429chr221710 --155 --
NM_001431chr62825 456 ------
NM_001438chr143599 2334 1258 157 22633 2495 ----
NM_001440chr862555 2075 2028 892 489 261 --12291 12815
NM_001448chrX2150 79 ------
NM_001449chrX21076 261 ------
NM_001453chr6----11592 --
NM_001460chr142788 2649 989 88 ------
NM_001463chr2146 --1208 --
NM_001482chr151386 ----1872
NM_001491chr611786 --22409 73 --
NM_001497chr942621 2500 2082 1728 ------
NM_001514chr1------1366
NM_001542chr132021 543 120 --2469 47 --
NM_001546chr611012 1348 ----
NM_001560chrX22444 1777 --31619 786 46 --
NM_001570chr341172 915 536 341 --1589 --
NM_001587chrX31403 394 188 12214 32067 1782 343 --
NM_001609chr1094285 3200 3016 2925 2799 1579 1175 744 370 13346 ----
NM_001614chr171614 ------
NM_001614chr171614 ------
NM_001616chr242781 1142 162 37 ------
NM_001621chr732865 2241 393 11130 1310 --
NM_001621chr732865 2241 393 11130 1310 --
NM_001622chr31303 ------
NM_001634chr631779 1712 1642 --11440 --
NM_001650chr1862945 1651 1617 724 709 32 ----13070
NM_001659chr1242569 2228 2198 717 ------
NM_001663chr1421902 965 --1893 --
NM_001668chr111686 --1475 --
NM_001679chr31725 ------
NM_001681chr12--1692 1278 --
NM_001683chr31988 --21733 433 --
NM_001699chr1961813 1533 1339 1323 1211 294 --21370 1231 51559 1290 1270 1248 266
NM_001701chr921320 240 ----11114
NM_001706chr31406 1320 ----
NM_001709chr1122470 1784 ----12241
NM_001717chr15--1126 1400 --
NM_001718chr621259 977 --31294 1176 104 --
NM_001730chr131601 ------
NM_001730chr131601 ------
NM_001744chr5199 ------
NM_001746chr552648 2589 2426 1136 127 ------
NM_001753chr731557 1441 1426 ------
NM_001754chr2163602 3465 1546 1083 663 310 ----13669
NM_001759chr1274972 4534 4486 4423 4159 4090 1141 14542 33860 1592 348 --
NM_001769chr12------1308
NM_001781chr121850 --1101 --
NM_001789chr331618 1341 489 11352 11656 --
NM_001791chr11332 --31231 1218 1188 --
NM_001802chr161249 --179 --
NM_001819chr201298 ------
NM_001829chr41749 ----1881
NM_001830chrX13912 11079 12821 --
NM_001845chr1321166 502 ------
NM_001854chr121321 230 31043 540 459 ----
NM_001859chr944018 2732 222 55 --12824 13206
NM_001892chr541281 621 549 156 --1575 --
NM_001894chr2231224 886 199 ------
NM_001901chr62209 129 1941 ----
NM_001903chr51101 ----1792
NM_001918chr149228 6967 6519 657 --79016 8704 5949 3456 3309 2626 159 13269
NM_001924chr11169 ------
NM_001931chr11----11291 --
NM_001932chr175822 675 629 273 57 ------
NM_001936chr72345 32 11342 1714 --
NM_001938chr111883 ------
NM_001951chr83179 115 56 ------
NM_001955chr63790 316 59 11099 ----
NM_001969chr1433459 1175 321 12612 ----
NM_001977chr41682 ------
NM_001980chr1272141 2121 1852 1535 1399 244 36 --12153 --
NM_001981chr152074 1517 606 167 115 ------
NM_001987chr1283767 3648 3039 1498 1375 672 354 228 14143 12722 --
NM_001995chr42350 282 ------
NM_002006chr455114 3850 1220 1204 926 24800 3839 35247 4690 2185 --
NM_002010chr131451 --1495 --
NM_002015chr1333171 2498 160 ------
NM_002024chrX1383 ------
NM_002025chrX178494 7840 6958 6393 3427 3200 2467 2362 2299 2068 1749 1696 853 625 482 348 244 28028 6598 58511 7411 2209 2021 1484 --
NM_002032chr111359 ------
NM_002035chr1884043 2759 1202 1066 1010 747 606 394 --23900 3406 --
NM_002039chr41155 --1664 --
NM_002040chr2133035 1179 22 ----1931
NM_002044chr1531034 175 58 ------
NM_002048chr93477 346 172 ------
NM_002051chr10--1318 ----
NM_002052chr831264 1187 262 --21385 1085 --
NM_002063chrX--1871 ----
NM_002069chr71716 2301 235 11673 --
NM_002072chr93981 301 119 ------
NM_002092chr474888 4686 4268 3836 3678 3101 1343 --13751 --
NM_002107chr11407 ------
NM_002114chr61537 ------
NM_002126chr1753097 2867 1227 1072 385 ----12646
NM_002128chr13--1832 12279 --
NM_002129chr4----1140 --
NM_002130chr541127 610 246 24 ------
NM_002134chr16195 ------
NM_002135chr122508 395 --1462 --
NM_002137chr7----1535 --
NM_002139chrX2236 193 ------
NM_002140chr91972 ------
NM_002145chr172264 92 ------
NM_002148chr21159 ------
NM_002163chr162322 285 1459 ----
NM_002167chr11436 ------
NM_002187chr511024 ------
NM_002193chr231872 1389 1379 --11830 --
NM_002196chr20----1696 --
NM_002196chr20----1696 --
NM_002202chr51916 ------
NM_002210chr221356 744 ----22663 485
NM_002214chr734680 3510 182 ------
NM_002221chr162796 2716 2621 2353 1184 1085 --12864 11841
NM_002223chr1233884 2772 1558 --33938 1294 668 --
NM_002227chr1------11333
NM_002228chr12282 61 ----1892
NM_002232chr121344 253 ----11077
NM_002233chr111462 ------
NM_002235chr122690 105 --11434 --
NM_002241chr172845 2623 2122 1929 1066 1051 728 --22137 432 12786
NM_002247chr1041818 916 370 230 ------
NM_002264chr394954 4420 4281 3148 2021 1584 709 339 177 24946 1093 ----
NM_002270chr514808 --13644 --
NM_002271chr1332253 2027 810 ------
NM_002285chr254050 3412 2749 1077 30 1657 23593 3191 14063
NM_002298chr1331459 500 115 ------
NM_002312chr132845 43 ------
NM_002313chr1064735 3897 3176 2011 1465 1093 23499 941 11451 --
NM_002317chr52359 270 ------
NM_002334chr1142039 1986 1803 1286 12081 ----
NM_002336chr1254880 4049 3698 3676 3097 34391 4289 1626 34464 4123 3559 13158
NM_002349chr22620 208 --21594 1234 --
NM_002351chrX1163 --1464 --
NM_002372chr51122 --1203 --
NM_002374chr253282 1465 679 513 64 --13407 --
NM_002375chr342287 1569 1502 284 --11412 1476
NM_002376chr141568 ------
NM_002380chr8--1398 ----
NM_002382chr141910 --2426 99 --
NM_002397chr521823 835 ------
NM_002398chr2--11142 ----
NM_002399chr152966 554 11124 1378 --
NM_002408chr141533 ------
NM_002430chr2252448 2320 2110 1998 1980 --11640 --
NM_002431chr142291 61 ------
NM_002444chrX32036 1298 633 1626 ----
NM_002451chr953797 1196 439 361 164 ------
NM_002467chr81157 ------
NM_002470chr17188 ------
NM_002480chr1211237 ----1974
NM_002482chr1173 ------
NM_002485chr832121 642 155 ------
NM_002487chr15----1560 --
NM_002489chr7--1292 ----
NM_002499chr1541992 1919 754 688 ------
NM_002500chr21472 ------
NM_002501chr1974116 3281 1211 1139 606 561 305 --1548 --
NM_002505chr621286 1026 1604 ----
NM_002507chr1721473 391 1428 ----
NM_002509chr202188 131 ------
NM_002519chr1131115 366 178 ------
NM_002522chr1773146 3066 1544 1464 1110 585 222 ------
NM_002538chr5174 ------
NM_002545chr1175066 4993 4559 3930 3198 1833 1139 13620 --154
NM_002547chrX63583 2966 2959 1270 983 262 --2278 137 --
NM_002556chr1172032 1901 1820 1313 455 292 79 ------
NM_002563chr31831 --11109 --
NM_002572chr111245 --1335 --
NM_002577chr384034 2475 1220 872 774 757 306 179 23205 825 --11444
NM_002581chr954734 4659 2068 530 154 --11195 --
NM_002590chr132484 229 ------
NM_002594chr2022482 2002 1234 ----
NM_002597chr11332 ------
NM_002600chr141485 1458 510 245 --11865 --
NM_002634chr172715 56 1869 ----
NM_002643chr2----136 --
NM_002645chr1142917 2140 1196 825 --2982 288 --
NM_002646chr181762 1495 783 494 465 131 75 60 ------
NM_002649chr731566 1424 1154 --1676 --
NM_002655chr843695 1086 993 563 1354 2663 244 --
NM_002657chr2043391 1316 824 35 ----1164
NM_002668chrX----1140 --
NM_002670chr3162 ------
NM_002687chr1421186 1075 1856 ----
NM_002709chr243152 2357 1390 781 11420 ----
NM_002710chr1211065 --1179 --
NM_002716chr1173458 3302 3214 3088 1413 865 374 --136 --
NM_002718chr372684 2619 2382 2028 1784 500 178 --195 --
NM_002719chr1442412 2138 504 51 --31916 1856 843 1422
NM_002734chr1711508 --1222 --
NM_002736chr731719 594 228 ------
NM_002737chr1795906 5857 5510 5243 5214 4782 2364 1989 1835 31564 1032 257 46193 5816 5362 1525 --
NM_002745chr2232828 1678 803 1400 1384 --
NM_002748chr1511001 --1148 --
NM_002750chr10173 ------
NM_002755chr152629 365 ----1144
NM_002758chr172446 422 ------
NM_002775chr103514 129 66 --297 42 --
NM_002787chr71269 --2654 83 --
NM_002796chr1----175 --
NM_002803chr7157 ------
NM_002808chr3----1151 --
NM_002815chr17----178 --
NM_002822chr122553 168 ----1654
NM_002825chr71542 ------
NM_002829chr91465 ------
NM_002834chr1273879 3644 3055 1624 1609 1274 43 ------
NM_002835chr71640 ------
NM_002837chr1274531 4386 3538 3150 2824 1714 1659 --14367 --
NM_002839chr91408 13043 12286 --
NM_002841chr3------179
NM_002843chr1143445 3045 2997 2900 13310 1768 --
NM_002844chr621256 1229 --1117 --
NM_002847chr7--170 ----
NM_002848chr1251051 816 378 192 158 --1860 --
NM_002849chr1221072 929 1289 ----
NM_002851chr72180 133 ------
NM_002855chr1143483 2338 1355 103 1415 ----
NM_002858chr11338 21111 348 ----
NM_002869chr1142088 1952 742 649 --1766 --
NM_002874chr922306 1838 12503 ----
NM_002886chr394800 4330 4323 3476 3264 652 625 222 57 14537 21451 1000 --
NM_002890chr5----1149 --
NM_002892chr1411600 ------
NM_002893chrX--1132 ----
NM_002906chr1111710 11760 ----
NM_002928chr15620 428 304 263 193 ----11495
NM_002938chr451991 1696 1515 1430 527 ------
NM_002942chr32269 53 171 ----
NM_002958chr32847 165 ------
NM_002959chr174459 3323 1134 1079 836 429 204 --23602 1644 --
NM_002970chrX1327 ------
NM_002971chr31761 ------
NM_002973chr121391 ------
NM_002977chr263353 2375 1168 683 506 190 ----11119
NM_002994chr411673 ------
NM_002998chr821949 784 --11596 --
NM_002999chr201557 131 1544 11375
NM_003001chr122307 765 ------
NM_003010chr1751926 1844 735 364 320 ----123
NM_003016chr1731530 1343 1291 --11514 --
NM_003017chr62999 87 ------
NM_003022chrX21271 1082 --1803 --
NM_003026chr91135 --21239 999 --
NM_003027chr151113 ------
NM_003030chr361529 558 349 207 170 156 ------
NM_003036chr11322 ------
NM_003037chr1125 ------
NM_003042chr321755 398 ------
NM_003043chr363954 3523 2742 1734 1216 856 2717 484 44102 3198 943 57 --
NM_003045chr1354050 3641 3614 3576 169 13214 24824 4016 --
NM_003046chr855323 4829 4794 4049 2029 24396 2108 44043 1548 987 559 --
NM_003068chr82968 770 ----11070
NM_003069chrX----1557 --
NM_003070chr91226 ------
NM_003071chr311270 ------
NM_003081chr2041219 959 743 326 1229 1404 --
NM_003107chr652067 923 624 564 433 --11673 --
NM_003108chr2136677 6308 6222 6175 5058 4870 4774 4760 2579 1911 1493 1367 689 11307 11023 17314
NM_003112chr712087 ------
NM_003118chr551982 773 496 300 28 1787 2573 377 --
NM_003128chr22439 432 ------
NM_003129chr8----160 --
NM_003133chr1----121 --
NM_003142chr2149 --1226 --
NM_003144chr6--22226 657 ----
NM_003155chr832525 1728 781 --22072 602 --
NM_003161chr1713360 11434 ----
NM_003178chr312247 21465 290 ----
NM_003179chrX21442 1018 --1369 --
NM_003182chr7--1483 ----
NM_003182chr7--1483 ----
NM_003185chr20124 1965 --11132
NM_003188chr61844 1765 144 --
NM_003189chr153341 3160 2063 686 93 ------
NM_003199chr1854638 3730 3457 1639 227 --34073 1964 708 --
NM_003200chr1922174 1848 12332 ----
NM_003206chr62357 157 ------
NM_003211chr121333 --11696 --
NM_003216chr2273126 2150 1217 715 667 336 88 12448 11208 --
NM_003217chr1251697 1439 1360 678 31 ------
NM_003221chr623938 1289 ------
NM_003222chr2031050 928 238 ----11072
NM_003234chr362373 2201 1845 781 662 54 ----1797
NM_003236chr242614 683 261 231 ----12990
NM_003241chr32702 109 ------
NM_003242chr342307 2161 697 538 ------
NM_003253chr21--11453 --1294
NM_003255chr1721960 134 --12315 --
NM_003262chr354382 3609 1863 955 683 21166 1133 1496 --
NM_003269chr6--11127 1995 --
NM_003274chr2162878 2846 945 334 193 67 22452 2414 --12976
NM_003286chr201331 ------
NM_003315chr17138 ------
NM_003317chr142567 101 --1867 --
NM_003320chr1154464 3740 3495 1342 763 13724 13790 --
NM_003326chr122696 73 ------
NM_003337chr531407 649 101 1563 21438 434 --
NM_003340chr431107 244 168 ------
NM_003342chr1722311 848 --11287 --
NM_003348chr1251447 1304 1063 589 50 ------
NM_003352chr23906 380 325 ------
NM_003356chr1131065 897 165 ------
NM_003368chr11599 ------
NM_003376chr631620 758 203 --2558 169 --
NM_003376chr631620 758 203 --2558 169 --
NM_003379chr63957 929 213 --1975 --
NM_003390chr113809 390 124 ------
NM_003392chr343292 800 255 66 --13512 --
NM_003404chr201109 ------
NM_003405chr222755 58 ------
NM_003407chr19--1509 ----
NM_003409chr182969 310 --1156 --
NM_003410chrX22371 141 1256 ----
NM_003411chrY1717 1245 ----
NM_003412chr352362 2144 2097 1171 323 --11002 --
NM_003418chr31160 ------
NM_003421chr1044505 3534 1585 825 ------
NM_003439chr752774 2612 2216 862 318 11178 11135 --
NM_003455chr1141516 467 424 293 ------
NM_003457chr171541 1102 ----
NM_003458chr373492 3081 2905 1559 1299 140 93 ----12892
NM_003463chr612355 --1208 --
NM_003468chr243827 1255 525 21 --13644 --
NM_003471chr31133 1726 ----
NM_003472chr621217 1144 11180 1287 --
NM_003473chr102167 62 ------
NM_003478chr11196 ------
NM_003482chr121419 --12234 12560
NM_003483chr1222772 2087 ------
NM_003507chr241581 1527 1498 225 ------
NM_003557chr11385 --21098 34 --
NM_003559chr1763591 3250 3110 2817 1531 760 --11309 1163
NM_003563chr1721243 22 --1142 --
NM_003566chr121181 --12495 --
NM_003574chr1835373 4476 1351 12037 1606 --
NM_003582chr11217 ------
NM_003589chr1351429 406 162 155 83 ------
NM_003590chr232578 1535 1127 --22970 1201 --
NM_003597chr242222 2190 2108 812 --12259 --
NM_003603chr442034 1928 1667 1401 ------
NM_003607chr174327 4276 3860 3686 1608 992 157 --34373 3726 202 22724 768
NM_003615chr3--12731 --13394
NM_003620chr171120 ------
NM_003622chr1241015 934 662 162 ------
NM_003626chr111229 --11078 --
NM_003628chr21184 --1227 --
NM_003630chr62528 181 ------
NM_003633chr562163 949 579 522 455 126 1627 ----
NM_003637chr181307 1264 1030 499 399 344 138 52 ------
NM_003642chr21298 172 ----
NM_003644chr17106051 5556 5526 5029 4954 4497 2542 1994 1048 408 --31135 978 350 11439
NM_003663chr343429 3055 2628 1368 ----12752
NM_003671chr942909 2526 2293 685 --13314 136
NM_003672chr11156 ------
NM_003677chr1231581 537 417 --1781 --
NM_003690chr22517 118 ------
NM_003701chr132736 189 1833 ----
NM_003713chr11552 1468 21704 630 --
NM_003718chr7182 --146 --
NM_003722chr32296 182 21710 576 1557 --
NM_003728chr41641 --1504 --
NM_003744chr1411145 --178 --
NM_003749chr1342291 822 682 144 ------
NM_003750chr10196 --1845 --
NM_003759chr414241 ------
NM_003762chr111310 ------
NM_003763chr2063132 2693 2342 1067 836 144 --12118 1929
NM_003766chr173526 237 222 ------
NM_003774chr1283334 2723 2585 2337 2259 813 713 304 ------
NM_003783chr1----1227 --
NM_003791chr167498 415 266 236 220 186 166 ------
NM_003796chr191403 ------
NM_003797chr11------1184
NM_003798chr9----1198 --
NM_003800chr621824 788 12337 ----
NM_003812chr2143 ------
NM_003816chr82306 129 --11424 --
NM_003822chr122928 2603 ------
NM_003825chr15------11307
NM_003861chr1472740 2359 1829 1803 1059 711 695 --31130 1096 279 1804
NM_003864chr4--1131 ----
NM_003872chr242977 2058 2038 389 ------
NM_003873chr1062078 1638 909 452 327 188 ------
NM_003884chr32745 103 1431 1506 --
NM_003887chr212036 ------
NM_003899chr1352454 1670 750 662 205 --1304 --
NM_003901chr1062590 1948 1852 588 334 148 --11937 --
NM_003908chr2051002 514 389 294 250 ------
NM_003913chr663647 3337 3306 2795 2754 333 11148 --23423 804
NM_003921chr1159 ----11700
NM_003924chr451239 1163 659 648 601 ------
NM_003927chr182742 31 --1910 --
NM_003931chr61279 ------
NM_003934chr91236 ------
NM_003941chr732430 1978 70 --32441 1667 727 11661
NM_003942chr11--1703 ----
NM_003948chr452409 1882 913 169 92 --31860 797 683 --
NM_003953chr142050 1034 620 50 1227 ----
NM_003955chr1721467 275 ------
NM_003958chr6103656 3429 2985 2795 1298 993 930 600 128 68 12764 23902 245 --
