TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5010-5p
miRNA Sequence: AGGGGGAUGGCAGAGCAAAAUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1242227 1948 1879 234 31978 1560 1503 22125 183 --
NM_000025chr851199 988 764 343 176 31175 857 235 189 --
NM_000037chr852515 2169 1967 611 181 22457 2196 12074 12486
NM_000081chr131230 432 320 11612 ----
NM_000084chrX106672 5847 5414 2490 1862 1804 1496 1455 1132 1035 55867 5832 4225 2220 1210 ----
NM_000088chr1771289 1245 1218 419 394 48 28 11189 11208 --
NM_000089chr72624 194 1204 ----
NM_000092chr284464 4206 3050 3013 2918 1402 988 139 43961 3598 3123 884 ----
NM_000125chr693570 3334 1448 1201 836 772 268 238 36 12714 33583 1438 585 1627
NM_000129chr641360 1180 436 305 11421 --1382
NM_000168chr762112 2062 770 601 593 501 32492 2332 2156 13238 --
NM_000170chr9143 ----180
NM_000176chr541281 1169 739 281 --1406 --
NM_000189chr231848 1582 236 --3282 269 73 1394
NM_000202chrX93239 2762 2694 2685 2664 2491 2451 2417 234 11565 12716 11026
NM_000210chr242329 769 275 65 ----1507
NM_000216chrX33824 1353 619 23178 1435 ----
NM_000217chr1265222 3680 3354 1604 1335 641 21004 318 13654 --
NM_000222chr451988 1590 1497 542 207 ------
NM_000259chr1534546 4039 3906 32428 2249 1917 1143 22417 114
NM_000264chr933133 1213 895 21175 1089 ----
NM_000266chrX4992 253 201 113 ------
NM_000267chr1763458 2936 2590 1124 883 81 13478 ----
NM_000268chr22103475 3344 2606 2368 2340 1063 981 728 561 403 2787 130 1436 --
NM_000276chrX42129 1632 854 464 --1150 --
NM_000278chr10102205 2006 1714 1641 1610 1595 863 751 543 58 2770 564 1906 --
NM_000318chr842747 2018 1871 660 --11892 --
NM_000319chr1231045 63 45 2993 373 1986 1823
NM_000322chr63371 128 21 11207 21433 66 2643 98
NM_000330chrX41586 1509 438 234 --1735 1195
NM_000332chr6115997 5907 5677 4464 2836 1969 662 498 443 249 34 26289 2871 16511 --
NM_000334chr17102106 2087 1937 1801 1794 702 561 413 54 43 ------
NM_000337chr5166244 6062 5265 5176 4839 4661 4653 4294 4279 1283 1231 933 704 534 283 205 46443 5784 4858 1689 --24462 333
NM_000353chr162250 200 1147 1177 --
NM_000362chr2293008 2884 2689 2302 1463 845 823 352 31 53547 3407 2680 417 373 1175 2646 388
NM_000368chr984359 4271 4241 3290 1664 1570 293 197 34369 3724 719 ----
NM_000379chr241474 1444 512 365 --11208 1303
NM_000399chr104419 331 103 97 ------
NM_000430chr1763486 3306 3062 2703 1343 25 13619 1838 12337
NM_000435chr197998 966 950 878 717 632 99 3649 269 253 1746 --
NM_000439chr532017 503 136 11615 ----
NM_000448chr1142232 1236 390 46 ------
NM_000461chr384279 4133 3583 1229 1156 1146 1108 1095 13309 --1879
NM_000522chr72429 139 --2990 838 --
NM_000523chr25874 865 386 268 142 --190 --
NM_000530chr16920 848 822 711 281 270 2361 133 --1341
NM_000544chr6_cox_hap173133 2445 2427 1000 696 669 207 11190 ----
NM_000555chrX117628 7297 6996 6619 5662 5627 5239 5033 4934 3136 2701 47655 3087 2575 1620 15840 --
NM_000567chr13825 817 769 1134 1897 2891 410
NM_000578chr22670 464 51548 1331 1313 1300 678 --11717
NM_000599chr254081 640 567 552 69 73534 3471 3298 2997 1680 1452 26 23482 3196 21229 773
NM_000609chr1072836 2484 2313 1266 888 852 84 42617 2082 1087 986 12782 42993 2857 2303 628
NM_000612chr11183675 3640 3630 3552 3535 3314 2897 2701 875 842 521 322 282 272 260 135 109 52 --22356 628 --
NM_000615chr1152869 1845 894 583 186 12421 11177 --
NM_000618chr1296347 6018 5958 5599 5285 4222 2649 2151 1050 35331 2332 133 14177 --
NM_000618chr1296347 6018 5958 5599 5285 4222 2649 2151 1050 35331 2332 133 14177 --
NM_000620chr12132107 2024 1894 1801 1549 1457 1400 1292 738 401 338 253 128 2721 386 31867 823 594 12079
NM_000663chr1672822 2386 940 743 689 432 192 1472 21155 640 2734 727
NM_000678chr205797 632 589 276 136 1839 --1303
NM_000682chr271176 736 585 265 231 189 86 --21361 415 --
NM_000719chr12146521 6460 6279 5530 5330 5200 4480 4442 4226 4208 2354 2241 1273 407 66333 6324 6064 5109 1911 253 56315 6192 5884 2506 583 36431 6357 2113
NM_000721chr141893 1835 1687 300 82686 2121 2084 1817 1740 779 527 441 1190 --
NM_000723chr1761288 1074 1058 494 249 106 61348 474 451 369 281 258 ----
NM_000724chr1051635 1453 746 225 63 11386 ----
NM_000791chr552436 2139 211 40 33 ----1129
NM_000793chr14104940 4926 4546 4538 3979 3841 3368 1272 1076 440 ----1611
NM_000800chr54584 360 282 255 --2510 389 --
NM_000801chr203965 941 192 21068 999 ----
NM_000809chr478549 7655 7167 6856 3199 3191 2647 46068 3607 2844 1183 39272 8440 5762 --
NM_000813chr545050 1790 506 39 13812 ----
NM_000814chr1583940 3887 3594 3254 1187 956 522 394 ------
NM_000831chr1115533 5258 4862 4397 4101 3977 1623 1066 713 81 74 21770 299 2524 194 --
NM_000833chr1611266 1597 --11227
NM_000834chr1281299 1259 897 824 345 317 217 191 ------
NM_000870chr56999 652 586 559 423 234 11012 1510 --
NM_000875chr15116678 6448 5874 5842 4374 2158 1582 1337 973 325 210 32609 959 613 --11474
NM_000880chr8------149
NM_000891chr1753490 2993 2966 2930 2277 1664 13137 --
NM_000901chr4------2223 209
NM_000924chr1241144 1020 968 468 3418 369 79 1865 1256
NM_000949chr55798 732 715 626 299 ------
NM_000950chrX43028 1462 871 736 1690 ----
NM_000961chr2063793 3540 3006 2688 994 613 43409 597 476 133 13728 --
NM_000966chr1271020 977 946 744 673 192 105 2940 886 31041 738 170 164
NM_001001132chr2161371 1289 1278 1251 1031 542 1301 121 --
NM_001001323chr1242798 2134 1993 249 2173 163 1104 --
NM_001001344chrX41999 1884 1875 909 31592 854 332 ----
NM_001001396chr1133983 3660 3545 3262 3199 3071 1755 1686 948 694 603 575 309 43325 2913 1694 243 23502 1779 --
NM_001001481chr833019 2616 685 13154 ----
NM_001001484chr1032357 843 298 1500 --1275
NM_001001890chr21114169 3993 2944 2855 2800 2788 1111 758 745 625 312 --12812 --
NM_001001924chr811870 31432 1390 206 11482 11833
NM_001001925chr811870 31432 1390 206 11482 11833
NM_001001931chr811870 31432 1390 206 11482 11833
NM_001002233chr821448 195 11589 1114 1381
NM_001002295chr10------1231
NM_001002762chr10112908 2498 2261 2036 1188 981 826 517 250 240 150 42660 2591 2164 2149 1530 --
NM_001002814chr843743 1448 909 195 23799 3629 23612 114 1381
