TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5010-3p
miRNA Sequence: UUUUGUGUCUCCCAUUCCCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr832351 1595 90 11759 21830 689 2339 276
NM_000084chrX76973 5670 5209 1623 1258 699 155 11543 ----
NM_000092chr293980 3284 3235 1064 1049 678 667 316 182 34226 3624 837 2973 533 14110
NM_000109chrX42466 2273 995 135 1286 --1495
NM_000115chr1352664 1799 778 668 290 ----12051
NM_000125chr673962 3354 2905 1581 922 610 599 1822 13944 --
NM_000138chr1572611 2541 2179 1942 880 470 385 11791 ----
NM_000139chr1182570 2479 2472 2203 2125 1012 711 441 --12564 11075
NM_000165chr641441 1312 664 306 21515 608 21574 138 --
NM_000167chrX21315 45 11705 21692 1633 --
NM_000176chr553197 2929 2903 1064 574 21433 723 11308 --
NM_000189chr272351 1860 1708 1652 1528 747 702 12029 11642 11980
NM_000208chr1974417 4299 3507 1789 1459 1140 331 1551 34091 3712 2893 24635 4211
NM_000210chr272145 1631 855 787 756 305 156 31759 1741 618 ----
NM_000216chrX83611 3450 3443 1080 460 378 367 33 2856 640 11313 --
NM_000217chr1274378 1747 1703 882 845 595 282 --32023 1439 1430 --
NM_000232chr462704 2340 2204 2135 1238 1192 12009 --23147 2890
NM_000242chr1042693 2641 938 561 21931 814 1531 12177
NM_000245chr731906 1880 1724 21556 349 11832 1881
NM_000248chr392812 2789 2713 2116 616 256 219 197 29 --12073 --
NM_000252chrX41415 1035 301 119 21439 1021 ----
NM_000259chr1576063 5141 4703 2286 2056 1649 771 25889 1672 --11170
NM_000267chr1783021 2538 2255 2198 572 564 441 362 21343 518 ----
NM_000314chr1042897 2231 799 759 22087 1094 --13170
NM_000330chrX102029 1859 1730 1601 1545 820 702 666 103 44 1255 22072 335 --
NM_000332chr686845 6068 4590 2146 1928 1800 1622 81 35150 1729 302 26013 5592 --
NM_000335chr362130 1922 610 584 323 78 1773 2884 571 --
NM_000337chr594979 2509 2449 2377 2202 1072 716 353 36 56084 5862 2041 757 232 35691 2551 1199 190
NM_000340chr321040 334 --11262 11124
NM_000351chrX133504 3303 2905 2666 1486 1027 1004 763 746 487 285 87 56 23162 3076 --32985 2699 463
NM_000361chr2072078 2003 1853 1726 1551 1531 460 11761 1248 --
NM_000362chr2252863 2354 1035 927 639 1784 32223 435 426 11060
NM_000369chr1441605 1537 519 504 4738 623 414 42 21386 465 --
NM_000390chrX53394 2557 2253 439 174 12375 --21369 1246
NM_000393chr252092 1733 1667 1500 223 160 ----
NM_000408chr233323 1088 333 12361 11215 23345 3130
NM_000428chr1422078 837 --32312 854 652 --
NM_000430chr1743653 1374 912 861 11066 33522 3298 151 --
NM_000439chr542505 1581 367 232 1778 11747 --
NM_000448chr1173075 2215 2044 1311 1156 880 563 12714 23002 2793 --
NM_000489chrX42774 807 402 286 33080 340 329 --1578
NM_000533chrX61971 1812 1694 1398 272 50 31659 593 454 31941 1874 1368 --
NM_000538chr1321773 313 11168 2108 76 --
NM_000555chrX107600 6635 5978 5591 5396 4966 3098 2737 2111 34 --23069 432 11319
NM_000587chr551145 969 367 149 72 1395 21272 498 --
NM_000612chr11303033 2498 1525 1483 1447 1428 1409 1377 1358 1351 1334 1319 1285 1261 1242 1223 1204 1185 1145 1137 1126 1073 1029 981 962 928 917 900 893 723 2378 223 121498 1421 1297 1271 1216 1153 1102 1085 1037 993 970 946 1292
NM_000615chr1172097 2032 1999 506 399 77 45 1867 1103 --
NM_000616chr1281461 1243 1225 571 552 530 429 401 1421 ----
NM_000618chr1265118 4802 1896 1814 438 308 2670 582 56197 1635 1000 640 147 25732 1087
NM_000618chr1265118 4802 1896 1814 438 308 2670 582 56197 1635 1000 640 147 25732 1087
NM_000633chr1884443 3901 3793 3209 1413 949 765 162 24659 3330 1143 15108
NM_000719chr12105863 5228 4731 4640 4541 4258 1858 1812 1432 822 36397 5721 1392 45161 4872 4798 4711 26715 1500
NM_000724chr1041595 1339 514 355 --2502 199 11610
NM_000767chr1941021 1008 614 558 ----2565 204
NM_000793chr1445118 4069 1993 740 24591 3519 34573 1199 808 --
NM_000794chr53732 210 136 --3792 687 377 --
NM_000800chr531668 1592 111 ----11303
NM_000806chr541894 1718 1681 285 1605 1472 11429
NM_000809chr4189200 8525 8166 7637 3473 3430 3125 3020 2960 2825 2451 2254 2029 1961 1110 1092 948 832 58660 5873 1947 1135 546 49314 7994 7346 7287 --
NM_000810chr152438 136 1484 1548 1619
NM_000813chr5155534 5427 5389 5173 4580 4304 4266 4256 4205 2244 2026 1585 1030 821 215 14835 44107 1326 1018 741 1955
NM_000814chr15114189 3998 3412 3134 1537 1442 1346 811 384 209 125 --32600 98 90 --
NM_000818chr10--1100 1454 1446
NM_000824chr44614 268 254 62 124 --1791
NM_000826chr482143 2125 1991 1822 903 575 330 199 12638 --12623
NM_000866chr381799 1702 1670 1606 1451 598 438 284 --11761 --
NM_000868chrX72373 2164 2142 1895 1670 1641 490 --1908 --
NM_000875chr15156967 6735 6241 6205 5491 5230 5024 4790 2085 1430 798 751 538 371 91 32243 1864 473 46217 5423 1634 994 46824 6388 6298 2329
NM_000891chr1783646 2794 2288 973 602 175 134 116 22266 1479 1408 --
NM_000899chr1233751 2694 67 13258 31416 646 393 33355 3215 1514
NM_000901chr452135 2032 1718 677 302 12181 11596 3782 464 411
NM_000902chr372615 2527 2330 2225 1228 923 230 151 12588 13221
NM_000909chr42879 52 ----21059 926
NM_000926chr11149414 9338 7032 6860 6733 6594 6032 5713 3517 2984 2542 2005 1907 750 98127 7495 7062 6130 3663 3572 1717 1655 1594 78566 7442 6990 5787 1068 623 367 27245 2112
NM_000933chr205718 286 252 199 40 1208 154 11095
NM_000945chr241834 1820 1617 464 1420 --1440
NM_000950chrX62903 2423 1300 1258 1117 309 33363 2465 925 21143 78 --
NM_001001132chr2141458 1237 470 249 21209 241 --11506
NM_001001323chr1252949 2594 2409 1988 1175 1145 12006 --
NM_001001331chr362189 1935 1759 808 600 156 11694 22594 1716 12559
NM_001001395chr1282480 2349 2312 1112 793 319 84 72 21945 969 3558 502 31 1673
NM_001001419chr574833 4316 4176 3325 1694 1176 123 11413 --44131 3542 1422 594
NM_001001420chr574833 4316 4176 3325 1694 1176 123 11413 --44131 3542 1422 594
NM_001001433chr203906 390 238 12194 22995 955 12203
NM_001001484chr1062319 1943 1791 734 683 522 21850 715 12177 --
NM_001001557chr842111 1989 1719 865 22055 1925 --1561
NM_001001664chr284071 3778 3642 3334 3006 2813 1568 1515 23546 112 33657 3628 73 11158
NM_001001668chr1984187 4164 4047 1507 1000 321 186 77 43916 2636 1036 679 22861 452 21622 1099
NM_001001890chr2164149 4002 1660 1257 1237 750 23958 3334 12955 12927
NM_001001971chr1081397 1354 1336 1291 263 193 160 89 1933 ----
NM_001002258chr241838 1489 1352 189 --11934 --
NM_001002860chr1441637 1622 568 279 12908 11630 1952
NM_001002926chr772575 2405 1788 1079 1006 321 47 1106 22386 2228 52130 1858 504 276 216
NM_001003407chr1034457 1394 269 24702 3881 33408 819 225 --
NM_001003408chr1034457 1394 269 24702 3881 33408 819 225 --
NM_001003652chr1857906 7766 3025 1556 1271 38533 949 261 26486 2120 37413 7014 6717
NM_001003665chr163495 2675 2209 329 269 69 --43538 1192 1006 736 --
NM_001003674chr18166874 5640 5484 4443 4330 2622 2400 2084 2033 1761 1611 1592 1521 307 210 101 27072 2047 1187 25220 1228
NM_001003675chr18166874 5640 5484 4443 4330 2622 2400 2084 2033 1761 1611 1592 1521 307 210 101 27072 2047 1187 25220 1228
NM_001003712chr1263819 2759 1460 623 480 283 53737 3329 2867 428 417 --13072
NM_001003760chr673317 3075 2327 987 761 519 487 1710 --12413
NM_001003800chr963709 2752 2573 2510 637 107 --23686 3579 12951
NM_001003945chr93656 586 553 11603 1774 11930
NM_001004065chr963457 2870 1518 1231 644 145 43273 2573 608 500 23248 1184 11066
NM_001004342chr165977 5133 4644 3907 2329 867 189 11139 21954 933
NM_001004346chr461058 969 906 850 307 82 ------
NM_001004360chr241240 634 613 364 21336 1280 2663 161 --
NM_001004419chr1284240 3614 3341 3222 3021 2992 1788 450 23867 1162 33126 215 33 23191 2882
NM_001004441chr541688 1654 516 490 31036 437 167 11267 11324
NM_001005339chr10--2220 109 --1182
NM_001005404chr1774324 4038 3647 2980 2960 1464 874 21614 600 ----
NM_001005463chr1052612 2219 2211 1901 1818 22393 131 11799 11810
NM_001005473chr585863 4698 4075 2098 2023 1815 1536 1457 --42087 2061 2031 1401 11976
NM_001005845chr831827 563 129 31445 1265 508 11650 1528
NM_001006600chr5--1251 12342 1985
NM_001007023chr1445118 4069 1993 740 24591 3519 34573 1199 808 --
NM_001007097chr985070 3961 3415 1977 1557 1505 1410 542 23946 1727 34862 4834 1440 34007 3614 290
NM_001007099chr14580 333 224 210 1651 ----
NM_001007100chr14580 333 224 210 1651 ----
NM_001007214chr121238 659 1412 11374 21555 1466
NM_001007278chr1365283 4470 4277 3569 1430 154 34326 1720 1472 13274 1862
NM_001007466chr674753 4424 3683 3617 3526 1216 767 1520 13202 14082
NM_001008239chr1873825 3147 3009 2781 2623 603 195 ------
NM_001008392chr383189 3040 2496 2410 1185 1093 445 203 ----12296
NM_001008393chr452707 1120 924 541 498 22294 2261 12624 --
NM_001008401chr1961484 1256 581 430 292 179 1242 --11466
NM_001008405chr73651 405 202 --21850 1683 11709
NM_001008491chr242029 730 605 525 ----11560
NM_001008492chr242029 730 605 525 ----11560
NM_001008541chr10----22067 58 12343
NM_001008541chr10----22067 58 12343
NM_001008707chr1441618 641 211 102 1323 31825 502 47 --
NM_001008726chr1421053 510 31567 1312 1158 11407 1656
NM_001008738chr542795 610 338 62 1284 22434 845 --
NM_001008777chr171501 --2597 463 1631
NM_001008801chr1982164 1935 794 558 525 446 224 170 ------
NM_001009554chr444442 4293 3676 3401 11855 24212 3730 11350
NM_001009554chr444442 4293 3676 3401 11855 24212 3730 11350
NM_001009899chr3126397 6118 6105 5613 5578 2576 2481 2456 601 408 69 43 11652 45621 5523 5184 3943 14221
NM_001009959chr282209 2185 2170 2155 2072 1800 1778 830 12558 12327 12147
NM_001009993chr253288 1445 1351 1339 128 ----23871 315
NM_001010000chr1853280 3200 2861 1386 772 12475 12322 --
NM_001010853chr683010 2874 2422 2196 2136 1100 1059 568 --12540 13263
NM_001010861chr141003 927 893 233 1311 1347 --
NM_001010888chrX114660 4430 4037 3965 3350 3115 3102 1060 745 452 64 13697 44458 3130 1356 30 --
NM_001010891chr576844 6730 6123 5845 5480 2448 1403 16488 21040 261 14620
NM_001010934chr751041 971 452 145 120 1390 --11009
NM_001010986chrX3437 293 60 130 --11709
NM_001011513chr443388 3343 2839 172 1229 13913 21264 652
NM_001011537chr36949 859 671 576 386 103 11649 --1476
NM_001011666chr7126565 6159 5981 5887 5838 5273 5216 5198 1768 1477 1063 483 32481 1913 819 35319 1685 1094 --
NM_001011708chr242573 706 528 30 ----32268 2250 1941
NM_001011713chr1441639 330 293 142 2312 38 --1398
NM_001011885chr153244 203 27 31761 275 71 1264 11432
NM_001012393chr11104976 4599 3510 1910 1698 1661 761 393 332 49 13479 11783 24006 1116
NM_001012420chr1531051 465 76 2637 319 1299 1962
NM_001012423chr152465 76 2637 319 1299 1962
NM_001012751chr1051224 684 677 197 154 1465 ----
NM_001012755chrX55099 4506 4044 3983 1956 43129 813 587 439 2948 861 13976
NM_001013031chr1053523 3405 2761 953 526 --32815 415 124 151
NM_001013415chr4------21182 228
NM_001013620chr12157608 7392 7121 6569 6233 5426 5181 2392 2285 1725 1119 780 470 275 57 17773 48130 5862 5838 1629 36889 5545 3233
NM_001014283chr1352007 1898 1707 1528 750 1276 11920 --
NM_001014286chr135347 337 233 136 118 ----140
NM_001014380chr1355674 5440 3811 3647 1297 34878 4288 4065 35564 5476 1623 24987 1075
NM_001014797chr10188204 7850 6989 6730 6655 5969 5935 5784 5679 5336 5121 5045 2991 2307 2125 1928 179 87 26338 5896 77796 7564 6303 5710 2315 2283 926 27694 5506
NM_001015048chr1473111 2854 2792 1268 921 631 358 11293 1421 --
NM_001015049chr1473111 2854 2792 1268 921 631 358 11293 1421 --
NM_001017395chr353515 3337 2253 1279 156 ----1611
NM_001017440chr7157510 7332 7042 5979 5869 5426 5227 3254 3151 3093 2694 1773 1161 375 78 25900 476 26711 2854 37364 6328 2618
NM_001017923chr1421485 1217 11375 21512 1494 --
NM_001018054chr161428 1394 587 448 296 162 ------
NM_001018067chr154264 4118 3688 1932 401 33928 3887 1228 14753 24413 177
NM_001018068chr154264 4118 3688 1932 401 33928 3887 1228 14753 24413 177
NM_001018069chr154264 4118 3688 1932 401 33928 3887 1228 14753 24413 177
NM_001018074chr553197 2929 2903 1064 574 21433 723 11308 --
NM_001018075chr553197 2929 2903 1064 574 21433 723 11308 --
NM_001018076chr553197 2929 2903 1064 574 21433 723 11308 --
NM_001018077chr553197 2929 2903 1064 574 21433 723 11308 --
NM_001018090chr1552674 2621 2577 881 861 --1118 --
NM_001018091chr1552784 2731 2687 991 971 --1228 --
NM_001018102chr1552674 2621 2577 881 861 --1118 --
NM_001018111chr763808 3443 3376 2704 748 35 13991 43823 3570 3511 1469 --
NM_001023567chr15176 22471 319 1299 22513 970
NM_001024094chr553197 2929 2903 1064 574 21433 723 11308 --
NM_001024647chr12167441 7340 7172 7057 6922 6133 5627 5615 2498 2435 2361 1622 1440 1107 516 362 57368 2840 2462 2030 2017 37604 7246 2620 15262
NM_001024649chr532214 367 230 --11082 12760
NM_001024660chr361680 1606 1460 1281 614 544 2344 239 ----
NM_001024666chrX1150 2604 135 2225 156 --
NM_001024847chr322195 1744 --32465 2326 1708 --
NM_001024947chr5--21062 44 1337 2702 388
NM_001024948chr183192 3153 2951 2225 816 571 352 280 1164 --151
NM_001024956chr1175898 5885 4047 3982 2004 1151 881 11194 --14463
NM_001025076chr1066037 5762 4940 4254 3849 1226 15414 22355 2199 2875 436
NM_001025077chr1077395 7120 6298 5612 5207 5076 2584 36772 4627 689 3807 799 332 32233 1794 872
NM_001025079chr364031 3934 3494 3081 2749 711 13633 11385 --
NM_001025108chr273689 3680 1608 344 337 208 42 11581 23404 3268 13744
NM_001025580chrX64078 3981 3214 2948 792 684 23492 1612 53727 2854 2723 2665 1402 --
NM_001025595chr431515 211 120 --21345 508 1617
NM_001025780chr92381 113 ----21358 70
NM_001029863chr692988 2461 2421 2322 2003 1992 1044 524 225 22886 2161 23254 322 32351 2128 494
NM_001029875chr573025 2852 1142 774 673 650 82 150 --1585
NM_001029884chr631064 281 143 21797 49 22442 891 --
NM_001029955chr463391 2770 2711 2191 1023 921 1217 12829 12798
NM_001030006chr1772110 2014 1801 977 956 488 154 12299 12457 12714
NM_001030055chr1463860 3423 1659 1095 235 164 24207 4083 1915 --
NM_001031623chr63435 364 101 11433 21759 1531 --
NM_001031679chr1273553 2736 2620 2507 1283 436 240 ----13399
NM_001031681chr1731962 614 178 ----22359 1426
NM_001031695chr2243835 1070 978 570 24916 3862 --21355 134
NM_001031732chr473468 3124 2422 1417 1121 960 278 11038 1970 2843 38
NM_001031804chr1644076 3326 3232 358 24318 3480 53683 3486 3210 2817 155 --
NM_001031812chr532032 1642 429 11725 12189 --
NM_001032282chr871294 1124 457 289 279 215 133 1188 ----
NM_001032380chr1041683 798 589 169 22017 1783 21347 299 --
NM_001032999chr2095113 4894 4066 1875 1856 1793 1150 648 43 25216 5129 11383 33520 3270 621
NM_001033002chr17173 ----2304 249
NM_001033045chr254464 2784 2689 1672 744 13338 12804 23183 475
NM_001033057chr352057 1989 729 610 59 --22130 685 --
NM_001033087chr2062748 1173 961 569 371 358 22739 922 23292 2510 12427
NM_001033117chr364018 3946 3751 3610 1808 1303 11742 23841 649 --
NM_001033602chr1342069 1984 1843 1006 1299 41998 1960 820 605 --
NM_001033925chr1031653 266 135 1228 --11790
NM_001034841chr16105012 4011 3679 1842 1526 1069 824 536 425 130 1945 1370 --
NM_001037131chr281128 1064 910 479 462 314 246 226 1161 --1965
