TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-500a-3p
miRNA Sequence: AUGCACCUGGGCAAGGAUUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX65103 4379 2389 1314 1292 1179 14509 ----
NM_000114chr202894 230 ------
NM_000125chr653932 3530 3264 2671 1189 ------
NM_000165chr64539 171 76 55 --1212 --
NM_000176chr51400 ------
NM_000208chr1954379 3834 3616 1641 1615 1738 11509 --
NM_000210chr211574 ----1793
NM_000212chr1732310 2263 328 ------
NM_000217chr1234871 1846 1493 --13267 11472
NM_000245chr711452 ------
NM_000264chr932133 1297 582 ------
NM_000272chr211185 ------
NM_000280chr111253 ------
NM_000297chr4------1214
NM_000314chr1012357 ------
NM_000321chr13----11301 --
NM_000332chr676359 2252 1038 395 371 168 149 ------
NM_000378chr111162 ------
NM_000390chrX2680 557 ------
NM_000495chrX1433 ------
NM_000503chr811825 1737 ----
NM_000522chr711006 ------
NM_000555chrX57738 6866 6430 1679 296 ------
NM_000610chr111467 ------
NM_000615chr1112746 12968 ----
NM_000633chr1831545 1441 479 ------
NM_000814chr1533561 3507 1568 --11424 --
NM_000818chr102349 180 ------
NM_000829chr1152328 2156 1599 852 268 ------
NM_000857chr41464 ------
NM_000899chr1243842 1765 1742 832 --14332 --
NM_000926chr1119223 ----11867
NM_001001389chr111467 ------
NM_001001390chr111467 ------
NM_001001391chr111467 ------
NM_001001392chr111513 146 ----
NM_001001481chr823236 228 ------
NM_001001549chr722494 642 ------
NM_001001550chr722494 642 ------
NM_001001555chr722494 642 ------
NM_001001701chr411570 ------
NM_001002243chr21259 ------
NM_001002838chrX21850 565 ------
NM_001003652chr1858337 8201 7619 2832 381 15588 15877 --
NM_001003665chr112246 ------
NM_001003674chr1896944 6407 6169 5489 4989 4851 2391 1874 456 14317 ----
NM_001003675chr1896944 6407 6169 5489 4989 4851 2391 1874 456 14317 ----
NM_001003792chr3----1341 --
NM_001003793chr3----1341 --
NM_001004065chr953339 3293 1369 976 399 ------
NM_001004317chr612980 11569 ----
NM_001005463chr1012068 11789 ----
NM_001005473chr511577 26539 4254 ----
NM_001005476chr22245 203 1456 ----
NM_001005505chr341512 690 552 186 ------
NM_001005609chrX52541 1493 1309 867 497 --2363 93 --
NM_001005910chr31144 ------
NM_001005911chr31144 ------
NM_001006617chr91150 --1408 --
NM_001006619chr91150 --1408 --
NM_001006620chr91150 --1408 --
NM_001006621chr91150 --1408 --
NM_001007097chr954452 4213 3265 3220 1966 ----13787
NM_001007156chr1511657 ------
NM_001007471chr91135 ------
NM_001008392chr343237 1120 597 552 13012 11216 --
NM_001008660chr1111005 ------
NM_001009552chr81586 ------
NM_001009566chr12935 107 ------
NM_001009899chr32823 211 --14058 11929
NM_001009955chr12551 78 ------
NM_001009955chr12551 78 ------
NM_001009960chr722852 512 ------
NM_001010861chr11242 ------
NM_001010862chrX1350 12363 ----
NM_001010867chr1115280 4930 2568 2425 1915 1865 1619 1309 1212 1054 147 --25428 2534 --
NM_001010891chr546588 5500 4532 1166 16198 ----
NM_001010971chr1--1848 ----
NM_001011513chr421144 497 ------
NM_001011537chr322290 1875 1556 ----
NM_001011666chr746266 5108 1810 1600 11390 21919 1315 --
NM_001011722chr11409 ------
NM_001011722chr11409 ------
NM_001012393chr1154241 3499 1888 1571 1331 --14452 --
NM_001012755chrX41718 1653 580 365 13537 14611 --
NM_001013415chr41115 ----1291
NM_001015053chr17190 ------
NM_001015881chrX21144 321 ------
NM_001015887chr321150 397 ------
NM_001017368chr1722354 172 ------
NM_001017396chr242151 1661 839 793 ------
NM_001017415chr12694 501 ------
NM_001017416chr12694 501 ------
NM_001017963chr141817 ------
NM_001018057chr1131213 143 60 ------
NM_001018067chr165061 5009 4441 4105 2029 322 --14138 --
NM_001018068chr165061 5009 4441 4105 2029 322 --14138 --
NM_001018069chr165061 5009 4441 4105 2029 322 --14138 --
NM_001018074chr51400 ------
NM_001018075chr51400 ------
NM_001018076chr51400 ------
NM_001018077chr51400 ------
NM_001020658chr121521 245 ------
NM_001020658chr121521 245 ------
NM_001023587chr3176 ------
NM_001024094chr51400 ------
NM_001024647chr1235274 2874 1458 17131 1213 15142
NM_001024956chr1123749 1818 ----1574
NM_001025076chr1035011 4231 1982 ----15362
NM_001025079chr333760 3184 490 ------
NM_001025105chr5--1127 ----
NM_001025108chr2--21550 1538 --1431
NM_001029875chr533035 2621 761 ------
NM_001030055chr1424772 450 ------
NM_001031679chr1212915 --13099 --
NM_001031685chr11235 ------
NM_001031723chr41471 ------
NM_001031732chr413176 ------
NM_001031812chr512040 ------
NM_001033045chr241355 670 501 342 ------