NM_003981chr152685 197 172 ----
NM_003983chr1653898 3772 1409 1356 166 24106 426 2650 67 13522
NM_003987chr1092258 2082 1561 1538 804 738 730 511 355 1642 ----
NM_003988chr1092335 2159 1638 1615 881 815 807 588 432 1719 ----
NM_003989chr1092194 2018 1497 1474 740 674 666 447 291 1578 ----
NM_003990chr1092194 2018 1497 1474 740 674 666 447 291 1578 ----
NM_003994chr1223233 718 2243 147 ----
NM_004004chr13177 11064 1108 --
NM_004006chrX32615 750 588 ------
NM_004007chrX32615 750 588 ------
NM_004009chrX32615 750 588 ------
NM_004010chrX32615 750 588 ------
NM_004011chrX32615 750 588 ------
NM_004012chrX32615 750 588 ------
NM_004013chrX32615 750 588 ------
NM_004014chrX32615 750 588 ------
NM_004015chrX32615 750 588 ------
NM_004016chrX32529 664 502 ------
NM_004017chrX32615 750 588 ------
NM_004018chrX32529 664 502 ------
NM_004020chrX32615 750 588 ------
NM_004021chrX32529 664 502 ------
NM_004022chrX32529 664 502 ------
NM_004023chrX32529 664 502 ------
NM_004028chr1862945 1651 1617 724 709 32 ----13070
NM_004036chr2--1105 ----
NM_004040chr21979 ------
NM_004041chr113683 641 276 --1500 --
NM_004050chr1452720 2497 2308 797 673 --12284 --
NM_004056chr81843 ------
NM_004061chr52522 142 ------
NM_004065chrX3234 217 35 ------
NM_004077chr1231338 408 88 ----1152
NM_004081chrY21570 406 --1223 21415 648
NM_004085chrX2836 788 ------
NM_004087chr31550 --1395 --
NM_004093chr1332720 1124 523 ------
NM_004094chr1422552 68 ------
NM_004098chr1031154 489 222 --1160 --
NM_004099chr931969 1905 581 --21579 543 --
NM_004100chr632395 753 534 3519 405 81 11071 --
NM_004111chr111220 1103 1656 --
NM_004124chr1431200 443 242 --1831 11277
NM_004126chr7----1111 --
NM_004128chr131206 ------
NM_004134chr5160 1184 ----
NM_004136chr1513003 11041 1315 1427
NM_004161chr231053 652 156 --1108 --
NM_004162chr31106 ----1416
NM_004169chr171140 ------
NM_004171chr11119279 8551 8464 3652 3604 3107 2616 2462 2045 1750 1290 23391 1543 --23165 450
NM_004193chr101529 ------
NM_004200chr1172858 2680 2548 1291 909 210 143 ------
NM_004206chr3140 ------
NM_004215chr83198 179 144 ------
NM_004225chr821401 1045 --1588 --
NM_004232chr181978 22629 1141 12380 --
NM_004241chr10--2813 82 ----
NM_004242chr6--1102 ----
NM_004267chr32215 84 --1496 --
NM_004272chr5--11428 21243 70 --
NM_004281chr10125 2490 435 --179
NM_004293chr963374 2744 2332 1435 298 240 --43870 3133 2998 1390 --
NM_004296chr14123934 3424 3168 3109 2741 1545 1085 894 769 218 152 97 ------
NM_004302chr1252726 2454 2234 1079 152 --1219 --
NM_004311chr1042902 2167 879 731 --12356 --
NM_004316chr12139 ------
NM_004326chr13931 365 43 ----1450
NM_004329chr1031255 1190 276 --3416 397 106 --
NM_004331chr822534 1055 ------
NM_004338chr18136521 6441 6181 5774 2761 2736 2714 2659 2549 2380 2292 1882 1195 26261 1417 35574 827 342 16198
NM_004342chr712025 --1251 --
NM_004380chr1631721 823 286 ----1379
NM_004392chr1331868 485 408 --22189 385 --
NM_004393chr392272 1678 1575 1540 857 470 362 279 202 --1193 --
NM_004395chr53496 207 167 ------
NM_004397chr1174207 3874 3850 2668 381 116 31 ------
NM_004414chr21----1631 --
NM_004415chr6----1692 --
NM_004423chr382486 2412 2166 2151 837 738 278 179 1466 21969 1006 12357
NM_004427chr151195 937 161 111 22 ------
NM_004429chrX1553 ------
NM_004430chr831991 1094 412 11933 22448 584 --
NM_004432chr912405 ------
NM_004434chr14150 ----21183 604
NM_004436chr11665 ------
NM_004437chr163594 3477 2681 1097 381 92 --53429 2516 2352 167 100 --
NM_004438chr272527 2167 2014 1049 1004 457 350 1718 32330 1126 831 --
NM_004439chr4137 ------
NM_004440chr641633 1223 449 147 --1298 --
NM_004442chr151677 1412 1320 319 264 ------
NM_004443chr34607 77 68 61 ------
NM_004447chr1231081 921 87 ------
NM_004454chr362107 1808 693 461 394 235 --11723 --
NM_004458chrX22250 2099 --11795 --
NM_004459chr1731609 1593 106 --1684 1789
NM_004464chr441002 787 676 316 ------
NM_004482chr23909 897 669 ------
NM_004492chr15----174 --
NM_004496chr1411027 11359 1506 --
NM_004497chr191679 ------
NM_004500chr14----11750 --
NM_004501chr1103776 3066 2952 2691 2685 1080 742 688 418 276 --1460 --
NM_004504chr242233 1975 734 722 12244 12533 --
NM_004505chr1731370 1357 493 11859 1648 --
NM_004513chr1573776 3169 2951 2686 1515 1286 67 --13676 --
NM_004514chr1742415 947 847 781 11031 22083 494 --
NM_004519chr8--1216 144 --
NM_004525chr221340 570 ------
NM_004529chr921205 1108 ------
NM_004532chr33397 117 34 ------
NM_004554chr1451434 668 592 519 361 1732 ----
NM_004560chr91277 1859 ----
NM_004569chr143734 714 48 ------
NM_004571chr2173167 2957 2914 2291 2171 1309 26 ----11159
NM_004576chr5--196 ----
NM_004580chr153626 429 193 ----11509
NM_004586chrX23753 3534 14376 11755 --
NM_004588chr1163396 3175 2956 2781 1522 1392 --1827 --
NM_004593chr31113 --1859 --
NM_004598chr553253 838 586 162 77 ------
NM_004612chr954719 4072 1671 1107 424 11679 1455 --
NM_004614chr1642422 918 761 656 --2563 475 --
NM_004630chr1151154 1073 926 348 211 ------
NM_004634chr32641 585 ------
NM_004654chrY11231 --11427 --
NM_004655chr1711281 11133 ----
NM_004660chrY51775 1629 935 536 117 1315 11480 --
NM_004667chr15----1473 --
NM_004673chr121521 1140 ------
NM_004685chr1332044 840 506 --12717 11139
NM_004686chr821105 376 ------
NM_004709chrX41812 1544 1339 713 2506 370 1350 --
NM_004711chr2283653 3445 3233 3128 2647 2564 2456 764 ------
NM_004719chr1221078 765 --1733 --
NM_004724chr114468 356 74 43 1129 ----
NM_004725chr102934 377 --1557 --
NM_004726chrX75657 5022 4680 1855 1551 1128 640 13857 --25047 4660
NM_004730chr531745 1714 1349 ------
NM_004734chr1333008 2396 2111 --2875 152 --
NM_004737chr2231194 1028 814 ------
NM_004739chr113618 476 172 ------
NM_004744chr483711 3574 2971 2709 2591 1306 1204 362 --13349 13517
NM_004745chr866681 2380 1240 943 571 246 24944 1275 --22317 2080
NM_004747chr1031190 642 55 ------
NM_004755chr14----1451 --
NM_004760chr71487 ------
NM_004768chr1----11174 --
NM_004774chr1742669 1107 505 195 ------
NM_004776chr2032519 2254 1029 12638 11221 --
NM_004779chr531076 878 410 --2398 135 --
NM_004781chr131293 1166 507 --150 11381
NM_004781chr131293 1166 507 --150 11381
NM_004786chr18167 ------
NM_004787chr41117 --1143 --
NM_004788chr113551 485 172 --22262 2202 12098
NM_004796chr1431923 365 130 ------
NM_004798chr2073119 2526 2406 2307 1277 1200 1052 23643 3582 ----
NM_004801chr221042 560 --1136 --
NM_004805chr2------1392
NM_004808chr1022669 985 22837 2564 11039 23178 2824
NM_004811chr11130 ----1151
NM_004815chr184632 4198 3925 3457 3182 3146 1002 280 --13734 --
NM_004824chr631172 536 512 ------
NM_004831chr1921009 932 ------
NM_004834chr253194 2435 1190 1075 341 12201 12843 1247
NM_004836chr22738 83 ------
NM_004841chr1------11083
NM_004845chrX73921 3563 3202 1155 496 289 204 --22658 1246 11350
NM_004849chr62235 140 ----11319
NM_004850chr221779 1120 --1251 --
NM_004856chr15----1488 --
NM_004863chr1445313 1405 585 354 13247 24930 1857 --
NM_004866chr534789 4371 444 13879 11928 --
NM_004867chrX1592 159 ----
NM_004870chr171624 --1119 --
NM_004871chr1783774 3283 3192 2699 546 349 139 21 --24096 1475 --
NM_004874chr8------1465
NM_004884chr1561255 707 698 445 410 355 ------
NM_004887chr53249 60 46 ------
NM_004888chr92292 173 ------
NM_004891chr2122 ------
NM_004897chr101923 1910 ----
NM_004898chr452825 2752 2598 1946 445 ------
NM_004902chr201816 ------
NM_004904chr745085 2375 634 98 11081 25138 4793 15856
NM_004905chr1----1167 --
NM_004912chr721177 357 11520 ----
NM_004930chr1146 --1527 --
NM_004932chr521486 1339 --21613 151 --
NM_004952chr13948 282 230 ----1628
NM_004956chr754454 4268 3025 1616 682 --13038 13369
NM_004958chr1198 ------
NM_004972chr9----1289 --
NM_004975chr203793 148 136 --127 --
NM_004976chr1174703 4305 4081 1842 1627 1068 281 1689 25120 3686 --
NM_004985chr1273426 3139 2884 1795 1550 695 476 ----13512
NM_004992chrX137447 6150 5740 5685 3246 3045 2637 2564 2431 1432 504 262 79 ------
NM_004992chrX137447 6150 5740 5685 3246 3045 2637 2564 2431 1432 504 262 79 ------
NM_004994chr201183 ------
NM_004999chr633902 1226 1122 --13372 --
NM_005006chr2--1733 1927 --
NM_005011chr761835 1408 1251 625 607 96 11737 21568 1529 --
NM_005022chr17------1241
NM_005028chr1031856 774 209 ------
NM_005032chrX1112 ------
NM_005056chr1255630 4420 1739 939 402 --15156 --
NM_005063chr1011544 ----12830
NM_005065chr1424030 1782 --24092 3888 --
NM_005067chr31387 ------
NM_005076chr164196 4067 4019 2963 1635 361 --33768 3363 970 --
NM_005095chr111648 --11452 --
NM_005097chr10176 ------
NM_005104chr63777 137 30 1564 ----
NM_005109chr342542 2472 2133 35 ------
NM_005116chr20104336 4226 3924 3298 3103 1426 1334 849 669 503 13055 ----
NM_005119chr11504 --192 --
NM_005121chr1722453 1180 21493 184 11276 11302
NM_005124chr63960 846 215 ------
NM_005126chr322011 443 12299 1274 --
NM_005134chr181329 1211 ----
NM_005135chr1533462 2610 1212 13302 ----
NM_005137chr2272246 1568 859 684 611 519 73 ------
NM_005141chr41122 --1426 --
NM_005151chr1821521 338 1569 ----
NM_005156chr953835 3569 3510 1460 391 --22134 1706 --
NM_005157chr921922 1377 ------
NM_005168chr2----11310 --
NM_005180chr10----1235 --
NM_005188chr11168189 7708 7579 7380 6206 5873 5295 5249 2967 2696 2356 2331 2305 1044 489 342 --16181 --
NM_005190chr611018 1166 ----
NM_005197chr1495733 5425 5416 5029 4399 4288 4143 4110 1713 ------
NM_005201chr33404 358 238 --21178 1139 --
NM_005207chr2283057 2568 1308 1264 875 677 536 327 ------
NM_005221chr71110 --1250 --
NM_005233chr342320 2254 1748 383 ------
NM_005235chr277718 7399 6246 3121 2825 2524 2440 15328 --15661
NM_005238chr1141309 890 686 65 --1268 --
NM_005239chr2141382 795 687 35 --21495 307 --
NM_005240chr13749 558 289 --1630 --
NM_005241chr331392 1084 51 ------
NM_005243chr22------1229
NM_005245chr4--131 ----
NM_005252chr142666 181 1488 ----
NM_005254chr1521391 994 --1492 --
NM_005259chr21296 11332 ----
NM_005261chr81366 --1233 1684
NM_005277chr41487 ------
NM_005296chrX1288 ------
NM_005308chr101500 --1399 --
NM_005311chr762367 2298 2203 2099 677 91 ----1775
NM_005327chr41311 1704 1180 --
NM_005329chr1621955 222 --22379 2015 --
NM_005334chrX31387 494 27 --21779 277 --
NM_005339chr443915 3535 2886 75 ------
NM_005342chrX22206 532 ------
NM_005349chr41634 ------
NM_005358chr131313 11241 ----
NM_005359chr18116148 5935 5906 5472 5150 4559 4380 2183 1814 1201 1054 ------
NM_005375chr61453 --2840 772 --
NM_005382chr81382 ------
NM_005392chr91504 ------
NM_005399chr174368 4112 1511 1444 834 646 403 13752 --22838 384
NM_005400chr262774 378 371 224 56 22 --1954 --
NM_005402chr711728 ------
NM_005406chr1831468 1073 354 11126 ----
NM_005436chr1042795 701 200 35 --14062 --
NM_005442chr33647 607 537 ----1223
NM_005445chr102107 51 ------
NM_005455chr11559 --11595 11638
NM_005458chr941528 1517 171 84 12263 ----
NM_005460chr51238 ------
NM_005465chr131867 1585 681 1389 ----
NM_005475chr1263013 2989 1321 1072 972 895 12465 22367 375 --
NM_005486chr171597 --164 1570
NM_005487chr222250 74 --11447 --
NM_005494chr7198 --1162 --
NM_005497chr1776178 6115 5738 1705 1386 140 91 ------
NM_005499chr192430 117 ------
NM_005502chr92230 216 --2774 49 --
NM_005503chr1521144 82 ------
NM_005504chr12116588 6266 6223 5685 5243 4778 4722 2528 2203 1805 826 11737 21127 471 14025
NM_005506chr442655 2285 1985 208 ------
NM_005509chr511722 ------
NM_005517chr161220 1006 457 379 282 246 ------
NM_005520chr52266 144 ------
NM_005524chr3198 162 ----
NM_005539chr102514 304 ------
NM_005542chr741681 1332 342 21 ------
NM_005544chr2------180
NM_005563chr12300 21 ----1784
NM_005573chr51268 --1611 --
NM_005575chr5158 --1700 --
NM_005578chr374758 4509 4497 3636 3495 1998 1791 --25077 1113 --
NM_005596chr964589 4522 4200 2313 2294 418 24784 941 --1775
NM_005602chr3------21008 102
NM_005603chr182185 70 --2478 61 --
NM_005604chr612180 ----11591
NM_005610chr13316 197 31 ----188
NM_005611chr161262 ------
NM_005613chr111945 --11372 2402 40
NM_005614chr7--11081 ----
NM_005644chr11405 ------
NM_005650chr2221156 410 --1375 --
NM_005667chr2------1286
NM_005668chr524169 482 2987 196 1665 --
NM_005676chrX1155 ------
NM_005682chr1651268 223 202 159 39 --1107 --
NM_005684chr1161 ------
NM_005721chr23909 865 296 ------
NM_005722chr252206 1935 1878 809 231 ------
NM_005724chr152198 173 ------
NM_005725chr132425 860 278 ------
NM_005730chr1283543 3522 2532 2217 1065 978 399 43 --22579 322 --
NM_005731chr21107 ------
NM_005738chr721643 1490 ------
NM_005746chr722223 2192 1775 22468 458 --
NM_005748chr1263453 3437 3253 2516 1295 191 ------
NM_005754chr531106 1060 237 ------
NM_005765chrX1202 ------
NM_005776chr141885 165 ----
NM_005786chr1811099 ------
NM_005813chr24607 501 421 287 11838 ----
NM_005819chr173314 2414 1222 1032 525 321 125 ------
NM_005822chr692408 2384 2195 1841 1790 1745 1692 410 113 ------
NM_005828chr1774972 3665 3311 3291 3226 1823 183 --43963 3727 1762 853 --
NM_005832chr321419 1136 ------
NM_005840chrX76403 4673 2493 1786 1507 1347 951 26311 1361 45852 5526 2991 354 11927
NM_005842chr13----1525 --
NM_005843chr2------11278
NM_005853chr162429 26 ------
NM_005859chr511225 1470 ----
NM_005862chr33929 863 769 ------
NM_005875chr3197 ------
NM_005877chr2252260 2031 748 463 433 ------
NM_005880chr1621553 240 ------
NM_005882chr42827 374 ------
NM_005885chr5----2381 157 --
NM_005895chr1253624 3559 3213 2963 652 --33956 229 44 13790
NM_005898chr1143149 801 344 249 --12792 --
NM_005900chr41265 --2336 253 --
NM_005901chr1877802 7496 7399 2656 2206 237 32 --35707 5508 2339 --
NM_005902chr1574383 3953 3088 3082 1805 797 560 --2915 311 --
NM_005903chr524504 1960 --44106 1621 1567 1207 --
NM_005906chr621467 1132 --1488 --
NM_005907chr631409 1247 1053 ------
NM_005909chr523040 2799 13136 --1780
NM_005910chr1723944 304 1994 33089 3060 348 --
NM_005911chr22340 27 ------
NM_005920chr163703 3584 3405 630 265 193 --23834 1441 11377
NM_005933chr1162349 2215 2207 1104 436 281 ------
NM_005941chr821430 56 --21263 324 --
NM_005955chr11667 --44100 4063 3902 3500 1731
NM_005962chr1021469 592 ------
NM_005962chr1021469 592 ------
NM_005963chr17181 ------
NM_005968chr191235 ------
NM_005977chr13------1346
NM_005986chr1342660 2284 213 23 --1251 12680
NM_005999chr1163 ------
NM_006007chr963946 3657 3615 3604 988 923 11055 14520 --
NM_006011chr1563723 3114 506 322 265 21 11690 ----
NM_006015chr1----21354 282 --
NM_006023chr101167 ------
NM_006032chr141205 ------
NM_006037chr284218 4181 3491 3352 2997 1869 1189 100 13697 13573 11763
NM_006047chr2032695 504 162 --21191 721 33426 1423 1303
NM_006048chr1----11067 --
NM_006055chr242711 1175 937 887 --21992 1234 --
NM_006060chr743415 2786 1307 270 --13883 11485
NM_006070chr32266 57 ------
NM_006080chr732500 1874 245 11188 22456 2196 --
NM_006095chr45777 633 417 402 143 --126 --
NM_006096chr831253 1229 30 ------
NM_006106chr1132970 2413 358 1205 ----
NM_006107chr173542 468 351 ------
NM_006108chr1151982 1943 535 404 37 --1303 --
NM_006113chr141736 1709 1540 1523 1781 ----
NM_006122chr1582269 899 830 653 482 445 298 125 --1258 1417
NM_006133chr1141911 1836 1763 1586 --22368 1863 --
NM_006135chr12561 169 ------
NM_006136chr71259 ------
NM_006139chr272540 2272 1952 1797 1089 708 302 --1173 --