NM_001037132chr761969 1906 1380 817 718 149 --11591 --
NM_001037133chr761969 1906 1380 817 718 149 --11591 --
NM_001037164chr752063 721 382 272 213 ----11504
NM_001037165chr775600 3317 2855 2370 2314 1964 85 --1195 27915 633
NM_001037174chr231966 390 280 11731 2528 380 12195
NM_001037317chr141003 927 893 233 1311 1347 --
NM_001037339chr131729 1451 1230 11545 21609 476 1282
NM_001037340chr131729 1451 1230 11545 21609 476 1282
NM_001037341chr131729 1451 1230 11545 21609 476 1282
NM_001037341chr131729 1451 1230 11545 21609 476 1282
NM_001037553chr2194985 4623 4485 4140 4057 3867 1549 847 545 15008 24313 69 15018
NM_001037954chr1143518 1036 434 241 53244 2645 2611 2563 2190 --11293
NM_001039199chr2063420 1321 967 692 588 59 34346 3773 3247 11593 23591 1384
NM_001039538chr273551 2545 2481 2383 2356 1396 1024 23460 101 11437 --
NM_001039570chr2254647 4584 3913 3715 504 13019 34369 1056 421 11478
NM_001039571chr2254647 4584 3913 3715 504 13019 34369 1056 421 11478
NM_001039577chr164189 3756 3556 2924 2790 965 --34540 2853 670 14021
NM_001039580chr4114802 4585 3681 3659 3381 1929 1382 1125 915 813 239 --34602 4552 4289 13827
NM_001039590chrX63088 3011 2979 2792 1447 307 2406 325 33254 2824 317 14035
NM_001039591chrX63088 3011 2979 2792 1447 307 2406 325 33254 2824 317 14035
NM_001039618chr11105614 5277 3651 3629 1732 1597 1182 1094 736 162 --25182 4654 11546
NM_001039693chr253764 3679 3671 1249 741 11034 11266 --
NM_001039709chr2095113 4894 4066 1875 1856 1793 1150 648 43 25216 5129 11383 33520 3270 621
NM_001039762chr1041486 859 508 347 --12027 22286 2062
NM_001039840chrX105421 5241 5022 4546 2182 2172 1656 1317 976 608 33760 2206 895 35703 5598 4227 11951
NM_001039937chr1363060 2944 887 680 462 59 33750 3456 2920 21592 49 --
NM_001040020chr73604 583 287 1979 11186 11063
NM_001040108chr1462810 2683 2558 2089 1114 809 22008 237 ----
NM_001040142chr252164 2077 761 732 116 62458 2023 1687 927 603 396 21943 844 1587
NM_001040143chr252164 2077 761 732 116 62458 2023 1687 927 603 396 21943 844 1587
NM_001040152chr754376 1974 1937 643 164 34278 267 46 23964 1543 14154
NM_001040159chr431387 1137 1035 31517 606 49 --21447 209
NM_001040272chr941505 635 425 52 22300 1675 140 12356
NM_001040402chr442627 1991 615 63 33110 3018 2472 ----
NM_001040429chr1353023 2329 1285 954 147 33555 3156 1410 33408 586 421 13096
NM_001040441chr183987 3949 2045 1946 1408 1192 841 409 34985 3776 3388 11608 45135 4581 1759 905
NM_001040450chr1552771 1873 666 402 173 ----11160
NM_001040453chr1552771 1873 666 402 173 ----11160
NM_001040624chr82917 820 21677 957 2964 672 11971
NM_001040625chr82917 820 21677 957 2964 672 11971
NM_001040626chr82917 820 21677 957 2964 672 11971
NM_001040627chr82917 820 21677 957 2964 672 11971
NM_001040628chr82917 820 21677 957 2964 672 11971
NM_001040629chr82917 820 21677 957 2964 672 11971
NM_001040630chr82917 820 21677 957 2964 672 11971
NM_001040665chr743635 1711 245 168 34197 1590 518 2835 578 --
NM_001040712chr983597 3457 3363 3122 2771 1177 868 612 1371 13581 2955 137
NM_001040876chr411322 1648 21491 252 41920 1766 176 139
NM_001042355chr1695098 4912 4244 4019 1882 1454 1300 826 304 11398 13699 --
NM_001042357chr103404 102 59 --1547 1257
NM_001042358chr103404 102 59 --1547 1257
NM_001042360chr103404 102 59 --1547 1257
NM_001042361chr103435 133 90 --1578 1288
NM_001042363chr103404 102 59 --1547 1257
NM_001042364chr103435 133 90 --1578 1288
NM_001042365chr103435 133 90 --1578 1288
NM_001042387chr103435 133 90 --1578 1288
NM_001042389chr103404 102 59 --1547 1257
NM_001042390chr103404 102 59 --1547 1257
NM_001042392chr103404 102 59 --1547 1257
NM_001042393chr103435 133 90 --1578 1288
NM_001042395chr103404 102 59 --1547 1257
NM_001042396chr103435 133 90 --1578 1288
NM_001042397chr103435 133 90 --1578 1288
NM_001042404chr141865 493 485 204 --21669 1655 21562 81
NM_001042412chr1695098 4912 4244 4019 1882 1454 1300 826 304 11398 13699 --
NM_001042413chr9124092 3847 3620 3502 3009 2810 2804 2730 1610 1398 458 75 13021 23511 3462 12781
NM_001042424chr423074 884 --23038 116 12554
NM_001042453chrX31660 1531 1383 11270 11678 --
NM_001042473chr1062054 1650 882 658 637 335 177 2245 169 --
NM_001042481chr1431698 1661 584 21842 759 12550 2408 182
NM_001042486chr203602 484 139 2226 204 --148
NM_001042492chr1783021 2538 2255 2198 572 564 441 362 21343 518 ----
NM_001042494chr1552566 1196 846 828 693 ----23050 1485
NM_001042495chr1552566 1196 846 828 693 ----23050 1485
NM_001042496chr1552566 1196 846 828 693 ----23050 1485
NM_001042497chr1552566 1196 846 828 693 ----23050 1485
NM_001042533chr3103356 3346 2716 2657 2379 2077 2030 517 503 265 --1476 --
NM_001042543chr441610 1445 1419 1359 1451 1103 21196 384
NM_001042550chr91150 --11500 2309 87
NM_001042555chr1274647 4574 4125 3986 3817 3571 3308 ------
NM_001042599chr2107448 7307 6638 6077 6003 5493 5314 1313 900 803 26883 749 66385 6227 2487 2250 1462 1435 25863 2822
NM_001042601chr322087 416 11218 22557 2145 22779 2493
NM_001042604chr374112 3914 3303 1759 1633 780 700 177 11678 --
NM_001042681chr142573 2120 852 574 --22662 1665 172
NM_001042682chr142573 2120 852 574 --22662 1665 172
NM_001042682chr142573 2120 852 574 --22662 1665 172
NM_001044385chr263544 3489 3315 2917 2594 2556 23529 1218 1365 13572
NM_001044722chr532032 1642 429 11725 12189 --
NM_001044723chr532032 1642 429 11725 12189 --
NM_001046chr51139 1313 12958 12399
NM_001048183chr153321 2995 631 556 347 ----32368 1043 853
NM_001049chr1442397 2303 2162 364 --22435 1537 --
NM_001083620chr482141 2123 1989 1820 902 574 329 199 12636 --12621
NM_001099678chr3136142 5792 4304 3914 2521 2343 1977 1278 1090 539 469 272 202 25246 1829 11335 14862
NM_001100108chr1128334 8065 7693 7278 7209 7154 6622 5808 2730 908 510 185 16824 22784 686 25537 560
NM_001106chr3128778 8551 5997 5972 5891 3065 2771 1438 1060 964 447 227 48584 7151 6429 87 38045 7647 372 1104
NM_001116chr1682836 2696 2453 2327 2175 2121 1211 47 22737 2386 ----
NM_001117chr1882098 2091 1878 1732 306 189 170 42 --2478 296 --
NM_001121chr1071927 1831 1777 1761 686 503 264 1147 11333 --
NM_001146chr831481 725 489 32067 1681 180 --11426
NM_001149chr102377 268 31420 1090 320 2918 565 21335 897
NM_001160chr1242084 2070 448 307 22852 126 ----
NM_001167chrX85862 5568 5057 4648 2564 2449 411 268 26131 5294 25086 4345 46139 5303 5077 4146
NM_001173chr1463860 3423 1659 1095 235 164 24207 4083 1915 --
NM_001174chrX41897 1788 1526 1422 ----21937 1649
NM_001186chr2112271 11229 11170 12208
NM_001201chr483095 2778 2734 2577 870 640 511 257 21142 1116 1837 12615
NM_001204chr297313 5852 4918 2642 2549 1921 531 433 256 11070 34947 4751 1699 25629 4703
NM_001233chr762336 729 521 496 462 352 --1820 164
NM_001241chr262087 1978 1935 1655 1636 46 ------
NM_001241chr262087 1978 1935 1655 1636 46 ------
NM_001244chr92675 108 ----31075 1053 246
NM_001259chr765663 5038 2506 2251 1231 672 25932 3970 32227 2069 1381 22554 1701
NM_001282chr1772110 2014 1801 977 956 488 154 12299 12457 12714
NM_001310chr1242706 424 271 202 22891 2814 12874 --
NM_001332chr531412 1292 1093 31349 350 53 --1357
NM_001356chrX61753 1563 895 473 443 432 21885 159 ----
NM_001364chr1164633 3901 2990 1395 1156 711 1577 23428 142 --
NM_001390chr1893289 3278 2850 2750 1049 875 613 385 355 --1105 --
NM_001396chr2172459 2196 1763 1025 555 377 367 32399 2106 1057 22495 932 --
NM_001401chr931467 1121 1026 31423 1115 160 --11252
NM_001412chrX52793 2522 1362 707 432 23557 256 13743 22991 570
NM_001419chr1953737 1506 1351 354 100 21872 1831 1640 21929 899
NM_001420chr1931240 963 850 --72480 2059 1975 1064 977 956 790 32788 2018 673
NM_001432chr493522 3141 3015 2980 2972 2855 1577 1097 227 22643 2580 13713 12819
NM_001438chr162909 2850 2743 2606 1409 1041 12891 21231 707 13218
NM_001455chr663204 1599 1410 652 562 536 31547 1496 1246 31656 1185 579 23744 54
NM_001491chr661960 1918 1724 1699 1087 491 --21875 324 --
NM_001609chr1044414 4024 3113 1704 14477 --13913
NM_001616chr263493 3226 3121 2893 484 184 23455 3194 1524 --
NM_001621chr753055 2912 2267 1965 765 1277 32515 640 414 1286
NM_001621chr753055 2912 2267 1965 765 1277 32515 640 414 1286
NM_001650chr1863559 3369 3322 776 570 161 23156 2778 22654 2618 1768
NM_001655chr113204 176 118 --32172 1836 211 --
NM_001663chr1452786 2155 2055 1941 312 1795 2933 261 --
NM_001683chr362189 1935 1759 808 600 156 11694 22594 1716 12559
NM_001689chr241838 1489 1352 189 --11934 --
NM_001690chr341943 1764 960 511 ------
NM_001695chr883626 3478 3057 2674 1544 1304 1150 399 1333 23648 704 --
NM_001701chr931077 599 588 1208 11208 11388
NM_001709chr1162926 2838 2392 372 202 65 ----1275
NM_001713chr561036 441 353 207 146 58 11016 ----
NM_001746chr532214 367 230 --11082 12760
NM_001754chr2164149 4002 1660 1257 1237 750 23958 3334 12955 12927
NM_001755chr1641696 1615 1498 193 ----1822
NM_001759chr1264572 4071 1760 1485 1118 664 32020 1232 499 11588 13299
NM_001769chr121413 --1358 1329
NM_001777chr364031 3934 3494 3081 2749 711 13633 11385 --
NM_001792chr184968 955 712 36 1837 --1416
NM_001797chr161500 1194 --1255
NM_001830chrX44056 3716 3522 526 23567 3314 1749 13227
NM_001855chr92691 596 ----1876
NM_001858chr664229 3837 3455 1996 1825 1358 33931 3811 3402 34537 4134 3122 --
NM_001859chr933336 2906 517 12745 13863 23690 638
NM_001918chr1149134 8769 8116 7853 7345 7328 7254 7159 6360 5814 5778 3273 2421 133 88864 8541 8441 8126 7444 7220 6386 2813 26427 2140 98737 8561 8499 8394 6012 2484 1748 707 422
NM_001942chr18101750 1701 1614 1358 519 472 463 436 190 90 --1445 --
NM_001944chr1852388 1844 734 416 123 22328 1562 --22310 547
NM_001949chr622165 126 12710 12421 12517
NM_001968chr44757 702 689 252 1932 1626 --
NM_001981chr182373 2363 2142 1972 1641 1509 745 550 11602 --1103
NM_001992chr542234 1584 1374 705 12194 1840 12048
NM_002009chr1552632 2125 1094 875 816 22477 753 12597 1207
NM_002015chr1343264 2218 713 504 1567 23274 2849 13231
NM_002024chrX32032 1819 1485 31987 1880 189 31443 704 124 --
NM_002025chrX209175 9128 8231 7328 7236 7057 6536 6527 6445 6387 5922 5637 3694 3160 2915 2342 1955 938 613 479 1547 38140 6023 399 --
NM_002040chr2121219 1136 23185 2886 --23141 2782
NM_002069chr751915 1814 1576 557 546 --1376 190
NM_002086chr1752281 1536 695 225 69 ----2453 53
NM_002092chr431957 1282 216 11829 13735 --
NM_002126chr1784042 4008 3275 2705 1348 1216 500 111 --43976 2772 695 72 --
NM_002128chr1362055 934 718 450 283 61 ------
NM_002137chr752340 1947 780 428 127 22094 852 --12262
NM_002158chr2103734 3682 3122 3022 2688 2453 1076 594 459 446 13635 32512 972 536 --
NM_002193chr251567 650 423 325 269 ----1417
NM_002203chr573887 3161 3039 1586 842 537 497 53988 3957 3131 1362 733 33415 3214 2573 13595
NM_002214chr7105538 5108 4269 2266 2180 1598 851 757 702 539 74844 4328 3793 1118 1110 933 743 15128 15325
NM_002223chr1273982 3881 3554 3515 2974 629 567 1687 13561 1430
NM_002242chr261813 1769 322 192 176 138 --21648 593 21542 726
NM_002247chr1052384 875 454 296 190 1177 1268 --
NM_002264chr374786 4702 3843 3638 3176 1114 417 23858 3205 14534 34045 3879 1275
NM_002265chr1731123 1036 961 ----11148
NM_002267chr1351989 1678 1610 455 398 ----21826 536
NM_002268chr331634 1335 306 41575 1482 397 183 11560 --
NM_002270chr5125661 5331 5077 4730 4315 4280 3772 1528 1312 1164 435 405 25266 308 31330 650 537 14573
NM_002271chr1342452 2292 309 135 --1371 1662
NM_002285chr273689 3680 1608 344 337 208 42 11581 23404 3268 13744
NM_002290chr621041 249 --31399 59 30 11240
NM_002293chr152593 2506 2118 147 59 --174 1812
NM_002310chr576503 5506 5397 2280 1175 638 477 46291 5916 525 210 --15557
NM_002313chr1034457 1394 269 24702 3881 33408 819 225 --
NM_002336chr1254407 4341 4232 1382 312 1219 1276 --
NM_002374chr273551 2545 2481 2383 2356 1396 1024 23460 101 11437 --
NM_002399chr153889 256 26 11440 1492 21084 362
NM_002408chr14162 1711 --1106
NM_002481chr187967 6984 6402 5676 5641 5625 2574 661 15835 11752 36095 5856 2173
NM_002486chr921747 1714 1283 2979 237 21966 1777
NM_002487chr154778 661 570 519 ----1797
NM_002500chr251277 897 821 321 262 21014 70 ----
NM_002501chr1983964 3773 3566 3370 2848 2835 479 418 --11630 22788 2734
NM_002519chr1131359 1048 465 1483 ----
NM_002522chr1783961 3574 3523 2945 2683 2676 1273 136 --1162 --
NM_002526chr631451 699 356 ----21474 340
NM_002545chr11104976 4599 3510 1910 1698 1661 761 393 332 49 13479 11783 24006 1116
NM_002581chr9105612 5471 5337 5303 5052 2083 2034 914 552 286 25008 2159 55270 4401 3675 3669 366 14077
NM_002594chr2022225 413 --21519 990 11831
NM_002600chr131729 1451 1230 11545 21609 476 1282
NM_002613chr1631487 1331 102 24731 3971 2202 177 14909
NM_002645chr1162190 1967 485 408 249 186 2990 758 172 --
NM_002655chr895047 4825 4685 4482 4144 1511 1301 719 291 35305 3833 3763 34112 633 118 14329
NM_002670chr341624 1118 390 183 11447 21066 325 --
NM_002703chr42711 200 --2378 230 11266
NM_002709chr263374 3273 2473 2431 2314 2295 23633 2279 11379 --
NM_002716chr1153600 2391 1387 319 45 12957 12715 11208
NM_002731chr142409 2007 925 213 --1542 --
NM_002736chr751778 799 452 415 43 2241 201 --11706
NM_002737chr1764204 2224 2094 1941 1921 1346 24527 2217 --15340
NM_002740chr351986 1861 957 351 77 22370 107 --1719
NM_002745chr2264250 3936 2841 1804 1032 859 44316 3886 3041 809 --11746
NM_002748chr153914 344 329 ----1205
NM_002825chr72433 114 ----2576 25
NM_002837chr12123755 3697 3679 3369 3106 1527 1509 1491 1445 1379 1035 784 11627 24558 3377 1290
NM_002839chr983597 3457 3363 3122 2771 1177 868 612 1371 13581 2955 137
NM_002843chr1163450 2650 2410 2376 2301 1267 --23286 2528 --
NM_002869chr1152217 1923 1664 712 167 1209 --12252
NM_002874chr942264 1817 226 208 22218 956 --11696
NM_002912chr62685 196 ----1840
NM_002925chr10--2220 109 --1182
NM_002940chr411322 1648 21491 252 41920 1766 176 139
NM_002959chr173976 2898 919 856 842 684 592 34338 4179 4076 23841 554 11158
NM_002977chr2103405 3360 3334 2240 2125 2097 1316 1249 1073 638 1754 22921 1125 23482 241
NM_002979chr14580 333 224 210 1651 ----
NM_002998chr831867 1806 279 1667 --2286 176
NM_003010chr1772323 2178 2066 1704 831 385 194 ------
NM_003016chr1741562 1374 49 35 11438 ----
NM_003022chrX1288 ----2210 154
NM_003028chr993750 3534 2858 1501 1400 1334 1153 1054 1036 13038 23369 555 41434 1368 1300 856
NM_003034chr12157155 6934 6919 5648 5325 5216 2969 2724 2495 2018 1539 1311 1246 652 618 36092 5417 1330 66925 1816 1440 1153 743 387 1538
NM_003043chr334167 2660 1679 63969 3672 3664 2971 218 125 33532 3334 665 --
NM_003051chr12631 266 2599 513 11271 11488
NM_003071chr361774 1719 1703 1682 451 145 --1580 11595
NM_003099chr1561923 1810 1773 1635 1059 510 24561 2338 41556 1385 1079 286 15217
NM_003108chr2107288 6008 5912 5807 5371 4710 927 811 732 509 46287 5884 901 743 25924 182 --
NM_003112chr753161 2714 2302 1115 256 2844 424 13127 2666 178
NM_003113chr22275 58 3866 748 624 --1340
NM_003128chr292518 2488 2164 1831 1782 954 728 625 572 1193 ----
NM_003155chr851938 1912 1835 1823 426 --2900 768 1306