NM_001002838chrX41787 670 440 238 1104 1350 --
NM_001002860chr1464032 2921 1703 1495 802 742 21864 621 ----
NM_001002909chr1771737 1715 659 372 287 220 204 11593 1313 1640
NM_001003406chr22113218 2944 2859 2849 2654 2328 1256 1186 1075 803 454 23135 2937 1674 11030
NM_001003407chr1075037 4869 4533 3592 3532 1525 962 21489 1445 23833 1859 --
NM_001003408chr1075037 4869 4533 3592 3532 1525 962 21489 1445 23833 1859 --
NM_001003652chr1888305 6360 5566 2819 2221 1015 747 447 38496 6296 207 12864 --
NM_001003674chr18116879 5815 5467 5454 4708 4305 2663 1406 1139 1127 696 11432 --1978
NM_001003675chr18116879 5815 5467 5454 4708 4305 2663 1406 1139 1127 696 11432 --1978
NM_001003676chr116797 733 643 385 363 148 21043 782 ----
NM_001003698chr681990 1955 1699 1671 1636 1574 1228 750 21553 1494 1243 --
NM_001003699chr681990 1955 1699 1671 1636 1574 1228 750 21553 1494 1243 --
NM_001003760chr653282 2840 809 527 482 2676 288 11131 --
NM_001003799chr73642 546 243 2582 131 ----
NM_001003940chr15123855 3705 3648 2887 2762 2572 2509 2386 1256 1041 1032 262 33028 2400 1177 --12604
NM_001003942chr15123855 3705 3648 2887 2762 2572 2509 2386 1256 1041 1032 262 33028 2400 1177 --12604
NM_001003943chr15123859 3709 3652 2891 2766 2576 2513 2390 1260 1045 1036 266 33032 2404 1181 --12608
NM_001004106chr56804 774 295 191 141 131 2149 84 ----
NM_001004317chr653742 1643 1028 625 570 11225 ----
NM_001004356chr471549 1267 1254 1126 1114 1102 1090 21178 1069 ----
NM_001004358chr471549 1267 1254 1126 1114 1102 1090 21178 1069 ----
NM_001004419chr1244315 4061 4038 1249 44372 4357 4337 273 14363 13585
NM_001004439chr1571290 1074 923 834 818 345 153 31023 514 283 1131 1353
NM_001004720chr2177 1150 --11043
NM_001004722chr21246 1319 --11212
NM_001005210chr1162482 2448 1673 1607 262 230 --22309 21 12369
NM_001005242chr123670 125 37 11593 1548 --
NM_001005335chr19------1210
NM_001005354chr121522 249 25 --1421
NM_001005404chr1721380 1276 33375 1568 1339 33198 2844 128 --
NM_001005609chrX93849 3553 3447 3027 2645 2373 1083 806 776 43670 3465 1407 1325 --1140
NM_001006115chr372386 2354 2127 1814 1127 875 719 3918 627 417 ----
NM_001006932chr682692 2292 2078 793 758 569 41 28 22736 225 11174 --
NM_001007023chr14104940 4926 4546 4538 3979 3841 3368 1272 1076 440 ----1611
NM_001007024chr1774165 3752 3116 476 459 432 255 ------
NM_001007025chr1774165 3752 3116 476 459 432 255 ------
NM_001007097chr9104257 3694 3159 3107 3093 1899 1831 1581 1329 1051 33976 3514 3506 11211 --
NM_001007156chr1551763 1474 1223 422 201 31725 433 171 ----
NM_001007237chr131870 359 50 21942 592 --11788
NM_001007466chr655153 4177 3391 3148 1026 24917 481 11761 --
NM_001008220chr5153906 3641 3552 3253 3236 2879 2541 2532 979 926 884 558 337 304 142 63608 3317 1065 594 235 158 13781 13412
NM_001008239chr1853226 790 149 138 52 32530 2508 219 11400 --
NM_001008407chr721591 135 41451 655 100 23 ----
NM_001008408chr786190 5620 5489 4629 4069 3942 3926 992 26206 5798 15598 14152
NM_001008701chr19162964 2936 2909 2840 2664 2478 2052 2027 1085 1078 881 617 520 505 317 145 32868 891 325 1816 --
NM_001008738chr542346 1051 996 754 ------
NM_001008895chr1341279 419 189 21 ------
NM_001009566chr121075 292 21121 61 11114 11324
NM_001009571chr751652 1557 1286 674 234 11356 ----
NM_001009880chr2294567 4547 4373 4282 3590 1806 1500 365 193 43644 1571 1253 1108 2828 503 --
NM_001009993chr274112 3768 3735 3659 2840 1465 660 33193 1133 1036 --14382
NM_001010862chrX53339 3107 2598 2493 95 --1413 --
NM_001010888chrX44120 4080 3744 166 24495 4106 ----
NM_001010898chr1153445 3024 2930 2909 2620 2457 2443 1040 1003 955 809 349 343 142 29 33723 3374 776 1802 13034
NM_001010934chr7--1967 2237 32 --
NM_001010984chr142153 1041 860 695 ------
NM_001011666chr776122 4961 4698 2466 1825 1577 576 14786 11417 --
NM_001011708chr242791 2655 2022 290 11130 --12562
NM_001011885chr152139 57 --11804 --
NM_001012264chr143785 112 68 2636 244 --2796 748
NM_001012267chr921631 480 11567 11976 1298
NM_001012329chr142094 1735 1575 103 42161 1914 1666 111 22154 1583 --
NM_001012393chr1194164 4023 3789 3212 1226 983 958 320 308 11016 ----
NM_001012421chr9------1641
NM_001012426chr6163290 3232 3199 2875 2510 2114 1332 1113 962 944 917 796 548 325 280 183 83241 2449 2396 1190 1084 909 709 314 166 --
NM_001012427chr6163290 3232 3199 2875 2510 2114 1332 1113 962 944 917 796 548 325 280 183 83241 2449 2396 1190 1084 909 709 314 166 --
NM_001012642chr15102113 2009 1977 1751 1554 1410 475 162 75 22 --1134 --
NM_001012755chrX74598 4572 3568 3403 2040 1711 986 54417 3230 1441 1144 371 ----
NM_001012968chrX42073 734 575 567 1399 ----
NM_001012977chrX9987 488 418 287 208 177 159 147 83 --11148 --
NM_001013031chr10102417 2392 2383 1304 1095 986 818 685 582 229 ------
NM_001013415chr431426 99 58 ------
NM_001013620chr1252338 1565 1557 1230 1022 22863 1695 37202 5992 1550 --
NM_001013624chr173350 174 53 41027 973 911 296 11185 1838
NM_001013635chr1251151 1048 290 274 138 11058 11216 --
NM_001013690chr12162459 2401 2395 2363 2182 2157 1906 1808 906 702 520 475 409 248 44 37 42191 1746 936 366 --1494
NM_001013839chr1792316 2232 2192 1644 517 480 351 228 210 3531 388 176 ----
NM_001014797chr10147839 7732 7605 7418 7238 7195 7041 3153 2820 2769 2517 2326 1460 1050 37449 2943 2355 25831 1632 --
NM_001014809chr44824 763 756 55 --1246 1625
NM_001015053chr17101542 1494 1276 1235 559 520 417 272 235 189 --11408 --
NM_001017368chr1772216 2005 767 407 356 338 309 --32489 2320 929 --
NM_001017392chr194463 270 248 63 --1988 1879
NM_001017395chr383447 3082 2814 2762 1049 962 703 418 12319 --1630
NM_001017440chr7167449 7390 6552 6187 3217 3029 2889 1994 1918 1853 1739 1629 1516 899 882 180 87616 2944 2253 2096 1095 737 514 73 11601 15583
NM_001017916chr1751703 1393 773 704 430 2817 529 ----
NM_001017917chr1751703 1393 773 704 430 2817 529 ----
NM_001017970chr1462593 2534 593 295 110 66 1640 123 --
NM_001017995chr5184658 4596 4243 4206 3132 3051 3029 2955 1698 1483 1272 1220 1049 735 551 476 274 255 33630 608 558 21166 190 13855
NM_001017999chr171958 1485 536 475 380 369 184 11501 --11477