NM_006147chr12395 124 --1183 --
NM_006148chr1732919 521 461 22628 495 ----
NM_006154chr1532839 2459 2421 ------
NM_006158chr8----21618 692 192
NM_006166chr12154 --12304 --
NM_006180chr93837 298 131 11528 ----
NM_006191chr121180 --165 --
NM_006194chr141132 1207 --11010
NM_006195chr911290 11333 ----
NM_006197chr812240 --21489 854 --
NM_006203chr534940 4588 3390 11931 24252 3618 11983
NM_006206chr432662 2531 2178 ------
NM_006210chr192171 99 --11008 --
NM_006216chr22137 57 --1247 --
NM_006241chr332400 1943 731 ----11930
NM_006246chr14----11069 --
NM_006251chr521250 597 22714 2226 ----
NM_006252chr167333 5733 5681 4823 4801 2535 16389 27493 2678 --
NM_006256chr12744 440 --11967 --
NM_006265chr831227 527 235 ----11077
NM_006267chr231779 1693 465 --11593 --
NM_006275chr2042453 2030 1880 1535 ----1162
NM_006282chr20104232 4152 2990 1372 1342 1068 831 399 267 151 --21665 351 11859
NM_006283chr884343 4194 3928 3111 1302 1010 843 482 24210 3676 14010 --
NM_006298chr663224 3082 2993 2548 837 783 11135 --12685
NM_006306chrX34671 4565 3842 --34550 1569 597 15837
NM_006311chr17----1113 --
NM_006315chr43645 405 102 ------
NM_006319chr16----1747 --
NM_006345chr42894 93 ------
NM_006350chr5131 ------
NM_006352chr111877 ----11333
NM_006353chr62493 369 140 1270 --
NM_006357chr21144 1111 ----
NM_006359chrX21657 607 --32299 2022 1920 1666
NM_006366chr62883 122 ------
NM_006371chr335128 3708 22 15028 24131 51 --
NM_006378chr9----21274 1069 --
NM_006380chr1774120 3582 3544 2920 2751 651 584 ------
NM_006386chr2232368 2359 33 ------
NM_006391chr111264 ------
NM_006420chr2032783 2222 1171 ------
NM_006421chr81837 ------
NM_006449chr241979 1597 1456 450 --22111 428 1697
NM_006451chr51758 --11076 --
NM_006457chr453978 3170 1413 1406 77 13514 1797 --
NM_006459chr103643 630 75 ------
NM_006460chr1731512 1474 38 ------
NM_006466chr202277 122 --1762 --
NM_006520chrX21624 1111 ------
NM_006529chr421310 1104 1212 21304 177 1565
NM_006538chr253701 3017 2656 966 764 --23945 2806 --
NM_006540chr821459 1427 --11435 --
NM_006544chr1456080 5075 4484 3735 1802 --25851 259 --
NM_006547chr711741 ------
NM_006548chr31144 ----1571
NM_006559chr1----1922 --
NM_006561chr10116254 6108 5737 5116 4884 3827 2136 1857 1765 1473 362 --15020 --
NM_006565chr1611025 ----11149
NM_006572chr1733109 1088 882 --13395 --
NM_006574chr31284 ------
NM_006579chrX1257 ------
NM_006587chr431654 455 290 --31111 241 23 1218
NM_006595chr111307 11853 --151
NM_006599chr1637726 6335 3307 --26377 5980 --
NM_006601chr121881 --1242 --
NM_006603chrX11581 ------
NM_006618chr141285 988 153 45 --21442 1302 --
NM_006620chr644307 3754 1499 1307 --1688 --
NM_006621chr141874 617 262 181 1287 11297 --
NM_006624chr1032121 1811 1709 ------
NM_006625chr1193 ------
NM_006625chr1193 ------
NM_006625chr1193 ------
NM_006626chr941080 547 307 194 1275 11709 --
NM_006628chr1531396 924 479 24322 594 --11704
NM_006633chr5127 --1619 --
NM_006636chr22939 706 --1989 --
NM_006644chr132481 204 163 ----
NM_006654chr1234608 706 415 ------
NM_006658chr72115 74 1451 --1851
NM_006670chr62110 49 --1474 --
NM_006675chr1243225 2710 2092 621 --32879 948 711 --
NM_006710chr2124 ------
NM_006717chr942383 2144 1076 66 --11126 --
NM_006720chr1064735 3897 3176 2011 1465 1093 23499 941 11451 --
NM_006722chr322697 172 --2934 657 1261
NM_006726chr421094 161 ------
NM_006729chrX74665 4324 4133 4039 3870 956 166 11838 15001 14797
NM_006731chr932244 1978 1226 --35283 1551 499 --
NM_006732chr1981877 1356 727 699 425 286 235 47 ------
NM_006734chr621173 469 --121 --
NM_006750chr16117756 7720 6952 6414 6006 4946 2409 2064 1195 1052 209 ----16483
NM_006751chr22209 201 ------
NM_006756chr811016 --1123 --
NM_006761chr172347 101 ------
NM_006766chr832300 1754 503 ------
NM_006772chr6----11268 11279
NM_006775chr643101 2498 2437 391 --12583 --
NM_006777chrX21983 924 12885 32236 1783 652 22030 940
NM_006783chr133262 110 40 ------
NM_006790chr51156 ------
NM_006801chr193648 252 91 ------
NM_006805chr531700 353 205 1250 --1601
NM_006815chr1221274 419 ------
NM_006822chr171245 ------
NM_006823chr81309 --1177 --
NM_006838chr121197 --21647 552 --
NM_006851chr1252678 631 412 300 220 1365 12724 --
NM_006852chr174940 475 328 166 11911 ----
NM_006854chr731661 1336 134 --1629 --
NM_006856chr1231127 1095 865 1743 ----
NM_006873chr233336 2745 2309 ----1831
NM_006874chr44911 814 298 132 --1463 195
NM_006875chrX2318 238 --1786 --
NM_006877chr61361 ------
NM_006884chr361529 558 349 207 170 156 ------
NM_006885chr1631675 1641 819 11209 ----
NM_006888chr1462661 2335 2285 1397 718 258 ------
NM_006895chr221508 226 --1351 11647
NM_006910chr16173 ------
NM_006914chr931426 180 75 --1580 --
NM_006922chr211790 ------
NM_006924chr1734025 3369 1084 ----22955 1035
NM_006948chr212353 284 11745 ----
NM_006981chr922014 153 --32534 778 136 --
NM_006996chr131260 759 230 ------
NM_007005chr911029 --21570 565 --
NM_007007chr1254641 3881 3586 3457 720 14541 44604 3172 3017 2941 --
NM_007010chr1751866 1449 1255 460 329 ------
NM_007011chr1586566 5653 2428 2145 1886 939 904 721 16828 36487 2498 2075 --
NM_007013chr8--1293 1781 1246
NM_007017chr51809 ------
NM_007023chr2----1693 --
NM_007026chr171494 ------
NM_007034chr11738 --1672 --
NM_007036chr52396 360 1902 --131
NM_007038chr2145979 5391 3893 1848 16067 35576 5406 5167 --
NM_007042chr321771 810 --22201 333 --
NM_007043chr1211305 ------
NM_007050chr20118111 6501 6370 5716 2623 2590 2464 2316 1501 368 154 --46821 5990 2247 444 12472
NM_007054chr542870 2744 2471 82 --13341 11569
NM_007068chr222934 425 ------
NM_007078chr1052248 1028 657 556 203 --12239 11962
NM_007084chr131547 11002 11098 --
NM_007107chr342441 1761 942 927 ------
NM_007125chrY21299 1237 ------
NM_007137chrX64527 3524 1888 813 793 751 --11699 --
NM_007144chr1721175 1168 --1928 --
NM_007145chr1941194 1162 924 396 ------
NM_007146chr1752353 2116 2000 1918 712 ------
NM_007147chr19------11036
NM_007159chr321082 533 1193 1260 --
NM_007166chr111393 --21554 975 11289
NM_007170chr13932 125 81 --1664 --
NM_007174chr1231603 1562 863 --1181 12296
NM_007175chr833409 1239 427 23103 1033 1912 --
NM_007191chr121514 ------
NM_007197chr121861 ------
NM_007203chr933607 2855 219 --33285 3104 187 --
NM_007207chr13837 190 66 ------
NM_007212chr142075 482 408 331 ------
NM_007214chr62906 357 1838 ----
NM_007222chr8----1303 --
NM_007236chr1542102 2024 947 809 ------
NM_007245chr164908 819 292 116 ------
NM_007247chr1731044 879 27 ------
NM_007249chr13147764 7704 6684 6676 6173 6160 3286 3236 3172 2461 1382 1051 1026 681 --39172 8079 7753 --
NM_007266chr2----1636 --
NM_007313chr921922 1377 ------
NM_007350chr1264277 4186 3824 3437 1171 157 12903 23316 219 --
NM_007358chr131969 554 211 ------
NM_007361chr14124 --1151 --
NM_007365chr182040 2032 1961 1764 861 819 704 204 --1359 --
NM_007371chr92298 185 --151 --
NM_007372chr173853 844 596 1231 1588 --
NM_007375chr132327 2148 861 --21793 1010 --
NM_012081chr553666 3590 2845 552 214 --22669 2661 178
NM_012089chr1------134
NM_012096chr323538 2414 13627 --22701 1422
NM_012098chr931139 592 127 ------
NM_012102chr132060 2026 62 --22279 791 --
NM_012104chr1153659 3197 1011 991 29 11320 ----
NM_012104chr1153659 3197 1011 991 29 11320 ----
NM_012105chr212162 146 --1759 1262
NM_012110chr4----125 --
NM_012137chr122258 56 1134 12193 --
NM_012141chr1363159 2969 2854 1082 768 271 --23255 2751 --
NM_012154chr8----1131 --
NM_012156chr2051339 1092 801 613 79 ------
NM_012157chr33987 131 98 ------
NM_012158chr1331569 1396 1378 ------
NM_012164chr997169 6470 5497 5438 5280 4960 2310 2191 30 --45382 2165 1926 850 --
NM_012166chr921590 78 21206 387 1341 --
NM_012175chr11--137 ----
NM_012180chr41469 ------
NM_012193chr1195250 4323 4030 3797 3344 2047 1771 1283 303 11085 43886 3654 1203 191 12037
NM_012197chr921228 76 ------
NM_012204chr93914 774 210 --1849 --
NM_012207chr10--1867 155 --
NM_012215chr1011268 --21634 1218 --
NM_012218chr1983080 2879 1074 1018 840 756 749 194 ------
NM_012224chr42483 124 ----1176
NM_012234chr321495 672 --12662 --
NM_012238chr1021783 487 ------
NM_012244chr1431423 406 129 ------
NM_012249chr233398 3344 814 12997 21193 797 --
NM_012257chr7263 49 --1830 --
NM_012262chr144210 3472 2022 25 14962 ----
NM_012281chr71228 ------
NM_012287chr344325 3812 3557 308 13380 ----
NM_012290chr221465 1381 --1593 --
NM_012297chr421675 211 ------
NM_012300chr562441 2176 2153 1702 347 185 12218 ----
NM_012301chr7--11878 ----
NM_012302chr12449 103 --1258 --
NM_012307chr18----11017 --
NM_012309chr1174944 4495 3731 3593 3179 630 313 --34220 592 260 13331
NM_012316chr174882 3758 3741 3697 1329 712 196 --45241 5196 3766 3476 --
NM_012322chr71346 ------
NM_012323chr22----11592 --
NM_012325chr2031477 1309 92 --11565 --
NM_012328chr72925 39 ------
NM_012329chr1731556 243 232 1111 1272 --
NM_012330chr1031706 1589 1396 ------
NM_012337chr11119 --145 --
NM_012342chr101170 ------
NM_012343chr521112 378 ------
NM_012347chr632740 2225 463 12952 --1613
NM_012382chr544402 4355 2912 613 13995 ----
NM_012383chr9------1457
NM_012388chr1542924 2384 2185 1252 --12724 --
NM_012399chr221552 --11228 --
NM_012408chr203884 267 101 1680 ----
NM_012417chr173568 482 207 ----1625
NM_012425chr1042458 1763 1674 275 --42682 727 687 160 --
NM_012434chr631404 1034 593 ------
NM_012448chr1752473 1913 1813 1601 376 ------
NM_012464chr442208 1088 841 436 ----1259
NM_012465chr1042245 882 799 789 --12962 --
NM_012479chr772112 2040 1748 1706 494 432 248 ------
NM_012486chr1----2185 96 --
NM_013230chrY21457 368 1437 ----
NM_013231chr1472741 1390 1079 938 786 731 402 --34311 3116 42 --
NM_013235chr52702 220 2627 366 2591 339 --
NM_013252chr722507 74 --22738 474 --
NM_013255chr7168707 8635 8535 8414 8376 8200 8111 7161 2823 1874 1348 1315 1159 872 742 375 15892 47492 7241 2267 1105 --
NM_013257chr822125 1935 ----12185
NM_013262chr621458 569 ----11490
NM_013269chr1264359 4051 3944 3664 1113 520 --14199 --
NM_013272chr151146 ------
NM_013279chr1192256 1817 1613 685 569 542 497 458 216 ------
NM_013282chr19----11325 1851
NM_013283chr51107 --1302 --
NM_013286chr353784 2323 1343 805 464 1477 ----
NM_013293chr7189 ------
NM_013302chr1674101 4042 3910 3263 894 393 147 ----1191
NM_013313chr2272848 2387 2356 1153 1027 792 321 ------
NM_013320chr12----1186 --
NM_013341chr222866 2143 --1914 --
NM_013348chr1961130 1044 893 424 289 70 11000 ----
NM_013352chr62870 102 ------
NM_013354chr8--1452 --11237
NM_013357chr83887 744 149 ------
NM_013358chr131697 1568 370 --11533 2685 253
NM_013365chr222523 155 ------
NM_013372chr1543023 2819 389 325 --2607 75 13003
NM_013374chr321991 512 --33176 3047 748 --
NM_013377chr121107 ------
NM_013390chr91637 11460 ----
NM_013396chr21------1149
NM_013399chr1631841 164 21 --1346 --
NM_013410chr111232 2807 426 ----
NM_013423chrX--1268 --1464
NM_013427chrX--1268 --1464
NM_013438chr951403 696 411 88 50 --21182 534 --
NM_013444chrX3984 103 52 ------
NM_013450chr21105 --11276 --
NM_013956chr8123 ------
NM_013957chr8123 ------
NM_013960chr81699 ------
NM_013964chr8123 ------
NM_013986chr22------1229
NM_013989chr1494789 4626 4478 4321 3968 3460 3256 2062 338 24251 406 24092 3774 --
NM_013996chr7--1483 ----
NM_013996chr7--1483 ----
NM_013997chr7--1483 ----
NM_013997chr7--1483 ----
NM_013998chr7--1483 ----
NM_013998chr7--1483 ----
NM_014010chr9--1240 135 --
NM_014011chr221945 634 ------
NM_014016chr32453 38 1611 ----
NM_014034chr611311 ------
NM_014042chr11132 ------
NM_014056chr332226 1747 436 1607 ----
NM_014071chr20273 44 ------
NM_014089chr1322286 219 ------
NM_014109chr81470 --1984 --
NM_014112chr864362 4306 3624 1608 1151 729 11340 ----
NM_014117chr1622535 2437 --32715 2527 1845 --
NM_014153chr16----1246 --
NM_014155chr1197008 6771 6740 5487 4955 4847 2319 1838 506 --12180 --
NM_014159chr3----1470 148
NM_014170chr3125 ------
NM_014181chr241951 1173 448 90 --22482 688 --
NM_014191chr122365 203 --11031 1104
NM_014212chr122877 181 --1274 --
NM_014216chr1441171 1138 136 108 ------
NM_014217chr131457 1281 549 --11828 --
NM_014230chr17138 --132 --
NM_014243chr431567 418 317 11821 ----
NM_014248chr222172 53 ------
NM_014250chr222250 74 --11447 --
NM_014253chrX21658 925 ------
NM_014264chr42216 53 ------
NM_014271chrX1218 ------
NM_014282chr94354 325 282 172 --2337 56 185
NM_014283chr1----131 --
NM_014288chr13311 291 221 ------
NM_014289chrX51063 444 281 103 78 --21073 1046 --
NM_014290chr91178 ------
NM_014294chr8----11155 21098 490
NM_014299chr1992038 1869 1591 630 613 564 414 101 46 --21640 575 --
NM_014300chr151348 --1465 --
NM_014305chr132122 114 --1254 --
NM_014309chr2294892 4594 4446 4409 4115 3839 3659 1966 885 --14004 --
NM_014316chr1631983 1953 391 --22104 44 --
NM_014319chr12--1261 ----
NM_014322chr1157 21009 423 ----
NM_014331chr4107514 6362 5428 4783 3003 2937 2602 2343 2246 1615 --27432 2685 22965 2395
NM_014332chrX------1118
NM_014350chr51301 ----1115
NM_014352chr1151502 1157 422 327 195 --1133 --
NM_014360chr143628 585 36 ------
NM_014372chr122087 1653 1575 11884 --
NM_014382chr321669 139 ----1148
NM_014386chr5--151 ----
NM_014392chr43621 587 53 11555 ----
NM_014410chr181385 ------
NM_014415chr331498 1186 532 --1423 --
NM_014421chr442089 1784 1312 308 11627 --1746
NM_014423chr544502 3775 1308 350 --22185 1806 11449
NM_014429chr3----154 --
NM_014444chr15160 2661 119 ----
NM_014445chr31117 ------
NM_014447chr42432 113 --21144 600 --
NM_014454chr6127 ------
NM_014456chr102659 503 ------
NM_014458chr11491 ------
NM_014470chr12----2745 700 --
NM_014494chr1621639 289 11507 11691 --
NM_014504chr742004 1918 1376 209 ----1744
NM_014515chr124864 356 274 28 ------
NM_014517chr341847 1625 775 519 --1680 --
NM_014521chr2------11875
NM_014554chr1242229 1953 1823 526 --12026 --
NM_014563chrX1355 ------
NM_014572chr1321596 182 --11264 --
NM_014577chr221701 --1283 --
NM_014592chr5----1148 --
NM_014606chr421341 116 ------
NM_014612chr91121 ------
NM_014614chr231503 1024 75 --129 --
NM_014615chr1653313 3241 2917 299 142 13051 ----
NM_014618chr9125 ------
NM_014620chr12165 ------
NM_014630chr1563106 2531 2467 1383 979 549 --31049 917 85 13807
NM_014636chr994175 3516 3492 1291 1053 646 552 199 121 --43450 3298 2922 2862 --
NM_014637chr821207 25 --1557 --
NM_014646chr1852922 2084 994 167 67 12445 12145 --
NM_014647chr1641947 1912 1793 48 11751 ----
NM_014653chr1282003 1730 1648 1546 342 261 164 59 11776 21662 374 --
NM_014655chr162282 1840 855 482 395 173 11847 32258 1952 149 --
NM_014660chr7----11070 --
NM_014662chr22----2461 202 181
NM_014666chr5--11164 ----
NM_014670chr21662 --21626 1286 --
NM_014682chr82874 180 ------
NM_014683chr1721998 1674 ------
NM_014685chr162476 462 ------
NM_014701chr1552451 2162 894 758 365 11300 ----
NM_014705chr73731 434 254 11624 12093 --
NM_014707chr711795 191 11968 --
NM_014709chr22636 459 ------
NM_014711chr16165 ----150
NM_014715chr113740 718 651 --1194 1602
NM_014720chr102237 34 ------
NM_014721chr647488 691 546 210 14622 11764 --
NM_014723chr20103195 2880 2848 2655 2483 2310 927 594 454 296 ------
NM_014729chr832167 1586 865 --21519 374 --
NM_014730chr1253686 1760 504 444 316 --14180 --
NM_014730chr1253686 1760 504 444 316 --14180 --
NM_014731chr2021703 596 --11787 --
NM_014733chr532194 679 473 --1350 --