NM_003157chr32928 660 1188 3712 612 327 --
NM_003161chr1763376 3312 2995 2488 2432 133 33295 2316 381 22348 1346 --
NM_003199chr18145699 5187 3630 3555 2141 2133 1812 1732 1597 1122 941 902 280 147 34730 4058 3566 180 14718
NM_003221chr683912 2988 1421 1054 926 421 328 126 --14199 142
NM_003242chr322195 1744 --32465 2326 1708 --
NM_003262chr395224 4142 3492 3384 3366 1882 1115 744 736 34876 865 808 24024 1475 --
NM_003269chr631318 1266 340 --2372 144 --
NM_003298chr3105677 5393 5076 4168 3931 2247 1852 1413 980 187 15246 22172 59 --
NM_003320chr11114321 4249 3970 3510 3207 3183 1548 910 860 759 702 44366 4001 3292 1113 1877 --
NM_003337chr561429 1161 1094 636 415 209 21251 145 11680 11117
NM_003339chr531366 1330 30 11597 11223 11217
NM_003342chr1753147 1031 939 313 270 ----12161
NM_003348chr1241483 1467 184 81 11406 11491 11674
NM_003369chr1142800 2733 2159 1981 ----193
NM_003385chr22873 360 2261 30 2677 109 --
NM_003387chr24965 909 553 422 22404 2087 --1631
NM_003392chr383848 3767 3424 3124 3072 1425 1252 250 33653 3217 2715 24068 844 --
NM_003404chr202574 392 11615 1196 12030
NM_003410chrX92853 2633 2616 2567 1168 923 761 115 85 ----12941
NM_003412chr352176 2003 850 842 62 --1106 --
NM_003430chr1991592 1524 543 512 375 344 291 260 207 --11690 --
NM_003463chr662689 2103 2060 890 366 327 12112 --12888
NM_003468chr243789 3746 1347 767 14092 11531 --
NM_003471chr342155 1949 930 367 11469 --11510
NM_003472chr641441 1293 1194 484 ------
NM_003474chr1042322 1510 927 916 --11708 11719
NM_003478chr1142818 2620 1071 371 1136 1107 22186 927
NM_003480chr1262010 1975 803 591 576 247 11861 2281 199 --
NM_003483chr1272915 2906 2684 1156 256 247 166 32604 2415 2351 11993 --
NM_003489chr2173302 3184 2499 2469 2381 385 292 --13172 --
NM_003506chr821084 1071 11234 1171 11307
NM_003566chr1253152 3063 2406 425 326 42778 2436 474 379 --12573
NM_003574chr1895468 5411 5022 4915 3828 1752 1304 264 167 34647 4568 2235 25781 1606 44311 3512 2107 581
NM_003583chr1233509 1534 458 12432 23017 2540 23592 567
NM_003590chr264052 3639 3360 3263 868 530 23679 2554 21490 515 --
NM_003607chr193957 3753 3602 3334 2942 2906 1196 988 153 24322 4287 2547 310 --
NM_003615chr373062 2775 2606 2544 1551 1540 722 32465 1456 1428 ----
NM_003622chr1242622 2299 1913 77 31897 729 177 ----
NM_003629chr163364 3194 2705 1187 596 446 43302 2747 881 105 --1747
NM_003633chr532337 2250 792 12472 --12273
NM_003648chr242594 1957 213 205 ----12241
NM_003663chr353284 3017 2460 1377 1321 --12276 12987
NM_003671chr962987 2322 1316 1092 1044 67 32952 1371 890 1798 23584 435
NM_003679chr163208 2857 2281 2168 1000 335 22516 511 23382 1065 --
NM_003692chr92290 210 1389 1735 1774
NM_003714chr522597 365 22382 22 22888 2663 11179
NM_003759chr431036 417 295 11403 32808 1029 407 --
NM_003763chr203906 390 238 12194 22995 955 12203
NM_003783chr151202 1178 1162 896 260 --2323 110 --
NM_003787chr1841623 1294 1258 248 2643 264 ----
NM_003794chr331105 102 52 1162 193 --
NM_003799chr1854312 4294 3041 1273 46 41292 1113 525 277 11642 --
NM_003800chr632117 1472 865 21754 377 1901 --
NM_003816chr831441 480 177 41059 601 562 122 11264 1142
NM_003821chr83535 438 167 136 ----
NM_003822chr173021 2737 2079 1262 951 779 284 1874 ----
NM_003861chr1431901 841 330 3776 46 32 12669 11996
NM_003873chr1021675 267 32576 2490 2204 21586 715 --
NM_003884chr351329 1203 689 323 74 11847 1722 --
NM_003887chr242212 2138 830 271 --22096 1818 1815
NM_003895chr2132118 1935 732 3685 248 119 22173 488 --
NM_003913chr673967 2761 1484 1350 1045 874 372 21170 232 32872 269 39 --
NM_003916chrX21255 144 11017 --11399
NM_003941chr752435 2171 2046 463 191 32142 1810 965 1876 1562
NM_003994chr1233751 2694 67 13258 31416 646 393 33355 3215 1514
NM_004006chrX42466 2273 995 135 1286 --1495
NM_004007chrX42466 2273 995 135 1286 --1495
NM_004009chrX42466 2273 995 135 1286 --1495
NM_004010chrX42466 2273 995 135 1286 --1495
NM_004011chrX42466 2273 995 135 1286 --1495
NM_004012chrX42466 2273 995 135 1286 --1495
NM_004013chrX42466 2273 995 135 1286 --1495
NM_004014chrX42466 2273 995 135 1286 --1495
NM_004015chrX42466 2273 995 135 1286 --1495
NM_004016chrX42380 2187 909 49 1200 --1409
NM_004017chrX42466 2273 995 135 1286 --1495
NM_004018chrX42380 2187 909 49 1200 --1409
NM_004020chrX42466 2273 995 135 1286 --1495
NM_004021chrX42380 2187 909 49 1200 --1409
NM_004022chrX42380 2187 909 49 1200 --1409
NM_004023chrX42380 2187 909 49 1200 --1409
NM_004028chr1863559 3369 3322 776 570 161 23156 2778 22654 2618 1768
NM_004035chr1785174 4960 4904 3780 1551 1303 1279 1118 1885 1902 24672 1837
NM_004061chr5125 --2106 65 1474
NM_004064chr1241151 1077 832 149 1489 1287 --
NM_004079chr122101 1962 62519 2085 1180 1041 959 533 12638 22405 269
NM_004087chr362049 1842 1499 1441 1243 358 1690 --1772
NM_004094chr1462871 2161 2063 1078 985 185 --32631 2530 37 --
NM_004113chr371733 1471 1433 384 269 219 114 1701 --11520
NM_004124chr1453489 2768 2533 1234 1189 --164 --
NM_004133chr821030 1016 --21892 33 32266 2129 584
NM_004136chr1553068 2578 2212 2153 648 ----12440
NM_004162chr32819 307 1520 11087 1969
NM_004170chr941624 1593 1239 383 11862 21429 276 --
NM_004171chr11199373 8995 8851 8354 6855 6621 6554 6085 5892 3461 3372 3004 2854 2700 2591 1736 1305 1144 393 47635 7139 6065 443 36627 3332 793 11127
NM_004172chr561899 1821 1710 393 292 253 11754 1152 --
NM_004200chr1152998 2920 2754 2242 70 13111 11318 13188
NM_004227chr752923 2858 860 669 388 12750 2960 632 11153
NM_004232chr18113922 3463 3080 2660 2606 2538 2499 965 780 544 66 23772 2793 --1469
NM_004279chr741543 901 648 288 22200 2124 11652 1610
NM_004293chr983470 2533 1506 1356 1234 1170 760 202 12542 --12566
NM_004316chr1241122 778 737 60 21131 312 11157 --
NM_004338chr18166874 5640 5484 4443 4330 2622 2400 2084 2033 1761 1611 1592 1521 307 210 101 27072 2047 1187 25220 1228
NM_004379chr231481 1158 425 21227 114 --11638
NM_004384chr532032 1642 429 11725 12189 --
NM_004386chr1971518 1454 567 268 147 134 24 --1760 31965 477 180
NM_004392chr1342303 1860 1757 1662 42535 2524 1718 152 1831 1823
NM_004397chr1154090 3283 1477 1136 501 33146 3082 26 21602 343 --
NM_004404chr242029 730 605 525 ----11560
NM_004407chr44774 399 209 175 --134 11002
NM_004432chr931593 320 43 ----21704 1585
NM_004434chr1441618 641 211 102 1323 31825 502 47 --
NM_004438chr283337 3227 2915 869 722 580 396 154 12125 --11253
NM_004458chrX32544 1954 635 ----1518
NM_004459chr1741698 1309 651 594 1375 11671 127
NM_004464chr474185 3269 2835 2650 1565 491 91 21346 1320 31572 1312 231 --
NM_004491chr1934295 1004 805 23780 739 11751 13265
NM_004496chr1461238 900 551 262 214 144 --182 1909
NM_004500chr1431933 808 349 1747 31746 1466 480 11991
NM_004501chr1103887 3790 3562 3281 3219 3106 2927 1462 1224 362 52548 1535 854 98 50 33880 3312 3113 12786
NM_004505chr1742035 1713 597 184 --11881 12047
NM_004513chr1573261 2941 2796 1188 269 47 36 22443 321 41410 1399 730 218 --
NM_004529chr92397 297 ----1304
NM_004586chrX75107 4821 4808 4598 3966 1887 49 11859 --22009 1610
NM_004598chr563272 2778 1260 983 965 647 21208 36 124 12641
NM_004600chr11534 --1566 11307
NM_004612chr944188 3303 1943 555 13191 ----
NM_004631chr161428 1394 587 448 296 162 ------
NM_004654chrY41408 1150 327 319 ----2886 426
NM_004657chr241419 1143 979 151 21325 1193 1452 --
NM_004660chrY72074 1686 1509 472 441 429 31 31815 806 150 ----
NM_004663chr153437 385 295 ----1630
NM_004666chr641089 607 296 253 2586 310 ----
NM_004673chr12310 90 --1241 2107 33
NM_004685chr1342298 2063 1146 248 --21173 308 12130
NM_004694chr173894 685 273 --170 1753
NM_004709chrX51728 1622 1539 1260 119 1305 11285 --
NM_004719chr1242495 2114 323 84 21856 212 --1897
NM_004726chrX85336 4882 4785 4672 4501 3828 3743 1762 11577 14074 --
NM_004744chr432993 2956 2825 31354 1270 293 33051 829 143 12448
NM_004745chr8116453 6083 6053 5404 4683 4598 4451 2591 1336 566 138 22132 676 15706 22258 976
NM_004748chr1573201 1697 1207 776 486 459 140 --21459 353 11539
NM_004762chr171370 ----11907
NM_004763chr27786 730 450 394 338 282 171 1266 1960 11120
NM_004775chr1831819 1614 47 11832 22415 1809 --
NM_004776chr2073079 3046 2286 2071 161 128 88 33265 808 246 1582 12304
NM_004788chr1142516 1992 1090 1050 32468 1785 972 --1523
NM_004801chr23339 309 59 --21249 1037 4370 358 346 101
NM_004808chr1063284 2863 2636 2424 234 93 13033 12874 1840
NM_004834chr263343 3032 2955 1087 580 406 33138 2898 1102 23279 1299 32925 2471 1233
NM_004842chr661758 1254 1195 400 258 167 --1296 --
NM_004857chr1484476 4190 3893 3626 1166 948 235 214 34265 3099 1810 14490 24287 761
NM_004866chr575000 4694 3412 1906 1455 91 67 44938 1838 1234 685 11575 24222 1043
NM_004869chr181442 2242 199 21751 287 --
NM_004873chr1473111 2854 2792 1268 921 631 358 11293 1421 --
NM_004898chr442559 843 740 710 12087 12231 11060
NM_004904chr7126565 6159 5981 5887 5838 5273 5216 5198 1768 1477 1063 483 32481 1913 819 35319 1685 1094 --
NM_004929chr81270 21380 426 --1583
NM_004937chr1742327 979 543 99 ----22724 1791
NM_004949chr183555 268 46 21679 1552 1385 11812
NM_004951chr131190 1476 2184 170 --
NM_004956chr743477 1364 672 348 32831 617 474 64078 2934 1822 1724 899 752 1124
NM_004985chr12114117 3648 3589 3145 3044 3016 1689 1659 1368 1140 538 13920 33164 450 382 --
NM_004992chrX68135 7247 5502 2928 1626 1158 --15463 15541
NM_004992chrX68135 7247 5502 2928 1626 1158 --15463 15541
NM_004999chr683800 3587 3121 1360 1173 1039 669 646 --24497 3414 13955
NM_005010chr761969 1906 1380 817 718 149 --11591 --
NM_005023chr511311 --1337 1972
NM_005065chr1495334 5283 4521 4421 3647 1282 953 879 116 13783 34954 4497 885 --
NM_005068chr63572 371 88 --2357 209 21419 184
NM_005093chr2095113 4894 4066 1875 1856 1793 1150 648 43 25216 5129 11383 33520 3270 621
NM_005121chr1793763 3568 3050 2971 2514 1515 1418 1143 846 ----1219
NM_005135chr1552566 1196 846 828 693 ----23050 1485
NM_005153chr164829 777 680 159 ----1242
NM_005156chr954253 3869 1077 537 345 33885 221 101 1388 --
NM_005160chr22155899 5698 5568 5518 5361 4989 4689 4594 4199 4133 2728 2319 2047 1943 1250 35930 4710 922 15113 --
NM_005168chr231550 1158 658 31596 1528 409 1251 --
NM_005181chr82660 605 --1880 1815
NM_005188chr1188288 7436 6943 5301 3330 1931 1512 884 21106 458 --26124 1725
NM_005197chr14136172 5964 5327 5139 5026 4782 4775 4622 4233 4074 2208 1766 597 21298 251 2860 482 --
NM_005207chr2253643 3360 390 232 156 --1259 23612 1067
NM_005233chr3112607 2242 2214 2200 2069 1890 1713 1699 1685 299 134 2373 314 32333 756 451 --
NM_005235chr2107448 7307 6638 6077 6003 5493 5314 1313 900 803 26883 749 66385 6227 2487 2250 1462 1435 25863 2822
NM_005254chr153316 67 50 ----1161
NM_005259chr241053 965 540 196 21075 489 --1615
NM_005329chr1672218 1732 1695 1675 1668 513 402 --21778 727 --
NM_005339chr454258 3393 1710 1318 638 13340 11664 22943 1349
NM_005358chr1331389 403 255 ----11166
NM_005359chr18135578 5197 4757 4454 3952 2510 2071 1867 1705 1290 1252 787 113 24673 51 24448 1314 --
NM_005375chr61883 ----1285
NM_005397chr763808 3443 3376 2704 748 35 13991 43823 3570 3511 1469 --
NM_005399chr164307 4104 3817 3071 1605 510 34431 4019 547 --1626
NM_005400chr243094 2791 987 490 12162 31144 910 393 11037
NM_005406chr1821079 153 1622 199 21166 493
NM_005413chr21150 ----2467 319
NM_005433chr182927 27 2605 144 --11768
NM_005436chr1073774 3680 3516 3503 3124 1136 1094 --1664 12754
NM_005440chr1773289 3008 2798 2112 1000 659 47 22812 1278 --11063
NM_005458chr972237 2176 2022 1601 875 690 219 22364 2254 --12041
NM_005475chr12103284 3080 2955 2781 1279 1270 1223 1058 542 480 --13166 --
NM_005504chr1296458 5942 5001 4706 4469 4056 2349 1140 1008 32255 1283 441 15422 --
NM_005509chr551713 1581 1160 364 87 ------
NM_005530chr1531351 432 405 31094 474 442 ----
NM_005578chr383647 3501 1613 1462 930 574 528 243 44959 3207 1783 1502 1137 21053 45
NM_005591chr1162799 2544 2371 2218 142 135 12212 ----
NM_005596chr9186304 6117 6063 5101 5038 4467 4420 4197 2271 2249 2182 1541 1463 1245 1223 1075 129 74 36101 1167 855 31913 768 200 1300
NM_005604chr632583 1983 917 21799 1686 1519 42570 1584 807 399
NM_005638chrX21780 1500 ----31110 593 372
NM_005639chr1281855 1668 1601 1584 703 609 150 113 21816 671 ----
NM_005655chr871294 1124 457 289 279 215 133 1188 ----
NM_005665chr154199 3908 3355 1405 210 --2917 885 --
NM_005668chr584408 4018 3992 3712 3146 1306 1154 369 24471 3598 1659 --
NM_005715chr651936 1928 1765 1758 1090 22380 256 11733 1402
NM_005725chr112245 31902 1726 1521 22334 691 22159 779
NM_005738chr752063 721 382 272 213 ----11504
NM_005739chr1562206 2092 1865 756 69 21 12140 1762 --
NM_005746chr762161 1695 454 376 267 41 31961 869 328 22284 851 1313
NM_005748chr1292877 2485 1347 1222 1051 1010 418 303 103 43306 2846 2187 958 155 32609 2195 128
NM_005779chr553176 2424 1270 1146 674 21328 1213 32998 2829 163 12275
NM_005786chr1821248 803 --1308 21168 500
NM_005795chr262942 2425 974 341 283 113 22620 741 11189 12026
NM_005798chr1365283 4470 4277 3569 1430 154 34326 1720 1472 13274 1862
NM_005808chr383189 3040 2496 2410 1185 1093 445 203 ----12296
NM_005813chr252361 1888 884 416 280 1738 --12057
NM_005822chr652038 1575 917 839 528 22029 789 ----
NM_005840chrX67044 6725 5738 5085 2573 2127 27554 1144 36988 5121 5044 35574 1814 1134
NM_005853chr162553 397 ----2174 152
NM_005859chr521195 54 2478 159 --2272 68
NM_005880chr1651609 1311 481 412 177 11523 ----
NM_005898chr1152079 1212 573 369 136 23185 3063 --12529
NM_005901chr1857906 7766 3025 1556 1271 38533 949 261 26486 2120 37413 7014 6717
NM_005903chr574833 4316 4176 3325 1694 1176 123 11413 --44131 3542 1422 594
NM_005909chr583309 2970 2963 2858 1337 965 718 361 --23037 790 24317 1615
NM_005935chr485204 4962 4548 3706 1376 1346 1091 325 13733 35023 3422 1686 13837
NM_005941chr8134217 4152 4101 3451 3398 3260 2761 2632 2589 1269 1108 921 785 13492 23632 1185 --
NM_005955chr143660 1519 1353 618 34886 4002 310 --11152
NM_005962chr10----22067 58 12343
NM_005962chr10----22067 58 12343
NM_005986chr1322426 811 11980 22272 528 12585
NM_006007chr974417 3599 2801 1429 1280 499 195 1735 1258 14380
NM_006011chr1594305 1427 1065 671 611 578 561 527 79 11322 13842 --
NM_006033chr1821869 1685 11486 --11909
NM_006037chr224882 354 21554 363 --33792 3455 393
NM_006047chr2053440 2911 2878 2826 2813 33169 1416 731 2277 222 --
NM_006055chr222221 2122 21205 955 12165 12101
NM_006095chr4104117 3878 3849 3347 3264 1733 1707 718 354 162 23362 658 ----
NM_006106chr1152978 2958 2276 948 583 12481 13406 --
NM_006108chr1131718 1458 388 12121 1945 21735 1495
NM_006134chr2131498 1026 202 1652 11355 1452
NM_006139chr231990 1894 366 22637 1137 22432 2083 1945
NM_006154chr15112944 2858 2810 2715 2624 2551 2025 1149 843 276 199 1615 12381 --
NM_006155chr242029 730 605 525 ----11560
NM_006187chr1293104 2986 2972 2596 2579 2457 2273 2121 759 12209 22189 765 --
NM_006194chr1441342 1287 323 279 ----1905
NM_006203chr5185517 5401 5244 4963 4927 4920 4616 4470 4370 3770 3600 1636 1521 1163 704 440 387 214 55625 5110 4391 3593 474 24308 4037 --
