TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-501-3p
miRNA Sequence: AAUGCACCCGGGCAAGGAUUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000055chr31334 ------
NM_000098chr1----1562 --
NM_000138chr152806 260 2752 594 12031 --
NM_000176chr513618 1474 1401 --
NM_000217chr1233267 1471 464 23998 1052 24872 1494 --
NM_000259chr1554832 4779 4737 4717 3955 1986 ----
NM_000267chr1743466 3251 2217 222 ----11073
NM_000284chrX2709 170 11747 ----
NM_000321chr1311672 --11302 --
NM_000332chr676464 6443 6359 6042 2252 396 372 26897 6840 --1170
NM_000430chr1742810 1152 905 431 11063 ----
NM_000461chr353994 3821 3019 3009 2999 ------
NM_000462chr1511307 ------
NM_000826chr421854 108 12273 22238 1884 --
NM_000857chr4--1366 --1466
NM_000899chr1214294 14301 14333 1834
NM_000922chr11----1269 --
NM_000933chr2041228 593 398 375 ------
NM_000945chr221286 89 11874 ----
NM_001001323chr1232644 2507 575 ------
NM_001001484chr1032398 2227 2054 12069 ----
NM_001001870chr172659 304 --1700 --
NM_001001995chrX21863 81 --11249 --
NM_001002243chr21896 ----1261
NM_001002838chrX11850 ----1567
NM_001003652chr1838607 8337 5587 27894 1696 15878 --
NM_001003800chr923504 3147 --1958 --
NM_001004304chr1233218 2571 142 --12322 --
NM_001004360chr23640 273 190 1671 ----
NM_001004419chr1233181 950 740 1912 ----
NM_001005404chr1764473 3856 3551 3040 1541 706 --11069 --
NM_001005463chr1021788 441 ------
NM_001005609chrX23121 363 13766 194 --
NM_001007024chr1744374 3996 3292 1606 ----12824
NM_001008239chr1843863 3783 3244 488 ------
NM_001008493chr11254 ------
NM_001008539chr841949 1609 255 243 --15393 --
NM_001010867chr152568 2559 2534 2425 1309 --15429 --
NM_001010888chrX54525 4320 4199 3382 1010 14144 ----
NM_001010935chr1--1194 ----
NM_001011513chr423442 1018 13457 ----
NM_001011537chr332255 1973 555 ------
NM_001011666chr786556 5108 4850 4169 2497 1919 1389 1315 24242 3996 ----
NM_001011722chr11347 1424 --1411
NM_001013843chr151200 ------
NM_001017371chr211365 ------
NM_001017395chr333431 2533 44 1738 ----
NM_001017440chr787852 6340 6165 2699 2194 1050 566 48 18153 36787 5236 1582 --
NM_001018067chr114138 --12030 14443
NM_001020658chr131608 1521 1057 31590 1543 1067 --1247
NM_001024660chr31683 ----11269
NM_001024948chr132967 2797 1411 --12337 --
NM_001025107chr132485 1022 696 ------
NM_001025356chr1252984 2942 2156 1032 963 --1520 --
NM_001031679chr1213141 --23100 2916 --
NM_001031695chr222414 232 15357 ----
NM_001032296chr1372868 2714 2672 1083 1069 426 105 1475 ----
NM_001032380chr104610 581 392 143 ------
NM_001033117chr313993 4478 414 370 356 11391 --
NM_001033507chr11148 ----1348
NM_001033910chr1--22122 840 --11477
NM_001037132chr752068 870 738 728 345 1195 12193 --
NM_001037582chr411520 ----11212
NM_001039199chr2054978 4221 1862 1062 811 --24369 3520 --
NM_001039590chrX33876 3854 3770 33250 1573 191 --1243
NM_001039840chrX21737 754 25499 236 11783 --
NM_001040020chr731477 1161 114 ------
NM_001040101chr451393 1203 483 188 112 ------
NM_001040110chr73426 292 68 1277 11493 --
NM_001040142chr212388 1810 ----