NM_014735chrX1728 ------
NM_014737chr2063395 1650 1578 1315 751 216 ------
NM_014742chr2021723 1397 11481 11656 --
NM_014743chr463145 2885 1184 647 571 391 ------
NM_014746chr274413 3216 2883 1261 1000 593 49 --23680 329 --
NM_014752chr1131333 376 342 --2535 279 --
NM_014755chr221510 1399 --1568 13690
NM_014757chr532020 1944 58 --12083 --
NM_014762chr141613 993 430 249 11922 22510 2299 --
NM_014765chr132379 1903 426 12552 ----
NM_014766chr73729 455 36 12506 --21023 969
NM_014774chr152836 2389 2338 706 399 ----13070
NM_014779chr32841 303 ------
NM_014782chrX2364 25 ------
NM_014787chr142143 938 680 456 12619 ----
NM_014791chr92261 252 ------
NM_014800chr71193 ------
NM_014802chr122710 80 --2968 379 --
NM_014810chr173400 3118 2812 2341 2307 1325 1065 ------
NM_014812chr1------11449
NM_014819chr51269 ------
NM_014820chr31550 11841 ----
NM_014822chr4----1481 --
NM_014824chr114612 299 150 95 --1396 --
NM_014826chr174327 4276 3860 3686 1608 992 157 --34373 3726 202 22724 768
NM_014827chr131550 1385 516 ------
NM_014828chr1432133 1616 1016 --11930 --
NM_014829chr532315 2195 444 --22341 1766 --
NM_014830chr1243880 3534 3063 2775 13506 --11556
NM_014832chr1311698 11337 ----
NM_014835chr2022038 1914 --21780 547 --
NM_014836chr102441 211 ------
NM_014838chr2232643 2592 1075 12835 ----
NM_014840chr1263176 3135 2715 1121 178 57 12521 ----
NM_014850chr354649 4373 4024 662 577 13527 13644 --
NM_014862chr15104224 3364 3149 3040 2995 2985 1686 1448 860 431 23198 1306 --13313
NM_014870chr163534 3166 3060 3041 1707 941 ------
NM_014871chr121194 ------
NM_014873chr131723 1305 1172 --23761 45 --
NM_014876chr2231524 674 353 ------
NM_014877chr17107742 7551 7120 6944 6614 6007 5401 1785 817 146 12478 26316 2512 27512 4797
NM_014883chr422569 2341 1422 1780 --
NM_014892chr6--1451 1247 --
NM_014893chrY31825 855 425 1114 12164 1447
NM_014897chr1793283 3113 2566 902 712 593 334 274 250 12809 195 --
NM_014903chr1232001 1786 313 --130 --
NM_014904chr1073135 1499 1437 1111 1025 807 252 --1225 --
NM_014905chr22516 418 ----1575
NM_014906chr1743135 1335 1306 587 ------
NM_014909chr1442856 2687 1190 771 --23865 2799 --
NM_014912chr1043287 826 436 343 ------
NM_014917chr11937 ------
NM_014918chr1521483 127 ----1395
NM_014921chr1953036 2761 2510 2251 62 21949 158 1314 --
NM_014926chr311049 1836 2293 245 --
NM_014932chr33495 85 61 ------
NM_014934chr1353893 3289 2566 622 220 22907 81 ----
NM_014937chr1011242 1446 ----
NM_014939chr1831165 604 340 ------
NM_014945chr541563 1413 221 115 ----11779
NM_014946chr282998 2734 2606 1917 1226 268 160 105 --12289 --
NM_014947chr122123 765 ----12670
NM_014949chr12124 37 --176 --
NM_014950chr14--1221 ----
NM_014961chr441438 611 138 122 194 1368 --
NM_014964chr1762162 2132 2109 1953 1610 58 1585 11827 --
NM_014969chr1143 ----1996
NM_014974chr1041668 1274 217 27 ------
NM_014978chr102328 38 --1278 --
NM_014982chr1475212 4933 4722 3698 3319 3283 1853 25158 4989 ----
NM_014988chr432109 1759 895 --2635 121 --
NM_014989chr631943 1740 1628 11669 2833 558 --
NM_014991chr453097 2970 2954 2204 52 ------
NM_014992chr141860 ------
NM_014996chr3----1390 1812
NM_014997chr742851 700 314 50 --12144 --
NM_015000chr1222611 188 --12605 12496
NM_015001chr15378 239 162 105 43 --1795 --
NM_015008chr332478 2335 1431 13399 13637 --
NM_015012chr111114 164 ----
NM_015020chr1683810 3569 3343 1377 1324 990 688 483 --12841 --
NM_015025chr252277 2018 740 586 129 21976 483 ----
NM_015026chr1254270 4048 3661 1285 183 --1922 --
NM_015027chr1641451 556 479 224 --11937 --
NM_015033chr933074 2320 1060 1549 ----
NM_015035chr2044886 2045 1106 75 15022 ----
NM_015039chr1104107 3620 3115 1658 1649 429 423 384 345 306 --1192 --
NM_015042chr1544122 3438 930 604 --1480 --
NM_015044chr1642899 2672 2132 2043 23160 2709 1121 --
NM_015051chr972801 2165 968 799 782 774 543 ------
NM_015052chr731360 1026 1008 ------
NM_015054chr121421 --188 --
NM_015064chr1273661 3334 2647 2303 892 664 149 13514 ----
NM_015068chr762887 1382 1162 942 717 454 ------
NM_015069chr16----1241 --
NM_015071chr596547 5904 5137 4564 4028 2357 485 251 111 35780 4841 1507 ----
NM_015074chr1104896 4137 4112 3836 3675 3536 3435 757 88 75 24633 4189 44731 4624 3566 1343 --
NM_015076chr644556 3559 2840 45 --1187 --
NM_015077chr17113598 3377 1894 1505 1224 1060 1042 791 474 122 105 13173 11532 --
NM_015082chr54971 924 823 552 12566 1383 --
NM_015087chr1312049 ----12578
NM_015090chr196124 5555 4076 3926 3862 1780 1317 805 459 11797 34663 2425 1181 --
NM_015092chr1644153 4067 3813 3460 1864 53906 3181 3105 1786 467 --
NM_015094chr2293896 3542 3399 3238 1693 1146 992 747 110 ------
NM_015100chr141986 1907 1763 259 ------
NM_015101chr172443 2144 1982 1117 1061 615 520 12136 22294 1140 --
NM_015107chrX22369 495 ------
NM_015138chr1552133 1982 1020 750 234 ----1119
NM_015143chr4----11376 --
NM_015144chr1683145 2510 1162 897 577 439 405 319 --13108 --
NM_015149chr141449 892 527 212 1323 ----
NM_015153chr61625 1720 ----
NM_015155chr1052470 1316 1287 319 153 ------
NM_015156chr1473689 3680 3439 3117 1299 369 269 --22478 983 --
NM_015158chr92719 567 --1833 --
NM_015161chr1651078 1024 492 241 143 ------
NM_015170chr82191 97 --12146 --
NM_015176chr111686 ------
NM_015180chr142910 119 --1763 --
NM_015185chrX32948 2885 1999 --11002 --
NM_015187chr41326 --2686 267 --
NM_015192chr2072839 1113 675 428 280 173 54 ------
NM_015197chr1441267 982 906 343 13404 11065 --
NM_015198chr71257 --1372 --
NM_015199chr312338 12114 --11928
NM_015200chr432345 923 48 --1251 --
NM_015205chr1395213 4412 3782 3657 1836 1501 1495 1330 1125 14782 12024 --
NM_015208chr1854076 3334 3040 2492 887 ------
NM_015215chr133001 2583 491 ------
NM_015219chr1742585 2493 1051 553 --12467 --
NM_015225chr933191 3081 2221 ------
NM_015231chr111309 --1672 --
NM_015233chr1332735 1890 853 ------
NM_015235chr10--11687 --12097
NM_015236chr42976 245 11134 1140 --
NM_015238chr51141 ------
NM_015242chr111560 125 ----
NM_015245chr652572 2207 959 500 54 --12306 --
NM_015247chr1665154 5017 4490 4028 1203 641 11257 33350 1852 1527 14101
NM_015264chr2264202 3564 1483 1274 977 743 --44675 3720 1312 450 --
NM_015265chr21516 --2468 306 --
NM_015267chr1211965 ----1636
NM_015269chr11540 ----1408
NM_015270chr1252002 1690 1637 214 55 --1839 --
NM_015275chr1222059 282 --1862 1176
NM_015277chr1821460 1386 --174 --
NM_015278chr621360 441 --11094 --
NM_015288chr583757 3612 3149 1433 843 735 682 320 ------
NM_015291chr143470 1118 781 73 12164 137 --
NM_015296chr13172 --1277 11141
NM_015310chr887442 7077 7046 6480 6236 5844 2353 1172 16006 37979 7339 2586 --
NM_015313chr1144484 3969 1456 641 11147 --13787
NM_015317chr212752 1129 ----
NM_015321chr19134758 4387 3997 3892 3758 3495 3372 3095 1955 1747 1216 355 102 ------
NM_015322chr15152 ------
NM_015328chr751941 1235 977 613 329 ------
NM_015335chr123706 453 230 21678 641 12571 --
NM_015336chr1222708 2001 ------
NM_015339chr202818 691 --1405 --
NM_015344chr841893 1709 1453 167 1377 11991 --
NM_015347chr1262690 2626 2181 998 464 93 ------
NM_015349chr61392 22812 2423 22779 1095 --
NM_015355chr1711513 ------
NM_015356chr8125 ----1200
NM_015358chr211229 ------
NM_015359chr842458 771 284 247 1429 21967 849 12955
NM_015361chr22862 97 ------
NM_015375chr174933 4871 4820 4387 3741 1713 422 21624 397 23663 963 12007
NM_015382chr14------135
NM_015387chr211619 ------
NM_015397chr911928 --2390 93 --
NM_015419chrX1727 --1434 --
NM_015443chr1741483 451 417 27 --11095 --
NM_015446chr131322 441 201 --1633 --
NM_015455chr533129 415 116 --1602 --
NM_015457chr111252 1341 ----
NM_015458chr844892 4515 4205 4175 11032 1407 --
NM_015460chr32214 177 1321 ----
NM_015475chr21113 --1377 --
NM_015484chr13884 809 389 ------
NM_015508chr321541 1021 2573 392 ----
NM_015509chr1231384 1362 31 ------
NM_015511chr201432 --21116 260 --
NM_015515chr171109 --1244 --
NM_015520chr321874 440 11841 ----
NM_015526chr1961074 547 526 264 211 88 ------
NM_015532chr151163 --154 --
NM_015535chr254127 3336 2977 1266 290 --1220 13233
NM_015550chr752844 2749 2507 927 323 12379 13417 --
NM_015553chr6114930 4787 4138 3934 3391 3380 3171 3146 2001 1317 874 1274 ----
NM_015554chr1522204 1849 2413 115 32800 2646 56 --
NM_015557chr183546 3390 2730 804 771 464 390 345 ------
NM_015564chr573313 2306 1363 1117 642 435 124 ------
NM_015565chr2132042 1811 1789 --21729 896 --
NM_015568chr2073954 3837 3816 3474 1572 470 110 13023 ----
NM_015569chr184754 4678 4324 3942 2997 2963 983 540 ------
NM_015570chr72724 141 11368 ----
NM_015571chr642501 2025 705 47 --1935 --
NM_015575chr223109 2694 23716 3273 21038 162 --
NM_015601chr101938 ------
NM_015602chr12730 268 11787 ----
NM_015605chr1061435 1135 1054 408 40 24 ------
NM_015608chr10--1560 ----
NM_015609chr162775 1041 983 796 691 291 --11920 --
NM_015610chr772765 2603 1927 718 609 487 58 --22207 1135 1115
NM_015626chr1711248 ------
NM_015630chr221051 419 ------
NM_015635chr922133 187 --11425 1560
NM_015640chr144972 4897 3997 3515 --25275 1835 --
NM_015657chr23946 659 256 ------
NM_015668chr81148 --166 --
NM_015678chr13----1306 --
NM_015686chrX42544 2318 2074 778 ------
NM_015695chr631755 1449 660 12022 ----
NM_015700chr2138 ------
NM_015726chr141391 1170 230 106 1210 11624 --
NM_015855chr111834 ------
NM_015874chr41634 ------
NM_015878chr832180 1681 760 ------
NM_015879chr18187865 7173 6065 6044 5933 5688 5637 5555 5445 5313 2713 2642 2440 2406 2339 2093 662 206 16349 22087 413 --
NM_015888chr132321 744 591 1166 23272 2493 --
NM_015891chr631998 1362 217 1326 1723 --
NM_015906chr194577 3954 3251 1438 1399 1153 869 363 277 --13516 1491
NM_015912chr84478 352 165 123 1676 11798 --
NM_015926chr31251 --265 53 --
NM_015948chr61397 ------
NM_015955chr22334 101 ------
NM_015975chrX------2488 311
NM_015981chr583009 2743 2470 2341 2313 1178 1014 867 --12006 --
NM_015986chr172510 161 11210 ----
NM_015995chr15114532 4290 2093 1618 1295 1250 1215 806 566 470 226 24912 3607 24991 4298 15478
NM_016003chr772765 2603 1927 718 609 487 58 --22207 1135 1115
NM_016009chr164654 3950 3721 3052 1063 37 --24733 3627 --
NM_016018chr832639 864 728 12021 22132 1761 --
NM_016019chr73956 712 393 ------
NM_016021chr622811 2383 23048 514 12625 11064
NM_016025chr164806 639 508 303 ------
NM_016032chrX1934 --3997 498 21 --
NM_016040chr11656 ------
NM_016045chr2021436 340 ------
NM_016048chr5----1318 --
NM_016072chr1261969 1929 1636 1529 354 22 11749 ----
NM_016073chr152786 276 --1800 --
NM_016076chr192771 2746 2573 2183 1117 1046 704 316 107 --11952 --
NM_016081chr431595 1585 622 ------
NM_016083chr653635 2604 855 832 695 --1509 --
NM_016096chr832011 193 37 1634 11956 --
NM_016097chr182897 25 ------
NM_016098chr61353 ------
NM_016100chr204437 294 117 71 ------
NM_016103chr5----190 --
NM_016131chr2--21835 170 ----
NM_016132chr1522862 2796 ----1457
NM_016141chr31776 ------
NM_016152chr321210 351 --1329 --
NM_016169chr1093206 2717 2680 2670 2577 2285 2270 857 301 --1283 --
NM_016203chr71180 ------
NM_016205chr411174 156 11009 --
NM_016206chr377299 6733 6080 3099 2978 2528 2387 --68380 8048 6923 6331 2340 1857 13507
NM_016224chr631914 1711 818 --12075 --
NM_016227chr1----131 --
NM_016228chr42634 275 ------
NM_016231chr1721547 1203 --1170 --
NM_016257chr162907 2287 2226 2212 1238 411 13466 --12301
NM_016258chr12123 84 ------
NM_016260chr247182 2154 397 315 --1329 --
NM_016271chr1811477 --11737 22156 1576
NM_016272chr2221821 899 --12551 --
NM_016277chr63201 128 111 --196 --
NM_016279chr51333 ------
NM_016284chr162198 96 ------
NM_016287chr12459 231 1135 --11581
NM_016289chr232058 1811 651 ------
NM_016293chr122456 409 ------
NM_016322chr913080 --31138 928 234 12383
NM_016337chr14179 --1193 --
NM_016356chr622661 2141 12577 ----
NM_016374chr1--11092 21598 566 --
NM_016374chr1--11092 21598 566 --
NM_016376chr1742717 1419 962 463 1881 13459 --
NM_016395chr1541645 492 247 49 ------
NM_016396chr1552773 1899 877 418 354 ----1165
NM_016401chr11129 --1195 --
NM_016410chr91158 1549 ----
NM_016424chr1742047 1973 1856 228 --11789 --
NM_016436chr2072700 2420 1984 1958 923 545 377 --1220 --
NM_016441chr232402 954 146 ------
NM_016448chr1--194 11871 11320
NM_016467chr221294 398 ------
NM_016470chr201525 ------
NM_016472chr1421364 1040 --11302 --
NM_016505chr1275 63 1688 ----
NM_016507chr1722729 29 --2956 371 1740
NM_016521chrX121 ------
NM_016525chr93957 375 184 ------
NM_016529chr1351062 952 791 453 38 --1971 --
NM_016530chr1543287 889 337 183 --12994 --
NM_016544chr242978 1031 521 31 --148 --
NM_016570chr12------1462
NM_016577chr364509 4220 1491 1403 1397 587 1654 ----
NM_016578chr111112 ------
NM_016588chr62147 99 ------
NM_016592chr201326 --2364 22 --
NM_016603chr511470 --12238 --
NM_016604chr55981 825 311 212 75 ------
NM_016605chr572040 1945 1872 1741 897 635 40 ------
NM_016607chrX11643 ------
NM_016620chr151346 1253 1200 373 308 --1353 --
NM_016621chr1144504 4252 4073 2875 --33923 3901 1648 165
NM_016623chr82528 158 ------
NM_016631chr211948 ------
NM_016654chr1521391 994 --1492 --
NM_016824chr1031506 531 164 1122 ----
NM_016834chr1723944 304 1994 33089 3060 348 --
NM_016835chr1723944 304 1994 33089 3060 348 --
NM_016841chr1723944 304 1994 33089 3060 348 --
NM_016929chr663871 3354 1547 73 58 39 --11221 --
NM_016931chr11--127 158 --
NM_016952chr1173336 3219 2816 1284 1047 853 737 --21493 436 --
NM_017412chr81449 --11062 --
NM_017413chrX42513 1989 1732 251 ----1487
NM_017415chr554377 4092 770 589 55 --23880 3703 --
NM_017418chr92474 64 ------
NM_017420chr1433513 2755 2507 1285 23084 1458 1131
NM_017423chr421805 1606 11944 1396 --
NM_017447chr2134112 2748 207 11278 14254 11071
NM_017449chr151677 1412 1320 319 264 ------
NM_017450chr1741043 465 427 332 11023 1152 --
NM_017489chr821155 467 --11231 --
NM_017515chr113400 258 86 --11336 --
NM_017519chr6--1350 ----
NM_017548chr351826 1667 1559 588 445 --11844 --
NM_017551chr1041054 821 585 238 --1119 --
NM_017563chr385569 5259 4926 4807 4418 1372 1073 344 --14609 --
NM_017582chr151535 1419 1318 1264 1159 ------
NM_017593chr4----140 --
NM_017617chr931339 1057 329 11431 1299 11539
NM_017628chr464291 3318 1475 999 620 32 --24570 1729 11198
NM_017629chr14676 645 589 495 1288 21347 474 --
NM_017632chr4157 ------
NM_017633chr633671 2784 2572 1234 23703 3042 --
NM_017634chr831356 546 172 --1557 --
NM_017637chr9108943 8602 8216 7826 7784 7351 5832 2646 1103 518 16804 22530 2223 13001
NM_017643chr1742505 2278 1985 827 --12197 --
NM_017644chr365037 3769 3337 1460 877 747 33278 2023 589 ----
NM_017658chr1424404 126 --23707 235 13815
NM_017660chr1933070 766 455 13305 33425 3265 1143 --
NM_017661chr1521213 967 ------
NM_017666chrX31933 1717 230 1731 ----
NM_017667chr71169 ------
NM_017672chr152284 255 ------
NM_017686chr12776 384 ----1975
NM_017693chr1341355 594 567 347 --11165 --
NM_017694chr242033 2025 243 41 ------
NM_017700chr42172 107 ------
NM_017709chr193609 3580 3550 3338 2781 2769 417 118 52 ------
NM_017715chr73287 202 111 ----1132
NM_017730chr34625 260 213 194 --154 --
NM_017736chr1663085 2861 2635 2588 728 266 144 --22608 1027
NM_017737chr131360 499 85 --11920 --
NM_017740chr1641821 1787 366 37 --1177 --
NM_017741chr41442 ----1629
NM_017745chrX----1647 --
NM_017753chr911015 1778 ----