NM_006206chr452610 1032 1016 729 321 22581 273 --12882
NM_006223chrX1360 1407 --193
NM_006237chr1362229 2219 2189 2033 1782 608 1421 ----
NM_006241chr382462 2329 1987 1961 848 625 373 212 ------
NM_006246chr1441199 894 350 227 ------
NM_006251chr5103256 2512 2300 2150 1139 1029 438 290 232 90 --1316 33013 957 888
NM_006252chr1136935 6779 6628 6411 6273 5504 5488 5313 4833 2714 2314 550 130 57588 6603 5129 2591 1997 57542 4640 4608 1278 751 --
NM_006256chr182327 2320 2310 2072 2004 1874 520 266 137 1430 --
NM_006258chr1051557 1105 634 514 55 --11019 1487
NM_006275chr2021802 1605 12211 --21932 120
NM_006283chr834935 4527 3416 --24868 3294 --
NM_006287chr252186 2076 875 704 264 12123 12107 --
NM_006300chr1972212 2171 2121 1479 845 441 433 ----1682
NM_006306chrX105541 5474 5041 4637 4485 4016 3670 2221 2113 1834 11824 --14083
NM_006313chr1271394 1264 1127 566 478 249 169 123 ----
NM_006323chr42693 103 --1551 1704
NM_006330chr841572 1291 491 475 --21551 136 11188
NM_006371chr345119 4542 4206 1194 24272 1109 24982 47 --
NM_006379chr752036 1901 1654 520 437 --1138 22170 1795
NM_006390chr121444 31320 427 52 21625 450 --
NM_006393chr1074079 3805 3114 3088 2773 199 136 1678 23445 1821 13787
NM_006420chr2023296 2759 1596 11264 21395 726
NM_006452chr4140 --1105 11282
NM_006457chr443388 3343 2839 172 1229 13913 21264 652
NM_006482chr1233509 1534 458 12432 23017 2540 23592 567
NM_006502chr61256 21040 844 11028 1120
NM_006526chr2031758 1624 1605 11349 2852 211 1134
NM_006529chr441601 1436 1410 1350 1442 194 21187 375
NM_006544chr14116108 5935 5781 5718 4678 4286 3914 3758 1127 604 106 12301 14565 --
NM_006546chr1776644 5801 5274 4656 4280 735 666 15024 --14547
NM_006561chr1066037 5762 4940 4254 3849 1226 15414 22355 2199 2875 436
NM_006587chr441224 1082 529 523 3357 279 223 21701 1289 --
NM_006595chr1151934 1553 796 732 25 1555 2802 667 --
NM_006599chr16137331 7196 7049 6747 6535 6319 3196 3077 3057 2641 2026 1663 1236 47109 6719 2358 1551 35085 2747 592 17690
NM_006602chr202659 583 --2747 180 1797
NM_006614chr353306 3183 1045 920 671 12296 22935 2705 33060 2968 239
NM_006620chr6114740 4396 4067 3967 3932 3307 1484 1425 1184 1133 338 44106 3719 3243 1860 23131 654 14765
NM_006628chr1593779 2953 1746 1262 752 741 465 434 214 1811 --1825
NM_006629chr1862773 2653 2434 1985 1029 685 22806 2095 ----
NM_006633chr51535 ----1195
NM_006654chr1274647 4574 4125 3986 3817 3571 3308 ------
NM_006717chr9103325 3281 3009 2945 2497 1168 1009 870 833 521 --3443 171 61 --
NM_006720chr1034457 1394 269 24702 3881 33408 819 225 --
NM_006722chr392812 2789 2713 2116 616 256 219 197 29 --12073 --
NM_006729chrX73723 3659 2125 1842 1544 754 195 35397 527 212 45128 2026 1722 771 --
NM_006750chr16167988 7783 7482 7282 7013 6840 6559 6242 5538 5274 2901 2806 1925 1295 1080 336 47192 3192 73 39 25228 3114 15861
NM_006751chr2----11026 1760
NM_006754chr731106 1037 1008 --2446 146 --
NM_006766chr832465 2187 2112 1272 --22700 774
NM_006775chr631222 1197 942 ----12859
NM_006777chrX42658 1924 1147 441 ------
NM_006813chr64339 283 103 32 --1137 --
NM_006814chr2042324 2036 1770 634 22674 620 --11944
NM_006826chr22386 242 --1813 1997
NM_006827chr1443301 2149 1342 1137 32277 716 563 --13160
NM_006851chr1262659 2517 1819 994 756 670 1797 32935 2373 626 --
NM_006852chr1752809 1101 631 469 21 --139 --
NM_006873chr233459 2279 1264 12887 32938 872 423 --
NM_006874chr4----152 1120
NM_006885chr1663908 3787 3622 3281 1232 374 34161 3962 3484 33542 768 23 144
NM_006893chr1--1110 --193
NM_006914chr951437 1395 996 315 215 --1223 11554
NM_006918chr1175898 5885 4047 3982 2004 1151 881 11194 --14463
NM_006920chr22784 254 21880 610 31473 549 117 --
NM_006922chr252434 1866 1775 468 137 21899 367 --12120
NM_006924chr1754348 4298 1324 1044 511 33737 2732 1139 --11199
NM_006936chr212941 77 ----1867
NM_006939chr143852 828 99 1115 1382 1166
NM_006948chr212552 100 22207 77 21854 1584 --
NM_006981chr982720 2387 2326 2285 2207 1830 601 560 12755 ----
NM_006996chr141725 1665 1331 397 21516 407 ----
NM_007007chr1254462 4386 2996 818 158 --1869 --
NM_007011chr15136865 6203 6097 6052 5152 2590 2573 2360 1942 1411 705 543 458 --34822 4513 2262 15243
NM_007013chr83945 343 65 1142 --1867
NM_007023chr25952 862 811 741 383 2752 104 ----
NM_007038chr21105634 5463 5024 4054 3804 2450 2160 965 366 25 31811 958 90 --24417 4177
NM_007039chr142911 457 11872 --11923
NM_007050chr20108089 7671 7095 6253 5195 3194 2182 1594 1364 268 36553 2068 552 47368 6602 5561 2933 12986
NM_007064chr361680 1606 1460 1281 614 544 2344 239 ----
NM_007106chr132439 355 3732 572 313 12494 11053
NM_007114chr352764 2421 847 337 261 22196 2143 11030 21328 1181
NM_007124chr641975 584 434 373 --11418 11411
NM_007125chrY21106 147 183 1546 1255
NM_007145chr1931449 475 97 1958 --1573
NM_007146chr1752921 876 747 428 387 11948 ----
NM_007197chr122891 358 ----1123
NM_007203chr963457 2870 1518 1231 644 145 43273 2573 608 500 23248 1184 11066
NM_007214chr651207 487 393 338 72 --1982 --
NM_007238chr2074620 4397 3046 1747 1023 357 181 31141 649 521 2998 842 21612 658
NM_007249chr13197759 7536 7491 6885 6044 5982 5724 3684 3643 3555 3363 2974 2714 2302 2027 1766 1628 757 352 88782 8696 7931 3537 2536 2481 2406 1525 33446 2287 227 194
NM_007282chr31389 1721 --1261
NM_007287chr372615 2527 2330 2225 1228 923 230 151 12588 13221
NM_007288chr372615 2527 2330 2225 1228 923 230 151 12588 13221
NM_007289chr372615 2527 2330 2225 1228 923 230 151 12588 13221
NM_007292chr1785174 4960 4904 3780 1551 1303 1279 1118 1885 1902 24672 1837
NM_007315chr251437 1413 521 343 246 1944 --11205
NM_007332chr871558 1503 1136 632 606 402 373 11335 21296 1004 --
NM_007345chr1892197 905 868 760 746 470 416 287 213 1790 --12104
NM_007347chr1543135 1164 747 612 --13223 1770
NM_007350chr1234100 3136 1231 34301 3852 1499 11418 34426 3046 2930
NM_007353chr782893 2657 1075 934 819 764 423 272 ----2875 385
NM_007358chr13715 446 369 21601 180 21714 642 --
NM_007375chr121941 740 12095 12297 1505
NM_012081chr562675 2318 1406 1290 1218 1117 23060 491 ----
NM_012096chr331392 1049 197 --23380 1346 --
NM_012097chr231966 390 280 11731 2528 380 12195
NM_012098chr941481 539 291 71 11212 21566 1053 --
NM_012102chr142573 2120 852 574 --22662 1665 172
NM_012104chr1193844 3457 3301 2376 1268 1196 654 610 67 11399 2570 80 --
NM_012104chr1193844 3457 3301 2376 1268 1196 654 610 67 11399 2570 80 --
NM_012120chr633006 2325 1125 42500 2185 1155 718 12398 --
NM_012141chr1363060 2944 887 680 462 59 33750 3456 2920 21592 49 --
NM_012158chr1351758 1708 1496 580 514 1102 ----
NM_012164chr9127241 7234 6667 6490 5059 4833 1742 1710 1255 1102 193 125 27179 2053 25596 1291 --
NM_012193chr1165408 4881 4501 3882 1493 650 25355 608 33759 1005 515 --
NM_012234chr383762 3007 2907 905 794 564 394 297 22981 2839 22940 1395 --
NM_012238chr102496 185 11415 --11726
NM_012249chr243119 775 568 371 21308 918 22739 2190 --
NM_012262chr175269 5117 4228 3740 3398 1139 302 24733 943 12051 --
NM_012281chr772108 1919 944 898 442 320 242 11713 2307 132 --
NM_012287chr384320 2967 1174 1122 1060 961 566 516 2830 715 34229 4084 4029 --
NM_012288chr6104588 3847 3839 3807 3483 2091 1247 1155 905 188 --14814 25053 1485
NM_012294chr763414 3298 3071 2764 812 508 32840 2669 890 11464 --
NM_012302chr131017 387 224 1933 21074 195 1177
NM_012309chr1174982 4888 3083 3030 1720 1478 771 24763 1471 1588 24696 1654
NM_012316chr175504 4155 3472 3415 1543 1374 617 15044 --14737
NM_012330chr1031619 172 57 122 --11224
NM_012334chr564576 3242 2942 2925 684 612 24193 1363 32931 1836 97 11302
NM_012347chr652909 819 744 522 357 2932 56 12049 --
NM_012395chr762551 2524 963 951 431 28 1442 12682 13152
NM_012397chr1821592 384 --21705 492 1295
NM_012419chr62453 124 ----1195
NM_012425chr1042635 2038 454 301 12614 --32313 2082 1106
NM_012464chr462659 2303 1798 1109 1054 84 --62369 2280 1816 606 98 26 1373
NM_012465chr1062373 2200 1326 1175 614 565 12292 12928 --
NM_013229chr1242084 2070 448 307 22852 126 ----
NM_013230chrY21312 1260 21626 407 11799 21493 138
NM_013231chr1454024 3492 1622 998 202 11252 44105 3421 105 70 13760
NM_013243chr1541079 922 330 47 ----1551
NM_013254chr121620 142 1161 1151
NM_013255chr798736 7887 7538 6934 5927 5670 1068 462 138 48302 5970 1746 753 26106 2553 46383 1777 1769 23
NM_013261chr452296 1127 583 193 148 1123 ----
NM_013269chr1294167 3541 3268 3149 2948 2919 1793 1715 377 23794 1089 23053 142 23118 2809
NM_013281chr2031361 1114 218 11530 11093 --
NM_013286chr363771 3285 3237 2694 1421 1229 23572 41 32924 547 396 --
NM_013302chr1654719 4513 3492 3342 883 --34531 3851 1770 23372 1749
NM_013341chr242573 706 528 30 ----32268 2250 1941
NM_013372chr1542392 2246 742 205 23309 2165 33077 3041 878 --
NM_013374chr342556 2090 341 311 1249 22024 765 11059
NM_013377chr121279 --2559 523 1482
NM_013386chr12548 219 1116 1686 1174
NM_013396chr213537 382 225 21297 1185 ----
NM_013423chrX4859 488 384 283 ----2899 124
NM_013427chrX4859 488 384 283 ----2899 124
NM_013436chr2----1722 1794
NM_013438chr941626 1513 1372 479 11794 ----
NM_013447chr1963488 3397 3207 3081 321 265 1837 --23567 2487
NM_013943chr162932 2780 1089 899 258 102 1571 43131 2986 2409 2254 1962
NM_013989chr1445118 4069 1993 740 24591 3519 34573 1199 808 --
NM_013995chrX32211 829 159 131 11827 1638
NM_014021chr152566 2251 1273 547 76 23167 2419 --12201
NM_014028chr632085 113 54 13177 1331 12201
NM_014034chr63172 90 25 11157 --149
NM_014048chr1685185 4231 3972 3805 3525 1801 1083 489 53906 3679 1466 686 119 34850 3878 668 --
NM_014057chr941590 1418 1240 1222 21551 231 --11171
NM_014106chr152294 165 --22507 2406 11965
NM_014112chr875429 3887 3727 3385 1072 982 424 14172 1931 --
NM_014141chr7103398 1962 1785 1220 1057 1024 963 668 659 112 33267 810 168 14671 45223 4665 1407 237
NM_014155chr11107063 5982 5955 5576 2710 1711 1657 1208 696 473 --47459 6576 6467 2936 22927 2014
NM_014157chr1671586 1147 1118 936 512 479 256 33958 3780 3215 ----
NM_014160chr361386 1222 1208 1199 532 493 ------
NM_014240chr373559 3195 2740 1571 1273 1198 1180 23188 2812 --33801 3025 1167
NM_014243chr422028 1394 31762 632 234 22015 1725 1726
NM_014253chrX42208 2184 1549 722 1934 21784 232 155
NM_014263chr1021228 47 --1464 1935
NM_014265chr81785 ----1316
NM_014309chr2243825 1060 968 560 24906 3852 --21345 124
NM_014319chr1231423 1347 533 --1739 1326
NM_014331chr4147859 7484 7312 6350 6045 5873 5007 3013 2979 2850 2619 1764 1011 227 35317 5000 1938 37302 5195 2867 47169 1472 1127 48
NM_014335chr1521178 138 ----1373
NM_014372chr122061 1851 21984 107 11767 21514 469
NM_014379chr831036 232 222 3885 722 25 1663 1297
NM_014381chr1462810 2683 2558 2089 1114 809 22008 237 ----
NM_014393chr872375 1761 1536 481 384 318 68 1773 1133 --
NM_014421chr45825 720 667 440 277 31595 1305 137 2852 369 --
NM_014423chr585365 4554 4297 1929 1464 729 396 57 34407 815 761 14010 --
NM_014447chr431514 211 120 --21344 508 1617
NM_014456chr102708 69 1591 1367 31802 1773 1559
NM_014515chr123375 73 61 --11038 1144
NM_014521chr241786 1602 1238 319 11802 --11221
NM_014554chr1282235 2168 2022 1518 1482 909 482 148 1841 1465 1587
NM_014572chr1331808 1368 491 --11357 1394
NM_014574chr1451422 1200 1097 477 131 1564 --11212
NM_014613chr582983 2962 1946 873 817 507 470 127 13073 ----
NM_014614chr261428 1279 998 593 452 252 11118 --1562
NM_014615chr1673232 3057 2566 2486 1388 691 632 23214 103 53184 2427 2409 1369 569 --
NM_014616chr332371 644 556 13221 32777 986 691 11020
NM_014630chr1573586 3416 2902 2486 1350 1238 467 --23566 777 13406
NM_014636chr994356 3864 3812 3724 3614 3209 1303 1160 335 23308 549 ----
NM_014637chr82961 490 --2967 382 1293
NM_014647chr165879 872 639 293 163 11401 --158
NM_014682chr841932 1624 921 785 1649 11913 --
NM_014702chr683174 2959 2718 721 677 599 504 222 33379 2872 711 --11207
NM_014707chr782003 1865 1696 1661 790 761 425 220 11904 ----
NM_014711chr162756 701 --3357 230 77 11382
NM_014721chr667035 6765 5263 2727 1433 459 32235 2077 1915 55749 5611 5605 1111 1001 37445 5892 4960
NM_014733chr552283 2125 164 118 78 21703 450 ----
NM_014739chr654197 3629 1694 993 497 13006 23176 3049 --
NM_014743chr463017 2189 2085 2018 1934 702 --22917 2697 --
NM_014751chr871520 792 464 401 342 316 179 ------
NM_014755chr2104288 4130 3752 2786 2676 860 815 804 779 303 ------
NM_014766chr793829 3766 3756 3463 2858 1228 907 799 449 --11240 12699
NM_014803chr1042738 1965 837 568 31129 806 223 12784 --
NM_014810chr153262 2831 2240 803 416 13089 13143 --
NM_014812chr141865 493 485 204 --21669 1655 21562 81
NM_014826chr193957 3753 3602 3334 2942 2906 1196 988 153 24322 4287 2547 310 --
NM_014829chr581453 959 949 892 809 637 573 533 1494 1328 --
NM_014830chr1263904 2939 1476 1451 619 160 ----12457
NM_014836chr1041683 798 589 169 22017 1783 21347 299 --
NM_014841chr641131 479 407 147 11182 --1488
NM_014850chr364018 3946 3751 3610 1808 1303 11742 23841 649 --
NM_014864chr184306 4178 2702 1718 1658 176 55 37 13221 13965 14185
NM_014873chr184463 4137 3971 3920 1746 1167 705 619 1280 ----
NM_014877chr17167256 7134 7035 6770 6454 5873 4851 2931 2764 2745 2568 2099 1818 1183 542 438 27562 7386 15140 --
NM_014888chr73604 583 287 1979 11186 11063
NM_014891chr731475 654 398 21094 154 11140 21363 1175
NM_014893chrY52156 1646 898 462 414 11804 12058 11936
NM_014902chr203602 484 139 2226 204 --148
NM_014904chr1073957 3546 3004 2731 2508 1282 347 33821 2681 1206 11064 --
NM_014906chr17104011 3812 3679 2870 1349 887 856 285 247 211 --21548 963 1641
NM_014912chr1063014 2862 2502 1393 941 24 12549 12816 1759
NM_014914chr281128 1064 910 479 462 314 246 226 1161 --1965
NM_014920chr663398 3145 2709 1307 1061 840 42975 2942 2445 98 --13161
NM_014923chr1331781 877 623 32129 758 190 22138 2110 --
NM_014924chr1472532 2500 2422 1080 1011 667 335 22524 415 13180 11231
NM_014932chr341369 559 363 273 21993 1941 31949 461 171 11651
NM_014934chr1343995 3888 3874 3210 21481 261 22657 119 --
NM_014936chr61932 144 31039 875 22 11791
NM_014937chr1031091 414 101 1919 1325 21132 929
NM_014946chr243097 583 254 175 22950 2142 --2367 54
NM_014953chr13104059 3610 3526 2995 1625 1576 1363 1327 882 782 1724 23231 1516 13666
NM_014962chr2042676 2506 1933 818 11969 22812 984 --
NM_014978chr1041287 472 397 124 --21726 403 --
NM_014988chr442634 2079 1963 1097 12213 --1224
NM_014989chr651880 1321 642 381 374 1752 11394 --
NM_014991chr453237 2962 2470 2299 977 1205 32489 1268 806 --
NM_014997chr751183 579 435 352 84 12324 2918 384 --
NM_014999chr122533 204 --21683 1664 11444
NM_015000chr1223033 2760 1576 1605 --
NM_015008chr353515 3337 2253 1279 156 ----1611
NM_015020chr1633669 2831 1530 --13051 12671
NM_015025chr272744 2675 2633 2351 2321 1969 1872 22397 1950 2402 382 --
NM_015026chr1264679 4121 3704 1795 1100 748 44806 3040 1500 408 11377 1603
NM_015027chr1661789 620 403 315 242 130 21446 260 22028 723 11949
NM_015032chr1332709 1979 1958 22187 100 22006 241 12962