NM_001033059chr61388 ------
NM_001035003chr411311 ------
NM_001035004chr411311 ------
NM_001037132chr722192 1581 ------
NM_001037133chr722192 1581 ------
NM_001037172chr311246 ------
NM_001037174chr211999 ------
NM_001037317chr11242 ------
NM_001038640chr151735 ------
NM_001038702chr532097 753 741 ------
NM_001039538chr2--1635 ----
NM_001039590chrX----23876 241 13855
NM_001039591chrX----23876 241 13855
NM_001039618chr1115267 ----1671
NM_001039711chr1------1870
NM_001039712chr1------1870
NM_001039840chrX15379 --21782 754 --
NM_001040110chr731492 1320 713 --1426 169
NM_001040152chr754304 3497 3364 1679 309 11902 14273 --
NM_001040284chr1645639 4973 4586 2387 12198 ----
NM_001040441chr175408 4606 4527 4441 1780 929 394 12196 13984 --
NM_001042388chr18------2755 134
NM_001042404chr111280 ------
NM_001042406chr61944 ------
NM_001042453chrX1641 ----1458
NM_001042486chr2011059 ------
NM_001042510chr8----1651 --
NM_001042511chr8----1651 --
NM_001042555chr1231919 1749 612 --11184 --
NM_001042599chr226797 6600 27476 7094 17003 --
NM_001044722chr512040 ------
NM_001044723chr512040 ------
NM_001048183chr133696 3208 866 12651 ----
NM_001126chr121031 956 ------
NM_001144chr162998 357 ------
NM_001173chr1424772 450 ------
NM_001206chr922691 401 ----11225
NM_001270chr5----1970 --
NM_001356chrX1436 ----12532
NM_001399chrX52541 1493 1309 867 497 --2363 93 --
NM_001427chr711503 ------
NM_001438chr122625 2329 --23058 1133 --
NM_001448chrX21266 1139 ------
NM_001564chr41124 ------
NM_001604chr111253 ------
NM_001608chr21264 ------
NM_001616chr21904 ------
NM_001634chr61388 ------
NM_001635chr721024 411 --1331 --
NM_001642chr1111185 ------
NM_001656chr521756 1576 --11493 --
NM_001662chr71306 ------
NM_001677chr1----1352 1433
NM_001695chr8--1359 23017 538 1643
NM_001698chr9--1131 ----
NM_001704chr6--1598 1187 --
NM_001731chr12--1843 ----
NM_001743chr21427 ------
NM_001744chr5170 ----1114
NM_001777chr333760 3184 490 ------
NM_001800chr191136 ------
NM_001892chr5--1127 ----
NM_001895chr20--11242 ----
NM_001904chr32968 761 ------
NM_001918chr138584 1486 922 26957 184 18288 17980
NM_001946chr121100 11121 ----
NM_001949chr622346 285 13230 ----
NM_001964chr511188 ------
NM_002007chr11171 1243 --1111
NM_002032chr112318 167 ------
NM_002040chr21--12956 ----
NM_002054chr2----191 --
NM_002063chrX------1994
NM_002086chr1712135 ------
NM_002126chr1743722 2734 1320 272 --1495 --
NM_002136chr121493 ------
NM_002137chr721907 900 22247 418 ----
NM_002140chr91145 --1162 --
NM_002141chr72519 254 ------
NM_002152chr19----129 --
NM_002214chr715709 ------
NM_002224chr6--1715 ----
NM_002240chr211463 ----1149
NM_002270chr51168 35301 4197 1535 ----
NM_002285chr2--21550 1538 --1431
NM_002359chr1763501 3204 2873 2687 1691 1319 12645 12674 --
NM_002374chr2--1635 ----
NM_002395chr6------11175
NM_002399chr1511428 ------
NM_002408chr141127 ------
NM_002473chr221159 ------
NM_002500chr2--11270 ----
NM_002507chr1721732 329 ------
NM_002515chr141243 ------
NM_002519chr1121097 30 --11277 --
NM_002545chr1154241 3499 1888 1571 1331 --14452 --
NM_002547chrX64155 3878 3225 3019 2921 182 11480 ----
NM_002594chr2022150 924 12157 ----
NM_002595chr1211802 ------
NM_002618chr21118 ------
NM_002655chr81947 ----14543
NM_002657chr2033370 3119 2974 ------
NM_002670chr3--180 ----
NM_002707chr21103 ------
NM_002716chr1143260 3136 2398 2386 ------
NM_002731chr123055 1112 ------
NM_002745chr2233386 2974 926 ----1756
NM_002816chr17167 ------
NM_002819chr19--11191 ----
NM_002829chr91177 ------
NM_002843chr1122683 1384 --11263 1955
NM_002874chr91741 ------
NM_002890chr51252 ------
NM_002892chr141317 ----1540
NM_002948chr33322 169 68 --1413 --
NM_002971chr3----11077 --
NM_003016chr1711960 11448 ----
NM_003017chr641394 1274 102 27 ----1165
NM_003030chr3----11560 --
NM_003070chr9--1166 ----
NM_003075chr121275 ------
NM_003105chr11--134 ----
NM_003185chr201860 --1373 --
NM_003199chr1824420 1645 ------
NM_003217chr1211967 ------
NM_003274chr2111144 --12197 --
NM_003339chr52310 260 ------
NM_003348chr1211610 ------
NM_003350chr8----1676 --
NM_003368chr12694 501 ------
NM_003390chr111304 ------
NM_003406chr8----31861 1468 399 --
NM_003418chr31207 ------
NM_003442chr11--1819 ----
NM_003453chr131610 ------
NM_003463chr622595 349 ----1734
NM_003471chr341785 870 142 66 ------
NM_003489chr2121080 547 ------
NM_003502chr161112 ------
NM_003559chr1743344 1363 1159 74 ----12653
NM_003574chr1831412 1342 1043 13769 ----
NM_003583chr1211027 23264 2761 1431 --