NM_017754chr694457 3863 3542 3475 3172 1624 883 564 418 --11538 --
NM_017762chr151226 1660 ----
NM_017768chr11615 1844 ----
NM_017770chr631989 1067 573 1594 ----
NM_017778chr8137 --1157 --
NM_017780chr82830 756 ------
NM_017787chr1072815 2497 1140 1115 815 361 80 22892 393 32830 656 90 12210
NM_017798chr2031164 334 39 ------
NM_017799chr1441721 1682 732 702 --11784 1292
NM_017810chr16190 ------
NM_017811chr962694 2682 2602 2526 602 250 12995 2694 340 --
NM_017813chr854940 4010 2256 2044 141 24344 898 11111 --
NM_017824chr1052297 2191 2110 976 89 ------
NM_017831chr1884740 4677 3101 3078 1575 1186 917 810 --33628 1050 201 --
NM_017848chrX104466 4320 3789 3771 3537 3281 1680 824 398 177 --11718 23293 1672
NM_017849chr253168 2829 1235 852 401 --31223 318 141 --
NM_017856chrX31974 1347 94 1395 ----
NM_017857chr11----1237 --
NM_017860chr11597 ------
NM_017864chr82213 165 ------
NM_017902chr10115220 5180 4585 3976 3890 3778 1668 466 403 118 77 24428 582 14991 --
NM_017913chr91334 ------
NM_017915chr123996 836 368 --1390 --
NM_017919chr974913 4699 2270 1915 1213 664 574 --42007 1747 1582 1096 --
NM_017922chr141679 --1593 --
NM_017925chr931860 1277 264 ------
NM_017938chrX193 ----11826
NM_017944chr1121970 481 ------
NM_017957chr1761492 1315 1047 550 231 134 ------
NM_017994chr732540 2484 650 42778 2032 938 863 11983 --
NM_018003chr1522041 1802 --1787 --
NM_018011chr13--1248 ----
NM_018014chr211269 ------
NM_018015chrX1182 ------
NM_018017chr10--12278 2636 76 12742
NM_018018chr121112 ------
NM_018027chr1043163 2799 2302 1042 23085 2164 --12440
NM_018060chr11359 ------
NM_018061chr1----2542 430 --
NM_018078chr4--1761 160 --
NM_018092chr1631219 1096 297 --11156 --
NM_018097chr1521021 161 ------
NM_018099chr12167 ------
NM_018112chr91153 --1227 --
NM_018121chr1042157 2100 2081 801 --12553 --
NM_018139chr14264 21 ------
NM_018155chr363440 2665 2513 2480 1290 1151 13062 ----
NM_018184chr311777 --22085 628 --
NM_018191chr132551 86 --1524 --
NM_018200chr1511827 12055 2793 355 --
NM_018201chr952099 1894 1721 1620 314 --22322 1703 --
NM_018207chr151510 1153 1069 423 81 11437 21537 1249 --
NM_018211chr121407 443 ------
NM_018227chr442796 1163 755 693 --12236 1800
NM_018241chr43297 199 193 ------
NM_018243chr433437 2933 217 --23277 2844 --
NM_018247chr612246 ------
NM_018257chr2052561 2246 2216 852 290 1946 11919 11022
NM_018263chr2----32391 615 211 --
NM_018287chr1031025 368 99 --1412 --
NM_018293chr342831 2638 1097 182 --12347 1804
NM_018299chr813195 1520 22670 1273 13226
NM_018312chr1142204 1976 1528 58 ----1147
NM_018313chr341983 1907 638 272 1195 ----
NM_018314chr112519 156 ------
NM_018315chr421482 440 --2359 271 --
NM_018351chr1264110 3736 3517 2930 1545 1112 --23768 2923 13659
NM_018362chr1123651 1082 13715 ----
NM_018364chr133291 1054 548 --43837 3052 1265 305 --
NM_018373chr14165520 5377 4748 4563 4529 4172 4137 4016 2559 2541 2398 1915 1554 1030 251 209 --45706 5689 5394 4832 --
NM_018374chr733591 1467 792 14993 1418 24980 4398
NM_018375chr1421931 1869 1526 21914 402 --
NM_018383chr221766 61 --11899 11916
NM_018387chr91417 --1494 --
NM_018403chr373901 3892 3017 2715 2690 2590 124 --33917 679 315 --
NM_018406chr33397 117 34 ------
NM_018416chr1242215 1050 925 374 ------
NM_018424chr941541 1165 673 219 ------
NM_018425chr1042583 2089 1034 984 ------
NM_018427chr16------1455
NM_018433chr2277 70 ------
NM_018440chr8117624 7249 6651 6411 5806 2190 1931 1800 1267 835 461 38171 7583 430 ----
NM_018444chr831580 400 152 --1924 --
NM_018462chr33788 295 151 --1561 --
NM_018464chr10--1101 ----
NM_018469chr1721060 398 11212 ----
NM_018471chr23467 170 111 ------
NM_018475chr4--1161 ----
NM_018477chr141158 ------
NM_018482chr81360 --11946 --
NM_018489chr11817 ------
NM_018509chr1721438 320 11071 ----
NM_018553chr1731814 1665 1348 11626 ----
NM_018557chr211374 1651 21482 486 --
NM_018566chr154668 4533 3851 3821 1907 15113 153 --
NM_018638chr1243860 3649 2111 314 23740 1034 12146 --
NM_018640chr1212794 ------
NM_018660chr842932 2756 2570 122 --12471 --
NM_018672chr172741 733 ------
NM_018683chr2021672 185 --1441 --
NM_018688chr83965 141 24 ------
NM_018695chr522430 1676 --11619 --
NM_018703chr16173 ------
NM_018704chr13792 420 65 ------
NM_018710chr81529 --1127 --
NM_018712chr11----1278 1467
NM_018718chr761978 1924 1618 1481 918 527 11939 --1225
NM_018837chr20----1152 --
NM_018840chr201343 ------
NM_018846chr73852 718 22 ----2348 35
NM_018898chr521707 311 --1562 --
NM_018899chr521707 311 --1562 --
NM_018900chr521707 311 --1562 --
NM_018901chr521707 311 --1562 --
NM_018902chr521707 311 --1562 --
NM_018903chr521707 311 --1562 --
NM_018904chr521707 311 --1562 --
NM_018905chr521707 311 --1562 --
NM_018906chr521707 311 --1562 --
NM_018907chr521707 311 --1562 --
NM_018908chr521707 311 --1562 --
NM_018909chr521707 311 --1562 --
NM_018910chr521707 311 --1562 --
NM_018911chr521707 311 --1562 --
NM_018945chr651272 759 653 117 27 1628 1257 --
NM_018948chr11180 ------
NM_018953chr121813 ------
NM_018970chr712467 ----1423
NM_018976chr1221960 114 --12008 11842
NM_018992chr1651574 1426 1275 1137 1026 --11241 --
NM_018999chr1024654 413 --23691 541 --
NM_019000chr51622 --11457 --
NM_019001chr384888 4735 2967 1595 1379 1327 1071 505 23810 1027 24648 3190 --
NM_019002chr22104 22 ------
NM_019004chr7--22354 2204 176 --
NM_019006chr152195 153 ------
NM_019009chr1142450 1817 610 85 --22040 678 --
NM_019027chr451778 1596 793 660 218 ------
NM_019035chr411505 --11995 --
NM_019042chr72287 83 ------
NM_019045chrX1362 --1586 --
NM_019053chr1031054 428 340 ------
NM_019063chr221769 811 ------
NM_019064chr172800 138 ------
NM_019071chr71318 161 ----
NM_019072chr574173 4015 3089 1596 1429 1118 305 ------
NM_019084chr1021901 299 1563 ----
NM_019087chr581477 1424 1131 588 415 357 347 23 --21308 129 --
NM_019094chr1253648 2858 2399 1339 1261 ------
NM_019102chr7169 ------
NM_019102chr7169 ------
NM_019106chr2242867 2635 1243 735 1890 1425 13428
NM_019114chr92710 153 --12409 11006
NM_019555chr321674 548 ------
NM_019590chr1011454 --11132 --
NM_019592chr91882 1169 2276 144 1132
NM_019594chr941635 1058 568 199 --11174 --
NM_019597chrX1125 ------
NM_019600chr151102 ------
NM_019604chr111899 1259 1768 --
NM_019610chr132066 1889 1629 1198 ----
NM_019845chr21846 --1208 --
NM_019891chr121143 151 --11315 --
NM_019895chr321179 252 --1327 --
NM_019903chr1031506 531 164 1122 ----
NM_020120chr261609 1070 1029 237 142 128 --11499 --
NM_020122chr285957 5893 5689 5265 2147 1484 1353 1310 --64967 4076 3765 2378 1235 254 15600
NM_020123chr1041421 1159 966 528 ------
NM_020130chr82188 123 --11354 2894 71
NM_020141chr162306 2159 739 420 391 359 ------
NM_020144chr721986 348 --11737 --
NM_020148chr182570 74 12308 22796 1907 --
NM_020168chr1511289 --11241 --
NM_020178chr1721053 475 1986 1400 --
NM_020182chr20----13533 1684
NM_020184chr242269 2244 748 272 --11738 --
NM_020193chr111315 --1934 --
NM_020198chr171191 1421 1433 --
NM_020199chr5147 ------
NM_020200chr103474 436 419 ------
NM_020204chr11636 --188 --
NM_020205chr143028 2587 1008 266 --12240 12631
NM_020228chr1132225 1569 184 --11692 11995
NM_020235chr31135 ------
NM_020239chr142324 2142 1592 160 ------
NM_020251chr113683 641 276 --1500 --
NM_020310chr1772559 1853 874 728 654 597 206 --2224 151 12742
NM_020336chr2021092 440 1944 33884 2961 166 --
NM_020341chr203616 588 274 ------
NM_020342chr252484 1916 684 385 229 --22095 264 --
NM_020345chr32879 402 1819 ----
NM_020347chr352023 1884 850 739 184 --32212 2110 121 1864
NM_020362chr14854 714 703 82 ------
NM_020374chr1221347 337 11442 ----
NM_020381chr641995 635 258 91 ------
NM_020382chr1221282 296 ------
NM_020386chr31100 --1121 --
NM_020390chr344369 3727 1685 742 ------
NM_020403chr1311721 ------
NM_020405chr17114192 4012 3969 3246 1792 1359 1230 942 766 681 74 --23942 29 --
NM_020420chrY21570 406 --1223 21415 648
NM_020429chr773143 2633 1210 753 481 315 164 --11943 --
NM_020432chr7181 ------
NM_020440chr163208 2765 2102 882 709 189 ------
NM_020443chr1166988 5838 4991 2692 2670 2614 2607 2444 1985 1931 1413 1334 371 270 253 96 --12451 25107 2005
NM_020444chr5121 ------
NM_020452chr131722 657 548 --1122 --
NM_020456chr1332113 1734 739 --11517 --
NM_020457chr164465 220 126 28 --2256 191 --
NM_020466chr644259 4163 1380 606 24434 3313 11440 --
NM_020474chr1831541 470 147 --1718 --
NM_020546chr552392 501 438 421 125 --23203 957 --
NM_020630chr101115 ------
NM_020640chr3----31461 770 659 --
NM_020644chr113331 237 121 ------
NM_020647chr842211 1790 640 103 --12131 --
NM_020673chr20106481 6464 6441 5802 5696 2834 2322 1900 1031 23 12926 --17499
NM_020682chr1021125 831 --1381 --
NM_020689chr2091682 1655 1439 1285 1146 573 368 249 24 --1152 1284
NM_020699chr175348 4317 3494 3427 1795 1140 1101 1697 ----
NM_020703chr1----2582 26 --
NM_020708chr2052502 2168 1775 905 585 --11798 --
NM_020717chrX54442 4061 3924 2018 376 --34954 3419 688 21896 602
NM_020718chr1654681 1416 891 752 320 1472 54887 4852 4538 1502 845 1914
NM_020727chr21----13594 11451
NM_020728chr732881 2288 260 --21275 838 --
NM_020732chr6--1350 ----
NM_020734chr1253078 3023 2101 1239 527 22839 1206 23052 238 --
NM_020740chr171402 --1158 --
NM_020742chrX32054 1891 443 --32233 883 611 --
NM_020747chr51275 ----1847
NM_020748chr17----1566 --
NM_020749chr821572 201 --31445 181 25 --
NM_020752chr1062293 2243 870 769 678 305 21995 782 1194 11107
NM_020762chr121240 --1796 --
NM_020766chrX33473 3441 3203 ----14130
NM_020768chr551981 784 734 666 478 --22579 2152 --
NM_020769chrX----1949 --
NM_020772chr17118504 8114 6710 2795 2769 2282 2202 1673 921 327 199 21563 758 15415 --
NM_020773chr462669 2431 2416 1648 527 388 1998 ----
NM_020774chr1885854 5162 4880 2290 1033 630 606 519 --15699 11240
NM_020778chr1571601 931 862 742 492 465 311 14454 53983 3750 1357 143 73 13676
NM_020791chr1711350 11232 ----
NM_020794chr1------1541
NM_020796chr552037 1122 739 271 208 --13018 1538
NM_020801chr512429 1528 22581 409 --
NM_020803chr421495 444 1834 ----
NM_020805chr1841773 627 495 463 --1220 --
NM_020808chr12988 161 --1276 11041
NM_020810chr1473306 3228 3131 3095 1422 995 34 11441 ----
NM_020819chr6--11026 ----
NM_020826chr113982 517 130 12364 ----
NM_020839chr321126 99 --1290 --
NM_020841chr1242986 1167 918 142 --13385 --
NM_020843chr152425 353 ------
NM_020854chr1811292 --1448 --
NM_020856chr1941551 1392 1380 347 --1611 --
NM_020859chr41536 --1636 --
NM_020870chr42443 129 ------
NM_020871chrX32456 1746 603 --12141 --
NM_020872chr331162 401 288 --2659 234 1580
NM_020873chr3199 1194 184 --
NM_020917chr1943343 3015 510 373 --1589 --
NM_020918chr1043534 3389 3338 1142 --23444 1393 --
NM_020919chr21109 ------
NM_020921chr1431352 1284 1233 11168 13038 --
NM_020922chrX31246 690 437 ----11690
NM_020935chr2124530 4524 4517 4420 4117 3973 3774 3664 3300 3104 1643 936 13047 ----
NM_020940chr103383 318 62 22027 1005 ----
NM_020946chr981721 1548 1473 1431 608 503 354 68 ------
NM_020947chr1632287 2179 1942 --1763 --
NM_020948chr123378 3359 --2666 190 --
NM_020958chr142288 86 2248 239 ----
NM_020975chr1041380 683 126 27 11573 ----
NM_020983chr1252002 1690 1637 214 55 --1839 --
NM_021003chr142245 199 ------
NM_021012chr1782607 2520 2388 1998 1034 549 218 111 --1666 --
NM_021013chr172353 77 ------
NM_021033chr1323325 2170 --1528 --
NM_021038chr353359 2947 2444 2323 657 21140 373 ----
NM_021064chr62597 56 --1586 1137
NM_021069chr442034 1928 1667 1401 ------
NM_021072chr552557 1768 1629 695 684 ------
NM_021078chr17151 ------
NM_021090chr2284822 4579 4127 4008 3422 1399 1228 943 --13549 --
NM_021097chr252835 2018 1929 1910 724 ------
NM_021115chr22----1123 --
NM_021116chr7117191 6681 5479 3501 3277 3029 2857 2744 1518 1487 934 --36515 2037 1871 --
NM_021120chrX62194 2016 1943 1206 826 613 --22932 355 --
NM_021140chrX1182 ----1875
NM_021144chr92515 99 ----1153
NM_021145chr72474 152 ------
NM_021155chr1982998 2654 2113 1082 959 913 673 475 --188 --
NM_021159chr431486 1189 189 11494 1611 --
NM_021161chr14----193 --
NM_021174chr83719 649 304 ------
NM_021180chr12747 525 ------
NM_021183chrX22375 930 --1522 --
NM_021188chr141360 --2514 117 --
NM_021190chr121258 1208 11136 11267 --
NM_021194chr1258 29 ------
NM_021202chr2052984 2167 2122 2014 1197 --22959 2197 --
NM_021215chr202624 145 --2233 139 --
NM_021222chr131106 520 77 ------
NM_021229chr121236 1866 --1805
NM_021238chr1231780 1589 181 ------
NM_021239chr14160 ------
NM_021240chr9--2702 128 ----
NM_021253chr621366 570 --11377 --
NM_021255chr1443570 2749 1396 488 32646 1436 27 13009 1330
NM_021269chr1921562 110 ------
NM_021614chr5----132 --
NM_021627chr321065 766 --1277 --
NM_021629chr384365 3792 3698 3452 1986 1907 1331 793 --14974 --
NM_021637chrX31057 1039 279 ------
NM_021638chr473661 3327 3136 1963 1362 504 117 23040 1567 23803 210 --
NM_021639chr11818 ------
NM_021643chr2121 21698 1526 11588 --
NM_021644chr10--1867 155 --
NM_021705chr621286 1026 1604 ----
NM_021722chr7--1470 ----
NM_021784chr20----181 --
NM_021813chr695186 4939 4847 3830 3638 1958 1759 1606 1153 ----15544
NM_021831chr2----1329 --
NM_021911chr5114655 3443 2101 2088 1737 1649 997 655 567 321 35 --44598 4446 2076 526 --
NM_021912chr1553729 3162 1394 1256 28 ------
NM_021913chr1961813 1533 1339 1323 1211 294 --21370 1231 51559 1290 1270 1248 266
NM_021914chr14--11569 ----
NM_021940chr611634 --21677 1565 --
NM_021947chr1721303 423 --192 --
NM_021952chr1--1129 ----
NM_021956chr61170 --1140 --
NM_021960chr192053 1094 626 579 542 300 266 74 28 ------
NM_021961chr11176856 6664 6431 6411 6401 5927 5907 5019 2901 2275 1469 1438 1321 1075 831 503 141 --25400 1452 --
NM_021962chr1772102 1938 1572 877 628 112 68 12428 ----
NM_021964chr396206 5322 4194 2231 1970 1931 1631 1493 618 --56266 2356 2298 1102 288 11321
NM_021965chr9197 ------
NM_021967chr51458 --11141 --
NM_021970chr4------1292
NM_021977chr683494 3457 3227 815 784 754 699 335 11036 ----
NM_021998chrX--1113 ----
NM_022037chr21129 ------
NM_022048chr1596304 6147 4516 4479 1582 743 267 86 37 --1206 --
NM_022051chr11174 ------
NM_022058chr231973 345 85 ------
NM_022063chr1041477 463 166 33 --11791 --
NM_022073chr1431093 655 272 ------
NM_022079chr101938 ------
NM_022130chr53460 284 162 ------
NM_022133chr821620 561 ------
NM_022143chr721214 1099 --182 --
NM_022166chr16104885 4750 4408 2508 2466 2157 1173 871 609 509 15474 34480 1110 324 25618 2297
NM_022169chr1141378 508 170 84 --21472 345 11011
NM_022173chr21129 ------
NM_022340chr363552 3355 2936 2403 1045 460 1288 ----
NM_022346chr431219 1196 273 ------
NM_022444chr711976 174 ----
NM_022456chr1236661 6020 5848 --1104 15671
NM_022458chr753159 3021 2035 224 51 --42922 2512 2104 598 --
NM_022459chr1346237 5765 1424 1308 --44897 4603 453 229 --
NM_022462chr1973758 3393 3071 3044 987 512 185 63330 3015 2709 2556 2526 1332 53058 2653 2386 1354 552 --
NM_022473chr1564174 3137 1541 1206 1068 1057 --21135 439 --
NM_022474chr1432089 2036 595 21128 235 1648 1663
NM_022484chr7----1429 --
NM_022574chr741994 1763 784 80 --11860 1276
NM_022576chr11332 ------
NM_022648chr284197 3852 3519 3260 1549 1241 1042 97 11521 23545 768 --
NM_022650chr5----1149 --
NM_022719chr2263773 3103 2724 1384 814 72 ------
NM_022726chr62266 257 ------