NM_015035chr20106329 6176 4642 4105 2692 2327 1525 1503 1100 511 12474 16732 25393 304
NM_015039chr164219 3930 2997 833 458 26 11122 1929 --
NM_015040chr273114 2770 2538 2337 1029 932 351 23008 483 ----
NM_015049chr273201 2975 1304 712 360 105 30 11046 32891 849 290 1278
NM_015051chr933045 2662 2452 13014 --1904
NM_015059chr15103976 3728 3356 3183 2888 2454 1077 1070 950 922 23854 459 41538 782 768 473 --
NM_015064chr1253196 3185 3053 2313 467 11218 11240 13528
NM_015068chr733228 826 789 13130 22816 395 23006 1403
NM_015070chr13--21224 182 --21104 1069
NM_015071chr535693 1520 609 25462 5434 --15930
NM_015076chr683937 3784 3755 3552 3292 660 477 439 --33453 1611 946 14153
NM_015077chr17104671 4456 4385 4083 4013 3669 3497 1769 1122 1111 ----14747
NM_015090chr176105 4799 4293 4124 1832 167 84 15012 15951 25577 4380
NM_015091chr141567 ----1188
NM_015092chr1664195 3851 2886 1491 1318 336 24512 275 13251 43736 1638 1481 827
NM_015097chr342204 2074 1858 1621 12270 1243 --
NM_015110chr92683 280 1315 1130 12219
NM_015115chr442627 1991 615 63 33110 3018 2472 ----
NM_015116chr1351719 1674 1623 215 165 ----1507
NM_015132chr721543 657 1352 --21675 625
NM_015138chr1542369 2058 1951 1929 ----32166 1788 1098
NM_015144chr1653104 2745 861 634 45 23822 3687 --32854 2530 63
NM_015156chr1453545 3166 3045 2925 653 13123 22947 1137 13065
NM_015192chr2053018 2137 2030 814 68 11110 1972 12215
NM_015199chr322687 1079 1175 22773 312 12813
NM_015200chr44767 443 171 77 12574 --12335
NM_015205chr13155302 5061 4995 4524 3834 3767 3689 3554 3509 3317 3292 1996 1943 1749 1050 --35046 3623 3193 --
NM_015206chr1573540 3143 3022 1562 563 412 125 --1275 --
NM_015208chr18133560 3345 3153 3118 3103 3097 3063 2965 2788 1475 1276 601 191 33786 3678 441 1898 13302
NM_015215chr192968 2457 2368 2350 2315 2008 1093 713 375 ----32052 517 133
NM_015225chr993143 3008 2834 2243 2039 1161 744 488 410 22748 936 21170 497 --
NM_015233chr1342069 1984 1843 1006 1299 41998 1960 820 605 --
NM_015236chr42439 429 1951 1128 11391
NM_015247chr1695098 4912 4244 4019 1882 1454 1300 826 304 11398 13699 --
NM_015251chr1652301 2186 1723 660 340 --11970 21856 684
NM_015265chr252491 2006 1911 802 778 11719 11778 --
NM_015267chr1231936 800 578 1505 22135 1705 --
NM_015268chr31203 1274 --2711 217
NM_015271chr443856 3694 3613 2670 44317 745 432 365 --11421
NM_015277chr1841262 690 619 200 ----11670
NM_015278chr653389 2833 2497 838 808 12792 --12284
NM_015282chr232186 2130 109 2804 473 --32378 743 213
NM_015286chr1552329 969 770 447 302 22501 233 --12292
NM_015296chr1331077 784 84 ----1967
NM_015299chr1473658 3204 2533 1102 853 594 153 14048 ----
NM_015310chr8108405 7004 6575 6433 6334 5315 1968 1475 484 462 25188 5135 36508 6356 6014 28359 3291
NM_015313chr1144720 3670 3255 1654 13419 --13299
NM_015314chr71738 --32410 2343 763 1770
NM_015315chr532706 2340 2260 52965 2224 847 799 428 --13475
NM_015317chr282014 1950 1936 645 551 501 410 76 32544 330 250 12210 1729
NM_015323chr651381 1286 266 124 85 3628 533 68 1231 --
NM_015326chr152980 1944 681 620 588 ----11044
NM_015335chr1231034 658 365 21976 338 --22506 1956
NM_015336chr1221878 792 1296 22659 487 --
NM_015344chr842140 1987 162 64 1433 --11547
NM_015347chr1292699 2599 2569 2311 2236 1197 562 445 367 --22587 133 12393
NM_015358chr213876 478 150 1945 1400 --
NM_015365chrX64078 3981 3214 2948 792 684 23492 1612 53727 2854 2723 2665 1402 --
NM_015375chr183821 3725 3292 1326 1284 1066 754 280 --15014 1817
NM_015387chr2--11955 52128 673 590 540 355 --
NM_015409chr1231945 387 91 2358 53 22393 618 12135
NM_015458chr875289 4928 1539 852 778 702 176 14732 13546 34788 4030 508
NM_015475chr24894 839 205 180 ------
NM_015508chr321095 166 21204 1182 11059 11276
NM_015520chr362755 2687 757 671 99 65 11906 12828 --
NM_015525chr621058 32 ----1912
NM_015532chr1552674 2621 2577 881 861 --1118 --
NM_015541chr351352 1010 301 219 166 21290 186 ----
NM_015550chr733249 915 64 --12863 12487
NM_015554chr1572815 2560 882 650 613 438 209 32577 689 679 32889 2599 2545 144
NM_015555chr63435 364 101 11433 21759 1531 --
NM_015564chr5123412 3109 2829 2359 2282 2192 1408 1320 1297 1131 659 272 ----12303
NM_015569chr163461 3344 3214 3084 1650 1525 13522 11662 13421
NM_015570chr741385 549 490 467 1632 192 --
NM_015571chr632408 1679 840 12287 2591 288 12494
NM_015575chr233096 809 68 33245 791 115 13544 --
NM_015576chr362925 2383 2249 1929 1902 1163 11134 ----
NM_015605chr103435 133 90 --1578 1288
NM_015635chr912174 1247 --2837 670
NM_015640chr154264 4118 3688 1932 401 33928 3887 1228 14753 24413 177
NM_015660chr7----1334 1213
NM_015695chr651692 1461 755 731 54 ----12105
NM_015852chr7233475 3370 3277 1410 1307 1280 1196 1146 1115 1062 1031 978 947 894 810 726 695 642 443 306 275 222 107 22473 865 1138 61363 613 529 361 193 25
NM_015879chr18148605 8405 7215 7150 6970 6833 6265 5799 2944 2870 2578 1249 1242 790 37544 6718 6291 25395 986 27643 2907
NM_015888chr183219 3179 2690 2311 2256 871 559 488 13188 --141
NM_015906chr164380 4364 4146 4137 3054 147 --11735 24450 65
NM_015912chr851656 751 662 650 569 --1406 12384
NM_015995chr15114180 4080 3715 3668 3439 1783 1702 1524 1040 216 200 1104 --1167
NM_016009chr184620 4456 3049 1250 1155 940 749 51 34010 1403 216 2839 722 --
NM_016040chr162720 2586 2048 959 544 389 2474 44 32386 1119 668 --
NM_016045chr2041783 1736 421 82 11372 21729 1364 --
NM_016061chr221214 607 --21533 1160 --
NM_016076chr172948 2757 1057 551 409 302 256 12800 12016 1422
NM_016081chr462007 1412 1382 879 604 56 1409 1391 1546
NM_016083chr673771 3460 3240 2927 2569 1133 279 13215 --11329
NM_016084chr173666 527 25 --1586 1539
NM_016107chr5----41358 1262 1189 1039 21303 537
NM_016123chr1241344 883 468 258 1526 --21191 498
NM_016124chr131485 234 206 --11373 --
NM_016132chr1553302 3055 2658 1337 826 2887 92 ----
NM_016206chr3168808 8404 6668 6637 5924 5759 3235 3115 2431 1868 1340 1095 920 829 372 36 58753 6189 2598 2040 619 27543 7064 68548 3578 1619 1194 414 97
NM_016226chr121144 182 --1422
NM_016248chr1333146 2521 1145 53386 3300 2856 2829 1514 ----
NM_016257chr182954 2921 2915 2874 2723 2276 1269 424 11212 1696 23403 2961
NM_016260chr2116363 5548 5263 2786 2752 2725 2121 1936 1837 857 310 16339 46710 5233 4817 496 17661
NM_016272chr2252815 2655 2322 1970 1881 292 44 --12171
NM_016277chr61273 31270 1080 437 21304 307 --
NM_016312chr121480 ----1168
NM_016315chr251790 1692 1514 533 524 --1269 --
NM_016322chr973005 2429 1272 835 821 556 147 --1808 13104
NM_016338chr51180 1138 --11002
NM_016356chr652610 2434 2283 556 463 --12584 --
NM_016377chr661758 1254 1195 400 258 167 --1296 --
NM_016396chr1562924 2693 2628 2503 892 318 11214 1848 22450 787
NM_016424chr1761983 1584 1423 1371 635 106 11483 --1144
NM_016513chr663398 3145 2709 1307 1061 840 42975 2942 2445 98 --13161
NM_016530chr15114145 3875 3545 3296 2781 1597 1529 1449 1373 327 136 23084 988 ----
NM_016531chr4114041 3342 3292 3267 2871 2642 1666 1305 1177 534 310 14012 13696 12958
NM_016542chrX31660 1531 1383 11270 11678 --
NM_016570chr121188 --1100 145
NM_016588chr63940 795 761 --1259 1851
NM_016603chr562143 1667 615 472 211 30 --12168 1700
NM_016626chr1821542 1294 ----11178
NM_016644chr51507 1130 --153
NM_016654chr153316 67 50 ----1161
NM_016824chr1071927 1831 1777 1761 686 503 264 1147 11333 --
NM_016950chr431387 1137 1035 31517 606 49 --21447 209
NM_016953chr2136081 5618 4683 4384 4311 4247 4212 3906 1941 1734 1513 1393 786 14643 15656 45965 5162 4069 2202
NM_016954chrX----3611 545 533 --
NM_017420chr1453298 2579 2430 389 122 43386 2719 2497 1088 53694 3616 2798 1150 442 21468 70
NM_017437chr1432051 686 363 11644 --198
NM_017447chr2173281 2864 2807 1379 690 556 121 14239 --23646 1452
NM_017456chr171370 ----11907
NM_017519chr641180 1161 850 291 ----1977
NM_017522chr161428 1394 587 448 296 162 ------
NM_017548chr3--2687 466 1205 1258
NM_017551chr1031886 1652 63 --31744 113 80 22415 221
NM_017563chr346318 5494 719 106 56362 5511 5003 1044 438 --15820
NM_017569chr134384 374 270 155 ----177
NM_017577chr311057 31511 1028 351 --1276
NM_017594chr993325 3171 3094 2937 2826 992 848 517 314 22586 192 13188 12847
NM_017596chr174687 4565 4428 3925 3031 2985 1429 23826 3011 13846 --
NM_017599chr1241785 1579 499 246 21662 47 21823 798 --
NM_017628chr434536 4275 3341 65170 4443 1539 927 354 38 34069 4003 1752 --
NM_017633chr693643 3350 2845 2487 1335 1086 918 633 289 21326 395 12609 --
NM_017637chr9158874 7479 7147 6922 6698 6313 1906 1580 1043 1026 1004 955 769 325 21 79370 9090 5863 5729 3582 3252 2349 26070 805 31247 1170 987
NM_017643chr1762910 2296 1208 514 390 44 22028 819 --23134 2797
NM_017645chr942444 2370 2183 432 --12676 --
NM_017658chr14104306 4108 4096 4080 2889 1852 1819 1758 185 85 11792 ----
NM_017666chrX52022 1792 680 503 448 --21950 88 --
NM_017680chr93233 186 98 1716 1247 --
NM_017704chr114952 730 641 299 199 ----
NM_017712chr1955635 5410 1718 609 235 56341 5788 5761 4859 162 --35797 4704 880
NM_017719chr3----22053 891 12139
NM_017736chr1632671 2327 1012 22822 782 22800 676 --
NM_017738chr921144 236 1996 2307 224 1391
NM_017745chrX3693 529 67 ----1725
NM_017752chrX51801 1751 1500 331 136 --1259 --
NM_017754chr684877 4401 3896 3207 732 616 404 237 24131 545 24162 999 31938 1806 1085
NM_017769chr1453148 2560 2136 745 242 11316 12993 13023
NM_017770chr662838 807 335 304 253 116 32378 2313 1183 11880 1514
NM_017801chr32275 166 22478 2343 12421 1742
NM_017813chr895782 5558 5110 4763 4698 4314 4179 1410 317 35008 3809 472 34585 1563 245 --
NM_017831chr1894367 4236 3505 3350 1541 935 863 596 111 34702 3910 1242 13828 34019 1140 666
NM_017847chr1112198 2094 1899 1823 1809 1782 1773 1461 647 455 158 12116 --1876
NM_017848chrX32877 2834 330 24503 3937 ----
NM_017915chr123941 201 187 --1275 1464
NM_017919chr975511 5491 4612 4426 4032 1857 485 55243 5063 4599 4562 3994 22161 89 1644
NM_017938chrX51783 1420 699 465 103 51862 1477 770 199 77 11932 21597 1353
NM_017944chr1142957 2436 1980 1217 --32227 2140 1228 11959
NM_017987chr1021472 255 2538 400 31641 784 65 --
NM_018014chr231108 1091 400 11151 --1963
NM_018017chr1072443 2262 2060 2022 1887 1115 40 12096 1989 1133
NM_018027chr1022219 1150 --32709 968 802 32639 2628 724
NM_018036chr1434401 4304 669 11087 13454 23820 680
NM_018084chr2--32590 2190 1085 1179 12897
NM_018085chr197888 5232 2677 1571 1266 904 790 618 45 38168 7818 2289 68237 7502 7085 3085 2355 1461 46225 1719 1297 662
NM_018092chr1631315 1180 471 --11399 11133
NM_018117chr103782 236 156 --1765 1520
NM_018121chr1042680 2297 2169 511 22707 2565 1471 12734
NM_018133chr342135 1383 632 368 --11444 1258
NM_018157chr1272043 1210 1013 667 562 547 492 ----22945 2318
NM_018184chr361719 1536 526 506 452 170 ----1212
NM_018214chr611037 11138 --1934
NM_018227chr422518 220 1250 --12975
NM_018243chr4123672 3404 3353 3155 3117 2518 1002 953 843 730 440 273 33549 2690 2509 24071 3483 12699
NM_018247chr642813 2569 2319 111 ----13119
NM_018254chr162434 2067 1908 1625 930 649 1251 1776 --
NM_018293chr382903 2281 1975 1942 1163 714 423 163 11157 12248 11144
NM_018312chr1122166 366 2521 432 1345 --
NM_018313chr35980 792 610 128 36 --1208 1417
NM_018315chr4------21182 228
NM_018325chr921343 1204 2473 148 21233 1227 --
NM_018327chr2061862 1796 1722 1368 549 64 2740 451 127 --
NM_018328chr23507 425 50 1441 --1155
NM_018330chr1051143 1084 703 373 219 21686 491 1130 --
NM_018342chr43679 479 330 --31660 695 349 11756
NM_018362chr1142721 610 543 269 22991 1583 ----
NM_018364chr194017 3641 3564 2899 2676 1642 1369 513 135 33376 3198 2811 22498 161 --
NM_018374chr7115235 4836 4559 4393 3812 3567 3194 821 485 349 331 31480 895 815 24250 3352 --
NM_018416chr1232603 1858 898 --12354 11981
NM_018429chr542625 996 582 477 12217 1623 1792
NM_018440chr8128309 7254 6929 5914 5688 2765 2603 2413 2055 1573 1194 1186 45708 5371 1456 267 53491 1344 897 494 80 28231 3242
NM_018452chr6_random93879 3603 3372 2531 2488 2463 1521 1457 465 1926 13394 --
NM_018466chrX2307 78 2279 93 1588 --
NM_018482chr832086 614 488 1503 11636 12019
NM_018489chr1--12252 22338 895 1853
NM_018509chr1771576 1567 1542 1168 1093 373 74 --11363 1528
NM_018555chr1982272 2161 1822 1758 1496 748 521 395 --11471 21794 1778
NM_018557chr241605 1331 511 470 11317 21298 619 --
NM_018566chr184854 3900 3763 3645 1689 1452 661 99 1708 --24841 4011
NM_018638chr12105541 5238 5164 4170 3776 1595 1467 1424 1409 1184 11870 23511 1628 23536 905
NM_018640chr1282480 2349 2312 1112 793 319 84 72 21945 969 3558 502 31 1673
NM_018650chr122185 905 11799 22140 823 2612 547
NM_018667chr16112500 2198 1145 884 821 751 482 440 268 256 245 1666 11973 --
NM_018695chr5--1251 12342 1985
NM_018704chr131925 606 532 11442 11486 1438
NM_018717chr462747 2216 673 604 569 196 --11008 31970 794 417
NM_018841chr183873 3684 3203 2813 2703 2460 306 285 1616 143 --
NM_018844chr731316 647 444 --22092 1925 11951
NM_018940chr52912 174 ----1138
NM_018945chr6103407 3094 2837 2614 2531 1226 1075 899 454 167 13460 --12900
NM_018947chr774593 3218 1257 1244 912 869 281 54705 3509 3438 840 30 24560 814 13447
NM_018970chr743000 2060 1118 730 12692 13166 23023 2591
NM_018981chr221269 1176 --1439 1332
NM_018993chr2061468 1299 1268 457 326 168 21311 1194 11079 --
NM_018999chr1054869 4264 3553 1410 625 24113 1712 13360 23135 941
NM_019001chr374112 3914 3303 1759 1633 780 700 177 11678 --
NM_019022chr1833198 956 947 42243 1999 663 606 1207 --
NM_019027chr452085 1966 1675 983 448 --3491 464 34 11930
NM_019035chr451480 409 328 161 111 --11917 12111
NM_019041chr6102525 2406 1898 1820 1729 424 402 269 183 105 11858 2581 151 --
NM_019042chr741122 492 445 369 --2181 37 --
NM_019050chr431687 788 31 --12030 1179
NM_019053chr103286 263 107 --1253 1808
NM_019072chr572665 1287 1081 948 759 204 188 --33104 2970 31 12768
NM_019083chr171431 1365 1303 528 473 307 292 11619 11335 1607
NM_019087chr551716 1630 1421 1276 614 31689 422 363 ----
NM_019106chr2263219 1173 1048 934 648 605 1917 22910 406 1909
NM_019114chr932496 2450 92 21701 871 21001 463 12173
NM_019117chrX92883 2795 2483 1349 1232 1214 1157 732 723 22817 275 23095 765 12835
NM_019556chrX41106 996 521 406 1559 21364 1204 --
NM_019590chr1021098 23 177 2414 400 1924
NM_019891chr121250 989 --134 1935
NM_019903chr1071927 1831 1777 1761 686 503 264 1147 11333 --
NM_020116chr431148 206 170 1237 21496 325 --
NM_020119chr753377 3070 2985 2671 1624 11323 22489 1197 --
NM_020122chr2145643 5441 5308 4958 4653 4518 4233 2200 2018 1800 1623 561 499 432 25793 1082 1460 12261
NM_020132chr2194985 4623 4485 4140 4057 3867 1549 847 545 15008 24313 69 15018
NM_020141chr152404 2378 2325 2103 165 1301 --2649 548
NM_020144chr741885 1835 1772 32 21451 749 2569 82 11391
NM_020148chr1861923 1880 1230 618 562 149 22013 492 --12900
NM_020177chr5123340 2853 2838 2578 2481 2391 976 629 478 352 58 36 11036 ----
NM_020178chr1721171 195 11179 2227 207 1421
NM_020182chr2083635 3348 3058 2387 1063 905 574 172 23255 369 23237 3049 --
NM_020198chr1731464 562 458 --1301 11414