NM_001017999chr171958 1485 536 475 380 369 184 11501 --11477
NM_001018000chr171958 1485 536 475 380 369 184 11501 --11477
NM_001018000chr171958 1485 536 475 380 369 184 11501 --11477
NM_001018001chr171958 1485 536 475 380 369 184 11501 --11477
NM_001018057chr113958 353 120 2166 55 ----
NM_001018065chr9105567 4610 3929 1727 1671 1076 603 575 521 241 25860 2123 14836 --
NM_001018066chr9105567 4610 3929 1727 1671 1076 603 575 521 241 25860 2123 14836 --
NM_001018074chr541281 1169 739 281 --1406 --
NM_001018075chr541281 1169 739 281 --1406 --
NM_001018076chr541281 1169 739 281 --1406 --
NM_001018077chr541281 1169 739 281 --1406 --
NM_001018108chr1572033 1821 469 177 159 115 78 41830 1437 907 511 ----
NM_001018111chr741126 1011 292 118 12676 1130 23790 1486
NM_001024094chr541281 1169 739 281 --1406 --
NM_001024401chr16102183 2078 2011 1805 1085 960 914 789 777 151 52815 2522 2113 1880 1095 22433 444 --
NM_001024455chrX2971 323 22596 2064 21764 50 --
NM_001024647chr1287417 6407 6046 5729 4911 1086 569 111 13085 15196 --
NM_001024649chr53903 543 37 22198 465 ----
NM_001024808chr1272749 2424 1039 732 685 539 310 1865 22543 475 --
NM_001024912chr195417 407 275 209 90 11829 --11175
NM_001024934chr61206 1128 1554 --
NM_001024935chr61206 1128 1554 --
NM_001024936chr61206 1128 1554 --
NM_001024937chr1710712 698 609 573 281 247 219 179 82 45 2519 186 2565 511 --
NM_001025076chr10115120 4903 4761 4736 4275 4266 2450 2412 2252 1543 1186 25003 4283 ----
NM_001025077chr10136478 6261 6119 6094 5633 5624 2901 2544 1162 1128 1050 269 152 56361 5641 1173 226 166 ----
NM_001025079chr383726 2954 1132 1108 900 737 622 566 23097 1139 1631 --
NM_001025107chr172315 2266 1752 1728 884 504 453 1216 1631 --
NM_001025107chr172315 2266 1752 1728 884 504 453 1216 1631 --
NM_001025108chr234052 3613 639 1647 12824 22646 518
NM_001025242chrX2948 333 ----2843 25
NM_001025243chrX2948 333 ----2843 25
NM_001025266chr3114319 4233 1900 1609 1536 1278 740 696 502 495 394 24401 893 --14028
NM_001025366chr651417 1245 606 245 219 128 11496 --
NM_001025366chr651417 1245 606 245 219 128 11496 --
NM_001025367chr651417 1245 606 245 219 128 11496 --
NM_001025367chr651417 1245 606 245 219 128 11496 --
NM_001025368chr651417 1245 606 245 219 128 11496 --
NM_001025368chr651417 1245 606 245 219 128 11496 --
NM_001025369chr651433 1261 622 261 235 144 11512 --
NM_001025369chr651433 1261 622 261 235 144 11512 --
NM_001025370chr651417 1245 606 245 219 128 11496 --
NM_001025370chr651417 1245 606 245 219 128 11496 --
NM_001025579chr1731127 763 22 31178 481 124 ----
NM_001025580chrX43258 1445 706 319 43933 3606 3208 3148 ----
NM_001025595chr4------21637 1370
NM_001029858chr643183 2365 841 238 13351 --1133
NM_001029859chr1191829 1653 1626 988 921 643 562 462 435 21667 878 1136 --
NM_001029863chr623169 992 --1976 --
NM_001029864chr2082449 2419 2390 2177 953 676 412 371 32087 1880 1735 52464 2412 2118 820 266 --
NM_001029883chr262580 2510 2382 1266 1020 752 22703 1988 23050 990 --
NM_001030006chr1792506 2348 1828 1041 855 781 641 601 560 12134 12409 --
NM_001030007chr1672821 2716 892 829 769 293 81 43634 2837 547 189 ----
NM_001030055chr1423995 835 24033 1481 ----
NM_001031679chr1263283 3154 2728 2660 356 301 12361 ----
NM_001031690chr7122926 2754 2739 2246 2115 2086 1169 1136 941 840 473 68 43048 2761 2341 1067 --22865 1988
NM_001031695chr22125196 5081 4963 4932 4711 4468 4379 3908 3477 2042 1873 610 55097 4986 3646 1296 952 ----
NM_001031732chr453495 2892 2839 725 659 62997 2914 2785 2770 1180 496 ----
NM_001031804chr1664167 3596 3142 3035 766 447 13267 ----
NM_001032288chr2071285 1243 625 568 381 283 29 1579 11056 --
NM_001032289chrX6339 234 221 172 108 72 ------
NM_001032296chr1372847 2744 2175 1144 840 708 391 11945 153 --
NM_001032380chr10--1132 --1528
NM_001032394chr622472 25 32359 2036 1118 ----
NM_001033025chr131243 1233 1225 ------
NM_001033047chr441935 1862 77 43 12294 1628 1299
NM_001033059chr61652 1670 --1359
NM_001033081chr14613 455 191 62 ------
NM_001033082chr14613 455 191 62 ------
NM_001033117chr3164851 4762 4700 4500 4436 4282 3698 3488 3478 3471 1344 1325 781 488 292 258 ----24332 545
NM_001033551chr17153821 3741 3134 2875 1646 1374 1329 1183 1129 1088 432 256 221 83 38 43691 3625 3194 330 ----
NM_001033561chr174833 824 808 335 2317 299 ----
NM_001033723chr822629 1996 1769 --12265
NM_001033756chr651351 1179 540 179 153 --11430 --
NM_001033756chr651351 1179 540 179 153 --11430 --
NM_001034850chr521320 134 --1317 --
NM_001034954chr1042376 1289 436 265 1516 --1540
NM_001034955chr1042376 1289 436 265 1516 --1540
NM_001034956chr1042376 1289 436 265 1516 --1540
NM_001034957chr1042376 1289 436 265 1516 --1540
NM_001035254chr992454 2141 2122 2088 731 661 646 405 79 31947 832 121 11989 --
NM_001037131chr231256 405 124 1234 198 1176
NM_001037132chr721698 1690 12229 ----
NM_001037133chr721698 1690 12229 ----
NM_001037332chr582253 2102 580 491 362 346 259 181 2522 171 11791 --
NM_001037333chr582253 2102 580 491 362 346 259 181 2522 171 11791 --
NM_001037954chr1143397 2943 2344 889 --11346 --
NM_001038493chr271267 1215 1099 308 223 208 115 ------
NM_001038707chr172007 1902 728 693 454 173 164 11434 21540 84 --
NM_001038707chr172007 1902 728 693 454 173 164 11434 21540 84 --
NM_001039140chr206460 421 199 184 177 55 1191 ----
NM_001039348chr21785 ----1673
NM_001039349chr21785 ----1673
NM_001039350chr761283 239 222 174 82 75 1278 11097 --
NM_001039459chr731155 465 125 --1458 --
NM_001039538chr231033 925 118 --11375 --
NM_001039590chrX33838 3322 1285 23619 2882 ----
NM_001039591chrX33838 3322 1285 23619 2882 ----
NM_001039690chr1682218 2046 1940 1805 1586 589 208 147 21518 449 --1912
NM_001039711chr151049 896 828 747 194 1904 --1161
NM_001039712chr151049 896 828 747 194 1904 --1161
NM_001039762chr1062159 1774 1743 1559 650 641 2708 284 1933 --
NM_001039771chr1491055 979 936 887 859 803 315 177 97 1325 ----
NM_001039840chrX55924 4916 4835 682 389 ------
NM_001039877chr196851 811 763 743 649 247 2182 152 1162 --
NM_001040002chr174931 600 363 328 31251 1069 89 11061 --
