TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-501-5p
miRNA Sequence: AAUCCUUUGUCCCUGGGUGAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1586107 6027 4533 4445 3902 569 278 266 --34795 1561 1353 35246 4954 4936
NM_000314chr1051302 701 527 467 239 23163 23 --22722 769
NM_000332chr6126797 6783 6723 6560 6115 5255 4711 2505 1458 1321 358 262 --35610 1460 1323 11941
NM_000533chrX111764 1721 1559 1450 666 578 395 371 315 275 136 ----21946 342
NM_000555chrX107696 6758 6537 4838 2997 2252 1940 763 479 251 --26539 1351 12916
NM_000599chr2154009 3753 2965 1718 1709 1646 1596 524 374 350 298 288 276 268 107 1921 24520 4378 13730
NM_000809chr4159172 8945 8432 7872 7201 6700 6555 2370 2353 1347 865 843 568 494 461 ----27579 7358
NM_000813chr5115514 4786 4714 4681 4232 3819 3494 2219 1731 1609 1132 --11154 --
NM_001001396chr1114420 4408 3937 3562 3472 3298 3043 2956 457 123 84 13214 22940 1011 24423 915
NM_001004065chr9122624 2576 1438 1319 1107 1098 1057 679 351 277 215 168 ----11441
NM_001004419chr1253894 1217 973 943 38 14384 33025 1266 746 13291
NM_001010891chr585903 5684 5574 4885 4492 1707 1043 120 14463 11108 14697
NM_001011666chr7156381 6370 6103 6041 5948 5608 4575 4379 4256 4013 2485 1944 1296 942 182 ------
NM_001014797chr10146844 6750 6685 6664 6271 6117 6065 3295 3248 3160 2491 1285 809 563 --58194 6145 6012 5543 2287 --
NM_001024455chrX102507 2273 1046 957 894 882 876 586 448 207 12374 12714 1853
NM_001030007chr16123526 3271 3197 2813 2770 1390 1246 962 334 131 57 44 1721 ----
NM_001031695chr22215402 4444 4298 4162 3664 3545 3505 3426 2173 2119 2038 1666 1652 1416 1396 1018 1012 966 350 101 78 13445 --14729
NM_001033087chr20103033 3001 2684 2146 1193 844 646 474 387 110 11112 32620 1178 803 13313
NM_001040108chr1493252 3033 2882 2603 868 609 328 33 25 2617 589 135 --
NM_001040152chr764224 4178 4072 3967 3944 3902 13745 14899 13239
NM_001040441chr174774 3645 1379 1068 553 459 312 11823 --13907
NM_001042355chr16135174 5003 4921 4741 4437 4430 4421 4088 2125 2040 1961 1576 682 44722 3493 3336 383 21820 132 14037
NM_001042494chr1593767 3477 3250 2996 2361 1549 1031 785 307 1408 1309 12999
NM_001042599chr2167704 7513 6757 6352 5457 4827 2735 2557 2429 1697 1659 1363 1349 945 822 263 11481 37084 4773 2559 --
NM_001100108chr1208309 7747 7729 7599 7529 7147 6563 6381 5156 2768 2287 2051 2026 1993 1754 1620 1327 1054 911 55 12515 22366 2044 16345
NM_001401chr931354 1296 96 145 21636 1356 2599 405
NM_001453chr691426 1415 1329 1293 1219 624 429 294 53 --11754 11332
NM_001759chr12124335 3920 3444 3365 3303 1640 1235 820 491 459 342 219 --14282 24495 865
NM_001949chr673034 2949 2936 2583 2277 1169 1076 12942 13258 --
NM_002009chr1532669 1933 1024 --1677 22069 664
NM_002025chrX108773 8704 8540 8060 2813 2562 2507 1996 621 402 12702 43037 2649 2359 686 17735
NM_002158chr222984 2356 ----3812 97 51
NM_002223chr12103628 3534 3248 3212 2969 2652 2486 1516 690 295 --33957 2741 795 --
NM_002264chr3115033 4805 4728 3547 3526 1806 1531 822 726 434 336 14111 25067 3549 21691 209
NM_002336chr12124904 4779 4648 3357 3291 1861 1525 1470 499 386 315 95 --11842 24736 172
NM_002356chr692339 2302 1989 1028 588 581 400 380 103 12266 --21890 403
NM_002397chr551593 1580 831 572 349 --32222 1848 552 11596
NM_002698chr19172943 2917 2879 2846 2486 2404 2188 2159 1949 1847 1152 1096 908 773 525 460 415 --1954 --