NM_003628chr22245 203 1456 ----
NM_003629chr122483 1171 ----1977
NM_003654chr11138 ------
NM_003663chr312639 --12352 --
NM_003670chr3------11402
NM_003671chr922504 304 1181 --1257
NM_003701chr133914 804 83 ------
NM_003711chr5191 ------
NM_003718chr7----1509 --
NM_003762chr111274 ----1508
NM_003816chr81967 1328 ----
NM_003831chr18--1284 --11612
NM_003850chr13130 ------
NM_003861chr1472846 1163 953 853 817 462 441 ------
NM_003873chr101550 ----12253
NM_003877chr121165 1671 --1735
NM_003913chr631591 437 402 ----13137
NM_003927chr181814 --1899 1280
NM_003934chr91888 ------
NM_003939chr1053409 2787 2653 1221 1162 ----11656
NM_003941chr741761 1588 989 944 ----12230
NM_003958chr643441 2892 500 371 ------
NM_003972chr1031261 966 282 ------
NM_003994chr1243842 1765 1742 832 --14332 --
NM_004050chr142279 28 ------
NM_004056chr81928 ----1724
NM_004061chr51422 ------
NM_004080chr721263 246 ----11053
NM_004089chrX21144 321 ------
NM_004119chr131662 ------
NM_004156chr81586 ------
NM_004171chr1168113 7809 3575 1658 1360 852 --12579 18095
NM_004232chr1833743 221 167 12934 ----
NM_004272chr521670 575 ------
NM_004279chr732356 1837 392 1446 22316 751 --
NM_004321chr2103219 3040 2772 2761 2497 2425 2369 1003 630 583 ------
NM_004326chr11198 ------
NM_004331chr82737 48 ------
NM_004338chr1896944 6407 6169 5489 4989 4851 2391 1874 456 14317 ----
NM_004381chr61119 ------
NM_004384chr512040 ------
NM_004389chr2----1837 --
NM_004415chr61650 ------
NM_004450chr14149 ------
NM_004459chr17----11616 --
NM_004469chrX185 ------
NM_004482chr21748 ------
NM_004491chr1994252 3634 3625 3385 1702 1544 1479 1119 315 24327 2766 11127 13515
NM_004498chr15----1378 --
NM_004499chr51178 ------
NM_004501chr123664 3143 ------
NM_004505chr1731959 481 242 ------
NM_004506chr61178 ------
NM_004520chr51790 ------
NM_004521chr10124 ------
NM_004537chr12----11393 --
NM_004538chrX1658 ------
NM_004576chr51317 ------
NM_004626chr11--1270 ----
NM_004690chr6156 ------
NM_004703chr1722541 2357 ----12515
NM_004705chr111355 --161 --
NM_004726chrX45762 5628 4252 1388 ------
NM_004742chr3----11209 --
NM_004744chr422892 1572 ------
NM_004748chr1522666 836 ------
NM_004772chr53638 157 34 --11140 --
NM_004774chr171281 --12387 --
NM_004796chr1412001 ------
NM_004856chr151539 ------
NM_004857chr1424296 783 --24601 296 --
NM_004904chr746266 5108 1810 1600 11390 21919 1315 --
NM_004906chr61104 ------
NM_004947chr311874 1894 ----
NM_004976chr1164788 4406 1790 1525 440 100 ----1481
NM_004982chr121625 ------
NM_004985chr1243027 1538 976 274 --12916 --
NM_004992chrX68026 7698 5810 1919 690 479 12248 28199 805 --
NM_004992chrX68026 7698 5810 1919 690 479 12248 28199 805 --
NM_004995chr14----1453 --
NM_005010chr722192 1581 ------
NM_005011chr731492 1320 713 --1426 169
NM_005056chr1233783 644 100 --13416 --
NM_005066chr1--1649 ----
NM_005068chr611449 ----1948
NM_005113chr14--1463 ----
NM_005134chr18------2755 134
NM_005197chr1432433 1566 1068 ------
NM_005207chr2213287 ------
NM_005219chr511722 ------
NM_005235chr226797 6600 27476 7094 17003 --
NM_005249chr141157 ----1177
NM_005284chr6----1427 --
NM_005308chr101408 ------
NM_005311chr722494 642 ------
NM_005324chr171603 --11417 --
NM_005339chr433799 3769 2755 --13139 --
NM_005348chr141817 ------
NM_005375chr611147 ------
NM_005402chr731764 1480 1289 1568 ----
NM_005426chr11235 ------
NM_005439chr121548 ------
NM_005474chr17190 ------
NM_005504chr1234447 1965 1470 15155 --11222
NM_005521chr101802 ------
NM_005537chr131776 ----178
NM_005542chr7--1421 ----
NM_005563chr11269 ------
NM_005585chr151381 ------
NM_005595chr11355 ------
NM_005596chr941309 1264 1162 542 16320 ----
NM_005610chr11368 ------
NM_005639chr1211573 ------
NM_005737chr252521 2068 1108 930 706 22477 955 ----
NM_005739chr1521951 1833 ------
NM_005751chr71335 ------
NM_005796chr161146 ------
NM_005808chr343237 1120 597 552 13012 11216 --
NM_005822chr6----11482 --
NM_005828chr1734273 1389 349 --14789 --
NM_005839chr11167 ------
NM_005840chrX46644 1897 1472 161 ------
NM_005859chr511261 --11392 --
NM_005871chr10--1954 ----
NM_005880chr1611455 1643 ----
NM_005901chr1858337 8201 7619 2832 381 15588 15877 --
NM_005907chr611687 ----1268
NM_005920chr163661 2690 986 663 655 362 32819 2592 1320 ----
NM_005937chr1793833 3681 3439 3374 2986 2946 2934 2883 2565 --1656 --
NM_005941chr813456 ------
NM_005955chr145077 3701 2119 997 13729 21456 948 --
NM_006007chr933922 1070 1047 ------
NM_006010chr31194 ------
NM_006022chr1321046 752 ------