NM_001040057chr741253 544 450 23 ------
NM_001040144chr1682218 2046 1940 1805 1586 589 208 147 21518 449 --1912
NM_001040146chr1682218 2046 1940 1805 1586 589 208 147 21518 449 --1912
NM_001040151chr11154603 4390 4262 4024 3928 3830 3774 3765 3636 3395 3209 649 484 361 313 21824 1644 --11488
NM_001040152chr775022 1704 1269 852 650 61 40 11795 --13428
NM_001040158chr51427 --169 1388
NM_001040172chr56999 652 586 559 423 234 11012 1510 --
NM_001040173chr56999 652 586 559 423 234 11012 1510 --
NM_001040202chr442051 1681 559 82 ------
NM_001040284chr1675272 5256 4492 3614 1310 954 853 ------
NM_001040441chr194026 3382 1937 1623 1282 1265 1182 268 248 23959 3945 ----
NM_001040458chr571395 732 723 646 617 440 135 11507 1473 --
NM_001040624chr83529 136 111 41915 1864 539 512 --1457
NM_001040625chr83529 136 111 41915 1864 539 512 --1457
NM_001040626chr83529 136 111 41915 1864 539 512 --1457
NM_001040627chr83529 136 111 41915 1864 539 512 --1457
NM_001040628chr83529 136 111 41915 1864 539 512 --1457
NM_001040629chr83529 136 111 41915 1864 539 512 --1457
NM_001040630chr83529 136 111 41915 1864 539 512 --1457
NM_001040665chr774898 4460 4220 3711 3566 3491 1010 --11657 --
NM_001040709chr191801 1663 1633 829 820 510 427 80 24 41681 916 101 87 6909 889 751 742 187 94 --
NM_001042404chr141754 1541 1323 117 --11934 11608
NM_001042413chr964060 2886 2681 1594 1158 424 13170 33822 2756 1124 12981
NM_001042424chr482776 2290 2091 2032 635 342 288 166 ----22571 2528
NM_001042459chr3----170 181
NM_001042486chr2081528 1430 1388 1136 572 426 408 170 1417 ----
NM_001042492chr1763458 2936 2590 1124 883 81 13478 ----
NM_001042494chr1573652 3521 3497 3490 1250 902 474 33643 210 54 23331 596 --
NM_001042495chr1573652 3521 3497 3490 1250 902 474 33643 210 54 23331 596 --
NM_001042496chr1573652 3521 3497 3490 1250 902 474 33643 210 54 23331 596 --
NM_001042497chr1573652 3521 3497 3490 1250 902 474 33643 210 54 23331 596 --
NM_001042506chrX101158 987 488 418 287 208 177 159 147 83 ------
NM_001042510chr862130 1935 1899 1341 426 146 ------
NM_001042511chr862130 1935 1899 1341 426 146 ------
NM_001042555chr12104774 4168 4141 4134 3532 3031 1856 1845 765 222 33540 1214 1177 23198 1235 --
NM_001042599chr2127708 7137 6716 6309 5542 2980 2809 2160 2026 1580 600 446 77624 7593 6330 5979 693 540 51 17611 --
NM_001042603chr1274726 4192 3968 3910 1548 417 128 34848 4371 1372 ----
NM_001042632chr2082488 2316 1928 1905 1833 1616 122 116 11807 ----
NM_001042633chr2082488 2316 1928 1905 1833 1616 122 116 11807 ----
NM_001042681chr142399 2250 2153 685 1221 1204 --
NM_001042682chr142399 2250 2153 685 1221 1204 --
NM_001042682chr142399 2250 2153 685 1221 1204 --
NM_001042728chr1271020 977 946 744 673 192 105 2940 886 31041 738 170 164
NM_001044385chr263805 3072 1487 1333 1205 415 --1880 --
NM_001048183chr133734 2573 109 1322 23041 1123 --
NM_001095chr1261669 1494 1321 1282 1273 504 41226 468 279 265 1588 --
NM_001100108chr1157982 7850 6781 6756 5840 5174 2339 2149 2095 1781 1221 938 793 298 134 57474 2201 1565 1232 708 11571 16653
NM_001106chr3139709 7279 7004 6274 3483 3037 2962 2554 2250 1166 509 498 385 27146 6926 ----
NM_001111chr172315 2266 1752 1728 884 504 453 1216 1631 --
NM_001113490chrX52596 2498 1162 655 56 13574 ----
NM_001117chr1851909 856 760 741 606 ----11718
NM_001122631chr11------1446
NM_001128chr1672821 2716 892 829 769 293 81 43634 2837 547 189 ----
NM_001148chr421828 116 1323 --11660
NM_001157chr10----1274 1217
NM_001167chrX26286 2227 --1400 15725
NM_001173chr1423995 835 24033 1481 ----
NM_001177chr124812 386 49 21 --11989 --
NM_001188chr661217 850 814 385 329 91 31052 445 242 21249 979 --
NM_001191chr2071335 1153 1118 570 487 453 443 21401 382 159 --
NM_001204chr287177 6950 6346 5283 5215 3017 1731 1487 --193 1609
NM_001256chr1732503 964 63 1800 2602 273 1548
NM_001259chr766216 5989 5481 4559 4392 62 --26080 1127 11515
NM_001282chr1792506 2348 1828 1041 855 781 641 601 560 12134 12409 --
NM_001299chr193370 88 27 1324 --1104
NM_001304chr1711200 23303 2940 --124
NM_001310chr1232100 1240 48 --11971 --
NM_001313chr44824 763 756 55 --1246 1625
NM_001315chr672169 1956 1935 1892 1873 1612 351 3789 491 108 ----
NM_001331chr1151732 1098 932 630 202 3925 229 209 ----
NM_001343chr52696 355 2645 620 ----
NM_001364chr11103983 3709 3351 3341 3240 3188 3124 970 855 498 --14300 --
NM_001387chr593065 3001 2925 2890 2857 2529 2313 1236 222 1615 12570 12772
NM_001397chr1112559 2286 2274 2233 2021 1826 927 772 729 540 497 52260 1795 1041 999 506 22046 185 --
NM_001399chrX93849 3553 3447 3027 2645 2373 1083 806 776 43670 3465 1407 1325 --1140
NM_001401chr951288 1181 217 211 58 ------
NM_001406chr1791517 1306 581 534 464 410 304 171 126 2501 54 21158 451 --
NM_001408chr191497 1485 1299 1265 1102 352 297 245 197 2601 45 21287 210 --
NM_001417chr1241793 1776 1202 105 21783 1469 ----
NM_001419chr19114124 3843 3706 3577 3050 3031 1884 1685 929 835 278 23616 1867 23603 1739 --
NM_001420chr1972581 2556 2529 2510 2459 2371 458 22669 1156 2221 209 --
NM_001421chrX111684 1615 1469 1433 1368 1360 553 394 356 179 127 --1610 11262
NM_001427chr7111726 829 810 793 768 759 752 745 736 716 688 ----21403 295
NM_001430chr25661 470 300 253 184 11283 ----
NM_001432chr452697 2436 1409 309 60 12893 ----
NM_001438chr142581 644 435 383 1162 1428 --
NM_001439chr131243 1233 1225 ------
NM_001453chr661522 1164 651 443 367 353 11262 1146 --
NM_001455chr624839 3924 33655 3445 473 ----
NM_001497chr962269 662 484 308 114 83 21976 1114 ----
NM_001533chr19------1210
NM_001542chr131870 359 50 21942 592 --11788
NM_001543chr5134219 3870 3357 3335 1875 1604 1570 800 707 626 489 326 215 64829 3580 3472 1398 398 304 34527 3707 3459 --
NM_001569chrX2948 333 ----2843 25
NM_001587chrX42129 1632 854 464 --1150 --
NM_001616chr263523 3512 3449 2639 1371 824 1580 --11124
NM_001634chr61652 1670 --1359
NM_001635chr72205 195 --2400 271 --
NM_001659chr12122627 2579 2501 2443 2401 2221 2018 416 369 189 156 147 1891 11815 --
NM_001663chr141542 1766 22695 23 --
NM_001668chr182123 2109 625 596 500 201 148 96 22270 109 ----