NM_020208chr353385 2639 2324 1310 1134 43290 1402 956 629 12342 1892
NM_020245chr674659 4330 3589 3523 3432 1122 673 1426 13108 13988
NM_020336chr2072851 797 636 278 242 199 51 ------
NM_020337chr453096 2515 1100 752 231 12104 12305 --
NM_020346chr1141152 608 509 314 31337 331 62 11580 31172 1146 410
NM_020390chr344529 3096 3051 356 34292 1935 758 34027 1914 476 1690
NM_020416chr492643 2395 2143 1785 1743 1672 918 248 140 1256 ----
NM_020432chr732225 824 284 21911 1830 --1423
NM_020440chr173332 3229 3057 2579 1056 911 770 12647 1485 --
NM_020443chr1106186 6081 5242 4846 4599 4377 1350 448 377 305 56090 4859 2125 2000 728 56390 5619 5291 4683 1556 11623
NM_020453chr452093 1929 1583 1493 1400 12015 ----
NM_020466chr674357 3663 3581 3546 3355 1059 259 44686 3396 1823 894 23509 77 23041 424
NM_020475chr832288 1532 27 11696 21767 626 2276 213
NM_020476chr832288 1532 27 11696 21767 626 2276 213
NM_020477chr832288 1532 27 11696 21767 626 2276 213
NM_020478chr832351 1595 90 11759 21830 689 2339 276
NM_020480chr832288 1532 27 11696 21767 626 2276 213
NM_020546chr572357 2051 1157 1118 819 759 399 --21246 1223 --
NM_020640chr36889 844 798 339 333 48 32175 682 396 12147 --
NM_020673chr2057800 7107 6505 6374 217 36666 4927 131 56963 6786 3034 2969 2910 --
NM_020699chr175182 4890 4764 4058 1305 1201 1054 11756 21069 475 14346
NM_020711chr282209 2185 2170 2155 2072 1800 1778 830 12558 12327 12147
NM_020717chrX84622 3471 1705 1576 515 439 280 191 --21943 1402 24808 4637
NM_020718chr16136612 6200 5933 5244 4625 4057 4001 2365 1533 1301 1271 1214 670 15884 16286 14012
NM_020727chr2143746 3192 2849 863 11417 --12715
NM_020728chr763013 2146 2133 705 608 70 ----22732 740
NM_020732chr641180 1161 850 291 ----1977
NM_020734chr1273260 2856 2323 430 362 195 186 1342 --1680
NM_020739chr1573201 1697 1207 776 486 459 140 --21459 353 11539
NM_020742chrX42248 2225 660 432 21870 914 11107 --
NM_020752chr1092487 2351 1969 1957 1775 1173 1119 834 598 ----1341
NM_020766chrX53909 3489 3343 3103 1205 --22866 1661 --
NM_020768chr5123265 3001 2863 2823 2053 1150 1115 1056 1002 579 118 90 1883 1543 --
NM_020772chr17168584 8047 7608 7438 6379 5838 5656 5279 3466 3047 2871 2101 1791 1412 1387 827 23459 2361 36819 135 65 37961 3258 1433
NM_020774chr1875196 4577 3915 3901 2501 385 340 35242 4509 163 32092 1802 1334 --
NM_020776chr18102659 2459 2122 1162 976 711 544 536 422 364 12644 ----
NM_020786chr162494 236 21480 383 134 11928
NM_020791chr1741406 1384 1330 1123 11022 11046 --
NM_020792chr3--11790 22051 861 1845
NM_020794chr131272 494 438 1424 2398 325 1463
NM_020796chr582802 1195 690 566 379 357 287 150 2266 164 1463 12029
NM_020800chr331099 563 443 --21237 163 --
NM_020801chr572386 2215 2081 1005 682 616 443 12270 --21832 967
NM_020805chr1851899 1861 1402 559 492 2261 145 ----
NM_020810chr1472709 2231 879 696 614 202 125 43158 2493 1201 382 11395 12988
NM_020830chr253302 3047 1087 356 110 32316 1022 955 22054 772 --
NM_020841chr1263819 2759 1460 623 480 283 53737 3329 2867 428 417 --13072
NM_020844chr8137313 5993 5587 5483 5152 5122 4863 3079 2947 2746 462 226 170 --36166 2781 1518 16872
NM_020850chr1662946 2515 2499 2059 809 225 ----13268
NM_020868chr241240 634 613 364 21336 1280 2663 161 --
NM_020870chr452158 1578 766 53 40 --2582 245 --
NM_020871chrX52505 1797 1774 1679 444 12357 1907 --
NM_020872chr321416 584 ----11469
NM_020899chr1721848 1678 11961 11924 32435 1821 1638
NM_020918chr1063519 3286 2628 2318 1051 186 13114 23417 993 23647 343
NM_020921chr1463426 3248 873 749 332 108 11470 ----
NM_020927chr1672154 2052 782 631 503 369 298 11969 --12378
NM_020935chr234010 3118 785 21701 1366 31687 1404 299 23761 3677
NM_020940chr1072727 2708 2686 2665 503 246 219 182 ----
NM_020948chr183565 3407 3393 2880 2779 2315 1327 903 32989 1126 351 22599 1195 1732
NM_020951chr1972280 2171 821 779 554 417 393 ------
NM_020975chr1051726 1618 1256 672 32 21446 735 --1432
NM_020987chr102377 268 31420 1090 320 2918 565 21335 897
NM_021007chr252164 2077 761 732 116 62458 2023 1687 927 603 396 21943 844 1587
NM_021032chr371733 1471 1433 384 269 219 114 1701 --11520
NM_021033chr1333389 723 319 1705 32725 1403 1125 22868 2834
NM_021061chr883678 3154 3028 2831 2754 1496 235 54 44400 4255 126 34 1621 --
NM_021072chr552265 2225 1618 935 41 22054 832 ----
NM_021083chrX43013 2581 1269 83 63249 2683 2314 1381 1317 879 166 --
NM_021097chr242739 1192 1084 1005 1617 22970 2292 151
NM_021116chr7178812 8770 8359 8195 8130 7912 6963 6782 6628 3475 3138 2979 2870 2731 571 542 60 --18124 16365
NM_021132chr1021274 303 11104 --1514
NM_021148chr721531 304 22446 1908 --1623
NM_021163chr7123637 3569 2778 2340 1462 1335 1153 995 978 823 705 148 33551 3162 2414 1298 13320
NM_021167chr732754 2191 2172 31073 167 125 --32508 751 446
NM_021204chr41162 ----1194
NM_021205chr12954 423 21106 532 42769 1029 960 702 12151
NM_021229chr1241149 1036 828 22 144 150 21138 929
NM_021252chr1052026 1489 1296 821 103 2520 219 1313 --
NM_021255chr1474085 3269 3165 2515 1107 929 673 12739 12608 13734
NM_021629chr375044 4730 4395 4269 4003 1341 676 31134 410 124 11841 23314 365
NM_021639chr13871 704 113 1731 --164
NM_021647chr444442 4293 3676 3401 11855 24212 3730 11350
NM_021813chr675343 5225 4596 4387 2090 1517 336 --35539 5151 4536 --
NM_021911chr5155534 5427 5389 5173 4580 4304 4266 4256 4205 2244 2026 1585 1030 821 215 14835 44107 1326 1018 741 1955
NM_021912chr15114189 3998 3412 3134 1537 1442 1346 811 384 209 125 --32600 98 90 --
NM_021954chr1333330 2749 1379 33620 3075 2934 12913 23026 732
NM_021961chr1195444 5319 2350 2176 1974 1639 719 442 107 25142 2301 34844 1222 392 2485 423
NM_021964chr396517 5125 2345 2004 1737 1216 842 684 295 24082 2012 26108 4365 25350 855
NM_021977chr653701 3208 1360 781 210 33276 3138 712 23433 2421 --
NM_021998chrX41511 1252 1184 346 --1322 --
NM_021999chr133783 767 637 ----1727
NM_022048chr1595888 5869 5427 4987 4885 4855 4715 2220 2198 55147 4799 2521 385 305 46099 2181 2024 620 12530
NM_022123chr141416 ----1576
NM_022143chr72415 247 11258 147 1494
NM_022166chr1675279 4505 4271 1980 960 938 776 25889 1683 21807 833 21194 1051
NM_022334chr27786 730 450 394 338 282 171 1266 1960 11120
NM_022351chr863862 3799 2819 2398 1107 298 2919 900 11555 --
NM_022361chr62549 179 ----177
NM_022405chr353385 2639 2324 1310 1134 43290 1402 956 629 12342 1892
NM_022456chr12167441 7340 7172 7057 6922 6133 5627 5615 2498 2435 2361 1622 1440 1107 516 362 57368 2840 2462 2030 2017 37604 7246 2620 15262
NM_022459chr13105633 5552 5522 4805 4666 4476 4437 1999 1363 793 35068 4521 296 11168 24427 917
NM_022465chr1212723 22509 2434 --12797
NM_022469chr162337 2242 1074 662 549 158 12502 22199 786 --
NM_022473chr1574452 3682 3647 2849 1167 585 65 ----11404
NM_022497chr363270 3006 2747 2456 1224 401 21089 1080 23402 3304 13099
NM_022552chr22922 146 --134 21299 62
NM_022716chr172931 2843 2626 814 609 530 105 11148 21127 877 11038
NM_022719chr2293805 3644 3144 2974 2643 1363 296 165 37 11007 13358 --
NM_022726chr641768 1521 1309 676 1359 --11256
NM_022763chr372967 2576 2475 2278 1162 1036 467 12749 12628 --
NM_022766chr2262590 2389 1895 1711 791 23 --12706 --
NM_022841chr1552607 2052 1704 1102 786 32470 2238 332 --21059 738
NM_022845chr1641650 1569 1452 147 ----1776
NM_022898chr1474405 4090 3346 1820 795 753 194 13288 43278 2945 1933 1080 2998 946
NM_022901chr971624 1569 561 523 337 324 79 1135 ----
NM_022912chr282574 2539 2086 769 741 655 454 179 22587 94 --22483 1089
NM_022918chr1151967 1770 849 407 270 1767 22077 67 --
NM_022977chrX32544 1954 635 ----1518
NM_023016chr221107 975 12333 --21801 750
NM_023923chr153321 2995 631 556 347 ----32368 1043 853
NM_023929chr821734 704 ----11073
NM_024007chr542835 1093 341 68 42825 2236 896 428 22575 2076 --
NM_024052chr1743031 2787 843 129 52886 978 797 523 151 --11018
NM_024090chr451560 485 420 411 71 --21678 1670 1123
NM_024332chrX41680 1485 1280 1257 1494 21814 1167 1397
NM_024345chr9145496 5489 5414 5271 5136 4060 2433 1604 1507 1181 1164 1157 924 550 24868 818 36125 5874 3778 11667
NM_024408chr173410 3364 2343 644 616 244 29 33459 3229 1160 ----
NM_024416chr941590 1418 1240 1222 21551 231 --11171
NM_024513chr353121 2862 2840 847 499 23345 2470 23313 66 --
NM_024524chr352582 1976 1131 634 205 1960 ----
NM_024596chr8154785 4656 4622 4591 4413 3976 2087 1996 1939 1614 1529 1494 280 104 35 105094 4680 4664 3535 1835 1474 1325 907 526 44 34428 4157 4106 24613 1050
NM_024607chr863165 3020 753 688 185 38 --34427 4101 3548 21708 1075
NM_024613chr831620 1469 639 2693 350 11587 11720
NM_024628chr341134 1120 861 215 ----1906
NM_024645chr851530 1518 442 124 23 1463 --11313
NM_024646chr1103907 3530 3386 3307 2796 2592 958 726 363 302 43590 3117 985 112 --12859
NM_024657chrX1457 ----1482
NM_024665chr364343 4229 3529 3357 1569 871 21803 443 34243 2995 1153 --
NM_024721chr8102597 2374 2174 2111 1650 1039 675 537 431 251 12155 22203 571 --
NM_024744chr242708 2401 1954 629 22429 339 32249 549 289 12004
NM_024749chr131783 646 550 21580 810 32199 2066 831 --
NM_024770chr2145943 5515 4999 4803 4564 4172 2403 2308 2242 1287 1246 631 386 25 22526 1778 26568 2474 22038 770
NM_024817chr15135884 5771 5463 5078 4534 4318 4238 4031 3946 1292 1127 1106 588 13790 44985 3909 3641 542 1179
NM_024828chr931326 1258 397 11528 11053 --
NM_024884chr1424146 3181 63616 3038 1434 1312 663 167 23656 447 33727 1506 672
NM_024913chr741280 673 580 152 --21449 1418 11581
NM_024921chrX91967 1929 1726 1557 1387 1257 750 447 288 11881 12003 --
NM_024939chr1651603 1563 1130 1109 612 21542 1075 21635 1176 11092
NM_024941chr52388 312 31437 1094 42 --21315 456
NM_024947chr3149626 8634 7997 7729 7205 6918 6704 5938 3619 3499 3009 1714 1160 1049 27106 49 22108 1586 47698 2499 2219 1774
NM_024949chr444331 3188 3069 1649 14665 51632 1263 752 661 243 21995 687
NM_024953chr1252552 2537 830 345 162 41726 517 426 112 1536 --
NM_024989chr2107219 6467 6254 6154 5452 5273 2839 2069 1340 651 48030 2603 500 393 37603 1777 68 --
NM_025054chr854166 3245 1251 478 353 11686 23389 3330 --
NM_025073chr1104738 4679 4340 3813 1852 1596 1266 856 449 411 1459 13744 1779
NM_025134chr1642300 2153 1876 913 21639 746 1214 1321
NM_025152chr1422043 1757 2336 163 --11504
NM_025160chr184178 4094 3084 1625 1428 1071 776 665 34159 3764 2657 11208 1849
NM_025179chr184936 4768 4326 4081 4020 1007 716 622 33103 3018 646 ----
NM_025184chrX3714 290 124 ----1351
NM_025191chr193433 3232 3078 2813 2631 2386 1221 953 670 22598 477 ----
NM_025208chr1132274 1857 246 2844 782 1122 2448 258
NM_025235chr1051713 904 384 366 344 1487 21742 1560 --
NM_025238chr15141 21558 72 161 11229
NM_030579chr1643723 3697 3042 2476 33332 2551 2420 22737 691 --
NM_030621chr1473929 3429 3044 2891 1705 1085 214 3892 649 262 11114 13492
NM_030623chr241675 1313 318 198 ----1507
NM_030627chr554024 2985 2893 2505 646 12646 13223 --
NM_030647chr784992 4371 4331 3964 3844 1996 1531 1521 35140 2193 1458 24603 4209 --
NM_030648chr4105622 4824 4451 4054 4026 3836 3821 1078 943 239 14165 ----
NM_030650chr263452 2682 2619 1361 943 221 ----14135
NM_030664chr1062319 1943 1791 734 683 522 21850 715 12177 --
NM_030674chr12185759 5486 5364 5254 4817 4342 4072 3593 2245 2169 2094 1637 1621 1403 1098 980 334 236 15767 15276 --
NM_030751chr1061728 1445 1410 524 314 80 1511 --3192 149 142
NM_030751chr1061728 1445 1410 524 314 80 1511 --3192 149 142
NM_030755chr1462715 2663 2326 1981 422 168 ----22793 153
NM_030762chr1251840 1731 1311 525 140 --11887 --
NM_030763chrX3319 154 96 ----1684
NM_030773chr2051803 1646 1494 590 137 1642 --11511
NM_030777chr2042234 1819 1565 83 ----12410
NM_030780chr831752 266 231 170 21275 249 --
NM_030799chr521602 456 31563 519 44 1337 2702 388
NM_030806chr1119048 7532 7006 6967 6610 6328 5684 3535 2586 1289 1122 45908 2463 2399 1435 39057 3036 1785 28815 3134
NM_030809chr1242404 1852 1645 338 42071 1760 534 516 11726 --
NM_030816chr133695 2955 1443 22488 484 13656 33464 2265 1075
NM_030885chr341617 1458 448 279 --22037 238 1848
NM_030918chr134462 3469 2187 13477 25347 1218 13540
NM_030938chr173933 375 301 1325 11041 --
NM_030945chr582672 2605 2025 1832 1743 1016 698 555 3527 306 190 12164 --
NM_031243chr752340 1947 780 428 127 22094 852 --12262
NM_031268chr1631487 1331 102 24731 3971 2202 177 14909
NM_031314chr1431933 808 349 1747 31746 1466 480 11991
NM_031427chr1465882 5457 4827 3928 2000 225 24990 1353 21513 1091 11650
NM_031438chr551617 1598 1291 332 158 1276 --1106
NM_031442chrX42698 2569 2460 191 12661 22745 2485 1983
NM_031468chr7157510 7332 7042 5979 5869 5426 5227 3254 3151 3093 2694 1773 1161 375 78 25900 476 26711 2854 37364 6328 2618
NM_031483chr2053492 687 580 383 233 --23124 2491 --
NM_031844chr1103887 3790 3562 3281 3219 3106 2927 1462 1224 362 52548 1535 854 98 50 33880 3312 3113 12786
NM_031845chr273551 2545 2481 2383 2356 1396 1024 23460 101 11437 --
NM_031847chr273551 2545 2481 2383 2356 1396 1024 23460 101 11437 --
NM_031908chr54906 322 315 307 --21030 845 11240
NM_031911chr492681 2624 2584 2179 1992 1014 692 368 234 12465 --21809 156
NM_031942chr22903 369 3493 348 166 --21209 435
NM_031954chr1262904 2541 2406 1097 883 521 22936 2861 11065 --
NM_032041chr82917 820 21677 957 2964 672 11971
NM_032047chr342278 1904 1527 726 ----11495
NM_032116chr1355674 5440 3811 3647 1297 34878 4288 4065 35564 5476 1623 24987 1075
NM_032144chr221779 1520 259 24 1587 1566
NM_032145chr661680 583 542 503 489 244 11622 1622 --
NM_032153chr352114 833 254 216 90 ----12512
NM_032160chr1874318 3549 3175 1239 1145 474 137 22826 426 34057 3428 910 14365
NM_032189chr13155104 4863 4797 4326 3636 3569 3491 3356 3311 3119 3094 1798 1745 1551 852 --24848 3425 --
NM_032199chr1083335 2860 2777 1115 903 846 792 187 33272 1043 427 1226 11453
NM_032208chr262928 1393 1072 1034 969 927 22686 2615 11118 33058 1195 584
NM_032217chr461284 1208 955 401 261 54 11431 11240 11057
NM_032228chr1132879 1427 1130 43524 2505 171 56 12259 --
NM_032268chr1652735 2145 1048 699 418 1308 12885 1907
NM_032281chr1931240 963 850 --72480 2059 1975 1064 977 956 790 32788 2018 673
NM_032288chr36949 859 671 576 386 103 11649 --1476
NM_032289chr52666 61 11670 1636 11941
NM_032312chr2--2864 807 --1248
NM_032321chr273315 2843 2698 2605 737 709 86 --21018 502 --
NM_032373chr10165829 5432 4884 4704 4153 3580 2342 2054 2006 1901 1774 1433 970 640 588 97 34264 2072 1062 35572 2258 1581 34562 4017 1198
NM_032410chr82346 25 ----2490 62
NM_032439chr1071469 1364 1308 1145 537 327 289 1644 11669 --
NM_032440chr1042179 567 256 31 22247 234 12468 2854 455
NM_032445chr1552566 2372 2335 2222 958 22613 2138 2650 475 --
NM_032446chr552668 1478 1339 824 640 23411 412 1691 --
NM_032457chr483800 2861 2786 1301 730 357 90 70 21470 943 23382 2937 23088 2529
NM_032499chr1561692 1212 516 493 451 215 --11406 11618
NM_032505chr362765 2572 2414 2378 2102 1035 2849 234 1438 165
NM_032509chr882598 2456 1848 1814 1655 540 447 116 --22073 496 --
NM_032521chr2053228 2660 2469 2110 2059 ----12940
NM_032560chr14----1112 2893 68