NM_006030chr341512 690 552 186 ------
NM_006089chrX11870 --2466 41 --
NM_006094chr81382 ------
NM_006166chr1222184 151 --12505 --
NM_006206chr4--12061 ----
NM_006241chr3--12337 ----
NM_006252chr154867 4766 940 925 364 ------
NM_006265chr81283 1404 1562 --
NM_006267chr22444 204 --1215 --
NM_006279chr11318 ------
NM_006306chrX74242 4234 1210 1103 1009 221 108 11349 ----
NM_006352chr11209 ------
NM_006393chr1033601 3454 1004 ------
NM_006415chr9--11023 ----
NM_006421chr81298 ------
NM_006457chr421144 497 ------
NM_006482chr1211027 23264 2761 1431 --
NM_006489chr141243 ------
NM_006496chr121781 288 11332 ----
NM_006534chr2013024 12497 22523 455 12889
NM_006540chr811381 ------
NM_006549chr1232958 2721 2289 12375 12875 --
NM_006561chr1035011 4231 1982 ----15362
NM_006572chr1722457 347 --12950 --
NM_006577chr2----136 11105
NM_006609chr242781 2208 1999 867 ------
NM_006620chr634435 3492 998 11011 --23960 3512
NM_006624chr1022017 1518 11758 ----
NM_006654chr1231919 1749 612 --11184 --
NM_006675chr1263085 3039 2917 2790 847 271 12800 ----
NM_006703chr61137 ------
NM_006706chr51267 ------
NM_006727chr51443 ------
NM_006769chr12753 167 ------
NM_006788chr1841554 777 480 106 ------
NM_006807chr172899 425 ------
NM_006813chr61268 ------
NM_006884chr3----11560 --
NM_006887chr21602 1499 ----
NM_006888chr1422732 653 ------
NM_006908chr7----1422 11126
NM_006915chrX11987 ----11563
NM_006918chr1123749 1818 ----1574
NM_006920chr21673 1294 --1756
NM_006931chr121655 --1346 1708
NM_006936chr21182 ------
NM_006940chr1211197 ------
NM_006946chr111555 ------
NM_007006chr16--1179 13266 1490
NM_007007chr1223431 1315 14032 ----
NM_007010chr172485 181 21425 1335 ----
NM_007011chr1556706 5815 5064 2663 1378 ------
NM_007034chr111034 ------
NM_007073chr664150 4009 3221 1222 902 37 ------
NM_007129chr131404 ------
NM_007146chr1722587 2227 ------
NM_007166chr1111005 ------
NM_007192chr141220 ------
NM_007203chr953339 3293 1369 976 399 ------
NM_007212chr1--11630 ----
NM_007235chr12--1152 ----
NM_007236chr151167 ------
NM_007246chr4--1708 ----
NM_007249chr1369265 2354 1503 1438 1112 762 ------
NM_007372chr172343 66 ------
NM_012081chr523612 645 --1539 --
NM_012082chr8------1142
NM_012097chr211999 ------
NM_012155chr19124 ------
NM_012177chr61110 ------
NM_012180chr41294 ------
NM_012238chr10------1112
NM_012252chr735308 318 204 ------
NM_012262chr143705 3223 2090 908 --196 --
NM_012288chr624775 2257 --21707 1496 --
NM_012431chr72524 131 ------
NM_012456chr11130 ------
NM_012479chr752293 1086 1066 1020 451 ------
NM_013231chr1424126 146 ------
NM_013233chr211358 ------
NM_013253chr1131213 143 60 ------
NM_013286chr353693 2707 2637 2488 1241 ----11135
NM_013357chr82894 827 ------
NM_013450chr21901 ------
NM_013958chr81183 ------
NM_013959chr81183 ------
NM_013961chr81183 ------
NM_013962chr81183 ------
NM_014011chr21203 ------
NM_014014chr22419 186 ------
NM_014079chr321010 135 ------
NM_014141chr734311 4109 312 ------
NM_014157chr1653792 3584 3240 2884 875 ------
NM_014181chr212415 12876 ----
NM_014253chrX11834 1404 --1489
NM_014268chr1821074 955 --1179 11408
NM_014271chrX1726 ------
NM_014305chr13----1245 --
NM_014333chr113744 117 27 --22689 1779 --
NM_014342chr111128 ------
NM_014344chr111115 1868 ----
NM_014452chr611227 ----1248
NM_014494chr1612150 ------
NM_014498chr31346 ------
NM_014504chr711808 ------
NM_014515chr121808 ------
NM_014517chr341376 1304 555 247 ------
NM_014574chr141269 11300 ----
NM_014607chr221813 151 ------
NM_014612chr921510 1062 ----11374
NM_014676chr121521 245 ------
NM_014682chr822334 938 ------
NM_014683chr1711614 ----1397
NM_014702chr6----1313 13057
NM_014707chr7----21480 846 --
NM_014718chr121663 ------
NM_014721chr611861 ----16771
NM_014732chr1675820 4760 4181 1653 728 605 465 --25317 3765 --
NM_014738chr171678 ------
NM_014742chr20----1293 --
NM_014746chr254088 1318 257 207 185 --1531 --
NM_014747chr195209 5046 4988 4568 1991 1614 1567 770 43 --15706 --
NM_014755chr234076 2927 1605 1726 ----
NM_014781chr81131 ------
NM_014812chr111280 ------
NM_014877chr1716335 --16482 16713
NM_014902chr2011059 ------
NM_014906chr1723891 2561 --14098 --
NM_014912chr1012821 --11113 --
NM_014939chr1821304 991 ------
NM_014944chr12935 107 ------
NM_014961chr41375 ----11775
NM_014969chr12433 151 ------
NM_014974chr10----1644 --
NM_014988chr431772 1002 947 ------
NM_014991chr422191 160 ------
NM_015017chr11498 ------
NM_015025chr242724 2111 1747 616 ------
NM_015026chr121311 ------