NM_002737chr17186569 6409 6238 5925 5843 5378 5239 5211 4615 4608 4170 2565 2501 2466 2284 1825 1209 463 34477 1094 769 14555 --
NM_003108chr2136972 6447 6390 5915 5852 5375 2708 2301 2233 1794 990 594 492 15340 37292 2091 1113 --
NM_003489chr2153130 2503 2455 2343 1376 ----22579 429
NM_003822chr162316 2207 1184 1177 1044 767 12136 32085 1050 241 --
NM_003953chr182669 2521 2176 2115 2016 1764 859 436 ----2692 154
NM_004171chr11118530 8368 7516 6684 3813 1795 1608 1191 599 141 87 29107 7287 25818 1284 11901
NM_004464chr463799 3637 3538 3362 1065 172 1257 21469 823 13147
NM_004685chr1352452 1033 132 81 57 1138 145 12377
NM_004852chr182513977 13813 13753 13506 13321 12634 11715 10643 10588 9041 8986 8672 4451 4238 4107 3581 3552 3152 2469 2391 2159 2047 1776 1126 70 24383 2413 512423 11952 9362 8631 1875 --
NM_004956chr7114321 4053 3940 3870 3408 3286 3163 1626 1314 252 128 ----1608
NM_005065chr14105080 5014 4455 4397 3871 3836 1910 583 412 39 1172 23680 818 --
NM_005105chr161689 1491 872 850 836 819 --42015 1359 879 842 --
NM_005359chr18106373 6242 6145 6094 5404 4941 4690 1608 816 269 --26100 117 14141
NM_005578chr354755 3797 3574 3145 1418 --1960 23528 478
NM_005596chr9116104 5510 5131 4896 2080 904 747 731 211 178 170 26253 1227 25226 305 --
NM_005935chr4155228 4865 4430 4423 4031 3534 3425 2033 1703 1689 899 836 541 414 245 --55292 3892 1691 1165 450 13428
NM_006080chr762725 1952 1067 1061 1009 336 2807 443 12154 12165
NM_006306chrX105789 5753 4679 4019 3577 2312 1321 412 216 148 ----24308 390
NM_006393chr1094240 3932 2826 1276 951 717 540 500 152 --23305 841 11773
NM_006544chr14116091 5882 5180 5018 4623 4222 1579 827 793 317 45 ----15611
NM_006981chr9112564 2449 2089 2065 1183 1045 680 550 402 106 63 ----2325 66
NM_007249chr13199151 8827 7786 7115 6825 6291 6237 3507 3144 2969 2831 2586 1967 1497 1245 1081 1022 542 97 37799 1462 1373 49182 2704 1490 1083 18848
NM_007350chr12144274 4244 4111 3545 3164 3006 1632 1212 1168 814 676 565 442 383 1694 34230 1358 242 11310
NM_012104chr11113653 3147 2979 2954 2930 2914 2607 1064 597 591 150 --43590 2496 1361 459 13186
NM_012164chr997340 5894 5708 2602 1694 1681 1315 1272 1010 11122 45641 1843 999 262 --
NM_012193chr11165443 5347 5325 5042 4746 4479 4226 3893 3867 3803 3789 3385 1708 1220 844 805 ------
NM_014112chr8114598 4290 4050 3652 3491 3455 1770 1318 1214 897 468 --1358 11810
NM_014423chr5115173 5009 4357 3673 3445 2026 1743 939 818 806 60 35542 3480 591 1921 11756
NM_014613chr572860 2128 2100 1130 1024 548 164 11109 22987 2191 22743 933
NM_014674chr3133942 3925 3688 3194 3102 2857 1585 1515 1270 1209 960 561 84 1205 23927 536 --
NM_014747chr1135344 5181 4689 4405 2131 2093 1979 1909 1776 1039 834 345 303 13573 14249 12151
NM_014828chr1441768 1745 246 233 --2410 239 --
NM_015049chr293178 2912 2412 753 401 385 125 109 94 148 --12962
NM_015076chr6114024 3865 3762 3575 3463 3339 3252 1781 1402 918 298 13189 23577 798 --
NM_015090chr1164949 4776 4762 4541 4488 4209 4034 3954 3922 2363 2303 2176 2139 1638 1611 846 24997 112 45022 4424 573 500 13849
NM_015206chr1553683 2451 637 399 300 --21391 796 33571 2830 495
NM_015310chr8188369 8035 7479 7236 7146 6848 6834 6688 5947 2719 2667 2534 2104 1381 1371 1049 687 680 --1756 13249
NM_015313chr1193952 3532 2966 1200 1173 836 541 520 451 13029 31665 1012 106 11191