NM_001678chr17111633 1617 1328 1274 737 638 579 573 562 497 445 31609 1195 206 2320 71 --
NM_001684chr1143700 3377 3262 2979 2916 2788 1601 1472 1403 665 411 320 292 26 33042 2630 1411 23219 1496 --
NM_001690chr342293 2222 649 208 1545 ----
NM_001717chr1541170 529 503 421 ----1977
NM_001746chr53903 543 37 22198 465 ----
NM_001754chr21114169 3993 2944 2855 2800 2788 1111 758 745 625 312 --12812 --
NM_001759chr12114856 4698 4363 3702 3575 3373 2131 1246 1170 1035 225 13550 ----
NM_001760chr65816 730 213 150 112 1807 --1830
NM_001773chr1101230 1218 1210 1178 1100 249 78 72 62 49 51305 1275 479 122 86 ----
NM_001777chr383726 2954 1132 1108 900 737 622 566 23097 1139 1631 --
NM_001789chr351465 1383 1276 213 39 --147 --
NM_001806chr1912731 1553 --21057 229
NM_001830chrX42694 1538 803 741 --23381 1043 --
NM_001895chr2061099 1014 1004 369 277 225 21022 384 --1792
NM_001915chr1751703 1393 773 704 430 2817 529 ----
NM_001936chr761283 239 222 174 82 75 1278 11097 --
NM_001949chr671248 1129 1011 738 318 311 246 33047 2091 99 1731 --
NM_001954chr65290 267 203 177 94 2529 27 1821 --
NM_001964chr54307 205 186 131 1193 ----
NM_001975chr121767 3795 546 248 293 44 --
NM_002014chr124574 561 279 49 1216 1604 --
NM_002015chr1362326 2192 2055 1322 530 517 12353 ----
NM_002025chrX188767 8688 7964 7774 7567 7560 7528 6814 6783 6501 3655 3055 2526 1861 1728 763 652 640 28787 5693 --36645 6485 412
NM_002033chr11113020 1289 1257 1238 1170 901 799 776 595 72 58 33038 1628 340 13329 --
NM_002040chr2162748 2146 2105 2070 395 210 ------
NM_002048chr941068 224 184 160 ------
NM_002051chr10------1231
NM_002062chr651539 1053 1026 500 150 51577 1279 1157 552 325 11070 --
NM_002076chr1253175 2535 1097 798 32 --11153 --
NM_002077chr981918 1579 1561 1549 1488 622 505 292 ------
NM_002082chr56767 737 258 154 104 94 2112 47 ----
NM_002092chr494809 4270 3999 3759 3545 3328 3218 2009 729 13933 ----
NM_002126chr1732781 987 863 33805 995 314 21043 320 13300
NM_002128chr131911 ----12128
NM_002130chr51354 ----1469
NM_002139chrX3602 132 119 1615 ----
NM_002146chr1721365 150 --21114 412 --
NM_002147chr174801 699 354 166 2947 309 168 --
NM_002158chr243615 2663 2499 269 12382 ----
NM_002193chr231822 1792 368 1566 ----
NM_002199chr41735 ----1226
NM_002204chr1731335 227 195 21206 219 --1934
NM_002214chr794671 4344 1928 1044 871 394 324 283 150 11897 ----
NM_002221chr122888 45 ----12291
NM_002241chr173076 3070 2357 608 391 185 117 42269 2194 652 199 22095 93 21070 110
NM_002246chr241017 487 476 140 3501 410 126 --1113
NM_002247chr1051960 1744 664 101 91 21842 52 11738 12081
NM_002254chr252251 883 797 771 318 41823 1728 410 296 12242 --
NM_002264chr381266 1259 1236 1020 711 351 343 246 1617 --24409 3371
NM_002270chr545515 5056 1572 1380 14043 15450 --
NM_002285chr234052 3613 639 1647 12824 22646 518
NM_002293chr151704 1119 932 485 350 32415 2164 1737 130 --
NM_002309chr2293004 2753 2743 2732 2490 2479 2002 974 716 32923 2444 484 32382 2287 1125 --
NM_002310chr582465 1885 1826 1793 1266 1046 972 199 45446 5421 2407 2260 --12275
NM_002313chr1075037 4869 4533 3592 3532 1525 962 21489 1445 23833 1859 --
NM_002334chr1161393 1309 767 688 311 104 41990 1518 737 318 ----
NM_002336chr1224963 4382 1748 --1864
NM_002355chr1211092 3571 91 39 11369 --
NM_002359chr17103736 3323 2827 2786 1684 930 385 358 97 72 23472 109 ----
NM_002373chr1541310 357 333 162 4926 483 38 22 --1497
NM_002374chr231033 925 118 --11375 --
NM_002375chr3151830 1702 1664 1622 723 624 540 481 294 166 76 63 54 43 32 12142 1368 12154
NM_002382chr1461309 492 234 227 214 118 2347 184 155 --
NM_002387chr584617 4129 1572 752 425 371 293 212 24571 3593 ----
NM_002401chr1732113 1888 1691 61903 1700 881 647 525 86 ----
NM_002430chr2261935 1740 1729 454 62 43 ------
NM_002442chr1281569 1290 610 437 243 228 204 106 41576 1331 1297 193 31712 1275 306 --
NM_002473chr228995 447 207 152 136 117 82 55 --1195 --
NM_002499chr1542047 1655 585 176 11638 --11996
NM_002501chr19274054 3919 3900 3891 3884 3872 3689 3654 3251 3198 3093 3061 3049 3018 2972 2899 1648 1559 1546 1495 1392 1215 870 573 551 398 355 63611 3533 1413 1340 621 189 --2542 122
NM_002507chr1741908 1826 1745 1531 61602 1397 1271 796 482 289 11277 --
NM_002508chr111225 31955 156 146 ----
NM_002516chr195234 62 56 44 37 ------
NM_002522chr1783148 2733 2582 2445 1340 737 673 82 32625 1238 91 23046 1126 --
NM_002524chr11909 2960 134 ----
NM_002545chr1194164 4023 3789 3212 1226 983 958 320 308 11016 ----
NM_002547chrX54014 3962 3944 946 192 21292 267 33979 3933 215 13921
NM_002556chr1162034 1857 1841 1724 340 302 11775 21981 1577 11951
NM_002570chr1551184 1114 433 369 199 162 2402 121 --
NM_002576chr112307 226 21124 106 --1330
NM_002577chr382849 1494 984 906 898 809 759 334 --11622 --
NM_002578chrX2369 326 1157 130 --
NM_002581chr953767 2139 208 51 30 21481 810 1789 1599
NM_002586chr661407 1164 1008 517 322 215 41300 402 388 329 31437 1095 128 --
NM_002588chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_002594chr2052338 2051 1537 310 34 11595 ----
NM_002608chr2281511 1451 1399 563 424 340 189 96 21360 145 ----
NM_002609chr581722 1571 1503 555 321 115 60 38 1250 1351 --
NM_002646chr162173 2164 1855 1376 79 64 ------
NM_002657chr20123656 3206 2902 2859 2517 2491 2372 1147 1046 802 680 530 33166 2477 74 --11040
NM_002698chr19222777 2599 2330 2309 2285 2266 2222 2113 2035 1195 1142 1131 1067 1033 1015 1008 755 315 207 198 190 166 32607 1934 224 21123 214 --
NM_002699chr141366 1080 1067 530 --3423 385 284 11142
NM_002705chr162260 82 ----1229
NM_002716chr1153558 3521 3510 2557 291 12496 --12443
NM_002730chr1981267 1250 1240 1029 999 925 910 195 61167 1133 1113 977 249 227 1204 1870
NM_002745chr2234170 320 198 54012 3483 1324 507 390 14179 --
NM_002748chr15------11107
NM_002753chr4228 21 2301 51 ----
NM_002776chr1971938 737 608 187 106 86 79 11577 2176 159 1697
NM_002821chr64309 157 87 80 1549 ----
NM_002824chr124462 372 356 136 1313 2392 381 1333
NM_002827chr204731 528 322 158 1420 ----
NM_002833chr1571427 1396 1287 414 325 313 286 31309 357 122 ----
NM_002837chr1244535 2920 2894 2876 --13914 --