NM_015032chr131571 ----12334
NM_015057chr131236 ------
NM_015064chr1252362 1133 1081 814 436 --12660 --
NM_015068chr723156 531 1754 13125 --
NM_015076chr654169 3324 3013 403 310 ------
NM_015091chr141729 ------
NM_015093chr62303 109 ------
NM_015097chr3----11774 --
NM_015100chr111540 ------
NM_015110chr911585 ------
NM_015150chr31202 ------
NM_015170chr812368 ------
NM_015176chr1------11451
NM_015192chr20--1357 ----
NM_015200chr421880 951 ------
NM_015215chr11666 ------
NM_015236chr411149 ------
NM_015252chr21286 ------
NM_015263chr151430 ------
NM_015268chr31237 ------
NM_015271chr421203 1108 ------
NM_015296chr1321099 362 --1301 --
NM_015299chr1441516 934 683 663 ------
NM_015310chr847244 3268 2990 113 --16265 11163
NM_015313chr1143557 1354 291 147 13147 ----
NM_015335chr121414 ------
NM_015347chr121709 --1686 --
NM_015355chr17----11673 --
NM_015455chr533345 2627 159 13942 ----
NM_015457chr111370 ------
NM_015469chr91104 ------
NM_015475chr211073 ------
NM_015548chr6172 ------
NM_015550chr723165 2823 --1385 --
NM_015630chr21913 ------
NM_015640chr165061 5009 4441 4105 2029 322 --14138 --
NM_015686chrX21956 1910 --3927 561 92 --
NM_015695chr611613 ------
NM_015878chr841574 1388 857 695 11835 ----
NM_015881chr1131213 143 60 ------
NM_015886chr834202 3590 1226 14971 ----
NM_015904chr2--1550 1135 --
NM_015906chr11329 ----13598
NM_015955chr2----1150 --
NM_015995chr15125166 4961 4816 4029 3925 3856 3653 3533 2174 1902 1776 129 24103 2185 13636 --
NM_016025chr1611256 ------
NM_016041chr17--1339 ----
NM_016096chr8----1651 --
NM_016133chr211454 ------
NM_016141chr31613 ------
NM_016147chr111835 ------
NM_016248chr1343335 811 682 161 ------
NM_016271chr18--11708 --1214
NM_016423chr141446 ------
NM_016441chr211937 ----12191
NM_016447chr7----1182 --
NM_016507chr1723125 439 ------
NM_016512chr82241 100 ------
NM_016522chr1111291 ------
NM_016529chr131277 ------
NM_016542chrX1641 ----1458
NM_016577chr364179 3204 2825 853 833 806 13459 --11435
NM_017415chr574343 3780 3651 1676 786 197 42 ------
NM_017519chr611085 ------
NM_017610chr151634 ------
NM_017635chr1111422 --1521 --
NM_017637chr938452 748 188 --16694 --
NM_017651chr61342 ----11307
NM_017655chr1------11094
NM_017657chr21259 ------
NM_017664chr133998 354 213 --1230 --
NM_017672chr151345 --1102 --
NM_017730chr31105 ------
NM_017768chr11213 ------
NM_017772chr621786 601 ------
NM_017780chr81151 ------
NM_017789chr2----141 --
NM_017843chr201632 ------
NM_017867chr4123 ------
NM_017902chr1035210 3955 143 2898 841 14971 --
NM_017919chr935652 4099 1453 ------
NM_017964chr21726 ------
NM_018011chr131463 ------
NM_018017chr1021150 50 1217 11003 --
NM_018027chr1032988 2082 1155 ----13027
NM_018061chr11364 ------
NM_018070chr12551 78 ------
NM_018085chr147096 1975 1319 931 ------
NM_018125chr11409 ------
NM_018126chr4183 ------
NM_018133chr31532 ------
NM_018150chr11600 ------
NM_018181chr1811413 ------
NM_018182chr1741694 457 375 337 11941 ----
NM_018191chr131163 ------
NM_018192chr311039 ------
NM_018195chr1141450 1424 504 442 ------
NM_018197chr20----1239 --
NM_018214chr6--1452 ----
NM_018244chr201335 ------
NM_018247chr612508 ------
NM_018299chr823236 228 ------
NM_018315chr41115 ----1291
NM_018334chr7--1423 ----
NM_018362chr1113646 ------
NM_018364chr11244 ------
NM_018584chr12411 401 ------
NM_018660chr812487 ----22705 138
NM_018700chr511206 ------
NM_018840chr201355 ------
NM_018890chr7----1422 11126
NM_018976chr1212771 ------
NM_019005chr7152 ------
NM_019022chr18--11062 ----
NM_019036chr61944 ------
NM_019064chr17------1847
NM_019071chr71789 ------
NM_019091chr21332 1254 ----
NM_019116chr1613629 ------
NM_019593chr2021222 765 --12857 --
NM_019605chr11656 ------
NM_019884chr19--1374 ----
NM_020116chr42650 401 ------
NM_020123chr1021511 1028 --1961 --
NM_020240chr532097 753 741 ------
NM_020309chr1911113 ------
NM_020338chr1033640 3316 175 --42591 2547 1137 812 --
NM_020346chr1111497 ------
NM_020357chr3--136 ----
NM_020381chr631810 590 389 11408 ----
NM_020466chr674787 1446 1049 999 718 446 303 --11156 --
NM_020706chr21----160 --
NM_020717chrX54822 3361 746 568 221 ----13842
NM_020732chr611085 ------
NM_020739chr1522666 836 ------
NM_020740chr171383 1340 ----
NM_020747chr51702 ------
NM_020748chr1711456 1718 11519 --
NM_020760chr211757 ------
NM_020766chrX13034 ------
NM_020772chr1765401 3472 3432 1117 912 566 ------
NM_020774chr1811372 15499 ----
NM_020783chr1811740 ------
NM_020791chr1711063 ------
NM_020824chr101658 ------