NM_032581chr731747 465 47 --11689 1530
NM_032632chr1452042 1760 1640 1335 23 --2696 336 --
NM_032727chr1071648 1134 1063 468 403 289 207 --11668 --
NM_032778chr3103356 3346 2716 2657 2379 2077 2030 517 503 265 --1476 --
NM_032796chrX2560 278 1272 --1716
NM_032804chr1072552 2425 2381 2068 1761 592 54 11932 11615 21716 325
NM_032828chr1984898 4822 4378 3930 3689 3515 1255 54 34977 1960 583 --24677 3752
NM_032859chr1353708 3586 3409 2692 656 53662 3209 2865 2440 1040 2684 309 11210
NM_032873chr11104142 4100 4035 3839 3667 2851 1835 1338 1045 223 11484 14283 --
NM_032968chrX53941 3354 3276 2771 61 --22779 1652 33395 1273 716
NM_032969chrX53941 3354 3276 2771 61 --22779 1652 33395 1273 716
NM_032973chrY63933 3349 3271 2766 538 61 --22774 1646 33390 1273 716
NM_032975chr1893289 3278 2850 2750 1049 875 613 385 355 --1105 --
NM_032980chr1893289 3278 2850 2750 1049 875 613 385 355 --1105 --
NM_033014chr941590 1418 1240 1222 21551 231 --11171
NM_033020chr164380 4364 4146 4137 3054 147 --11735 24450 65
NM_033081chr2041168 1074 1042 495 1518 21344 486 --
NM_033121chr1251411 1251 1153 53 28 11691 21477 644 --
NM_033135chr1132274 1857 246 2844 782 1122 2448 258
NM_033136chr531849 1773 292 ----11484
NM_033137chr531849 1773 292 ----11484
NM_033143chr464516 3600 3166 2981 822 422 21677 1651 21643 562 --
NM_033181chr673771 3460 3240 2927 2569 1133 279 13215 --11329
NM_033211chr522044 207 11310 1701 1131
NM_033222chr93903 485 395 11076 1991 --
NM_033224chr777984 6425 1955 1789 863 857 138 76575 1119 1067 1047 841 556 417 26535 3033 21880 1827
NM_033255chr131438 1449 1478 --
NM_033281chr53904 303 186 1812 --1596
NM_033285chr854260 3482 1202 928 176 11614 24354 2718 13607
NM_033290chrX53367 2524 1065 984 253 33450 2723 360 12764 --
NM_033300chr151428 1394 448 296 162 --1588 --
NM_033331chr962987 2322 1316 1092 1044 67 32952 1371 890 1798 23584 435
NM_033360chr12134238 3769 3710 3266 3165 3137 2833 1810 1780 1489 1261 659 127 14041 43285 571 503 55 --
NM_033364chr341889 1877 91 44 --11298 21680 1490
NM_033389chr1754846 1864 1676 1189 1174 13471 54050 1856 1282 788 731 --
NM_033394chr231606 1428 184 1325 --1476
NM_033425chr1143518 1036 434 241 53244 2645 2611 2563 2190 --11293
NM_033427chr74839 801 775 730 1694 170 148
NM_033428chr981940 1596 1422 1288 817 313 193 57 1805 31710 1517 362 1666
NM_033429chr15103282 2772 2481 2075 1179 1152 1035 631 575 99 --52673 2597 1312 637 350 --
NM_033430chr483635 3243 3142 3005 2868 1617 1604 135 42657 1423 927 678 --13190
NM_033437chr483635 3243 3142 3005 2868 1617 1604 135 42657 1423 927 678 --13190
NM_033480chr652909 819 744 522 357 2932 56 12049 --
NM_033481chr652909 819 744 522 357 2932 56 12049 --
NM_033505chr276524 5655 5371 4861 4850 4537 21 --11607 35137 1853 1127
NM_033551chr532706 2340 2260 52965 2224 847 799 428 --13475
NM_033632chr4------21182 228
NM_033656chr2155512 5273 4740 2002 438 14680 11206 --
NM_052811chr1365283 4470 4277 3569 1430 154 34326 1720 1472 13274 1862
NM_052832chr861965 1196 1111 504 448 73 22466 525 --32272 2224 417
NM_052867chr1341489 1137 1045 513 41358 346 149 116 --1579
NM_052885chr12114754 4359 3543 3485 3385 3194 3109 1175 492 181 155 34232 1488 1472 --24917 3127
NM_052886chr861956 1780 1772 1407 731 549 2303 281 1287 --
NM_052900chr851547 1202 570 448 152 ----148
NM_052903chr151511 ----2493 251
NM_052904chr661243 1039 887 490 347 316 --11054 --
NM_052905chr251776 1704 1596 1448 537 ----1101
NM_052907chr12103818 3711 3276 2846 2803 1148 977 957 860 290 14272 11264 11024
NM_052917chr24820 744 196 124 52289 2265 2218 2208 503 --1641
NM_052918chr1053722 3604 2960 1152 725 1172 33014 614 323 1250
NM_052937chr83703 564 528 11054 1146 22651 867
NM_053016chr9116976 6912 6546 5578 5287 4855 2886 1316 1052 816 550 55295 5259 4979 1798 1519 37525 2095 1848 23118 2441
NM_053023chr1112120 12144 --12293
NM_054016chr131630 1540 80 ----2613 394
NM_054016chr131630 1540 80 ----2613 394
NM_054016chr131630 1540 80 ----2613 394
NM_054027chr541380 473 384 274 2795 259 --12135
NM_057159chr931467 1121 1026 31423 1115 160 --11252
NM_057180chr121144 182 --1422
NM_058172chr431841 1498 1194 51596 1225 741 524 366 21734 339 --
NM_058240chr1431493 570 213 11508 51546 1480 1472 1137 231 --
NM_058241chr251987 1878 1835 1555 1536 ------
NM_058241chr251987 1878 1835 1555 1536 ------
NM_080546chr972327 1995 1978 1744 1502 558 56 --2898 141 --
NM_080617chr202696 165 11077 --1156
NM_080618chr2041353 1170 1152 91 1531 2515 207 1854
NM_080666chr1421053 510 31567 1312 1158 11407 1656
NM_080676chr2062748 1173 961 569 371 358 22739 922 23292 2510 12427
NM_080743chr652292 2285 1980 1757 191 1495 1343 --
NM_080759chr1342303 1860 1757 1662 42535 2524 1718 152 1831 1823
NM_080760chr1342303 1860 1757 1662 42535 2524 1718 152 1831 1823
NM_080764chr2213162 32081 809 59 172 1230
NM_080832chrX51628 1560 1388 169 93 11518 31754 1658 1444 --
NM_080867chr1464945 4164 3523 1491 972 90 34995 1725 1630 54008 3425 3393 781 162 14258
NM_080872chr8113919 3277 3079 3055 2659 1500 1319 833 769 619 595 54079 3233 3212 2947 1044 12816 --
NM_080927chr372874 2532 1117 1037 299 94 22 12561 --11130
NM_130385chr11103172 3064 2587 2421 1137 933 780 704 688 167 12669 --1861
NM_130391chr983597 3457 3363 3122 2771 1177 868 612 1371 13581 2955 137
NM_130392chr983597 3457 3363 3122 2771 1177 868 612 1371 13581 2955 137
NM_130393chr983597 3457 3363 3122 2771 1177 868 612 1371 13581 2955 137
NM_130436chr2172459 2196 1763 1025 555 377 367 32399 2106 1057 22495 932 --
NM_130438chr2163036 2773 2340 1132 954 944 22976 2683 13072 --
NM_130439chr10----22067 58 12343
NM_130439chr10----22067 58 12343
NM_130809chr583146 2688 2542 1256 1159 641 452 259 --33034 2514 243 12812
NM_130847chr1145852 4211 3707 1449 25377 5229 25032 3960 1162
NM_130848chr571453 807 586 292 272 37 26 1383 154 --
NM_133170chr20108089 7671 7095 6253 5195 3194 2182 1594 1364 268 36553 2068 552 47368 6602 5561 2933 12986
NM_133264chr1752671 1356 1263 1187 868 12975 --13890
NM_133330chr423074 884 --23038 116 12554
NM_133331chr423074 884 --23038 116 12554
NM_133334chr455981 4808 3931 499 131 45515 5333 1344 813 15289 14970
NM_133335chr423074 884 --23038 116 12554
NM_133370chr473468 3124 2422 1417 1121 960 278 11038 1970 2843 38
NM_133372chr542795 610 338 62 1284 22434 845 --
NM_133445chr963189 2488 1420 1186 549 442 --12853 1409
NM_133473chr1961820 1754 432 401 348 102 2485 338 2729 675 1165
NM_133477chr432977 2391 197 23232 2269 1720 12035
NM_133493chr664484 4457 3330 1800 1699 863 14083 ----
NM_133496chr144254 3707 1562 1463 31135 1033 448 11061 23598 1241
NM_133507chr125897 752 723 312 51 ------
NM_133646chr295499 4886 4493 3576 2242 1883 1602 265 30 33435 711 77 1971 44967 3913 2156 48
NM_133647chr1552566 1196 846 828 693 ----23050 1485
NM_134442chr231481 1158 425 21227 114 --11638
NM_138270chrX42774 807 402 286 33080 340 329 --1578
NM_138335chr42783 644 ----1879
NM_138423chr1551974 1554 1423 469 301 22017 1857 11613 1824
NM_138426chr732072 439 121 --22459 900 --
NM_138444chr1384414 3902 3250 3164 1935 507 348 180 23039 1337 24633 4468 14747
NM_138458chr23780 737 363 ----1938
NM_138459chr6171 1830 13401 1134
NM_138468chr296267 6016 5571 4774 4724 4468 4041 993 565 36378 6296 1946 14145 65060 4611 2312 1483 630 95
NM_138473chr1265142 4676 4001 3512 647 143 11617 11872 13181
NM_138559chr231098 1081 390 11141 --1953
NM_138576chr1474405 4090 3346 1820 795 753 194 13288 43278 2945 1933 1080 2998 946
NM_138633chr661758 1254 1195 400 258 167 --1296 --
NM_138703chrX3418 347 115 --1433 2450 363
NM_138713chr16137331 7196 7049 6747 6535 6319 3196 3077 3057 2641 2026 1663 1236 47109 6719 2358 1551 35085 2747 592 17690
NM_138714chr16137331 7196 7049 6747 6535 6319 3196 3077 3057 2641 2026 1663 1236 47109 6719 2358 1551 35085 2747 592 17690
NM_138720chr6--149 --1238
NM_138731chr1484225 4082 4028 2879 1703 907 639 156 11377 12701 --
NM_138735chr23339 309 59 --21231 1037 4370 358 346 101
NM_138782chr5112266 2018 1790 1722 1513 947 801 561 353 130 38 11634 1432 12397
NM_138971chr1193844 3457 3301 2376 1268 1196 654 610 67 11399 2570 80 --
NM_138971chr1193844 3457 3301 2376 1268 1196 654 610 67 11399 2570 80 --
NM_138972chr1193844 3457 3301 2376 1268 1196 654 610 67 11399 2570 80 --
NM_138972chr1193844 3457 3301 2376 1268 1196 654 610 67 11399 2570 80 --
NM_138973chr1193844 3457 3301 2376 1268 1196 654 610 67 11399 2570 80 --
NM_138973chr1193844 3457 3301 2376 1268 1196 654 610 67 11399 2570 80 --
NM_138980chr44525 296 274 99 --2578 86 --
NM_138982chr44525 296 274 99 --2578 86 --
NM_139076chr471493 1385 1346 1297 1227 931 166 --2250 139 11065
NM_139136chr1221058 731 2835 725 ----
NM_139207chr1251458 833 237 203 54 --12093 --
NM_139279chr262897 2808 2776 2447 2418 550 23387 465 133 1698
NM_139283chr1252534 2233 2198 1937 600 --1391 22380 1899
NM_139312chr1021228 47 --1464 1935
NM_139321chr2053631 3125 850 783 150 13886 34237 4192 770 --
NM_139323chr202574 392 11615 1196 12030
NM_144571chr456754 5043 2329 1596 528 35485 4723 209 15167 --
NM_144578chr1465094 4922 3929 3701 2144 182 1881 --11025
NM_144590chr10102840 2788 2068 1859 1004 901 816 775 639 360 1716 11088 22975 2254
NM_144599chr1574765 4341 1458 1433 1026 1003 771 24921 4101 1889 11805
NM_144618chr121466 1268 1319 --31513 1331 1197
NM_144632chr252358 1907 1836 286 87 1962 32044 653 447 --
NM_144664chr1122292 296 11996 --21721 414
NM_144710chr251510 1153 277 173 38 2349 23 ----
NM_144721chr4102554 2370 2050 1906 1093 768 432 426 275 45 ----2880 873
NM_144775chr1764540 4402 3981 1820 756 613 34762 3905 1422 23574 994 --
NM_144778chr1352288 2238 2107 601 102 --1261 --
NM_144963chr842715 2659 2578 2374 --1353 --
NM_144969chrX1688 --1739 1482
NM_144973chr12125358 5234 4647 4250 3812 3472 3253 1694 1549 542 493 419 1611 1680 11757
NM_145011chr1071978 1838 698 611 421 382 301 11403 11864 21495 64
NM_145055chr1873825 3147 3009 2781 2623 603 195 ------
NM_145176chr6123054 2898 2833 2692 2666 2441 1253 1083 995 955 471 286 12473 1387 53533 3349 3004 1237 453
NM_145251chr1451430 1055 464 89 55 ------
NM_145259chr266473 6190 5757 4997 1026 703 66939 2710 2596 882 654 271 31947 1281 993 16214
NM_145263chr462209 1915 1778 1500 700 283 1229 22166 137 --
NM_145284chrX42421 2271 843 567 22569 884 21822 869 148
NM_145305chrX4534 464 413 51 ----11315
NM_145307chr1074663 4224 4129 3311 3301 662 433 11342 ----
NM_145320chr733249 915 64 --12863 12487
NM_145321chr733249 915 64 --12863 12487
NM_145322chr733249 915 64 --12863 12487
NM_145332chr61326 ----144
NM_145333chr61326 ----144
NM_145341chr102708 69 1591 1367 31802 1773 1559
NM_145649chr661960 1918 1724 1699 1087 491 --21875 324 --
NM_145655chr661960 1918 1724 1699 1087 491 --21875 324 --
NM_145686chr263343 3032 2955 1087 580 406 33138 2898 1102 23279 1299 32925 2471 1233
NM_145687chr263343 3032 2955 1087 580 406 33138 2898 1102 23279 1299 32925 2471 1233
NM_145698chr1062054 1650 882 658 637 335 177 2245 169 --
NM_145728chr1552329 969 770 447 302 22501 233 --12292
NM_145735chr1392612 2561 2424 2313 2055 1860 888 571 360 12598 ----
NM_145808chr732515 1947 360 --22882 1168 --
NM_145810chr22903 369 3493 348 166 --21209 435
NM_147150chr963457 2870 1518 1231 644 145 43273 2573 608 500 23248 1184 11066
NM_147156chr1041497 1364 297 253 172 --1525
NM_147166chr7--2817 652 --1787
NM_147175chrX52152 1646 1591 1564 686 --1442 2464 325
NM_148955chr1561923 1810 1773 1635 1059 510 24561 2338 41556 1385 1079 286 15217
NM_152261chr1262423 2209 1701 1670 1650 395 1606 --11731
NM_152280chr143125 2373 1036 135 21402 122 1628 --
NM_152284chr81626 ----2938 306
NM_152330chr1431698 1661 584 21842 759 12550 2408 182
NM_152388chr263544 3489 3315 2917 2594 2556 23529 1218 1365 13572
NM_152400chr421688 1379 11819 11802 11742
NM_152409chr533334 700 83 23090 480 22191 1330 --
NM_152424chrX31864 1001 457 24625 3175 1416 23584 1215
NM_152470chr1843361 2988 1244 1059 --11559 24024 3755
NM_152475chr1942671 2595 2156 54 32747 2459 320 ----
NM_152484chr1971280 1270 1061 404 357 280 126 1454 11071 1902
NM_152519chr251766 1570 747 571 238 12232 2432 350 1704
NM_152529chr254464 2784 2689 1672 744 13338 12804 23183 475
NM_152556chr732191 1664 402 42217 991 785 105 ----
NM_152613chr2241259 896 825 280 2947 460 ----
NM_152622chr593171 3017 2637 2420 916 650 548 378 177 1618 13440 1727
NM_152624chr5116124 6009 5678 5368 4977 4952 4775 4577 1089 1074 159 37363 5912 1337 --1431
NM_152629chr9124092 3847 3620 3502 3009 2810 2804 2730 1610 1398 458 75 13021 23511 3462 12781
NM_152636chr1132611 1092 965 42488 1132 409 333 --33079 2900 390
NM_152666chr11140 1597 3676 257 51 --
NM_152682chr441798 1766 190 107 ----11126
NM_152695chrX41712 1500 599 222 --3501 292 31 --
NM_152724chr1042635 2038 454 301 12614 --32313 2082 1106
NM_152745chr721106 211 --1260 11166
NM_152754chr7113036 2980 2562 2429 2360 916 863 788 666 206 85 23091 117 53344 1463 1235 1040 465 --
NM_152756chr593765 3176 2963 1518 1510 1411 1085 634 364 43934 3874 3693 1726 ----
NM_152774chr762688 2165 1946 1894 1686 606 32590 890 546 1297 12111
NM_152787chrX73887 3622 2413 1232 1015 819 746 1155 1587 1271
NM_152793chr7144789 4571 4461 4261 4150 4128 4021 3619 3533 3494 1789 1679 515 503 55045 3138 1410 1143 157 11063 44900 4603 4308 1969
NM_152826chr1561923 1810 1773 1635 1059 510 24561 2338 41556 1385 1079 286 15217
NM_152838chr2053440 2911 2878 2826 2813 33169 1416 731 2277 222 --
NM_152879chr242594 1957 213 205 ----12241
NM_152903chr1341874 476 314 178 22069 455 12380 1651
NM_152919chr1963488 3397 3207 3081 321 265 1837 --23567 2487
NM_152924chr15136865 6203 6097 6052 5152 2590 2573 2360 1942 1411 705 543 458 --34822 4513 2262 15243
NM_152999chr743635 1711 245 168 34197 1590 518 2835 578 --
NM_153018chr1732381 2230 441 23287 374 23005 2552 --
NM_153182chr3103356 3346 2716 2657 2379 2077 2030 517 503 265 --1476 --
NM_153184chr361986 1367 1235 758 428 404 11903 11957 1534
NM_153188chr5125661 5331 5077 4730 4315 4280 3772 1528 1312 1164 435 405 25266 308 31330 650 537 14573
NM_153207chr1243098 2565 1274 403 24041 2819 23084 1619 12698
NM_153262chr152649 2615 2443 890 368 --22449 166 --
NM_153343chr462319 2242 2231 1492 373 103 42391 1936 1514 681 1184 21521 157
NM_153346chrX62053 1941 1756 1647 663 152 11369 --1816
NM_153365chr462738 2105 1794 839 482 430 32552 897 752 12466 12270
NM_153371chr133953 526 115 --11489 12095
NM_153456chr1396317 5443 2171 1792 1620 1610 888 546 341 42234 1847 987 627 24829 2439 45693 5216 3993 1048
NM_153487chr684708 4651 4419 3501 3253 1393 601 253 13852 23748 236 --
NM_153607chr542810 2259 780 191 22118 266 32959 1109 561 1350
NM_153619chr1552692 601 560 142 113 33521 2663 915 13668 --
NM_153686chr462456 2265 1679 1514 601 294 11766 32445 2013 1699 --
NM_153687chr1231168 506 144 11408 31382 128 43 --
NM_153689chr242321 1558 574 43 12387 --12115
NM_153712chr232970 1103 117 11411 33050 2922 243 33519 3092 2428
NM_153748chr1221058 731 2835 725 ----
NM_153759chr22922 146 --134 21299 62