NM_001040152chr754304 4273 1901 1679 665 --13365 --
NM_001040284chr1665530 4598 4488 2197 1547 452 21965 503 ----
NM_001040402chr4--2286 257 --1640
NM_001040712chr953109 2693 1358 1276 334 11296 ----
NM_001042404chr1----11281 --
NM_001042537chrX31691 516 84 ----1737
NM_001042555chr1241805 1184 612 134 23258 1825 ----
NM_001042599chr237475 7093 4815 1434 16798 17005
NM_001106chr357756 6972 2977 1759 818 ------
NM_001174chrX22231 2104 12154 ----
NM_001241chr23933 489 325 12339 ----
NM_001259chr741751 715 445 411 ------
NM_001332chr5240 34 1545 11010 --
NM_001364chr1154071 1648 1350 590 242 14679 ----
NM_001427chr731978 1615 115 177 ----
NM_001438chr122422 2329 --13059 11135
NM_001455chr634905 4509 1161 1693 ----
NM_001497chr942704 2690 2673 2482 1534 ----
NM_001543chr534635 3519 3274 11036 14192 --
NM_001564chr4----1125 --
NM_001616chr222544 1040 ------
NM_001621chr742883 2347 1981 1217 11070 ----
NM_001635chr7----21025 332 --
NM_001642chr11----11186 --
NM_001650chr1822528 1050 12579 ----
NM_001656chr511493 21981 1506 ----
NM_001677chr12432 323 ----1354
NM_001681chr125619 160 88 57 51 ------
NM_001695chr82642 358 13442 23018 539 --
NM_001706chr33731 685 386 ------
NM_001743chr2----1428 --
NM_001827chr9--152 ----
NM_001949chr643229 2928 2912 2346 12642 ----
NM_001964chr5------11190
NM_001969chr1463337 2462 1169 850 807 711 ------
NM_001999chr521504 1147 --1978 --
NM_002025chrX58891 8287 6479 6080 471 19079 19246 --
NM_002086chr172550 299 12173 --12137
NM_002126chr1763953 3933 495 205 199 139 1160 11321 --
NM_002140chr91162 ------
NM_002149chr21537 ------
NM_002239chr21435 ------
NM_002267chr1341600 789 420 361 --11509 --
NM_002268chr31219 167 --11287
NM_002270chr5105300 4888 4510 4225 4196 3867 2052 1778 1676 1534 ------
NM_002356chr61487 ----1451
NM_002507chr17----11733 --
NM_002515chr1421991 1385 2229 144 ----
NM_002594chr2042156 1937 1931 1809 31879 1869 1818 ----
NM_002740chr332466 597 487 22676 1092 ----
NM_002745chr2243946 3386 2974 755 ----1928
NM_002816chr17------169
NM_002827chr20--11650 ----
NM_002912chr63902 847 65 ------
NM_002948chr31413 1239 2323 170 --
NM_002971chr311147 --11078 --
NM_003010chr1722085 167 ----12167
NM_003016chr1731447 381 179 --11961 --
NM_003017chr62164 27 1936 1103 --
NM_003030chr311866 --11561 --
NM_003108chr246780 4568 2311 38 16164 17074 --
NM_003112chr742886 2567 617 402 ------
NM_003128chr252801 2671 903 846 205 --12232 --
NM_003185chr201336 --2861 374 --
NM_003298chr356154 4098 4014 1738 491 34086 1247 356 ----
NM_003350chr8----1677 --
NM_003405chr221691 ------
NM_003406chr821468 399 --11862 --
NM_003471chr331901 1849 1743 ------
NM_003566chr12--33166 3061 2591 ----
NM_003583chr1253263 3203 2760 865 431 13744 ----
NM_003657chr20----1160 --
NM_003749chr1332386 1894 1755 11716 ----
NM_003873chr1022252 550 2492 473 ----
NM_003913chr664316 3202 3136 2636 1591 437 ------
NM_003922chr15--1347 ----
NM_003924chr411438 11664 11521 --
NM_003958chr61371 --1501 --
NM_003966chr51114 26798 422 17597 --
NM_004064chr1221175 1043 1258 ----
NM_004080chr721052 457 --1247 --
NM_004093chr1362616 2597 2387 2223 2215 896 1427 22239 410 --