NM_022730chr23991 981 207 11054 ----
NM_022735chr131169 206 197 --21552 164 --
NM_022739chr171270 21167 29 1764 --
NM_022758chr662720 884 507 473 111 50 ------
NM_022763chr312716 --11192 --
NM_022776chr31354 ------
NM_022780chr251715 1701 1220 527 94 ------
NM_022781chr922482 1214 --22914 222 --
NM_022802chr1021310 106 11482 ----
NM_022818chr1611534 --11338 --
NM_022826chr21195 ------
NM_022828chr531550 327 65 --11163 --
NM_022831chr12343 192 1738 ----
NM_022834chr12323 123 ----1952
NM_022841chr1532519 524 156 ----1902
NM_022843chr13144 ------
NM_022898chr1443368 2999 798 501 --11673 --
NM_022902chr5--1277 ----
NM_022912chr221207 847 21168 615 ----
NM_022913chr51237 ------
NM_022918chr1111587 --21468 217 --
NM_022977chrX22250 2099 --11795 --
NM_022978chr51458 --11141 --
NM_023000chr1411600 ------
NM_023001chr1411600 ------
NM_023009chr11166 ------
NM_023010chrX1698 ------
NM_023012chr122699 38 1111 ----
NM_023016chr242116 1040 820 187 --11943 --
NM_023071chr121965 161 11018 --
NM_023079chr1741787 1443 1335 100 ------
NM_023112chr1482708 2659 1931 1133 690 589 477 70 --11815 --
NM_024007chr54988 871 362 44 ------
NM_024015chr172781 225 ------
NM_024052chr1763019 1198 1138 709 534 119 ------
NM_024057chr12123 ------
NM_024076chr1972333 1799 1724 616 459 199 59 --11521 --
NM_024077chr91605 --158 --
NM_024294chr662720 884 507 473 111 50 ------
NM_024295chr841994 1715 478 184 ------
NM_024296chr1153 ------
NM_024411chr2021055 550 ----1247
NM_024424chr112986 70 1885 ----
NM_024425chr112986 70 1885 ----
NM_024426chr112986 70 1885 ----
NM_024429chr71180 ------
NM_024511chr452810 2195 924 856 419 22804 896 --13554
NM_024513chr373605 2827 2531 1526 669 232 151 23201 2893 ----
NM_024519chr161109 ------
NM_024520chr2--131 ----
NM_024524chr332252 819 792 ------
NM_024539chrX11242 ------
NM_024541chr102659 378 11710 11396 --
NM_024546chr13----21121 182 --
NM_024551chr1251996 1852 1569 272 141 ----2835 509
NM_024551chr1251996 1852 1569 272 141 ----2835 509
NM_024557chr113615 415 322 --1518 --
NM_024558chr14--1957 --129
NM_024561chr1331347 31 21 --1296 --
NM_024567chr8----159 --
NM_024569chr142127 1111 697 127 1304 ----
NM_024580chr15122 ------
NM_024581chr6--153 ----
NM_024582chr41163 --1402 --
NM_024586chr11137 ------
NM_024594chr51351 --11605 --
NM_024595chr121246 418 ------
NM_024613chr821860 1512 --171 --
NM_024621chr31160 ------
NM_024631chr112158 29 --2492 99 --
NM_024632chr5----1185 --
NM_024638chr391895 1767 793 742 528 387 263 232 183 11550 2470 328 --
NM_024639chr652025 2006 1976 1838 1108 32257 2175 862 183 --
NM_024646chr133425 3003 1480 11115 22502 319 1276
NM_024665chr364303 3105 3094 1326 1237 696 13951 ----
NM_024670chr1041217 658 358 80 --11482 11403
NM_024674chr143251 3200 2191 386 --12701 --
NM_024676chr131226 258 67 1475 ----
NM_024686chr12584 217 ------
NM_024692chr221277 253 --2586 246 11305
NM_024704chr201393 ------
NM_024721chr81481 --1809 2546 67
NM_024740chr1133952 3623 747 ------
NM_024751chr441853 769 409 159 ------
NM_024753chr23500 242 212 ------
NM_024755chr151679 1350 1111 --
NM_024757chr931118 801 76 --1395 --
NM_024769chr1141141 817 139 53 ------
NM_024785chr221483 438 ----11311
NM_024812chr821859 1701 ----11652
NM_024817chr1584559 1896 1852 1623 1342 1145 957 678 --14178 --
NM_024828chr931139 471 119 ------
NM_024830chr561970 1770 1683 1540 1410 1384 --11943 --
NM_024834chr1031969 1716 172 --1616 --
NM_024835chr171120 ------
NM_024874chr131327 1247 1187 --11225 --
NM_024887chr181800 1476 1316 856 716 603 533 182 1423 12164 --
NM_024896chr932126 1674 1625 --12164 --
NM_024906chr4166 1989 --1238
NM_024920chr41302 1488 ----
NM_024930chr562675 2079 2053 1772 619 393 ------
NM_024947chr378989 8673 8266 7118 2079 1918 238 27183 6567 28154 2322 --
NM_024949chr434617 4164 1969 ------
NM_024953chr122127 31 11945 22460 699 11128
NM_024960chr20272 54 ------
NM_024969chr21827 1677 ----
NM_024989chr287758 7683 7365 6989 5396 4966 2769 263 23282 2612 15048 16161
NM_025054chr842979 2829 235 193 --13544 --
NM_025073chr143965 3767 3080 1077 13465 1476 --
NM_025074chr443033 2870 1032 469 11197 --12882
NM_025076chr21559 ----191
NM_025077chr1--1200 ----
NM_025104chr1761799 1252 1194 1102 249 114 --1537 --
NM_025106chr121225 182 11443 11670 --
NM_025133chr231074 754 225 ------
NM_025134chr1632101 768 175 --1150 --
NM_025137chr151320 --144 --
NM_025138chr131388 --1241 11047
NM_025146chr312093 1171 11907 --
NM_025147chr23806 272 158 138 1756 --
NM_025154chr761448 996 600 381 368 242 --11007 11060
NM_025160chr132755 1612 937 1525 11533 12611
NM_025164chr1122231 1565 ------
NM_025176chr203547 119 71 ------
NM_025179chr194381 4048 4039 4002 3277 1491 1427 1102 142 ------
NM_025180chr352928 2692 2629 1234 1094 --33303 2939 236 --
NM_025182chr92729 162 --2934 848 --
NM_025184chrX1325 ------
NM_025187chr1651203 1152 1078 340 332 ------
NM_025191chr132497 1252 957 12508 1422 --
NM_025195chr851801 1710 762 721 536 1165 1603 --
NM_025235chr10--21422 301 ----
NM_030583chr8--1398 ----
NM_030594chr1541096 976 919 249 --1550 --
NM_030621chr1431615 1336 80 --23277 405 --
NM_030623chr221236 638 --41639 1123 1076 498 --
NM_030627chr523296 1625 --1168 --
NM_030629chr163514 412 239 ----11546
NM_030647chr765821 5774 5263 4855 3847 520 --45551 4791 4060 751 --
NM_030648chr465173 4894 4487 4255 1643 135 14817 ----
NM_030664chr1022480 2322 --1492 --
NM_030667chr1251051 816 378 192 158 --1860 --
NM_030668chr1251051 816 378 192 158 --1860 --
NM_030669chr1251051 816 378 192 158 --1860 --
NM_030670chr1232083 1848 118 1265 11892 --
NM_030671chr1232083 1848 118 1265 11892 --
NM_030674chr1295666 4891 4217 3913 3809 3609 1066 700 583 13823 23760 364 --
NM_030756chr10--1223 ----
NM_030763chrX----1573 --
NM_030784chr6----1380 --
NM_030786chr11591 21798 214 --1170
NM_030797chr2----1245 --
NM_030799chr531903 1411 705 1505 1669 --
NM_030806chr1149440 7650 6839 6813 5962 3735 3727 2920 2216 1971 1707 1632 1479 954 39338 7219 5763 13493 --
NM_030809chr1242350 1983 1959 1821 ------
NM_030816chr1--13434 ----
NM_030881chr2232368 2359 33 ------
NM_030884chr342287 1569 1502 284 --11412 1476
NM_030885chr362291 1794 1496 1469 737 705 ------
NM_030920chr141935 1848 1420 246 --121 --
NM_030937chr151337 1270 943 592 132 ------
NM_030960chr6150 --1362 --
NM_030964chr583532 2923 2687 2345 1432 1165 772 411 ------
NM_031203chr191235 ------
NM_031243chr7----1535 --
NM_031262chr91915 ------
NM_031263chr91972 ------
NM_031267chr7182 --146 --
NM_031283chr21628 ----179
NM_031291chr41196 1554 ----
NM_031305chr461790 1309 679 53 43 32 --1535 --
NM_031314chr14----11750 --
NM_031371chr1--11092 21598 566 --
NM_031371chr1--11092 21598 566 --
NM_031372chr411519 11414 1110 --
NM_031411chr521707 311 --1562 --
NM_031417chr1952446 2091 1927 700 358 11913 21860 547 --
NM_031419chr31296 ------
NM_031427chr1454887 2231 1794 1314 512 25903 5199 25645 87 --
NM_031442chrX42758 2341 1097 616 ------
NM_031445chr243351 2603 2464 574 --23263 3041 --
NM_031453chr1052281 2122 1965 1859 248 12427 ----
NM_031467chr5----1267 --
NM_031468chr7147777 7689 7672 7522 6976 6512 6420 6001 5778 2924 2735 2235 1647 1346 --67375 6334 5060 1183 423 66 --
NM_031476chr1672642 2548 1915 1794 1015 875 205 1658 ----
NM_031483chr2022919 96 --1566 --
NM_031844chr1103776 3066 2952 2691 2685 1080 742 688 418 276 --1460 --
NM_031845chr253282 1465 679 513 64 --13407 --
NM_031847chr253282 1465 679 513 64 --13407 --
NM_031849chr521707 311 --1562 --
NM_031857chr521707 311 --1562 --
NM_031860chr521707 311 --1562 --
NM_031866chr103721 397 285 ------
NM_031892chrX2846 48 ------
NM_031900chr51443 ------
NM_032012chr934730 3623 1285 1933 44739 4526 2084 1195 --
NM_032041chr862403 2127 2077 304 221 53 22578 351 11838 --
NM_032047chr31899 1148 ----
NM_032051chr221222 --2686 526 --
NM_032102chr1132660 1077 347 --13054 --
NM_032121chrX62662 2442 1794 1753 1137 744 --22711 2375 --
NM_032123chr194499 489 382 196 ------
NM_032144chr211808 --1618 --
NM_032146chr32366 126 ------
NM_032147chr12------1381
NM_032160chr1894351 4220 4202 4064 3714 2687 1435 1255 913 1626 11174 14110
NM_032175chr51590 1446 21289 76 --
NM_032181chr21321 1782 ----
NM_032182chr101545 --11038 --
NM_032186chr151346 1253 1200 373 308 --1353 --
NM_032189chr1395015 4214 3584 3459 1638 1303 1297 1132 927 14584 22022 1826 --
NM_032199chr1012527 1810 --12944
NM_032217chr431019 467 29 ----1453
NM_032221chr2021299 705 ------
NM_032228chr1142455 2184 918 439 11114 12167 --
NM_032229chr13140 --1805 --
NM_032231chr153364 126 75 ------
NM_032239chr411005 --2915 36 --
NM_032256chr121892 1251 ----
NM_032281chr1942689 2576 2406 647 --13138 --
NM_032288chr32514 35 --1359 --
NM_032299chr111257 ------
NM_032303chr931591 1367 148 1206 ----
NM_032312chr21221 ------
NM_032319chr23417 397 36 ------
NM_032325chr1131766 194 49 1688 11713 --
NM_032368chr15547 511 412 238 229 --196 --
NM_032369chr121139 ------
NM_032373chr1044683 3793 1542 702 --35762 3753 2015 --
NM_032410chr81141 ------
NM_032412chr51237 1139 ----
NM_032413chr151137 --173 --
NM_032424chr1131561 1349 213 ------
NM_032434chr241627 1218 271 115 --21062 86 --
NM_032436chr132878 769 ------
NM_032438chr61595 ------
NM_032440chr1031968 540 280 12014 ----
NM_032445chr1542424 2203 708 50 ----1610
NM_032446chr572473 2350 1481 797 727 502 481 --1569 --
NM_032457chr432554 1347 1115 21384 174 23658 3092 --
NM_032458chrX73458 2928 2484 2284 2111 918 826 ------
NM_032468chr811232 ------
NM_032486chr16102201 2174 2083 1956 1938 1653 1045 913 527 512 --1624 1158
NM_032491chr123907 305 238 ----186
NM_032505chr342646 902 653 368 1416 1853 --
NM_032510chr1822526 2233 --1759 --
NM_032511chr61365 ------
NM_032521chr2053241 2651 2478 2212 403 ------
NM_032523chr23453 421 144 ------
NM_032539chrX2735 119 1722 ----
NM_032547chr431179 156 68 11327 --1216
NM_032550chr102822 784 --3338 157 25 --
NM_032552chr951872 1591 1530 1473 99 --21920 351 --
NM_032560chr1431113 360 199 --11037 --
NM_032564chr111729 --2988 793 --
NM_032569chr162529 134 --2308 127 --
NM_032578chr1051166 614 204 155 66 ------
NM_032582chr1731393 1376 504 11871 1663 --
NM_032595chr1721111 369 ----2449 324
NM_032632chr1411880 11590 ----
NM_032636chr14445 194 60 26 --196 --
NM_032638chr33631 440 372 --11256 --
NM_032682chr312952 --21167 328 12474
NM_032717chr4----1235 --
NM_032737chr1952630 2616 2502 1812 590 1636 1209 --
NM_032801chr1162508 2467 2442 2046 1952 1881 11759 21617 515 --
NM_032802chr15370 57 50 ------
NM_032804chr103882 817 778 ------
NM_032832chr621175 212 --2659 112 --
NM_032833chr142063 1866 1698 409 12165 --12583
NM_032839chr31183 ------
NM_032842chr741404 474 358 82 --21307 121 --
NM_032859chr132594 185 ------
NM_032873chr1144181 3049 207 172 --12959 1876
NM_032883chr202740 28 --1169 --
NM_032884chr13141 68 54 ------
NM_032900chr1041527 1381 1009 315 1504 23251 2739 --
NM_032905chr1021109 1086 --1109 --
NM_032918chr1221105 99 11283 31059 901 252 --
NM_032924chr71918 --1105 --
NM_032932chr17166424 6247 6227 6107 5613 4923 4764 4711 4683 4042 2087 2055 1627 1077 628 391 24736 346 26265 4802 --
NM_032947chr541065 311 279 163 ------
NM_032949chr132484 229 ------
NM_032961chr41948 1935 ----
NM_032968chrX14083 ------
NM_032969chrX14083 ------
NM_032973chrY14075 --13541 --
NM_032998chr11438 ----11086
NM_033012chr132736 189 1833 ----
NM_033020chr194577 3954 3251 1438 1399 1153 869 363 277 --13516 1491
NM_033058chr8158 ------
NM_033081chr2021388 90 ------
NM_033089chr2021272 183 ------
NM_033103chr192938 308 ------
NM_033132chr131104 --11781 --
NM_033138chr712025 --1251 --
NM_033139chr712025 --1251 --
NM_033140chr712025 --1251 --
NM_033143chr471333 1118 1007 647 313 266 181 ------
NM_033157chr712025 --1251 --
NM_033181chr653635 2604 855 832 695 --1509 --
NM_033211chr53842 300 84 ------
NM_033222chr91979 ------
NM_033224chr786697 6589 5696 5526 5492 5345 5076 3036 15987 38036 7851 5599 --
NM_033225chr832143 1956 509 --32606 683 310 --
NM_033274chr5103229 3065 2976 2568 2511 2305 971 947 735 292 --12268 --
NM_033280chr181138 ------
NM_033285chr843307 1709 1107 527 11220 ----
NM_033315chr1741752 1629 865 474 ------
NM_033331chr942909 2526 2293 685 --13314 136
NM_033338chr102527 268 --1180 --
NM_033339chr102527 268 --1180 --
NM_033360chr1263547 3260 3005 1671 816 597 ----13633
NM_033380chrX2255 159 ------
NM_033381chrX2255 159 ------
NM_033387chr9102530 2111 2089 911 577 490 293 160 66 29 1892 22656 739 --
NM_033389chr1794857 4004 1429 1363 804 611 486 368 24 --24616 3380 13187
NM_033393chr422453 1843 12351 1369 --
NM_033402chr8190 --1140 --
NM_033429chr1562122 1069 829 431 311 290 ------
NM_033480chr632740 2225 463 12952 --1613
NM_033481chr632740 2225 463 12952 --1613
NM_033505chr276628 6401 5283 4169 2546 2235 1593 --25353 4872 --
NM_033516chr931483 1469 74 ------
NM_033540chr32998 303 --1136 --
NM_033631chr163889 2904 2696 2381 806 533 ------
NM_033632chr421482 440 --2359 271 --
NM_033644chr562441 2176 2153 1702 347 185 12218 ----
NM_033645chr562441 2176 2153 1702 347 185 12218 ----
NM_033656chr2135133 4905 4099 14256 1431 25807 4273
NM_044472chr11467 ------
NM_052818chr1331903 1817 494 ------
NM_052840chr1541369 1030 997 626 ------
NM_052845chr1272699 2646 1132 1023 599 190 108 --22993 1038 --
NM_052851chr1342152 2127 604 480 --22009 1976 --
NM_052855chr172481 449 1520 ----
NM_052860chr5--1704 ----
NM_052885chr1263839 3653 1086 628 396 168 11575 ----
NM_052886chr812015 11674 --1130
NM_052897chr122596 337 ------
NM_052898chr83441 368 234 ------
NM_052900chr811418 21480 533 ----
NM_052904chr63467 210 69 ------
NM_052906chr22105058 4872 4512 1927 1834 1695 1421 961 281 90 ------
NM_052910chr1321573 552 ----11391
NM_052911chr181717 165 ----
NM_052913chr6----11083 --
NM_052918chr1053416 3077 2573 2320 304 1541 32760 1454 1083 --
NM_052927chr542168 2032 1426 467 --11378 --
NM_052937chr832720 852 265 12150 ----
NM_052978chr143544 290 147 1340 --1280
NM_053016chr965930 5309 5136 2237 1280 280 1471 47151 6985 6862 5033 --
NM_053023chr1172835 2092 846 755 701 670 299 --139 12515
NM_053025chr361338 1132 648 618 569 139 1434 ----
NM_053026chr361338 1132 648 618 569 139 1434 ----
NM_053027chr361338 1132 648 618 569 139 1434 ----
NM_053028chr361338 1132 648 618 569 139 1434 ----
NM_053031chr361338 1132 648 618 569 139 1434 ----
NM_053032chr361338 1132 648 618 569 139 1434 ----
NM_053042chr431009 890 70 --2282 195 --
NM_053043chr7126100 5853 5573 5486 5409 2388 2010 1884 1414 1371 868 339 34257 1536 314 42266 2105 598 485 --
NM_053064chr1443107 2188 699 205 ------
NM_054016chr121286 757 11680 1245 --
NM_054016chr121286 757 11680 1245 --
NM_054016chr121286 757 11680 1245 --
NM_054027chr541959 1499 832 811 --1388 --
NM_054111chr6125 --1714 --
NM_057096chr72461 90 ------
NM_057157chr103424 214 28 175 ----
NM_057159chr951552 1458 1300 636 163 --2302 268 --
NM_057175chr43478 413 31 ------
NM_057178chr1782767 2593 2162 1949 1772 1091 711 687 ------
NM_057749chr8----1418 --
NM_058237chr141187 ------
NM_058240chr14--1208 ----
NM_058241chr2--12338 ----
NM_058241chr2--12338 ----
NM_058243chr19250 25 ------
NM_078476chr63546 331 197 ------
NM_078625chr661043 354 262 208 130 103 ------
NM_078626chr12228 65 --1306 --
