TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-500a-5p
miRNA Sequence: UAAUCCUUGCUACCUGGGUGAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001017440chr7167874 7480 7243 6379 6089 5199 2956 2486 2229 2137 2002 1571 1305 467 409 254 12386 ----
NM_001025077chr1066639 6629 5146 724 594 581 --11740 25817 679
NM_001039547chr3137330 7099 6634 6502 5393 2803 2747 2348 2042 1882 1311 1063 71 12881 27773 5277 --
NM_001042355chr16175152 4721 4532 4507 4488 4315 4036 3498 3492 3408 3335 2040 1961 1820 1576 382 132 23667 684 14922 15005
NM_001042412chr16175152 4721 4532 4507 4488 4315 4036 3498 3492 3408 3335 2040 1961 1820 1576 382 132 23667 684 14922 15005
NM_001100108chr1108132 6344 5876 5156 3274 2514 2386 2287 1754 234 25066 2046 12367 --
NM_002336chr12104904 4780 4735 4482 3357 3239 1861 1226 171 96 11472 11843 --
NM_002737chr17105843 5773 4615 4555 4476 4266 4170 1825 1093 768 24946 134 66239 5926 5241 5212 1211 464 --
NM_003161chr1752974 2796 2598 1031 303 --42921 1449 700 266 1356
NM_004171chr11139277 9106 8368 7516 7286 6684 2827 2460 2312 1900 1795 1608 1284 38932 7431 2209 15819 --
NM_004612chr964744 4070 631 421 155 102 --24795 783 13491
NM_004726chrX104871 4451 4353 4324 4191 2019 1543 1436 903 456 22099 1964 21715 1617 --
NM_006212chr194347 3770 3640 3574 2079 1666 1591 1500 1489 21981 1363 24976 4204 --
NM_006750chr16138060 6799 6378 6207 5515 5265 5246 5087 2988 2793 2628 2518 381 37061 2217 871 1555 --
NM_006924chr1783561 3174 1505 1491 461 451 437 208 --21740 408 --
NM_007249chr1399182 8920 8847 7798 6826 2704 1490 1461 1372 --11084 17788
NM_012243chr11140 1216 --2859 210
NM_014423chr5115541 5337 5173 5094 5009 3673 3479 1755 939 921 590 --1807 --
NM_014721chr697019 6433 5583 4944 4917 4875 2592 199 85 --26625 507 12480
NM_014873chr174323 4263 4080 3975 1660 1647 1470 1175 --23283 758
NM_015076chr674446 3964 3577 3188 868 392 370 13006 33867 799 300 13465
NM_015247chr16175152 4721 4532 4507 4488 4315 4036 3498 3492 3408 3335 2040 1961 1820 1576 382 132 23667 684 14922 15005
NM_015313chr11123489 3028 2967 1896 1665 1200 1190 1012 822 816 451 106 21851 130 ----
NM_016206chr3138972 8522 8092 7576 6681 5539 2912 2536 1374 1294 1034 451 333 37751 7654 2134 27488 3481 17985
NM_017637chr9139159 8656 8366 7531 7256 6419 6120 3725 3377 2655 2278 2183 2127 --39382 9239 7813 --
NM_017643chr1792491 2109 1212 1204 1118 528 427 355 332 --32719 825 36 11962
NM_017813chr854608 4340 2265 2132 441 22075 822 55497 5116 4650 1370 74 15602
NM_018566chr174904 4521 3548 1883 1416 677 95 ----24776 3306
NM_031468chr7167874 7480 7243 6379 6089 5199 2956 2486 2229 2137 2002 1571 1305 467 409 254 12386 ----
NM_032873chr1184048 2777 1567 1066 993 917 899 586 23691 1713 --11600
NM_152624chr587116 6566 2765 2705 2120 1165 1141 1122 17204 47156 6911 4752 550 --
NM_172071chr162858 1724 1545 1054 740 666 --34522 1825 1698 12661
NM_194314chr155445 5367 5132 2147 1338 14811 --35008 4983 3711
NM_203458chr133207 1472 748 12687 11524 21128 772