NM_020825chr1663759 3527 2811 1294 827 367 ------
NM_020830chr21146 ------
NM_020870chr41216 ------
NM_020871chrX11825 ------
NM_020873chr31779 ------
NM_020922chrX21850 565 ------
NM_020952chr91135 ------
NM_020956chr19124511 4149 3987 3767 3590 1883 1805 1727 1649 1625 1514 1230 --41908 1830 1752 1674 --
NM_020981chr2276 59 ------
NM_021061chr853840 3340 3158 3009 2759 14153 ----
NM_021088chr242151 1661 839 793 ------
NM_021090chr2284305 4229 3857 3681 1777 1688 1533 1304 --24782 3284 --
NM_021109chrX1302 ------
NM_021109chrX1302 ------
NM_021120chrX22633 2423 1461 1858 1275
NM_021140chrX11045 ------
NM_021155chr192848 153 ------
NM_021252chr10----1227 --
NM_021620chr6----1576 --
NM_021637chrX11240 ------
NM_021638chr484558 4051 3821 3054 1557 1419 857 255 34994 1433 1118 13693 --
NM_021728chr141363 ------
NM_021813chr665515 5212 4806 4264 1798 112 14616 ----
NM_021912chr1533561 3507 1568 --11424 --
NM_021952chr1----1178 --
NM_021958chr11256 ------
NM_021961chr1157387 6503 2780 2031 1285 14824 ----
NM_021973chr4------1624
NM_022041chr1612682 --1327 11796
NM_022048chr1555123 4622 1362 505 294 --22409 1938 --
NM_022058chr2171 ------
NM_022118chr131552 ------
NM_022123chr141245 ------
NM_022130chr521402 1347 ------
NM_022133chr811381 ------
NM_022153chr1063029 2513 2262 1381 858 221 12532 32922 1068 49 1940
NM_022157chr11170 ------
NM_022170chr7--11570 ----
NM_022337chr111525 ------
NM_022373chr72245 114 ------
NM_022374chr21460 ------
NM_022451chr101589 ------
NM_022456chr1235274 2874 1458 17131 1213 15142
NM_022459chr1345179 4224 4122 1822 --11437 12204
NM_022461chr31256 ------
NM_022469chr122274 938 ------
NM_022650chr51252 ------
NM_022652chr121100 11121 ----
NM_022659chr8186 ------
NM_022728chr72289 103 ------
NM_022771chr121890 1805 ----
NM_022918chr11----11869 --
NM_023000chr141317 ----1540
NM_023001chr141317 ----1540
NM_023004chr22139 ------
NM_023074chr1911280 ------
NM_023923chr133696 3208 866 12651 ----
NM_024007chr512646 ------
NM_024055chr51622 ------
NM_024117chr91150 --1408 --
NM_024308chr17169 ------
NM_024337chr5--198 ----
NM_024424chr111162 ------
NM_024425chr111162 ------
NM_024426chr111162 ------
NM_024496chr141619 --1105 --
NM_024551chr1262078 1870 1829 1657 895 657 --12037 --
NM_024551chr1262078 1870 1829 1657 895 657 --12037 --
NM_024569chr1155 ------
NM_024612chr171791 ------
NM_024613chr8130 1607 ----
NM_024639chr622700 1068 ------
NM_024665chr321249 650 23258 3239 ----
NM_024671chr16129 ------
NM_024692chr211831 145 ----
NM_024700chr12412 391 ------
NM_024721chr821035 523 ----21991 397
NM_024753chr2121 ------
NM_024770chr246112 5969 5797 1699 ----1650
NM_024852chr11454 ------
NM_024859chrX1754 ------
NM_024920chr42631 471 ------
NM_024947chr369290 7442 5973 3382 3152 2565 17360 --12162
NM_024949chr414706 1944 ----
NM_024960chr20----1124 --
NM_024971chr91135 ------
NM_024989chr248099 6349 5868 1736 ----12273
NM_025054chr8----11544 --
NM_025126chr12----1714 --
NM_025134chr16------1221
NM_025146chr332697 923 804 ------
NM_025221chr411311 ------
NM_030567chr51146 ------
NM_030594chr1521356 208 ------
NM_030625chr1021003 56 21673 1603 1194 --
NM_030627chr522776 156 ------
NM_030631chr14----189 --
NM_030647chr745997 5174 1285 51 --1670 25332 2087
NM_030648chr455496 4435 4358 4346 1973 ------
NM_030674chr12--35826 4531 3922 14822 14058
NM_030792chr111664 ------
NM_030816chr133646 3384 2919 12982 ----
NM_030920chr12749 333 --1323 --
NM_030927chr1011516 ------
NM_030962chr111171 ------
NM_031157chr121493 ------
NM_031243chr721907 900 22247 418 ----
NM_031244chr611109 ------
NM_031262chr9188 --1105 --
NM_031263chr91145 --1162 --
NM_031266chr51178 ------
NM_031267chr7----1509 --
NM_031292chr121660 ------
NM_031445chr21809 --1403 --
NM_031844chr123664 3143 ------
NM_031845chr2--1635 ----
NM_031847chr2--1635 ----
NM_031990chr19--11191 ----
NM_031991chr19--11191 ----
NM_031992chr7--11570 ----
NM_032012chr9--1384 1802 --
NM_032102chr1122863 2403 1444 ----
NM_032217chr4--1562 ----
NM_032288chr322290 1875 1556 ----
NM_032436chr132108 34 ------
NM_032439chr10--1417 ----
NM_032514chr201392 ------
NM_032547chr411014 11308 ----
NM_032632chr1421710 495 ------
NM_032664chr811343 ------
NM_032689chr191614 ------
NM_032711chr1763501 3204 2873 2687 1691 1319 12645 12674 --
NM_032765chr52318 34 ------
NM_032804chr1032397 2203 1828 ------
NM_032833chr12933 53 ------
NM_032867chr112554 254 --1591 --
NM_032870chr6----1398 --
NM_032873chr1124054 1720 1354 34374 4315 3685 --