NM_004102chr1----1159 --
NM_004152chr19----1145 --
NM_004171chr1168906 8094 7898 2579 1360 852 39656 8558 8017 --18115
NM_004187chrX--1332 ----
NM_004263chr231441 576 458 127 ----
NM_004272chr521580 1409 ----1577
NM_004279chr722316 445 --1752 --
NM_004331chr822016 737 --149 --
NM_004370chr621921 1702 ----1304
NM_004437chr122487 511 ------
NM_004491chr19104326 4209 3634 3625 3514 3386 2765 1480 1127 1040 --11545 --
NM_004498chr15----1379 --
NM_004504chr22912 135 1319 ----
NM_004560chr91673 --11040 --
NM_004588chr1143801 3577 2741 548 ------
NM_004725chr1031170 593 183 ------
NM_004734chr1312848 1444 22673 2359 13256
NM_004748chr1533555 2736 2666 ------
NM_004772chr521393 1140 --135 --
NM_004774chr1732387 384 281 13055 ----
NM_004834chr233380 799 484 ------
NM_004852chr18714230 9954 4544 3986 2964 2889 961 210350 1554 15271 --
NM_004866chr544544 732 506 128 13060 ----
NM_004906chr62554 104 1593 ----
NM_004938chr91413 1395 --1954
NM_004972chr911163 ------
NM_005028chr1052053 1728 417 266 59 2919 216 ----
NM_005056chr1245604 5210 4601 3416 --1101 --
NM_005063chr10----13270 --
NM_005095chr112074 --11492 1258
NM_005126chr32927 346 174 ----
NM_005156chr935259 1242 1031 ------
NM_005188chr1148226 7344 527 212 1571 ----
NM_005225chr204353 274 214 208 ------
NM_005284chr6--1193 1428 --
NM_005308chr10------1410
NM_005437chr101488 ------
NM_005504chr1265154 5043 4447 1221 598 579 2837 106 ----
NM_005542chr72608 420 ------
NM_005585chr15----1382 --
NM_005587chr151153 ------
NM_005596chr946319 1385 1264 1162 11713 ----
NM_005604chr63839 757 204 --12013 --
NM_005665chr121282 404 1979 ----
NM_005668chr511015 34581 4035 3813 ----
NM_005737chr232476 954 35 --22522 2069 --
NM_005779chr512734 13608 12863 --
NM_005822chr632048 924 363 12365 11483 --
NM_005859chr521392 1325 2966 608 11262 --
NM_005871chr1031055 953 862 ------
NM_005935chr454663 4655 4037 3596 1299 --1276 --
NM_005937chr1732566 770 656 24088 1575 12987 12949
NM_005955chr133728 1456 948 23635 307 ----
NM_006094chr82336 245 --1383 --
NM_006133chr11--12495 ----
NM_006166chr1222184 1878 ----12507
NM_006186chr2----11217 --
NM_006194chr141845 1352 ----
NM_006256chr122188 1086 12624 ----
NM_006265chr82562 403 11236 1284 --
NM_006267chr22444 215 --1205 --
NM_006279chr1----1319 --
NM_006298chr652859 2155 2141 1198 538 --22260 2116 --
NM_006306chrX61693 1348 540 360 338 108 ------
NM_006313chr1231703 1413 423 ------
NM_006357chr2--195 ----
NM_006379chr7--11700 --1209
NM_006415chr921022 266 1245 ----
NM_006420chr2043309 2116 1200 1007 ------
NM_006496chr111331 ------
NM_006520chrX31426 684 52 ------
NM_006549chr1232895 2374 259 ----12877
NM_006599chr1647078 6634 6518 2568 28094 708 ----
NM_006699chr11766 ----12687
NM_006703chr6----1138 --
NM_006717chr932951 2571 1342 23186 420 21221 886 --
NM_006726chr4------1968
NM_006754chr711068 ------
NM_006769chr1----2754 168 --
NM_006807chr17----1426 --
NM_006826chr221151 106 11188 ----
NM_006948chr21--42447 2416 2384 1609 ----
NM_007007chr1234031 3391 1657 13289 13432 --
NM_007129chr13------1406