NM_002843chr1163269 2217 2108 747 702 256 11118 11110 12886
NM_002850chr1971058 973 965 942 795 394 237 1363 ----
NM_002855chr11173553 3314 3195 2758 2259 1357 1034 960 829 710 699 572 455 352 200 191 37 31479 1455 211 43633 1497 898 326 --
NM_002859chr12151609 1352 1333 1192 667 600 541 464 412 289 219 203 159 121 45 31715 1339 33 1243 --
NM_002866chr193499 187 23 4233 170 51 41 ----
NM_002868chr12142236 2172 2106 1982 1926 913 886 745 419 371 330 314 234 64 32414 2162 776 11494 --
NM_002869chr1131753 444 415 21775 859 11713 --
NM_002874chr942422 886 874 821 1894 ----
NM_002880chr33562 225 172 1873 --1238
NM_002881chr24458 242 231 102 11266 11401 --
NM_002886chr385152 4601 3362 1874 1300 270 244 153 34915 4152 1350 14594 11120
NM_002892chr14152 --1147 11225
NM_002955chr681990 1955 1699 1671 1636 1574 1228 750 21553 1494 1243 --
NM_002956chr1231272 959 166 --11018 --
NM_002957chr963694 3229 2638 2606 1370 484 22792 1004 --13522
NM_002959chr164240 4091 4066 3325 1589 422 24150 1435 13957 --
NM_003010chr1732377 1753 935 11822 --11910
NM_003011chr951165 1050 381 238 99 ------
NM_003012chr873128 2962 2714 1084 714 161 148 ------
NM_003016chr1761857 1851 1688 772 423 277 ----1356
NM_003028chr9113798 3777 3453 3331 3320 2920 2626 2481 1494 1066 989 ------
NM_003030chr311407 1141 21343 133 --
NM_003042chr361611 1514 692 646 605 417 11715 --11871
NM_003043chr3144202 3939 3767 3759 3745 3446 3301 3093 3058 2965 2915 2859 1573 946 23412 2704 23586 1188 43933 3430 1305 1024
NM_003045chr1364945 3416 3340 801 482 365 23062 283 23119 1289 --
NM_003047chr1101245 1179 1162 506 306 275 160 111 74 30 21267 1064 41343 1173 322 187 --
NM_003051chr11736 11549 --11645
NM_003076chr12121655 1602 1434 1416 1406 1039 666 575 505 481 241 166 11324 11371 --
NM_003081chr2021147 978 125 ----
NM_003107chr681908 674 663 641 529 446 368 344 ----1203
NM_003108chr2106503 6369 4497 2567 2272 2077 2018 1877 1826 269 25063 1859 15499 --
NM_003110chr177842 768 358 200 164 130 52 140 ----
NM_003118chr572065 2050 1986 747 634 515 45 2422 59 ----
NM_003131chr6122206 1431 817 797 677 667 654 601 525 369 249 202 21926 193 ----
NM_003139chr114815 766 715 234 3618 221 38 ----
NM_003150chr1772207 1880 1599 1580 967 310 130 ------
NM_003155chr8122439 2327 2077 2009 2001 1932 1801 1136 353 284 275 191 12427 22448 122 21038 538
NM_003156chr1151179 868 376 244 65 31149 402 280 11019 --
NM_003165chr971688 1602 1594 1379 1280 403 33 1772 11562 --
NM_003178chr342169 1478 450 410 1273 11663 1434
NM_003179chrX91362 1221 1208 1201 394 383 287 256 191 31451 1125 417 ----
NM_003189chr162424 2079 1257 675 326 251 22157 259 ----
NM_003200chr19102078 2018 1890 1827 1806 1518 929 772 235 228 12037 ----
NM_003202chr52447 106 21200 63 1581 1591
NM_003203chr241839 1650 541 93 --2899 146 --
NM_003221chr6113373 3231 3076 2848 2776 2646 1591 1486 1089 465 305 73764 3463 3384 3350 2855 2653 494 ----
NM_003234chr332143 1884 1553 1695 1230 1389
NM_003239chr144848 749 733 719 1841 ----
NM_003246chr1541658 1418 673 664 --1427 --
NM_003255chr1772091 644 620 552 282 142 77 11020 1210 1341
NM_003286chr2021139 439 1446 ----
NM_003304chr321408 371 ----11015
NM_003320chr1184182 4164 3603 3521 1581 1328 951 82 32745 1270 831 14153 --
NM_003342chr1742750 2718 854 560 1827 22188 2098 --
NM_003348chr1241396 1272 407 55 1271 21318 592 --
NM_003349chr2071285 1243 625 568 381 283 29 1579 11056 --
NM_003363chr33555 460 453 --1633 148
NM_003369chr1182618 2582 2388 1102 890 685 525 317 --1802 --
NM_003370chr197739 590 577 571 259 231 217 --2553 244 --
NM_003376chr651417 1245 606 245 219 128 11496 --
NM_003376chr651417 1245 606 245 219 128 11496 --
NM_003385chr22797 348 1276 1268 --
NM_003387chr272801 2056 943 930 712 373 73 12770 ----
NM_003404chr2031967 1444 58 21497 1365 11753 --
NM_003410chrX32903 795 249 1401 22415 2045 --
NM_003439chr763129 890 737 723 673 30 ------
NM_003458chr3114000 3832 3820 3813 3556 3210 3155 1289 976 937 448 33932 3295 724 2777 551 12975
NM_003463chr622675 302 32778 2637 261 12745 1515
NM_003466chr272432 2305 957 852 694 586 439 3621 506 198 1712 --
NM_003468chr263491 1127 1086 1079 1072 957 12642 1886 --
NM_003474chr1022394 2237 31988 1651 387 --1469
NM_003478chr1143193 2449 933 182 --11321 --
NM_003482chr1292648 2512 2490 2474 1062 531 509 195 33 2758 202 2977 503 12401
NM_003483chr1262932 2777 1057 879 498 207 ------
NM_003485chr1461243 1097 897 889 883 83 ------
NM_003489chr2122192 747 11174 ----
NM_003505chr75698 600 587 571 469 1778 11666 153
NM_003507chr24599 571 327 105 --1364 11944
NM_003559chr1793961 3539 2746 2504 1128 1055 1008 724 247 73495 2887 2789 2737 2638 644 600 23882 3094 12476
NM_003564chr15574 240 193 167 79 3430 200 174 ----
NM_003574chr1885134 4857 4122 1979 1695 516 475 346 --24143 1689 15146
NM_003576chr1372847 2744 2175 1144 840 708 391 11945 153 --
NM_003581chr2177 1150 --11043
NM_003589chr1341279 419 189 21 ------
NM_003607chr174250 3783 3273 1424 1102 1008 73 13657 --11291
NM_003617chr194559 4545 4524 3972 3750 3619 3514 3108 1480 3890 199 45 ----
NM_003624chr1941162 929 555 238 1935 --11203
NM_003629chr142865 1102 629 439 23473 1047 ----
NM_003633chr542438 2086 1595 1025 11929 ----
NM_003634chr227866 794 427 336 313 211 28 3928 907 38 ----
NM_003636chr141189 422 314 40 3585 528 296 --2275 146
NM_003637chr161440 1188 346 297 235 29 2430 362 31214 626 113 --
NM_003644chr17176324 6150 5673 5616 5565 4899 4170 4008 3990 2183 2123 2035 1350 1277 1258 957 178 76363 4505 4492 4295 740 357 171 25977 2134 11039
NM_003655chr177587 576 541 239 162 82 33 ------
NM_003663chr373249 2916 2281 2123 582 497 445 ------
NM_003671chr953093 2755 2299 1072 852 12743 22709 2419 --
NM_003679chr112415 13262 1758 12780
NM_003714chr552704 2369 2276 1150 250 133 --12496
NM_003735chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_003736chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_003743chr242302 1785 1759 1473 11602 12005 --
NM_003768chr141575 1554 325 301 3318 246 57 --164
NM_003787chr181608 ----11132
NM_003795chr6--1490 --1188
NM_003822chr142538 1100 490 348 32555 1172 425 --1736