NM_080415chr174959 371 206 32 1325 ----
NM_080546chr911989 1754 ----
NM_080550chr1731044 879 27 ------
NM_080617chr201262 3209 134 125 ----
NM_080629chr121321 230 31043 540 459 ----
NM_080630chr121321 230 31043 540 459 ----
NM_080632chrX1698 ------
NM_080669chr1764676 1732 1582 1309 984 893 --21995 1675 --
NM_080682chr13656 553 101 ------
NM_080717chr121199 1333 ----
NM_080738chr131557 681 557 ------
NM_080759chr1331868 485 408 --22189 385 --
NM_080760chr1331868 485 408 --22189 385 --
NM_080764chr2242590 387 142 129 12193 52843 2736 2431 2207 826 --
NM_080867chr1474874 4823 3992 3378 1753 1041 539 --24668 4610 --
NM_080872chr863058 2513 2500 1136 391 125 1209 11005 --
NM_080881chr53496 207 167 ------
NM_080916chr2144 --1155 --
NM_080927chr352976 2917 2463 2140 348 --1836 --
NM_130386chr181172 --1243 --
NM_130387chr3187 ------
NM_130391chr91408 13043 12286 --
NM_130392chr91408 13043 12286 --
NM_130393chr91408 13043 12286 --
NM_130436chr212850 696 --22653 973 --
NM_130438chr2132171 1273 361 --13230 1221
NM_130439chr1021469 592 ------
NM_130439chr1021469 592 ------
NM_130442chr71193 ------
NM_130466chr1241824 1485 235 136 11835 ----
NM_130797chr72345 32 11342 1714 --
NM_130798chr15------11307
NM_130808chr3----1417 --
NM_130811chr2041219 959 743 326 1229 1404 --
NM_130846chr1221072 929 1289 ----
NM_130850chr14--1193 ----
NM_130851chr14--1193 ----
NM_133170chr20118111 6501 6370 5716 2623 2590 2464 2316 1501 368 154 --46821 5990 2247 444 12472
NM_133264chr1763833 3464 1434 1082 981 130 --21270 1132 1194
NM_133265chrX83358 2697 2393 2311 925 836 643 126 --12300 --
NM_133334chr4115047 5028 4844 4763 4217 2145 1888 1384 1220 979 367 1523 26335 875 11419
NM_133369chr51892 ------
NM_133370chr453607 3150 1129 1093 267 12620 ----
NM_133372chr541906 752 188 99 --182 --
NM_133433chr5----1196 --
NM_133452chr1911136 ----1128
NM_133468chr731979 95 41 --31834 1666 25 --
NM_133477chr462933 2276 2228 2109 953 91 --21106 1020 12248
NM_133496chr164543 3894 3736 3122 3005 204 ------
NM_133642chr2231194 1028 814 ------
NM_133646chr255587 5084 4827 4057 276 21096 338 24604 1394 --
NM_133647chr1533462 2610 1212 13302 ----
NM_134265chr1711248 ------
NM_134325chr141497 735 432 21 ----1189
NM_134447chr191403 ------
NM_138270chrX43278 3188 2400 2155 1991 ----
NM_138286chr1922669 1212 --2998 900 --
NM_138288chr1411957 --21563 198 1565
NM_138297chr33397 117 34 ------
NM_138317chr14----193 --
NM_138318chr14----193 --
NM_138328chr17103403 3173 3062 2916 2907 2422 2281 2258 738 399 --33042 2116 117 22383 628
NM_138348chr586221 5685 5606 5571 4089 2623 2522 902 25635 1373 36176 5346 2124 --
NM_138357chr1021444 274 1367 ----
NM_138373chr1951749 1345 558 386 307 ------
NM_138423chr1531723 1418 73 --1202 --
NM_138440chr162562 35 1409 ----
NM_138444chr1354648 4626 3274 1958 987 14431 1560 --
NM_138459chr653490 2673 1295 779 59 ------
NM_138473chr1255112 4682 4547 3437 1142 13992 --1408
NM_138485chr3125 ------
NM_138492chr531511 435 209 --1549 --
NM_138494chr732350 1946 448 ------
NM_138555chr15----1488 --
NM_138559chr211259 ------
NM_138576chr1443368 2999 798 501 --11673 --
NM_138621chr253701 3017 2656 966 764 --23945 2806 --
NM_138635chr752176 1200 1089 634 322 --22641 162 164
NM_138638chr14--11569 ----
NM_138689chr112226 205 ------
NM_138713chr1637726 6335 3307 --26377 5980 --
NM_138714chr1637726 6335 3307 --26377 5980 --
NM_138730chr6--1127 ----
NM_138731chr1413606 21607 1551 1216 --
NM_138735chr221042 560 --1136 --
NM_138766chr5151 ------
NM_138775chr112787 171 ------
NM_138782chr52555 186 --1240 --
NM_138795chr11991 --21279 1244 --
NM_138821chr5151 ------
NM_138822chr5151 ------
NM_138931chr31406 1320 ----
NM_138959chr1116556 5758 5375 5049 2259 1253 946 763 742 374 213 36309 5258 4435 15022 15431
NM_138970chr1431923 365 130 ------
NM_138971chr1153659 3197 1011 991 29 11320 ----
NM_138971chr1153659 3197 1011 991 29 11320 ----
NM_138972chr1153659 3197 1011 991 29 11320 ----
NM_138972chr1153659 3197 1011 991 29 11320 ----
NM_138973chr1153659 3197 1011 991 29 11320 ----
NM_138973chr1153659 3197 1011 991 29 11320 ----
NM_138991chr212162 146 --1759 1262
NM_138992chr212359 343 --1956 1459
NM_139014chr631968 1758 499 22195 301 ----
NM_139035chrX----1557 --
NM_139045chr91226 ------
NM_139046chr10173 ------
NM_139057chr1521816 35 --21923 1155 --
NM_139072chr21867 ------
NM_139135chr1----21354 282 --
NM_139136chr122985 122 ------
NM_139159chr1941275 876 828 316 ------
NM_139167chr81473 ------
NM_139177chr1731279 250 139 --21268 226 --
NM_139181chr111560 125 ----
NM_139199chr5123 ------
NM_139207chr1211543 ------
NM_139242chr152397 80 ------
NM_139244chr62638 623 ------
NM_139245chr3140 --2674 317 --
NM_139273chr112226 94 ------
NM_139283chr1232587 541 143 ------
NM_139321chr2063934 3095 2769 2706 1236 1109 --12934 1803
NM_139323chr201109 ------
NM_144498chr2022038 1914 --21780 547 --
NM_144571chr465537 5186 4921 4717 4341 467 24494 1109 1139 15241
NM_144574chr14139 ------
NM_144578chr1424248 1702 --24029 1406 --
NM_144595chr13------11000
NM_144599chr1565014 2108 696 635 538 331 1856 34227 4047 3559 --
NM_144600chr161323 --1618 --
NM_144618chr12582 310 --21659 1475 --
NM_144633chr331217 1146 315 --1245 --
NM_144660chr10----1268 --
NM_144664chr1111727 ------
NM_144671chr1291787 1510 1278 761 750 712 658 517 173 --21839 155 --
NM_144721chr462402 2185 1832 911 533 111 --22644 150 --
NM_144726chr5--11183 1985 --
NM_144728chr13837 190 66 ------
NM_144729chr13837 190 66 ------
NM_144778chr131822 31031 670 453 1794 --
NM_144949chr221945 634 ------
NM_144963chr842193 1663 1030 706 --32172 1081 658 --
NM_144967chrX1405 --1299 --
NM_144973chr1265337 3522 3510 1890 855 820 15007 ----
NM_144982chr122596 61 --1233 --
NM_145005chr93834 427 254 1963 ----
NM_145011chr10----1154 --
NM_145012chr103416 243 67 --1829 --
NM_145021chr102774 766 ------
NM_145049chr51357 ------
NM_145055chr1841409 1303 393 275 ------
NM_145058chr122404 30 137 ----
NM_145112chr141910 --2426 99 --
NM_145117chr1172852 2821 2599 2424 2392 1248 850 12618 ----
NM_145203chr131155 ------
NM_145204chr153519 33 24 ------
NM_145206chr1052848 2358 2282 1289 217 --12415 --
NM_145234chrX----1697 1614
NM_145235chr101119 ------
NM_145239chr162894 171 --128 --
NM_145251chr1411153 11419 ----
NM_145259chr266842 6447 6401 6369 6064 470 16296 16558 --
NM_145268chr7----21183 89 --
NM_145306chr10----1421 --
NM_145307chr1041473 833 756 500 --23792 1656 --
NM_145320chr752844 2749 2507 927 323 12379 13417 --
NM_145321chr752844 2749 2507 927 323 12379 13417 --
NM_145322chr752844 2749 2507 927 323 12379 13417 --
NM_145331chr61844 1765 144 --
NM_145332chr62992 152 1913 1192 --
NM_145333chr62992 152 1913 1192 --
NM_145341chr102659 503 ------
NM_145649chr611786 --22409 73 --
NM_145655chr611786 --22409 73 --
NM_145686chr253194 2435 1190 1075 341 12201 12843 1247
NM_145687chr253194 2435 1190 1075 341 12201 12843 1247
NM_145693chr252609 1716 1614 565 496 ------
NM_145714chr162373 284 ------
NM_145733chr221424 ----11217
NM_145739chr23453 421 144 ------
NM_145808chr732102 755 37 32940 551 356 ----
NM_145861chr131557 681 557 ------
NM_145909chr6--11102 ----
NM_147150chr933607 2855 219 --33285 3104 187 --
NM_147156chr101472 --1596 --
NM_147166chr71620 ------
NM_147188chr151512 ------
NM_147223chr252076 1763 1757 1556 1502 ------
NM_148174chr832180 1681 760 ------
NM_148414chr162456 367 ------
NM_148415chr162396 307 ------
NM_148416chr162373 284 ------
NM_148571chr1732018 1607 363 --22030 1837 --
NM_148904chr11137 ------
NM_148905chr11137 ------
NM_148906chr11137 ------
NM_148907chr11137 ------
NM_148908chr11137 ------
NM_148909chr11137 ------
NM_148918chr171140 ------
NM_148921chr1762162 2132 2109 1953 1610 58 1585 11827 --
NM_152221chr2231224 886 199 ------
NM_152280chr153012 2984 1051 329 82 ------
NM_152284chr8----190 --
NM_152298chr1173 ------
NM_152300chr1751866 1449 1255 460 329 ------
NM_152344chr176442 320 219 144 110 21 11239 ----
NM_152346chr1731163 329 223 1862 ----
NM_152363chr191205 ------
NM_152373chr12542 114 ------
NM_152387chr23814 179 120 --1164 --
NM_152388chr243952 3035 1202 713 ------
NM_152390chr2----1512 --
NM_152400chr411566 --11584 --
NM_152414chr841115 615 513 162 ------
NM_152424chrX64292 4257 3390 1770 1252 728 14376 ----
NM_152437chr124706 681 218 181 --12135 --
NM_152442chr1211370 --21281 1198 1492
NM_152450chr1541796 1366 659 448 ----1838
NM_152451chr151572 --2317 131 --
NM_152455chr1562538 1052 529 159 72 31 --1400 --
NM_152470chr1874152 3464 3219 2792 2606 1354 1268 --13573 --
NM_152499chr12364 285 --124 --
NM_152529chr264353 4003 3996 3517 3328 290 11125 --1622
NM_152538chr33511 224 194 --1668 --
NM_152542chr431825 1612 440 --1296 --
NM_152545chr42262 195 --1549 --
NM_152556chr732451 2043 34 --11706 --
NM_152574chr92280 57 ------
NM_152581chrX1511 ------
NM_152594chr151333 ------
NM_152609chr11847 11207 2887 53 --
NM_152621chr4--1243 ----
NM_152624chr5116913 6522 6490 6484 5861 5503 5371 5091 1759 1639 1427 --36315 805 517 16734
NM_152629chr943188 2560 1556 630 1354 13515 --
NM_152636chr112715 67 --42702 2563 112 103 --
NM_152638chr1211171 ------
NM_152641chr1222858 31 --21858 723 --
NM_152678chr342124 1966 1021 274 ------
NM_152680chr442306 1765 1656 1537 ------
NM_152724chr1042458 1763 1674 275 --42682 727 687 160 --
NM_152733chr6106318 5130 4887 4614 4187 3930 2424 1774 1713 996 --26106 5953 --
NM_152739chr721159 716 1130 ----
NM_152742chr72449 115 ------
NM_152754chr753571 3178 2935 2668 1511 ------
NM_152756chr564028 3703 3357 1353 627 162 --33408 2936 640 --
NM_152758chr832590 2043 138 --2797 49 --
NM_152763chr11186 ------
NM_152774chr722358 1811 22066 1092 2556 247 1838
NM_152780chrX11159 ------
NM_152787chrX53953 2927 1206 439 406 175 33905 3631 3583 --
NM_152789chr711103 1370 ----
NM_152793chr723922 2071 --11999 --
NM_152835chr122930 1936 --1961 198
NM_152836chr821620 561 ------
NM_152837chr821620 561 ------
NM_152838chr2032695 504 162 --21191 721 33426 1423 1303
NM_152856chrX1155 ------
NM_152857chr63883 94 27 1682 1101 --
NM_152858chr63883 94 27 1682 1101 --
NM_152860chr1251386 1355 1205 113 54 --1271 --
NM_152862chr21107 ------
NM_152878chr22----11592 --
NM_152924chr1586566 5653 2428 2145 1886 939 904 721 16828 36487 2498 2075 --
NM_152991chr11------1714
NM_152994chr2----1450 --
NM_152999chr734162 1838 921 14332 24042 1802 11141
NM_153013chr551759 1727 1010 893 153 --12466 --
NM_153020chr621660 1590 ------
NM_153029chr1673854 3474 3054 3024 2591 836 778 --13172 --
NM_153038chr22733 672 ------
NM_153050chr2284822 4579 4127 4008 3422 1399 1228 943 --13549 --
NM_153051chr2284822 4579 4127 4008 3422 1399 1228 943 --13549 --
NM_153183chrX31109 904 437 ------
NM_153184chr3--1788 ----
NM_153186chr92719 567 --1833 --
NM_153188chr514808 --13644 --
NM_153207chr1211277 1828 22804 184 --
NM_153223chr521541 228 ----131
NM_153226chr1021204 1180 --11065 --
NM_153235chr62331 109 --22129 159 --
NM_153260chr1531318 1170 164 21367 534 11190 --
NM_153261chr1621492 389 ------
NM_153262chr152709 1981 1279 1114 852 1823 12053 11150
NM_153267chr91167 1118 ----
NM_153341chr1----1112 --
NM_153347chr1151833 1790 1732 457 268 --12493 --
NM_153354chr5--1335 --1785
NM_153374chr15173 ------
NM_153449chr121367 ----169
NM_153453chr64222 115 108 55 ------
NM_153487chr694569 3260 3184 1297 786 653 605 539 493 1387 21535 486 --
NM_153605chr3------11268
NM_153607chr532857 2518 1250 23198 835 12499 --
NM_153619chr1531326 218 145 --12645 --
NM_153633chr12165 ------
NM_153634chr1211398 ------
NM_153640chr20272 54 ------
NM_153646chr1441998 1959 1861 487 22567 2190 --12470
NM_153647chr1441998 1959 1861 487 22567 2190 --12470
NM_153648chr1441998 1959 1861 487 22567 2190 --12470
NM_153649chr13484 395 48 --22335 1498 --
NM_153675chr20----181 --
NM_153686chr452398 2058 1925 1688 757 --1996 --
NM_153690chr32748 200 ------
NM_153748chr122985 122 ------
NM_153757chr42189 88 --21181 480 --
NM_153810chr1095042 5036 4623 4571 4171 3136 1614 1115 199 11605 21684 251 --
NM_170665chr1231836 971 692 14527 14113 --
NM_170674chr152966 554 11124 1378 --
NM_170675chr151230 1800 154 --
NM_170676chr151230 1800 154 --
NM_170677chr152966 554 11124 1378 --
NM_170692chr1------11083
NM_170706chr1104107 3620 3115 1658 1649 429 423 384 345 306 --1192 --
NM_170709chr822125 1935 ----12185
NM_170719chr131388 --1241 11047
NM_170720chr1961130 1044 893 424 289 70 11000 ----
NM_170731chr1122470 1784 ----12241
NM_170732chr1122470 1784 ----12241
NM_170733chr1122470 1784 ----12241
NM_170734chr1122470 1784 ----12241
NM_170735chr1122470 1784 ----12241
NM_170739chr111231 ------
NM_170751chr631172 536 512 ------
NM_170752chr631172 536 512 ------
NM_170768chr1141453 1165 127 54 --21749 243 --
NM_170774chr2063395 1650 1578 1315 751 216 ------
NM_170775chr5----132 --
NM_171825chr583009 2743 2470 2341 2313 1178 1014 867 --12006 --
NM_171998chrX32067 144 134 --12022 --
NM_172016chr621366 570 --11377 --
NM_172037chr821068 478 194 11218 --
NM_172069chr262159 1940 853 709 358 151 1551 ----
NM_172070chr231578 894 294 --11821 --
NM_172071chr1117365 6714 6406 6326 6242 2636 2534 2471 2298 2036 1136 ------
NM_172103chr632395 753 534 3519 405 81 11071 --
NM_172105chr632395 753 534 3519 405 81 11071 --
NM_172159chr31133 1726 ----
NM_172160chr31133 1726 ----
NM_172164chr1173 ------
NM_172169chr1061609 1577 1483 1225 63 28 ------
NM_172170chr1061609 1577 1483 1225 63 28 ------
NM_172171chr1061609 1577 1483 1225 63 28 ------
NM_172173chr1061609 1577 1483 1225 63 28 ------
NM_172217chr1573776 3169 2951 2686 1515 1286 67 --13676 --
NM_172232chr172741 733 ------
NM_172315chr152966 554 11124 1378 --
NM_172316chr152966 554 11124 1378 --
NM_172373chr133411 322 136 2474 74 1981 --
NM_173075chr421729 1172 --11355 --
NM_173076chr23946 659 256 ------
NM_173082chr631393 1132 607 --1641 --
NM_173083chr1----11127 --
NM_173157chr122508 395 --1462 --
NM_173172chr22253 133 11002 ----
NM_173198chr922014 153 --32534 778 136 --
NM_173200chr922014 153 --32534 778 136 --
NM_173214chr1637726 6335 3307 --26377 5980 --
NM_173354chr213700 637 35 --1577 1539
NM_173355chr22872 799 ----1125
NM_173359chr361953 1487 1418 1233 147 83 ------
NM_173468chr476001 5430 4770 2433 1357 1040 395 14254 15090 --
NM_173470chrX3674 543 501 --22635 611 --
NM_173473chr103671 536 57 --22029 530 --
NM_173477chr1741953 1272 428 275 --21913 519 --
NM_173500chr15----11280 --
NM_173503chr171123 ------
NM_173510chr223721 586 141 12325 22185 64 --
NM_173511chr243593 290 162 62 --1484 --
NM_173513chr2293 46 ------
NM_173517chr71467 ------
NM_173519chr81184 --1256 --
NM_173560chr62483 76 1573 ----
NM_173570chr332138 646 38 --21361 231 --
NM_173576chr1022116 92 ----12073
NM_173595chr1264614 4173 2085 826 344 331 14939 ----
NM_173602chr1253822 2804 2723 895 138 ------
NM_173609chr154714 596 241 205 ------
NM_173642chr1198753 8593 8143 7935 6556 6310 3584 3462 3297 2955 2406 2244 1497 1081 833 817 334 301 283 --13099 --
NM_173654chr34549 383 252 56 --12262 --
NM_173667chr562248 2215 1618 793 214 90 ------
NM_173670chr52935 280 ------
NM_173694chrX2742 190 ------
NM_173698chrX2544 68 ------
NM_173797chr51439 ------
NM_173808chr144379 2736 369 34 --13575 --
NM_173809chr1021423 1286 --21172 262 1432