NM_007214chr62109 66 ----1137
NM_007236chr1512072 ----1169
NM_007246chr42810 707 1933 ----
NM_007249chr1349074 8310 3050 2934 18005 29266 2356 --
NM_007285chr163107 41 23 ------
NM_007363chrX3998 979 776 --1222 --
NM_012081chr533293 1503 795 1547 1540 --
NM_012090chr12317 275 1995 --163
NM_012180chr4----1295 --
NM_012214chr246390 5294 4886 760 13881 25546 926 1768
NM_012229chr1041342 425 312 174 --11139 --
NM_012249chr253561 900 752 693 148 ------
NM_012338chr731206 1187 247 ------
NM_012399chr2211754 3265 202 186 ----
NM_012479chr742236 1066 1021 451 ------
NM_013231chr142146 118 14206 ----
NM_013249chr111200 ------
NM_013302chr1673695 3105 1549 1105 799 744 432 ------
NM_013374chr31592 2777 125 ----
NM_013381chr122670 351 22199 642 ----
NM_014181chr212875 12550 ----
NM_014243chr411634 31976 1423 305 --168
NM_014253chrX42367 2177 488 403 --11835 --
NM_014319chr1221657 700 31905 711 685 ----
NM_014415chr331664 1439 219 ------
NM_014423chr555497 5356 3684 3676 3474 ----11351
NM_014481chrX2328 303 1312 ----
NM_014504chr731431 482 348 ------
NM_014612chr911373 --21511 1063 --
NM_014682chr81938 --12335 --
NM_014683chr1741614 851 620 396 ------
NM_014702chr633056 1172 292 --1314 --
NM_014707chr721918 1480 --1847 --
NM_014738chr17------1680
NM_014746chr221281 566 13708 14089 1533
NM_014755chr263868 1605 1041 725 719 78 1340 14077 --
NM_014774chr143082 2767 2074 549 1473 ----
NM_014784chr1------11012
NM_014819chr52208 30 11623 ----
NM_014841chr631364 233 216 ------
NM_014849chr14417 151 145 139 ------
NM_014906chr1712561 --14099 --
NM_014962chr2032755 2132 2126 22895 2235 ----
NM_014974chr10----1645 --
NM_015025chr2--21903 514 1617 --
NM_015026chr1241439 1140 1118 537 1504 1312 --
NM_015071chr535804 4194 2223 26309 5815 12095 --
NM_015076chr62936 310 ----1405
NM_015092chr163962 897 144 14639 ----
NM_015110chr911585 ------
NM_015132chr7--21621 327 --1216
NM_015156chr1423284 2967 1405 12503 --
NM_015199chr332841 2386 736 ------
NM_015215chr123062 1206 11018 ----
NM_015268chr3----1238 --
NM_015271chr444298 4179 3916 2613 12802 11204 --
NM_015272chr16------190
NM_015310chr876633 5243 3268 2528 1162 938 924 --1114 16267
NM_015317chr211130 21761 167 ----
NM_015347chr1252948 2343 2287 2093 686 12268 ----
NM_015358chr2131248 1055 365 ------
NM_015359chr812538 --12891 --
NM_015393chr443522 2503 2326 1245 ------
NM_015455chr533941 997 978 ----12629
NM_015695chr6------11615
NM_015878chr831834 1792 446 1634 1696 --
NM_015904chr21549 ----1137
NM_016107chr52369 309 1879 ----
NM_016206chr321548 392 11286 16701 --
NM_016248chr1333335 1378 1360 ----1163
NM_016322chr923152 1192 1697 ----
NM_016441chr232334 2190 1702 ------
NM_016952chr1143128 1580 1573 425 ------
NM_017593chr43133 73 53 ------
NM_017596chr124612 934 ----14573
NM_017610chr151471 --1635 --
NM_017633chr621015 596 63348 2919 2828 1045 1024 658 ----
NM_017637chr969173 8197 6694 3603 1804 118 22965 2718 18453 --
NM_017643chr1722544 272 12981 ----
NM_017650chr745357 5341 4862 4758 24934 1188 ----
NM_017742chr182494 333 1592 21280 263 --
NM_017762chr1512213 11989 1841 --