NM_003872chr272751 2708 2676 2663 2174 1024 526 1881 12433 --
NM_003877chr123892 745 42 1179 ----
NM_003885chr1742019 485 146 127 21993 424 12649 --
NM_003913chr644034 3532 2675 625 32919 2698 2683 ----
NM_003931chr61206 1128 1554 --
NM_003936chr28987 774 751 472 420 390 362 289 --31096 311 28 --
NM_003939chr10133991 3822 3808 2657 2552 1529 1499 1186 735 556 479 286 276 43430 1395 904 668 13328 --
NM_003949chr1792003 1857 1791 1269 752 578 513 271 175 --21874 113 1302
NM_003955chr1791489 1140 607 601 539 297 153 142 57 ------
NM_003966chr587660 7074 6020 2676 1337 1261 895 34 26951 2218 ----
NM_003983chr16104328 4300 4049 3610 3180 1599 1302 1235 1144 494 23781 2718 --13435
NM_003987chr10102205 2006 1714 1641 1610 1595 863 751 543 58 2770 564 1906 --
NM_003988chr10102282 2083 1791 1718 1687 1672 940 828 620 135 2847 641 ----
NM_004024chr11404 21049 115 --1122
NM_004050chr1472200 2057 1876 613 592 552 393 22006 874 22070 756 --
NM_004055chr11112210 2156 2059 1888 1633 1555 725 536 354 231 53 2441 417 ----
NM_004093chr1372175 1311 1300 592 416 269 130 1599 22983 1294 --
NM_004094chr1422943 1135 --12296 12037
NM_004105chr21785 ----1673
NM_004124chr1442846 2739 2726 2254 --12309 --
NM_004161chr221160 168 ----11070
NM_004170chr931345 507 469 31904 1298 1204 ----
NM_004171chr11149347 9035 8654 8503 7772 7272 6610 6570 6451 6261 2806 2163 1169 477 36863 6429 301 --16897
NM_004187chrX101328 464 452 420 365 355 241 215 116 58 21069 1010 21094 979 --
NM_004200chr11102275 2102 1222 1064 832 791 782 461 385 43 62750 2587 2341 1209 1097 341 32901 916 772 21112 184
NM_004210chr1061412 1352 548 244 234 113 31638 675 316 ----
NM_004225chr811290 ----1243
NM_004263chr291671 1610 1564 1244 725 465 275 242 198 1504 ----
NM_004272chr5--3767 718 122 1344 --
NM_004274chr1422982 330 31223 261 145 180 23034 2760
NM_004296chr14113815 2745 2688 1182 1090 933 897 659 484 366 358 42594 2470 1388 843 33709 3344 2671 1505
NM_004302chr1252126 1030 777 575 477 32309 865 784 --11113
NM_004308chr1161568 1296 738 560 382 58 31819 1634 127 11460 --
NM_004311chr10123052 2916 2734 2563 2552 2524 2479 2335 2322 604 424 150 --12788 --
NM_004321chr253395 3386 3353 3181 2552 63318 3124 2860 781 482 50 144 12931
NM_004326chr141151 1052 978 836 1358 ----
NM_004338chr18116879 5815 5467 5454 4708 4305 2663 1406 1139 1127 696 11432 --1978
NM_004371chr13600 84 41 1625 2616 65 --
NM_004380chr1622408 1847 41856 1658 1017 519 --11806
NM_004391chr3112090 1921 1750 1703 1586 1501 1434 1339 327 154 104 21361 377 --11488
NM_004393chr3102241 2052 1865 1851 1816 1647 1545 791 738 165 11831 ----
NM_004397chr1134015 1355 401 23040 3001 ----
NM_004416chr1271087 760 701 690 683 378 25 1741 1747 --
NM_004420chr11112319 1888 1881 1875 1625 1618 841 450 442 426 294 32133 2023 1644 11587 --
NM_004423chr392717 2590 2443 2318 1011 590 379 302 234 32350 789 364 2524 420 --
NM_004427chr16813 460 412 290 114 41 3305 257 154 --11158
NM_004430chr8102766 962 955 812 636 391 208 137 31 21 4979 624 383 221 ----
NM_004432chr921840 394 12166 ----
NM_004437chr193601 2780 2774 2411 1163 1113 792 634 436 42665 2420 2274 39 1450 1374
NM_004441chr341289 441 429 163 1453 ----
NM_004442chr161681 1603 1450 1154 672 368 21592 32 ----
NM_004485chr1123208 2789 2770 2725 2699 1399 1061 1030 440 373 101 47 23272 1203 23379 875 --
NM_004487chr341150 1079 1069 31 11090 ----
NM_004494chr161240 1013 506 451 242 204 31174 973 345 ----
NM_004496chr144409 319 312 284 1155 ----
NM_004500chr1441925 530 120 83 2742 90 11479 --
NM_004501chr173545 1551 1256 1103 974 487 349 22655 849 --11507
NM_004503chr126779 257 205 112 38 30 3332 172 62 ----
NM_004527chr174931 600 363 328 31251 1069 89 11061 --
NM_004530chr164978 219 203 168 --11133 1753
NM_004586chrX64163 4054 3897 2173 1364 431 34517 1877 673 --11212
NM_004588chr1173247 3217 1547 677 459 292 41 62974 2948 2648 1088 943 425 14074 1152
NM_004598chr572985 2924 2707 2118 1319 1097 486 22581 1333 ----
NM_004602chr2061404 1301 1123 1059 339 283 ------
NM_004630chr1161057 1047 863 813 797 283 --1307 --
NM_004637chr321001 444 11164 21174 72 --
NM_004726chrX35725 4491 1665 21680 1361 ----
NM_004734chr13274 31 2169 93 ----
NM_004742chr321243 582 146 --1465
NM_004745chr8176952 6221 6137 6091 5908 4826 2425 2400 2325 1911 1882 1779 1666 1584 536 89 23 46924 4908 4736 1946 26247 487 11680
NM_004759chr171976 1575 1512 1328 731 229 60 32026 1920 1780 ----
NM_004768chr1------1445
NM_004798chr20103180 2311 1221 1148 862 679 317 309 293 105 23135 1328 1982 --
NM_004815chr184539 4431 4355 4061 3991 1978 312 145 24439 285 14549 --
NM_004822chr17113730 3709 3527 3259 3185 1573 1536 1399 551 529 171 33072 2881 587 1519 --
NM_004841chr151153 1124 921 880 54 1195 11162 --
NM_004857chr1444115 1702 1149 1014 13596 11719 --
NM_004859chr1722601 254 21942 611 12660 --
NM_004863chr1455059 3910 3736 1029 418 2339 36 1332 1601
NM_004866chr553529 3472 1479 1077 1024 14757 --14968
NM_004871chr1774165 3752 3116 476 459 432 255 ------
NM_004884chr1571666 1454 1440 1122 623 569 548 21579 661 ----
NM_004887chr5--1889 --1936
NM_004893chr51427 --169 1388
NM_004898chr452745 2554 2276 2175 476 1465 --1876
NM_004904chr776122 4961 4698 2466 1825 1577 576 14786 11417 --
NM_004926chr144547 531 157 72 2519 133 11459 190
NM_004947chr392582 2129 2084 1962 927 866 848 380 281 22591 78 1788 --
NM_004952chr16701 671 334 325 163 104 1724 1915 1873
NM_004956chr723463 442 13570 11793 --
NM_004961chrX51165 1057 601 556 240 2173 42 1517 1128
NM_004964chr12368 122 252 39 ----
NM_004976chr11184842 4763 4722 4678 4595 4453 4433 4334 3700 3669 3309 2009 1888 1816 1737 1397 1312 846 64868 4852 4316 4155 3287 1334 24422 1747 24392 3718
NM_004978chr181613 1578 1567 1231 1117 529 503 365 31285 1273 182 ----
NM_004979chrX91137 1125 1057 1012 795 476 389 310 189 21025 287 ----
NM_004985chr1274101 1059 851 582 509 355 193 ------
NM_004991chr31130 1355 --1401
NM_004992chrX288514 8086 7976 7909 7793 7461 6973 6355 6130 5920 5776 5280 3418 3087 3070 2815 2519 2512 2505 1818 1809 1789 1378 1352 1301 1222 439 324 126176 5914 2978 2623 2609 2570 1276 1064 762 450 431 345 11282 27784 7753