NM_015328chr7103023 2903 2889 2849 2106 840 652 530 347 236 22415 1057 21902 222 --
NM_016131chr242176 1439 833 526 ----22130 658
NM_016206chr3148972 8604 7831 5911 3480 2774 2536 2251 2245 1374 1061 861 451 109 16682 58522 7983 7487 2912 333 15540
NM_017637chr9189381 9238 9003 8656 7812 7601 7531 6925 6152 6064 5868 3206 2086 1639 1173 449 421 230 27257 3378 59159 6419 6120 2655 2278 13726
NM_017643chr1762369 1960 822 528 338 34 21213 356 32718 2109 824 11205
NM_017650chr7115412 4700 4642 3897 2131 1578 1414 1295 1242 1077 583 23936 104 178 --
NM_017736chr1683049 2632 2018 950 670 350 296 171 32560 716 237 12528 1828
NM_017813chr8105496 5398 4649 4608 4399 3914 3610 2265 1369 367 --45600 5115 4340 73 --
NM_017902chr10155482 5348 5269 5155 5048 4976 4433 4113 4107 3743 1911 1590 1584 801 695 --44435 4099 1712 646 --
NM_018293chr3102843 2719 2527 2369 2321 1129 824 791 733 337 --22721 191 --
NM_018373chr14175903 5815 5374 5338 4477 4382 4118 2410 2291 2182 1214 1129 687 669 606 367 191 11721 36018 608 376 14716
NM_018566chr1105152 4904 4613 4208 4200 4167 3548 3304 1416 677 --24774 4521 196
NM_020440chr1113373 3233 3116 3108 2911 2607 2097 1276 903 817 60 12417 33264 2145 834 11233
NM_020443chr1176248 5755 5482 5294 5022 4951 4785 2602 2554 2365 2286 1819 1231 1099 627 187 141 24650 1946 12604 --
NM_020673chr20127764 7297 6809 6685 5352 2709 1490 778 363 333 255 220 --24728 123 --
NM_020699chr1105439 4776 4349 3534 3283 1921 1506 1016 813 620 --55378 4191 4106 3662 1117 15087
NM_020919chr25948 203 190 173 105 --11188 2312 290
NM_021964chr3125866 5319 5249 4983 4744 4544 4106 2262 1744 1045 584 273 12620 14112 --
NM_024665chr3113980 3867 3860 3672 3521 3496 2998 2924 1053 974 516 ----1734
NM_030806chr1209193 9083 8595 7792 7513 7336 7251 6933 6850 6809 6785 6035 5768 3672 3368 2671 2663 1666 1308 172 28435 6137 39356 8380 2515 26828 2597
NM_032873chr11113988 3785 1556 1066 993 899 586 398 359 183 23 --31598 1567 917 --
NM_033656chr2195677 5598 5046 4598 3990 3884 1672 865 31 14087 24600 817 11336
NM_053023chr1143239 2537 595 60 1601 22539 2050 13242
NM_133264chr17113929 3804 3560 2978 1203 1078 1053 786 720 524 477 23357 608 2669 34 13914
NM_138444chr1371833 1719 1640 1040 1031 824 235 --24525 667 11023
NM_138473chr12104459 4274 4175 3869 3833 3148 1399 1211 1096 150 34539 2023 140 24789 4024 --
NM_144571chr486859 6771 5706 4944 2809 2697 2332 1796 --11048 15161
NM_144599chr1575301 4790 4600 4507 4420 4182 1428 --25131 4861 15261
NM_145013chr11162963 2793 2456 2309 2285 2275 2251 2080 2035 1964 931 875 713 495 350 247 --22965 2503 --
NM_152407chr573244 3216 3103 2801 2683 384 372 --13158 1413
NM_152470chr18143216 2788 1632 1614 1477 870 793 596 589 351 268 164 135 103 --1648 13922
NM_152756chr524348 3418 --23148 1290 24351 875
NM_152787chrX72877 1202 1160 475 220 158 60 21519 531 32578 1505 242 1223
NM_153207chr1274044 3930 3487 1433 1283 1228 953 21201 425 --13008
NM_153810chr1094884 4430 4257 4236 1860 1369 894 534 38 --34010 3498 128 13525
NM_172071chr1117409 6623 6175 5428 4695 2857 2659 2093 1824 1697 740 21546 1055 14521 --
NM_173468chr4105937 5686 5619 5394 3847 2383 1999 1272 944 707 1213 --15940
NM_173808chr1123760 2932 2879 2871 2859 2833 2769 1730 1480 1018 743 31 --22920 946 1255
NM_203458chr1103457 2389 1523 1510 1363 1126 770 621 457 407 --11472 13208