NM_017769chr1422097 1161 12318 ----
NM_017772chr6--1632 11787 --
NM_017848chrX43833 1213 1019 722 43113 1040 1028 940 --23679 924
NM_017902chr1094971 1744 1732 926 897 840 342 332 302 2880 727 ----
NM_017925chr921365 1221 1765 ----
NM_018011chr13----1464 --
NM_018133chr331790 1477 865 1317 1533 --
NM_018150chr1------1602
NM_018247chr631045 369 36 1493 ----
NM_018361chr823624 297 13140 ----
NM_018362chr1113646 ------
NM_018374chr745228 4226 963 745 ------
NM_018424chr921892 1408 --11374 --
NM_018469chr1741307 1022 553 387 ------
NM_018490chr112326 262 11387 ----
NM_018566chr113633 11740 15106 --
NM_018650chr131709 1404 234 1441 ----
NM_018657chr3--1595 --164
NM_019004chr731873 953 933 ------
NM_019024chr2------1448
NM_019035chr4--1125 ----
NM_019072chr534242 3880 2904 1145 ----
NM_019080chr13----1487 --
NM_019091chr23253 225 161 1712 1333 --
NM_019116chr16----13630 --
NM_019842chr6----1272 --
NM_020122chr275126 3758 1450 1322 838 393 318 11229 ----
NM_020309chr19------11115
NM_020337chr42449 335 33010 2998 2683 ----
NM_020346chr11----11498 --
NM_020432chr731637 1432 702 ------
NM_020546chr532939 2082 94 --1334 1318
NM_020648chr1842838 762 728 259 ------
NM_020698chr1242435 2062 551 129 22017 62 ----
NM_020718chr1686492 6436 6402 4832 4512 4218 1529 139 1376 ----
NM_020734chr1252286 1121 1097 730 274 11308 ----
NM_020748chr1721519 717 11667 ----
NM_020772chr1727800 7697 35316 3194 1310 23473 567 --
NM_020791chr172524 252 1115 ----
NM_020809chr1112203 ------
NM_020824chr102612 152 1760 ----
NM_020825chr1633664 2551 367 13840 ----
NM_020870chr411923 ------
NM_020873chr3------1781
NM_020935chr224654 278 23756 287 14052 11209
NM_021033chr1313083 ------
NM_021038chr353156 1345 499 459 361 1611 ----
NM_021090chr2274782 4229 3284 3089 1760 1688 1558 ------
NM_021097chr232892 2491 1089 ------
NM_021202chr2043029 2912 2761 2663 12234 ----
NM_021813chr655383 4703 4615 4456 112 --14807 --
NM_022066chr17----11069 --
NM_022114chr134392 4043 1823 14115 1623 --
NM_022118chr131516 --1553 --
NM_022130chr51355 ----11404
NM_022133chr811536 2324 276 ----
NM_022166chr16--12490 --16300
NM_022726chr621565 1181 1459 ----
NM_022781chr942504 873 492 438 --1645 --
NM_022918chr11----11870 --
NM_024007chr532317 1988 576 12744 ----
NM_024055chr5----1623 --
NM_024496chr141105 --1620 --
NM_024551chr1262197 2079 2037 1870 657 204 ------
NM_024569chr1----156 --
NM_024665chr333504 3257 3238 1147 1651 --
NM_024721chr841990 1642 654 396 ----11037
NM_024761chr933773 1924 1420 33355 2064 1989 ----
NM_024852chr11462 ------
NM_024900chr442339 1830 1682 567 --11569 --
NM_024947chr349337 7359 2565 2161 13674 29291 3383 --
NM_025009chr421602 362 11526 1777 11319
NM_025054chr831034 902 136 --11545 --
NM_025126chr12----1715 --
NM_025160chr131574 417 73 ------
NM_025222chr331083 765 202 32952 1140 1114 ----
NM_030625chr1031672 194 43 1691 ----
NM_030627chr533906 3818 2793 ------
NM_030647chr756260 5331 2086 1218 52 1102 15175 1672
NM_030648chr424435 975 25024 3989 15498 --
NM_030791chr1441378 415 373 146 ------
NM_030920chr12753 323 --1334 --
NM_031365chr222544 46 1544 --1963