NM_032932chr1796094 6042 5982 5901 4973 4274 2340 2278 1869 ----16460
NM_032961chr4--11045 ----
NM_032998chr1------1870
NM_033012chr133914 804 83 ------
NM_033020chr11329 ----13598
NM_033030chr21316 ------
NM_033055chr11331 ------
NM_033211chr5--11411 --11275
NM_033225chr812544 13159 1380 22896 2253
NM_033227chr51106 --123 --
NM_033228chr51146 --163 --
NM_033331chr922504 304 1181 --1257
NM_033360chr1243148 1659 1097 395 --13037 --
NM_033380chrX1433 ------
NM_033381chrX1433 ------
NM_033389chr1754684 4532 4184 3008 126 ----158
NM_033426chr141256 --12089 11161
NM_033495chrX--1301 ----
NM_033546chr18--1196 ----
NM_033631chr133825 3702 2743 --23742 2925 1730
NM_033632chr41115 ----1291
NM_033637chr1053409 2787 2653 1221 1162 ----11656
NM_048368chr182331 281 ------
NM_052868chr1128 ------
NM_052897chr12----1577 --
NM_052968chr111557 ------
NM_053002chr31155 11083 1974 --
NM_053006chr22155 ----1112
NM_053016chr947404 6484 5661 2626 ------
NM_053024chr32255 156 ------
NM_057161chr61131 ------
NM_057175chr441996 1961 598 329 ------
NM_057178chr1722354 172 ------
NM_079421chr191136 ------
NM_080647chr221391 ------
NM_080764chr221235 ------
NM_080867chr142594 212 14839 1689 --
NM_080927chr31173 ------
NM_133334chr476403 6015 1548 1176 966 824 761 --24682 2452 --
NM_133370chr413176 ------
NM_133433chr5--1807 ----
NM_133493chr653634 3614 718 264 136 ----13895
NM_133496chr133178 1147 950 --13044 --
NM_134424chr1211260 ------
NM_134428chr92345 149 ------
NM_138396chr122633 89 1900 ----
NM_138426chr731554 838 411 --11813 --
NM_138459chr622527 1266 ------
NM_138494chr722852 512 ------
NM_138555chr151539 ------
NM_138694chr611365 1301 ----
NM_138731chr1424155 553 --11671 --
NM_138782chr5--12157 ----
NM_138804chr2--1573 ----
NM_138970chr1412001 ------
NM_139014chr641847 1499 915 880 ------
NM_139045chr9--1166 ----
NM_139067chr121275 ------
NM_139316chr721024 411 --1331 --
NM_144571chr446864 6569 6318 2462 ------
NM_144574chr14168 ------
NM_144632chr211879 ------
NM_144635chr311242 ------
NM_144636chr31546 ----1708
NM_144642chr31410 ------
NM_144664chr1112346 ------
NM_144949chr21203 ------
NM_145049chr511048 11082 ----
NM_145203chr13--1126 ----
NM_145285chr101661 ----1793
NM_145320chr723165 2823 --1385 --
NM_145321chr723165 2823 --1385 --
NM_145322chr723165 2823 --1385 --
NM_145690chr8----31861 1468 399 --
NM_145716chr12551 78 ------
NM_145753chr311604 1670 ----
NM_145800chrX1936 ------
NM_147128chr711427 ------
NM_147147chr664150 4009 3221 1222 902 37 ------
NM_147150chr953339 3293 1369 976 399 ------
NM_147171chr71335 ------
NM_147181chr411311 ------
NM_147182chr411311 ------
NM_147183chr411311 ------
NM_147185chr71335 ------
NM_147202chr912661 ------
NM_147223chr2134 ------
NM_148174chr841574 1388 857 695 11835 ----
NM_152265chr12287 221 ----11474
NM_152282chr311246 ------
NM_152284chr8--1783 ----
NM_152300chr172485 181 21425 1335 ----
NM_152342chr16197 ------
NM_152380chr131502 1188 491 11417 21605 1047 --
NM_152409chr5----12553 --
NM_152410chr61413 ------
NM_152414chr8----11070 --
NM_152455chr1522055 988 ------
NM_152515chr2129 ------
NM_152520chr21441 ------
NM_152529chr241355 670 501 342 ------
NM_152538chr321150 397 ------
NM_152594chr1512087 ------
NM_152624chr534981 2623 88 --12581 --
NM_152699chr353227 2824 2660 651 318 ----12494
NM_152719chr131161 ------
NM_152733chr6105968 5852 5739 5568 4872 3968 2550 2025 1349 508 --14745 --
NM_152744chr753573 2919 939 662 624 1261 1247 --
NM_152780chrX130 ------
NM_152835chr1--1210 ----
NM_152836chr811381 ------
NM_152837chr811381 ------
NM_152857chr61792 ------
NM_152858chr61792 ------
NM_152910chr13------137
NM_152924chr1556706 5815 5064 2663 1378 ------
NM_152989chr1211197 ------
NM_153050chr2284305 4229 3857 3681 1777 1688 1533 1304 --24782 3284 --
NM_153051chr2284305 4229 3857 3681 1777 1688 1533 1304 --24782 3284 --
NM_153188chr51168 35301 4197 1535 ----
NM_153261chr1611317 ----11134
NM_153341chr11266 ------
NM_153640chr20----1124 --
NM_153757chr431104 918 222 ------
NM_170674chr1511428 ------
NM_170675chr1511104 ------
NM_170676chr1511104 ------
NM_170677chr1511428 ------
NM_172037chr8--11211 ----
NM_172058chr811825 1737 ----
NM_172059chr811825 1737 ----
NM_172060chr811825 1737 ----
NM_172159chr341785 870 142 66 ------
NM_172160chr341785 870 142 66 ------
NM_172216chr1232958 2721 2289 12375 12875 --
NM_172315chr1511428 ------
NM_172316chr1511428 ------
NM_172337chr141363 ------
NM_173078chrX1109 ------
NM_173083chr11488 ------