NM_173814chr15286 33 --1389 --
NM_173822chr241780 680 489 371 --41813 1801 1475 478 --
NM_173825chr363093 2693 2518 2002 1170 971 ------
NM_173851chr853579 2684 1576 1274 454 --11294 11524
NM_173852chr1127 ------
NM_173854chr152230 1949 793 611 374 --32124 1994 814 --
NM_173872chr41681 ----1813
NM_174911chr853242 2601 1365 718 706 13024 23514 653 --
NM_174936chr141237 860 392 328 ------
NM_175061chr7----1846 1500
NM_175607chr321143 494 11101 ----
NM_175612chr321143 494 11101 ----
NM_175623chr1236661 6020 5848 --1104 15671
NM_175624chr1236756 6115 5943 --1199 15766
NM_175625chr1236756 6115 5943 --1199 15766
NM_175709chr2232049 1965 1067 ------
NM_175736chr12187741 7492 6463 6398 6378 6195 5807 5705 5638 5175 4769 4742 2928 2518 1326 893 570 533 56739 6097 5273 5236 1044 37097 2175 853 --
NM_175747chr66948 387 365 223 155 112 ------
NM_175767chr551471 1293 643 190 36 21892 1865 ----
NM_175854chr13----1314 --
NM_175856chr51286 ------
NM_175863chr6--1350 ----
NM_175920chr5158 --1700 --
NM_175921chr593964 3723 3679 3652 1591 1474 1042 489 197 34105 2678 910 23818 2803 13502
NM_176814chr7--11290 --2383 55
NM_177398chr161719 1485 803 587 300 30 --1259 --
NM_177399chr161719 1485 803 587 300 30 --1259 --
NM_177414chr11552 1468 21704 630 --
NM_177424chr111519 1192 ----
NM_177438chr1431615 1336 80 --23277 405 --
NM_177454chr23818 806 299 ------
NM_177947chrX11643 ------
NM_177948chrX11643 ------
NM_177949chrX2364 25 ------
NM_177952chr142245 199 ------
NM_177968chr222166 32 ------
NM_177972chr1154464 3740 3495 1342 763 13724 13790 --
NM_177974chr1531723 1418 73 --1202 --
NM_177976chr32366 126 ------
NM_177990chr203616 588 274 ------
NM_177996chr2051339 1092 801 613 79 ------
NM_178006chr1342152 2127 604 480 --22009 1976 --
NM_178007chr1342152 2127 604 480 --22009 1976 --
NM_178011chr1043274 2528 707 624 2510 85 1895 --
NM_178033chr1----1468 --
NM_178037chr1273661 3334 2647 2303 892 664 149 13514 ----
NM_178038chr1273661 3334 2647 2303 892 664 149 13514 ----
NM_178126chr171864 11714 12049 --
NM_178140chr51537 ------
NM_178151chrX107817 7763 7172 6514 5740 5519 5428 5017 3143 996 12954 27332 4802 --
NM_178152chrX107817 7763 7172 6514 5740 5519 5428 5017 3143 996 12954 27332 4802 --
NM_178153chrX107817 7763 7172 6514 5740 5519 5428 5017 3143 996 12954 27332 4802 --
NM_178234chr8--161 ----
NM_178313chr231911 821 56 ------
NM_178423chr72190 106 1215 ----
NM_178424chr51546 ------
NM_178425chr72190 106 1215 ----
NM_178427chr111686 --1475 --
NM_178450chr51476 ------
NM_178454chr12547 37 ------
NM_178496chr321299 31 1382 1156 --
NM_178500chr17161 ------
NM_178509chr1773744 3274 1413 949 816 672 137 --1130 1256
NM_178585chr453097 2970 2954 2204 52 ------
NM_178586chr1442412 2138 504 51 --31916 1856 843 1422
NM_178812chr821028 340 ------
NM_178815chr1052129 1713 1079 535 430 --12305 --
NM_178864chr116677 615 497 467 198 92 ------
NM_180989chr1332334 2045 72 1601 11714 --
NM_181077chr1531901 346 185 --12272 --
NM_181302chr14139 ------
NM_181308chr14139 ------
NM_181332chrX32054 1891 443 --32233 883 611 --
NM_181349chr773143 2633 1210 753 481 315 164 --11943 --
NM_181351chr1162999 2369 2185 1092 749 661 12019 32394 2157 594 --
NM_181354chr811224 ------
NM_181358chr121147 497 --23196 660 --
NM_181361chr321419 1136 ------
NM_181442chr202818 691 --1405 --
NM_181481chr18136521 6441 6181 5774 2761 2736 2714 2659 2549 2380 2292 1882 1195 26261 1417 35574 827 342 16198
NM_181482chr18136521 6441 6181 5774 2761 2736 2714 2659 2549 2380 2292 1882 1195 26261 1417 35574 827 342 16198
NM_181483chr18136521 6441 6181 5774 2761 2736 2714 2659 2549 2380 2292 1882 1195 26261 1417 35574 827 342 16198
NM_181486chr121199 1333 ----
NM_181492chr2221094 348 --1313 --
NM_181519chr10129 ------
NM_181527chr204437 294 117 71 ------
NM_181528chr204492 349 172 126 ------
NM_181670chr12----2544 193 --
NM_181671chr172879 793 ----1936
NM_181672chrX41948 514 439 149 --11554 --
NM_181673chrX41948 514 439 149 --11554 --
NM_181674chr5--196 ----
NM_181675chr5--196 ----
NM_181676chr5--196 ----
NM_181677chr5--196 ----
NM_181678chr5--196 ----
NM_181698chr103537 416 67 ------
NM_181702chr81366 --1233 1684
NM_181705chr554608 4565 4551 3711 3550 --33690 1707 1029 1735
NM_181712chr131764 1579 51 1302 21999 797 --
NM_181715chr1------185
NM_181782chr621993 1618 12328 41649 1578 227 160 --
NM_181784chr221623 265 --2426 175 --
NM_181836chr511850 1863 2685 562 --
NM_181839chr81309 --1177 --
NM_181869chr1211042 ----179
NM_181886chr431107 244 168 ------
NM_181887chr431107 244 168 ------
NM_181888chr431107 244 168 ------
NM_181889chr431107 244 168 ------
NM_181890chr431107 244 168 ------
NM_181891chr431107 244 168 ------
NM_181892chr441154 291 215 30 ------
NM_181893chr431107 244 168 ------
NM_181897chr372684 2619 2382 2028 1784 500 178 --195 --
NM_182472chr4137 ------
NM_182485chr412926 --13169 --
NM_182488chr131727 ------
NM_182503chr674413 3999 3404 1931 1864 1147 51 --34512 538 422 --
NM_182527chr2251905 1672 661 646 205 --21402 867 --
NM_182551chr2103184 3075 3023 2902 2856 2819 2604 644 452 322 --32989 2292 664 --
NM_182562chr1532244 2191 70 1317 --1160
NM_182565chr172613 503 --2770 631 --
NM_182607chrX51691 1642 1202 685 435 ------
NM_182641chr1731609 1593 106 --1684 1789
NM_182645chr64222 115 108 55 ------
NM_182646chr412926 --13169 --
NM_182662chr42634 275 ------
NM_182678chr21144 1111 ----
NM_182688chr212354 107 --21973 1664 --
NM_182691chr741327 1188 526 69 ------
NM_182692chr741327 1188 526 69 ------
NM_182700chr71622 --11848 --
NM_182706chr8125 ----1200
NM_182728chr1431423 406 129 ------
NM_182757chr623001 1153 --23536 125 --
NM_182758chr1553446 3376 3149 2828 2740 ------
NM_182763chr182042 1083 615 568 531 289 255 63 ------
NM_182765chr1031548 926 815 --1522 --
NM_182767chr1232049 609 172 --1720 11979
NM_182789chr51758 --11076 --
NM_182796chr51107 --1302 --
NM_182797chr2061694 1660 1393 713 147 51 ----11636
NM_182830chr1432266 97 30 --11581 --
NM_182896chr33743 169 102 --1530 --
NM_182898chr745085 2375 634 98 11081 25138 4793 15856
NM_182899chr745085 2375 634 98 11081 25138 4793 15856
NM_182907chr632215 884 430 11876 11649 --
NM_182910chr142910 119 --1763 --
NM_182913chr142910 119 --1763 --
NM_182914chr142910 119 --1763 --
NM_182936chr14--1208 ----
NM_182964chr1172852 2821 2599 2424 2392 1248 850 12618 ----
NM_182970chr2053216 1617 1602 1134 101 1626 13470 --
NM_182972chr121780 107 --12377 --
NM_182976chr12649 211 ------
NM_182977chr521112 378 ------
NM_183002chr14--1208 ----
NM_183004chr1433459 1175 321 12612 ----
NM_183043chr13------1346
NM_183044chr13------1346
NM_183047chr203884 267 101 1680 ----
NM_183048chr203884 267 101 1680 ----
NM_183075chr472992 1991 1863 1124 913 897 665 12402 22311 63 1577
NM_183078chr693562 3335 2891 2701 1204 899 836 506 34 12670 23808 151 --
NM_183227chr63201 128 111 --196 --
NM_183234chr153626 429 193 ----11509
NM_183235chr153626 429 193 ----11509
NM_183236chr153626 429 193 ----11509
NM_183323chr51758 --11076 --
NM_183397chr2095034 4939 4023 3306 3175 677 319 190 96 24083 3739 ----
NM_183415chr1241824 1485 235 136 11835 ----
NM_184234chr201816 ------
NM_194272chr1521026 234 ------
NM_194282chr431046 518 343 --1938 --
NM_194285chr1132976 2497 551 --1862 --
NM_194286chr1255726 5338 4973 4553 3965 ----12337
NM_194291chr832803 753 747 21982 597 ----
NM_194298chr1051863 1705 1304 476 128 --2714 66 --
NM_194313chr951928 1667 1212 716 55 ------
NM_194314chr164461 3946 2007 1871 579 453 24430 3692 --15108
NM_194317chr242577 2391 781 196 11016 42685 2422 2033 1029 --
NM_194328chr922482 1214 --22914 222 --
NM_194329chr922482 1214 --22914 222 --
NM_194330chr922482 1214 --22914 222 --
NM_194332chr922482 1214 --22914 222 --
NM_194356chr1272264 2244 1975 1658 1522 367 159 --12276 --
NM_194434chr1835373 4476 1351 12037 1606 --
NM_194454chr721177 357 11520 ----
NM_194455chr721177 357 11520 ----
NM_194456chr721177 357 11520 ----
NM_194463chrX11242 ------
NM_197955chr151137 --173 --
NM_198040chr151195 937 161 111 22 ------
NM_198120chr83198 179 144 ------
NM_198123chr811418 21480 533 ----
NM_198124chr811418 21480 533 ----
NM_198128chr1811477 --11737 22156 1576
NM_198151chr71590 --1421 --
NM_198158chr322697 172 --2934 657 1261
NM_198159chr322697 172 --2934 657 1261
NM_198173chr12747 525 ------
NM_198174chr12747 525 ------
NM_198177chr322697 172 --2934 657 1261
NM_198178chr322697 172 --2934 657 1261
NM_198181chr1532600 855 770 --22785 2401 11076
NM_198186chr9--1240 135 --
NM_198187chr9--1240 135 --
NM_198189chr2124 ------
NM_198225chr102441 211 ------
NM_198261chr122699 38 1111 ----
NM_198262chr122699 38 1111 ----
NM_198268chr121147 497 --23196 660 --
NM_198269chr121147 497 --23196 660 --
NM_198270chrX11183 12463 ----
NM_198277chr113361 252 28 --31135 346 210 --
NM_198324chr1231338 408 88 ----1152
NM_198336chr731593 1244 254 ------
NM_198353chr4194 ------
NM_198390chr163514 412 239 ----11546
NM_198392chr641963 871 332 276 12282 12054 --
NM_198395chr531106 1060 237 ------
NM_198399chr311122 1337 21441 91 --
NM_198400chr1532839 2459 2421 ------
NM_198404chr131606 --1202 --
NM_198428chr73515 316 154 ------
NM_198467chr72558 56 ------
NM_198513chr82584 169 --1791 --
NM_198525chr15135 ----1399
NM_198527chr152398 130 ----1232
NM_198560chr353194 1357 888 451 106 --2675 667 --
NM_198570chr7270 29 --196 --
NM_198581chr2107215 6907 6274 4957 4943 4711 2617 2482 1638 838 15883 ----
NM_198595chr473661 3327 3136 1963 1362 504 117 23040 1567 23803 210 --
NM_198715chr156036 3874 903 856 719 24068 997 15260 --
NM_198830chr172780 241 --1815 --
NM_198859chr3125068 4796 4445 4402 4193 4165 3932 3814 3773 1112 1101 491 ----1228
NM_198880chr34625 260 213 194 --154 --
NM_198889chr431019 467 29 ----1453
NM_198896chr1142088 1952 742 649 --1766 --
NM_198900chr12187741 7492 6463 6398 6378 6195 5807 5705 5638 5175 4769 4742 2928 2518 1326 893 570 533 56739 6097 5273 5236 1044 37097 2175 853 --
NM_198902chr152198 173 ------
NM_198903chr51663 ------
NM_198904chr562130 1910 1555 742 663 334 ------
NM_198956chr71622 --11848 --
NM_198965chr12142 ------
NM_198966chr12142 ------
NM_198968chr1353893 3289 2566 622 220 22907 81 ----
NM_198990chr752714 1165 1083 296 40 --192 --
NM_198995chr181191 ------
NM_199005chr9--1857 183 --
NM_199040chr1253648 2858 2399 1339 1261 ------
NM_199121chr12323 123 ----1952
NM_199132chr1942126 1791 501 146 11691 ----
NM_199160chr91789 ----11327
NM_199167chr181385 ------
NM_199169chr20----13533 1684
NM_199170chr20----13533 1684
NM_199171chr20----13533 1684
NM_199180chr194543 533 426 240 ------
NM_199205chr83719 649 304 ------
NM_199320chr422105 806 11963 1907 --
NM_199320chr422105 806 11963 1907 --
NM_199324chr432292 1445 425 ----1887
NM_199334chr171126 ------
NM_199355chr161397 1236 ----
NM_199413chr152685 197 172 ----
NM_199421chr1474874 4823 3992 3378 1753 1041 539 --24668 4610 --
NM_199436chr282998 2734 2606 1917 1226 268 160 105 --12289 --
NM_199437chr1132225 1569 184 --11692 11995
NM_199438chr1132225 1569 184 --11692 11995
NM_199439chr1132225 1569 184 --11692 11995
NM_199462chr174933 4871 4820 4387 3741 1713 422 21624 397 23663 963 12007
NM_199482chr211619 ------
NM_201263chr141949 1921 222 139 ----11371
NM_201266chr242977 2058 2038 389 ------
NM_201269chr151346 1253 1200 373 308 --1353 --
NM_201279chr242977 2058 2038 389 ------
NM_201413chr211947 --2880 290 --
NM_201414chr211947 --2880 290 --
NM_201432chr17106051 5556 5526 5029 4954 4497 2542 1994 1048 408 --31135 978 350 11439
NM_201433chr17106051 5556 5526 5029 4954 4497 2542 1994 1048 408 --31135 978 350 11439
NM_201435chr122514 300 1120 ----
NM_201437chr811016 --1123 --
NM_201524chr1651268 223 202 159 39 --1107 --
NM_201525chr1651268 223 202 159 39 --1107 --
NM_201567chr331618 1341 489 11352 11656 --
NM_201591chr41487 ------
NM_201592chr41487 ------
NM_201613chr12----1254 --
NM_201995chr115725 644 497 155 109 ------
NM_201998chr115790 709 562 220 174 ------
NM_201999chr44911 814 298 132 --1463 195
NM_203283chr41634 ------
NM_203284chr41634 ------
NM_203301chr1411266 11438 --1512
NM_203327chr20104336 4226 3924 3298 3103 1426 1334 849 669 503 13055 ----
NM_203342chr163594 3477 2681 1097 381 92 --53429 2516 2352 167 100 --
NM_203343chr163594 3477 2681 1097 381 92 --53429 2516 2352 167 100 --
NM_203350chr11454 --11490 11533
NM_203382chr541516 1353 1318 141 1537 2669 530 --
NM_203390chr831620 566 299 11525 ----
NM_203391chrX1644 --199 --
NM_203394chr1232234 1035 203 ------
NM_203399chr12300 21 ----1784
NM_203401chr12300 21 ----1784
NM_203413chr17--1235 2946 794 --
NM_203417chr21----1631 --
NM_203418chr21----1631 --
NM_203434chr921145 58 1192 1916 --
NM_203446chr2132146 596 103 1799 ----
NM_203458chr133248 3064 209 --1714 --
NM_203459chr11903 --194 --
NM_203464chr111232 2807 426 ----
NM_203487chr1311721 ------
NM_203499chr173853 844 596 1231 1588 --
NM_203504chr421675 211 ------
NM_203505chr421675 211 ------
NM_205768chr111877 ----11333
NM_205836chr51558 --1272 1484
NM_205846chr531511 435 209 --1549 --
NM_205860chr122928 2603 ------
NM_205861chr181800 1476 1316 856 716 603 533 182 1423 12164 --
NM_206594chr143599 2334 1258 157 22633 2495 ----
NM_206595chr143599 2334 1258 157 22633 2495 ----
NM_206814chr61212 --11463 --
NM_206853chr612937 ----13130
NM_206854chr654198 643 618 171 162 --13294 14391
NM_206855chr655163 1608 1583 1136 1127 --14259 15356
NM_206876chr243152 2357 1390 781 11420 ----
NM_206907chr521250 597 22714 2226 ----
NM_206909chr887442 7077 7046 6480 6236 5844 2353 1172 16006 37979 7339 2586 --
NM_206925chr1542397 2024 1908 65 12521 21940 1082 --
NM_206937chr132845 43 ------
NM_207042chr11665 ------
NM_207043chr171812 1677 905 839 833 583 119 1164 11601 --
NM_207044chr171812 1677 905 839 833 583 119 1164 11601 --
NM_207045chr11665 ------
NM_207046chr11665 ------
NM_207047chr171812 1677 905 839 833 583 119 1164 11601 --
NM_207113chr731651 271 246 ------
NM_207123chr41155 --1664 --
NM_207170chr13884 809 389 ------
NM_207171chr141986 1907 1763 259 ------
NM_207292chr353359 2947 2444 2323 657 21140 373 ----
NM_207293chr353359 2947 2444 2323 657 21140 373 ----
NM_207294chr353359 2947 2444 2323 657 21140 373 ----
NM_207295chr353359 2947 2444 2323 657 21140 373 ----
NM_207296chr353359 2947 2444 2323 657 21140 373 ----
NM_207297chr353384 2972 2469 2348 682 21165 398 ----
NM_207299chr911015 1778 ----
NM_207303chr10104201 3765 3737 3387 3365 3307 2781 2750 2600 334 24180 2698 ----
NM_207304chr131709 3918 557 340 1681 --
NM_207306chr174291 3724 2850 1517 1086 978 131 2839 623 24036 1744 --
NM_207317chr5--1450 ----
NM_207372chr1052474 1937 1913 1885 899 --11671 --
NM_207381chr153361 140 24 --1948 --
NM_207406chr4136383 6228 5039 4853 4120 3963 2507 2419 1792 1375 1235 927 455 --32367 1864 190 --
NM_207429chr1162248 1872 297 227 215 204 1749 22153 361 --
NM_207481chr22449 214 ----11442
NM_207491chr421120 189 --2219 101 --
NM_207647chr932134 1838 1707 ------
NM_212460chr721643 1490 ------
NM_212471chr1711508 --1222 --
NM_212472chr1711508 --1222 --
NM_212551chr14718 324 244 76 --1254 --
NM_212558chr954303 4062 3254 3041 2938 --24194 3160 --
NM_213594chr123907 305 238 ----186
NM_213606chr1022042 1740 12347 3767 545 58 --
NM_213609chr31768 --1802 --