NM_032153chr321745 846 1251 2576 116 --
NM_032228chr1132828 1391 961 ------
NM_032457chr433598 3167 1306 ------
NM_032505chr331971 1833 23 1746 12341 --
NM_032514chr20----1393 --
NM_032632chr1421461 495 1692 ----
NM_032765chr5------1320
NM_032804chr1032397 1828 439 12423 ----
NM_032833chr132106 542 522 12656 --1935
NM_032842chr731281 1264 658 --21550 109 --
NM_032873chr1123685 353 14202 34375 4316 4055 --
NM_033222chr921042 286 1384 ----
NM_033224chr747483 7473 7069 2456 --15224 --
NM_033285chr873989 2712 1368 632 562 169 129 163 14446 --
NM_033389chr1763681 2962 2956 579 156 57 1167 23009 127 --
NM_033495chrX2300 292 1674 ----
NM_033656chr2154975 1530 1420 700 474 ------
NM_052851chr1342206 1615 274 71 1362 ----
NM_052879chr1233816 3465 1211 21341 782 ----
NM_053002chr321082 1053 --1975 --
NM_130847chr1145164 3856 3657 1761 35107 4602 4590 ----
NM_133265chrX43283 2713 1230 543 33255 3173 378 ----
NM_133638chr5------1391
NM_134428chr9----2346 150 --
NM_138285chr2----1487 --
NM_138286chr1964025 3265 3252 2813 1507 918 154 ----
NM_138426chr731744 1735 676 --11814 --
NM_139283chr1211959 ------
NM_144571chr456762 6007 2521 2433 311 1156 ----
NM_144632chr242028 1879 1746 642 ------
NM_145011chr1042115 873 806 131 1761 ----
NM_145049chr511081 ----11050
NM_145808chr733007 2691 2039 12849 ----
NM_152265chr121473 221 1323 1288 --
NM_152409chr52774 660 12918 12554 --
NM_152414chr821651 1206 --11071 --
NM_152520chr231226 896 263 --1442 --
NM_152556chr722065 641 12233 ----
NM_152594chr1522276 184 22151 1733 ----
NM_152624chr535941 2581 581 21903 1577 ----
NM_152758chr852776 2697 2140 715 619 ------
NM_152902chr121970 1388 11763 ----
NM_153184chr3--1140 ----
NM_153261chr1631599 1235 1133 ------
NM_153607chr522951 790 ------
NM_153757chr42918 859 ----11106
NM_172071chr137266 5841 5612 1405 --16515
NM_173468chr455379 5030 4676 409 53 25758 2214 1481 --
NM_173508chr13859 796 78 1838 11138 --
NM_173552chr332395 1795 323 ------
NM_173567chr1----1200 --
NM_173582chr111603 1353 16230 --
NM_173602chr1212318 --23548 756 --
NM_173822chr222007 1521 12017 --1350
NM_174916chr15--12418 12182 --
NM_175061chr711907 12019 --11748
NM_175736chr1237833 6994 2311 ------
NM_176814chr741090 916 470 272 --11485 --
NM_181358chr143754 3168 1372 1162 11079 ----
NM_181504chr533954 3156 3042 33861 3843 3795 ----
NM_181672chrX1523 1432 --1242
NM_182485chr422813 94 1473 145 --
NM_182920chr32190 85 --179 --
NM_182976chr11289 ------
NM_183376chr1532440 2429 1874 21723 436 ----
NM_194247chr231660 884 757 22970 1354 ----
NM_194291chr811884 2669 205 12495 --
NM_194317chr232386 2361 2271 12650 ----
NM_198074chr141180 1149 1084 860 ------
NM_198243chr151749 --1796 --
NM_198270chrX13130 23499 1249 ----
NM_198273chr553099 2902 2010 714 40 22978 799 --11218
NM_198859chr324014 1371 14957 11651 --
NM_198904chr521308 580 12017 ----
NM_199320chr422500 2073 1945 12762 --
NM_203459chr122501 2163 21671 1658 ----
NM_206854chr645225 2015 553 325 11468 ----
NM_207406chr445463 4371 2552 837 --14387 --
NM_213589chr25427 418 204 151 131 3679 211 179 21047 498 --