NM_173172chr211524 ------
NM_173468chr446039 3744 2152 480 ----1410
NM_173500chr1521312 29 ------
NM_173508chr121137 859 --178 --
NM_173532chr11176 ------
NM_173536chr415128 ------
NM_173552chr31504 ------
NM_173602chr121755 --13547 --
NM_173812chr121501 11382 ----
NM_173822chr21348 ------
NM_174938chr91101 ------
NM_174963chr11318 ------
NM_174964chr11318 ------
NM_174965chr11337 ------
NM_174966chr11318 ------
NM_174967chr11337 ------
NM_174968chr11318 ------
NM_174969chr11318 ------
NM_174970chr11337 ------
NM_174971chr11318 ------
NM_175623chr1235274 2874 1458 17131 1213 15142
NM_175736chr1234830 2874 1481 --26994 2311 --
NM_175847chr19--11191 ----
NM_175852chr172609 2387 2151 883 761 701 513 --22222 2007 --
NM_175854chr1312382 ------
NM_175857chr21----123 --
NM_175863chr611085 ------
NM_175866chr11259 --11277 --
NM_176895chr5191 ------
NM_177422chr11454 ------
NM_177559chr20--11242 ----
NM_177560chr20--11242 ----
NM_177983chr21103 ------
NM_177985chr211999 ------
NM_178010chr1211197 ------
NM_178037chr1252362 1133 1081 814 436 --12660 --
NM_178038chr1252362 1133 1081 814 436 --12660 --
NM_178039chr1251997 768 716 449 71 --12295 --
NM_178040chr1251997 768 716 449 71 --12295 --
NM_178126chr1752199 2096 1977 573 307 ------
NM_178151chrX57738 6866 6430 1679 296 ------
NM_178152chrX57738 6866 6430 1679 296 ------
NM_178153chrX57738 6866 6430 1679 296 ------
NM_178313chr221963 430 ------
NM_178539chr121487 ------
NM_178585chr422191 160 ------
NM_178812chr811540 ------
NM_181050chr161112 ------
NM_181302chr14168 ------
NM_181308chr14168 ------
NM_181351chr1112746 12968 ----
NM_181354chr8----11289 --
NM_181481chr1896944 6407 6169 5489 4989 4851 2391 1874 456 14317 ----
NM_181482chr1896944 6407 6169 5489 4989 4851 2391 1874 456 14317 ----
NM_181483chr1896944 6407 6169 5489 4989 4851 2391 1874 456 14317 ----
NM_181509chr201392 ------
NM_181659chr2013024 12497 22523 455 12889
NM_181659chr2013024 12497 22523 455 12889
NM_181674chr51317 ------
NM_181675chr51317 ------
NM_181676chr51317 ------
NM_181677chr51317 ------
NM_181678chr51317 ------
NM_181825chr221324 ------
NM_181838chr52310 260 ------
NM_182641chr17----11616 --
NM_182643chr81382 ------
NM_182767chr1241539 428 266 106 --22141 2078 --
NM_182831chr1641694 1041 395 278 11183 ----
NM_182894chr1411718 ------
NM_182898chr746266 5108 1810 1600 11390 21919 1315 --
NM_182899chr746266 5108 1810 1600 11390 21919 1315 --
NM_182948chr123055 1112 ------
NM_183006chr2011059 ------
NM_183049chr41298 ------
NM_183078chr643347 2798 406 277 ------
NM_183380chr6172 ------
NM_183422chr1321046 752 ------
NM_194247chr21454 1885 ----
NM_194271chr12----1714 --
NM_194272chr151341 ------
NM_194280chr16137 ------
NM_194282chr4----21085 51 12051
NM_194286chr1265943 4869 4297 1855 1836 620 ------
NM_194434chr1831412 1342 1043 13769 ----
NM_197968chr131610 ------
NM_197970chr21316 ------
NM_198057chrX21144 321 ------
NM_198128chr18--11708 --1214
NM_198217chr131776 ----178
NM_198218chr131776 ----178
NM_198219chr131776 ----178
NM_198243chr151795 ------
NM_198336chr7--1333 ----
NM_198392chr632194 1722 145 ------
NM_198465chrX1212 12503 ----
NM_198595chr484558 4051 3821 3054 1557 1419 857 255 34994 1433 1118 13693 --
NM_198715chr121947 1193 15705 ----
NM_198793chr333756 3180 486 ------
NM_198799chr201559 ------
NM_198829chr7----1422 11126
NM_198880chr31105 ------
NM_198889chr4--1562 ----
NM_198900chr1234830 2874 1481 --26994 2311 --
NM_198935chr20--13247 ----
NM_198991chr18------1195
NM_199003chr811560 ------
NM_199050chr2173409 3043 2985 2745 1087 974 423 ------
NM_199168chr101115 ------
NM_199245chr12--1322 12267 11829
NM_199421chr142594 212 14839 1689 --
NM_199426chr20----1239 --
NM_199487chr201335 ------
NM_201624chr11498 ------
NM_203399chr11269 ------
NM_203401chr11269 ------
NM_203437chr21259 ------
NM_203499chr172343 66 ------
NM_203506chr1712135 ------
NM_205768chr11209 ------
NM_206594chr122625 2329 --23058 1133 --
NM_206595chr122625 2329 --23058 1133 --
NM_206855chr635186 1302 544 ------
NM_206909chr847244 3268 2990 113 --16265 11163
NM_206944chr91135 ------
NM_206945chr91135 ------
NM_206946chr91135 ------
NM_206947chr91135 ------
NM_206967chr16286 57 ------
NM_207043chr111706 ------
NM_207044chr111706 ------
NM_207047chr111706 ------
NM_207171chr111540 ------
NM_207361chr1335757 4183 317 ----1386
NM_207371chr1021518 1145 ------
NM_207517chr15------21764 155
NM_207578chr11612 ------
NM_213589chr274484 1304 1145 1046 983 497 79 ------