NM_153810chr103993 846 109 44223 3520 1955 1184 35024 3435 3180 --
NM_170606chr731886 1561 1222 1228 11863 11296
NM_170674chr153889 256 26 11440 1492 21084 362
NM_170675chr15--11116 1168 2760 38
NM_170676chr15--11116 1168 2760 38
NM_170677chr153889 256 26 11440 1492 21084 362
NM_170706chr164219 3930 2997 833 458 26 11122 1929 --
NM_170710chr442987 840 799 294 42696 2483 688 301 23103 2280 1979
NM_170724chr611030 11132 1706 1207
NM_170731chr1162926 2838 2392 372 202 65 ----1275
NM_170732chr1162926 2838 2392 372 202 65 ----1275
NM_170733chr1162926 2838 2392 372 202 65 ----1275
NM_170734chr1162926 2838 2392 372 202 65 ----1275
NM_170735chr1162926 2838 2392 372 202 65 ----1275
NM_171998chrX42187 911 838 612 11899 3550 390 378 11982
NM_172069chr21883 12385 1187 1194
NM_172070chr24613 275 263 247 12215 ----
NM_172071chr165756 5590 5560 5252 457 140 26004 5547 14566 --
NM_172159chr342155 1949 930 367 11469 --11510
NM_172160chr342155 1949 930 367 11469 --11510
NM_172217chr1573261 2941 2796 1188 269 47 36 22443 321 41410 1399 730 218 --
NM_172315chr153889 256 26 11440 1492 21084 362
NM_172316chr153889 256 26 11440 1492 21084 362
NM_173083chr151293 861 820 275 246 11118 ----
NM_173172chr251353 1151 569 215 52 ----1979
NM_173198chr982720 2387 2326 2285 2207 1830 601 560 12755 ----
NM_173200chr982720 2387 2326 2285 2207 1830 601 560 12755 ----
NM_173214chr16137331 7196 7049 6747 6535 6319 3196 3077 3057 2641 2026 1663 1236 47109 6719 2358 1551 35085 2747 592 17690
NM_173463chr474375 4361 4237 3441 3339 3230 3162 31222 462 273 ----
NM_173468chr475866 5760 5324 4806 4281 1659 1378 34341 3877 1946 25195 4518 24900 590
NM_173473chr101289 22377 2182 1868 21884 643
NM_173531chr1982837 1524 1454 593 484 404 163 132 12689 1216 33794 2705 50
NM_173536chr484464 4393 4163 4026 3877 3789 1676 626 44180 4153 3628 3353 44497 4312 1366 486 34538 3809 3200
NM_173545chr281876 1856 1727 1469 1408 770 465 140 31950 1597 317 --21669 1458
NM_173576chr1051636 1515 830 709 571 2604 228 1780 11755
NM_173582chr1144975 4427 4199 505 46216 4473 1221 430 --35222 1362 654
NM_173602chr12103501 3111 2843 2753 2720 704 577 565 370 45 1150 1885 11185
NM_173607chr1442146 1883 652 90 --11321 154
NM_173631chr191963 21116 1081 --21357 536
NM_173642chr1137238 7047 6789 5718 3662 2801 1931 1904 1744 1207 651 450 178 37733 7712 98 26003 5917 18361
NM_173683chr83684 611 277 21803 146 41195 617 441 213 21464 97
NM_173694chrX3503 359 126 196 --11775
NM_173808chr1104171 3418 3031 1790 1672 1617 1023 623 431 386 34466 4372 341 14259 --
NM_173812chr1251548 1424 237 88 31 11442 --11321
NM_173825chr372926 2857 2762 2285 2241 785 527 22892 2320 23055 631 13046
NM_173829chr5104677 4628 4330 4066 2088 1949 1850 1021 973 788 65608 5528 5289 4943 4922 4270 46181 6051 4094 433 23985 832
NM_174916chr1542013 677 555 30 --12326 --
NM_175056chr311976 22109 1576 --11596
NM_175061chr741734 1367 539 468 31893 1430 696 ----
NM_175607chr321414 371 ----11308
NM_175612chr321414 371 ----11308
NM_175623chr12167441 7340 7172 7057 6922 6133 5627 5615 2498 2435 2361 1622 1440 1107 516 362 57368 2840 2462 2030 2017 37604 7246 2620 15262
NM_175624chr12167536 7435 7267 7152 7017 6228 5722 5710 2593 2530 2456 1717 1535 1202 611 457 57463 2935 2557 2125 2112 37699 7341 2715 15357
NM_175625chr12167536 7435 7267 7152 7017 6228 5722 5710 2593 2530 2456 1717 1535 1202 611 457 57463 2935 2557 2125 2112 37699 7341 2715 15357
NM_175629chr22922 146 --134 21299 62
NM_175630chr21727 --1924 1198
NM_175736chr1257702 7184 7072 6607 4891 36188 6071 2028 57221 1596 1531 1054 842 --
NM_175767chr561652 1221 459 333 105 71 41182 85 63 43 21883 717 1655
NM_175861chr12105906 5552 5526 4982 4295 4226 4191 1574 1278 90 45084 4102 3621 969 21856 1549 1844
NM_175863chr641180 1161 850 291 ----1977
NM_175876chr132600 1861 102 22786 844 --1138
NM_175910chr19192351 2235 1539 954 871 846 793 762 709 625 594 541 510 439 373 289 258 121 90 --1457 1428
NM_175921chr573098 2950 2931 1640 526 285 115 24093 2699 1333 13523
NM_176816chr551966 1603 1537 1500 1239 11983 --31936 1759 669
NM_176824chr421184 992 11375 3342 334 216 --
NM_177438chr1473929 3429 3044 2891 1705 1085 214 3892 649 262 11114 13492
NM_177968chr261679 1665 637 376 288 78 --12022 --
NM_177972chr11114321 4249 3970 3510 3207 3183 1548 910 860 759 702 44366 4001 3292 1113 1877 --
NM_177974chr1551974 1554 1423 469 301 22017 1857 11613 1824
NM_177985chr231966 390 280 11731 2528 380 12195
NM_178011chr1053035 2940 2913 2259 298 --12956 1106
NM_178037chr1253196 3185 3053 2313 467 11218 11240 13528
NM_178038chr1253196 3185 3053 2313 467 11218 11240 13528
NM_178151chrX107600 6635 5978 5591 5396 4966 3098 2737 2111 34 --23069 432 11319
NM_178152chrX107600 6635 5978 5591 5396 4966 3098 2737 2111 34 --23069 432 11319
NM_178153chrX107600 6635 5978 5591 5396 4966 3098 2737 2111 34 --23069 432 11319
NM_178509chr17124027 4015 3570 3196 3136 2973 2588 1559 811 571 378 336 23208 536 24142 3576 12956
NM_178566chr971786 1651 1425 1227 299 179 22 1419 --21762 550
NM_178578chr2042324 2036 1770 634 22674 620 --11944
NM_178584chr251510 1153 277 173 38 2349 23 ----
NM_178585chr453237 2962 2470 2299 977 1205 32489 1268 806 --
NM_178815chr1022158 865 --21796 107 1156
NM_180991chr542870 2654 230 215 1111 32711 2129 255 --
NM_181054chr1461232 1090 803 343 257 86 ------
NM_181077chr1521471 76 2640 319 21937 299 --
NM_181265chr442987 840 799 294 42696 2483 688 301 23103 2280 1979
NM_181332chrX42248 2225 660 432 21870 914 11107 --
NM_181351chr1172097 2032 1999 506 399 77 45 1867 1103 --
NM_181358chr154233 4202 2850 1255 528 23141 3018 ----
NM_181443chr2042676 2506 1933 818 11969 22812 984 --
NM_181481chr18166874 5640 5484 4443 4330 2622 2400 2084 2033 1761 1611 1592 1521 307 210 101 27072 2047 1187 25220 1228
NM_181482chr18166874 5640 5484 4443 4330 2622 2400 2084 2033 1761 1611 1592 1521 307 210 101 27072 2047 1187 25220 1228
NM_181483chr18166874 5640 5484 4443 4330 2622 2400 2084 2033 1761 1611 1592 1521 307 210 101 27072 2047 1187 25220 1228
NM_181504chr5114076 3566 3197 3119 2949 2581 1445 1242 716 551 270 1148 23111 276 --
NM_181523chr5114076 3566 3197 3119 2949 2581 1445 1242 716 551 270 1148 23111 276 --
NM_181524chr5114076 3566 3197 3119 2949 2581 1445 1242 716 551 270 1148 23111 276 --
NM_181645chr114731 596 566 74 --1660 --
NM_181706chr111123 21888 212 --1283
NM_181712chr121781 1320 11348 21946 426 11513
NM_181723chr821911 195 ----22167 167
NM_181787chr863492 3274 1048 818 636 357 23733 287 33602 971 557 23031 2794
NM_181836chr562307 2225 2142 1927 922 610 --12105 1630
NM_181838chr531366 1330 30 11597 11223 11217
NM_181861chr1242084 2070 448 307 22852 126 ----
NM_181868chr1242084 2070 448 307 22852 126 ----
NM_181869chr1242169 2155 533 392 22937 211 ----
NM_181876chr492643 2395 2143 1785 1743 1672 918 248 140 1256 ----
NM_182485chr473411 2858 1106 694 584 439 312 22883 1331 22318 479 --
NM_182515chr19246128 6121 6008 5917 5666 5358 5327 4665 2667 2598 2546 2465 2415 2345 1987 1421 1170 1132 1047 918 784 389 253 104 34276 4127 475 24933 670 14672
NM_182540chrX3870 818 616 1717 --1759
NM_182557chr1112148 --11711 1651
NM_182641chr1741698 1309 651 594 1375 11671 127
NM_182646chr473411 2858 1106 694 584 439 312 22883 1331 22318 479 --
NM_182703chr1551483 1104 933 316 100 1249 ----
NM_182715chr731106 1037 1008 --2446 146 --
NM_182734chr2063265 2384 2277 2077 1061 315 1185 11219 12462
NM_182756chr2--2526 41 --1503
NM_182762chr7115696 5066 5042 5021 2419 2312 1800 1643 1222 629 290 35770 5642 4356 1406 12104
NM_182765chr10122318 2207 1945 1491 662 652 622 561 455 420 385 275 21746 881 11912 1189
NM_182767chr1251991 1868 1765 1543 801 --11778 11641
NM_182797chr205306 272 219 60 37 1228 174 11115
NM_182830chr1462276 2165 1905 1707 713 352 11413 --1205
NM_182896chr331841 1156 45 1154 1419 --
NM_182898chr7126565 6159 5981 5887 5838 5273 5216 5198 1768 1477 1063 483 32481 1913 819 35319 1685 1094 --
NM_182899chr7126565 6159 5981 5887 5838 5273 5216 5198 1768 1477 1063 483 32481 1913 819 35319 1685 1094 --
NM_182936chr1431493 570 213 11508 51546 1480 1472 1137 231 --
NM_182948chr142409 2007 925 213 --1542 --
NM_182972chr172403 1983 1905 1773 763 756 113 ------
NM_183002chr1431493 570 213 11508 51546 1480 1472 1137 231 --
NM_183006chr203602 484 139 2226 204 --148
NM_183227chr61273 31270 1080 437 21304 307 --
NM_183381chr31389 1721 --1261
NM_183383chr31389 1721 --1261
NM_183384chr31389 1721 --1261
NM_194247chr274260 4217 3066 2973 1737 1096 1061 21051 125 11366 --
NM_194282chr432981 2499 917 13039 22541 429 --
NM_194285chr11103427 3309 2393 2293 2246 1336 1160 888 561 244 22486 158 ----
NM_194286chr1246128 4391 1787 1309 21335 256 14965 1758
NM_194291chr872809 2752 2538 2317 2244 953 628 12389 12897 --
NM_194301chr1451162 878 401 326 48 ----1466
NM_194314chr1105023 4904 4291 3768 1905 1501 836 550 374 22 25221 1103 55034 4967 1370 730 471 35314 2217 1961
NM_194434chr1895468 5411 5022 4915 3828 1752 1304 264 167 34647 4568 2235 25781 1606 44311 3512 2107 581
NM_197941chr541931 1182 879 250 23046 2417 12176 12830
NM_198056chr362130 1922 610 584 323 78 1773 2884 571 --
NM_198066chr1453052 2186 860 194 99 41128 898 845 396 --22039 1931
NM_198123chr851547 1202 570 448 152 ----148
NM_198124chr851547 1202 570 448 152 ----148
NM_198150chr531500 1101 168 31534 626 383 1969 1231
NM_198158chr392812 2789 2713 2116 616 256 219 197 29 --12073 --
NM_198159chr392812 2789 2713 2116 616 256 219 197 29 --12073 --
NM_198177chr392812 2789 2713 2116 616 256 219 197 29 --12073 --
NM_198178chr392812 2789 2713 2116 616 256 219 197 29 --12073 --
NM_198181chr152405 61 12837 22875 385 22629 979
NM_198212chr762298 691 483 458 424 314 --1782 126
NM_198215chr1091452 1397 1354 1336 1291 263 193 160 89 1933 11461 --
NM_198225chr1041683 798 589 169 22017 1783 21347 299 --
NM_198268chr154233 4202 2850 1255 528 23141 3018 ----
NM_198269chr154233 4202 2850 1255 528 23141 3018 ----
NM_198270chrX52970 2758 1316 1113 247 32614 2379 2136 21012 880 2554 279
NM_198273chr531009 522 192 12935 13068 --
NM_198281chr433205 2136 359 22513 2503 22117 472 13478
NM_198391chr2031361 1114 218 11530 11093 --
NM_198400chr15112944 2858 2810 2715 2624 2551 2025 1149 843 276 199 1615 12381 --
NM_198465chrX41116 972 721 229 32387 1109 141 --1934
NM_198503chr142186 2129 2007 33 42027 432 72 55 2644 534 2366 240
NM_198513chr81603 2476 289 1304 --
NM_198549chr141311 976 691 79 22894 713 12289 33179 918 721
NM_198581chr227167 5654 1428 22672 2301 22597 1926
NM_198715chr176172 5469 4900 4112 1971 1628 1082 24094 2040 76339 6209 5646 1689 1171 1048 180 16079
NM_198793chr364027 3930 3490 3077 2745 707 13629 11381 --
NM_198834chr1731723 506 284 42216 2081 581 175 11972 11533
NM_198836chr1731723 506 284 42216 2081 581 175 11972 11533
NM_198837chr1731723 506 284 42216 2081 581 175 11972 11533
NM_198838chr1731723 506 284 42216 2081 581 175 11972 11533
NM_198839chr1731723 506 284 42216 2081 581 175 11972 11533
NM_198859chr374959 4783 3581 3530 753 661 219 24453 4273 1588 14442
NM_198889chr461284 1208 955 401 261 54 11431 11240 11057
NM_198896chr1152217 1923 1664 712 167 1209 --12252
NM_198900chr1257702 7184 7072 6607 4891 36188 6071 2028 57221 1596 1531 1054 842 --
NM_198947chr112751 160 1759 1901 11023
NM_198968chr1343995 3888 3874 3210 21481 261 22657 119 --
NM_198990chr753109 2774 1143 883 126 1268 --11275
NM_199000chr751947 1845 1698 1628 657 12047 --11526
NM_199003chr8169 1286 11252 11226
NM_199072chr783073 3037 2571 2434 1307 984 911 802 ----32215 2125 546
NM_199131chr1073129 3087 2847 2636 2617 2520 799 --12506 11212
NM_199132chr1982164 1935 794 558 525 446 224 170 ------
NM_199169chr2083635 3348 3058 2387 1063 905 574 172 23255 369 23237 3049 --
NM_199170chr2083635 3348 3058 2387 1063 905 574 172 23255 369 23237 3049 --
NM_199171chr2083635 3348 3058 2387 1063 905 574 172 23255 369 23237 3049 --
NM_199244chr92874 837 --3713 629 231 1988
NM_199320chr432644 423 347 --1107 32611 2280 2265
NM_199320chr432644 423 347 --1107 32611 2280 2265
NM_199324chr493489 3329 2765 1481 1242 607 486 434 73 ------
NM_199421chr1464945 4164 3523 1491 972 90 34995 1725 1630 54008 3425 3393 781 162 14258
NM_199436chr243097 583 254 175 22950 2142 --2367 54
NM_199461chr1063519 3212 3048 2944 2308 658 --22760 1412 23230 2365
NM_199462chr183821 3725 3292 1326 1284 1066 754 280 --15014 1817
NM_199478chrX61971 1812 1694 1398 272 50 31659 593 454 31941 1874 1368 --
NM_199482chr2--11955 52128 673 590 540 355 --
NM_201559chr663204 1599 1410 652 562 536 31547 1496 1246 31656 1185 579 23744 54
NM_201570chr1041595 1339 514 355 --2502 199 11610
NM_201571chr1041595 1339 514 355 --2502 199 11610
NM_201572chr1041595 1339 514 355 --2502 199 11610
NM_201590chr1041595 1339 514 355 --2502 199 11610
NM_201593chr1041595 1339 514 355 --2502 199 11610
NM_201596chr1041595 1339 514 355 --2502 199 11610
NM_201597chr1041595 1339 514 355 --2502 199 11610
NM_201999chr4----152 1120
NM_203282chr1951606 648 517 314 76 --11818 --
NM_203349chr1552083 1784 1615 291 100 21378 464 21982 61 --
NM_203391chrX21315 45 11705 21692 1633 --
NM_203406chr572501 2459 2430 2073 2020 1180 734 --1256 --
NM_203446chr2142928 2745 1907 668 21058 929 22983 178 12032
NM_203458chr1133763 3617 3315 3155 2961 2932 2386 1044 912 541 382 360 332 33271 948 609 2898 593 13296
NM_203463chr254791 4349 3991 1422 663 54539 4168 1883 1823 1700 2865 217 --
NM_203506chr1752281 1536 695 225 69 ----2453 53
NM_205836chr52498 223 --2180 155 1170
NM_205842chr2----1722 1794
NM_205860chr173021 2737 2079 1262 951 779 284 1874 ----
NM_206594chr162909 2850 2743 2606 1409 1041 12891 21231 707 13218
NM_206595chr162909 2850 2743 2606 1409 1041 12891 21231 707 13218
NM_206853chr643061 929 529 180 23418 879 11078 13045
NM_206854chr664322 3610 3278 1790 1441 44 34679 2140 429 11070 14306
NM_206855chr675287 4575 4243 4171 4030 2406 1009 35644 3957 1394 22035 568 15271
NM_206866chr2112271 11229 11170 12208
NM_206876chr263374 3273 2473 2431 2314 2295 23633 2279 11379 --
NM_206907chr5103256 2512 2300 2150 1139 1029 438 290 232 90 --1316 33013 957 888
NM_206909chr8108405 7004 6575 6433 6334 5315 1968 1475 484 462 25188 5135 36508 6356 6014 28359 3291
NM_206933chr1102832 2807 1913 1899 1844 1772 1150 640 440 82 32029 1072 815 22283 652 --
NM_207303chr10114084 3958 3486 3004 2667 1629 1406 1088 1034 953 813 23358 963 12822 33557 3148 1229
NM_207306chr164472 4335 3090 362 326 24 14448 14301 14578
NM_207322chr1522153 1883 2700 67 11681 21843 709
NM_207406chr496559 6301 4998 2406 2363 1438 912 782 657 --35511 1483 1430 --
NM_207445chr1552113 1782 1606 1324 246 --21893 318 12122
NM_207647chr91621 1540 --42171 1906 424 261
NM_212460chr752063 721 382 272 213 ----11504
NM_212554chr1041419 1234 197 140 --11364 2161 131
NM_212558chr964162 2798 1040 968 512 265 ----12690
NM_213589chr295310 5151 4125 3988 3523 1644 905 654 161 44546 3820 1962 1758 13650 11187
NM_213590chr1365283 4470 4277 3569 1430 154 34326 1720 1472 13274 1862
NM_213651chr12548 219 1116 1686 1174