NM_004992chrX288514 8086 7976 7909 7793 7461 6973 6355 6130 5920 5776 5280 3418 3087 3070 2815 2519 2512 2505 1818 1809 1789 1378 1352 1301 1222 439 324 126176 5914 2978 2623 2609 2570 1276 1064 762 450 431 345 11282 27784 7753
NM_004993chr1421366 505 ----11354
NM_005010chr721698 1690 12229 ----
NM_005045chr7------1708
NM_005053chr194365 211 202 157 --1183 1408
NM_005056chr1284970 4436 4212 4154 1792 661 372 105 35092 4615 1616 ----
NM_005057chr141747 733 673 484 ----1371
NM_005065chr1432035 1858 1646 14833 --11461
NM_005078chr1541822 1176 1147 223 2350 294 11235 --
NM_005080chr221742 3834 355 281 ----
NM_005095chr152238 2213 1835 1791 1582 1897 ----
NM_005096chrX2881 134 51021 896 451 226 61 ----
NM_005105chr141805 1764 1528 742 1760 ----
NM_005109chr352528 2476 239 204 156 2382 251 32280 1957 865 --
NM_005116chr20114091 3914 3538 3130 1684 1430 1004 976 564 267 187 24193 991 1520 --
NM_005119chr161307 1208 1168 1065 404 153 1167 11284 --
NM_005135chr1573652 3521 3497 3490 1250 902 474 33643 210 54 23331 596 --
NM_005147chr16--2993 869 --11025
NM_005155chr62694 449 3514 211 185 --2597 119
NM_005156chr954559 3712 1524 685 279 24732 3703 24957 167 --
NM_005161chr11112086 1978 1647 483 467 460 423 366 331 140 116 32193 740 392 21393 444 --
NM_005168chr241419 1119 400 367 ------
NM_005184chr1951348 1309 1281 1160 80 41189 433 332 312 1289 --
NM_005186chr115563 146 138 131 34 ------
NM_005187chr1691645 1616 1496 1432 1306 524 379 359 268 1600 --11626
NM_005197chr1435506 3995 515 36159 5493 308 --12440
NM_005202chr182307 1598 895 724 715 431 148 35 4482 423 399 203 ----
NM_005220chr1771290 1253 917 469 449 196 115 21132 135 21304 267 11433
NM_005225chr2041141 1015 926 82 1905 ----
NM_005229chrX3990 806 796 51232 943 358 220 171 1335 --
NM_005235chr2127708 7137 6716 6309 5542 2980 2809 2160 2026 1580 600 446 77624 7593 6330 5979 693 540 51 17611 --
NM_005238chr1142571 2547 957 864 22893 1193 ----
NM_005254chr151980 1455 11283 --
NM_005312chr9111978 1950 1857 1067 1006 966 945 541 382 323 298 1906 1955 12194
NM_005329chr1632261 2188 276 1386 --21728 199
NM_005336chr2112203 2153 2079 2066 1879 1861 1853 1593 730 419 115 41926 1800 477 172 ----
NM_005339chr484352 4308 3523 850 706 425 243 155 21681 1034 23635 603 --
NM_005359chr1895825 4812 4615 4307 4290 3980 1681 746 667 36362 1469 1448 ----
NM_005370chr1941249 1167 843 833 1391 ----
NM_005374chr1742263 2130 2083 426 22376 661 161 --
NM_005386chr206881 814 591 194 108 97 --1583 --
NM_005397chr741126 1011 292 118 12676 1130 23790 1486
NM_005400chr26655 444 421 164 143 99 12805 1405 --
NM_005407chr1471582 1383 1256 1246 310 293 204 1450 ----
NM_005413chr2583 74 53 33 21 2102 43 ----
NM_005417chr2081752 1634 1567 1430 765 755 261 250 21583 370 11806 --
NM_005436chr102863 243 33797 2569 2509 ----
NM_005439chr125462 194 132 88 82 --157 1359
NM_005474chr17101542 1494 1276 1235 559 520 417 272 235 189 --11408 --
NM_005477chr1572286 1986 1759 1045 862 798 41 --11901 --
NM_005477chr1572286 1986 1759 1045 862 798 41 --11901 --
NM_005479chr1041596 1208 1184 1014 11224 ----
NM_005502chr943017 2494 640 416 --12970 --
NM_005522chr74972 474 379 37 --1247 11027
NM_005578chr344806 4780 408 291 ----21588 1458
NM_005581chr195349 339 107 100 93 --1390 --
NM_005596chr996122 4959 4942 4025 2529 2500 2189 995 272 1850 ----
NM_005602chr32969 158 21148 169 1495 --
NM_005604chr66583 459 124 81 44 38 11969 1744 --
NM_005652chr1691200 1162 1118 1110 1022 1002 814 308 173 --1989 1915
NM_005668chr534636 4122 880 --11391 --
NM_005677chr341510 1158 1061 1042 21342 244 ----
NM_005678chr153945 807 314 4999 887 764 131 ----
NM_005715chr652298 774 653 427 121 21007 269 133 --
NM_005725chr142356 2225 849 550 21566 66 ----
NM_005730chr12103459 3244 3204 2785 2372 2355 918 897 731 654 11087 13135 --
NM_005746chr722515 2256 12699 12402 --
NM_005754chr52763 160 1325 1899 --
NM_005779chr543632 3325 849 28 --1268 --
NM_005789chr1791919 1575 1519 1511 1491 792 706 313 303 11804 22147 486 --
NM_005819chr142482 812 391 29 23461 161 1493 --
NM_005828chr1794919 4752 4153 3872 3756 3731 1785 1541 559 44593 3883 1322 586 ----
NM_005832chr341439 1064 990 973 ------
NM_005840chrX147343 5692 5446 5403 4760 2889 1831 1386 916 591 576 531 464 44 --26877 5495 --
NM_005843chr22458 91 21941 763 ----
NM_005877chr2242496 2136 2044 921 2175 52 21590 161 1605
NM_005883chr1972769 2544 1967 1057 964 296 34 22219 88 32855 2428 703 --
NM_005895chr1283421 3382 3306 3217 3204 2979 1299 770 42675 1668 1536 1356 ----
NM_005898chr1141975 1229 303 93 ------
NM_005901chr1888305 6360 5566 2819 2221 1015 747 447 38496 6296 207 12864 --
NM_005906chr6--11197 --1149
NM_005907chr62351 34 ----11211
NM_005909chr543529 3323 3249 1604 13409 14253 13222
NM_005911chr241223 1070 945 484 2345 22 1493 --
NM_005920chr1143508 3492 3225 3142 3086 2732 2614 2422 2415 1464 1269 1153 1139 83 53597 2439 2377 1132 837 23417 224 --
NM_005933chr1183036 2995 2952 2422 1953 1082 735 364 21857 703 23047 515 --
NM_005934chr19122238 2045 1782 1727 926 740 504 479 398 244 170 76 32251 2157 1986 ----
NM_005935chr453926 1642 1465 883 407 11813 34608 2118 650 --
NM_005937chr17164038 3577 3339 3273 3129 3037 2586 1330 1271 1193 1108 1046 943 827 294 272 53751 3535 3418 1460 1293 23844 516 --
NM_005941chr814191 1841 --11452
NM_005943chr621244 397 2149 28 1514 136
NM_005955chr154938 3987 1590 1195 117 44361 2180 2098 1381 12083 --
NM_005957chr1124455 4401 3701 3513 3219 3207 3167 1807 1525 1511 1146 698 3122 102 55 33562 3414 865 --
NM_005964chr1751458 1392 1296 1047 180 ----1612
NM_005967chr125591 524 457 273 73 2638 280 --1536
NM_006007chr934136 3869 212 ----13510
NM_006015chr181246 912 897 225 175 162 128 21 ------
NM_006034chr11112436 2385 1958 1932 1789 755 498 419 177 151 94 22377 737 --11911
NM_006036chr251576 845 486 428 382 --11961 --
NM_006037chr294821 4193 4104 3767 3183 3092 1919 1022 856 ------
NM_006040chr1671394 1304 568 508 454 184 111 2970 924 ----
NM_006054chr1151421 1379 1373 1034 1027 1142 ----
NM_006080chr742141 1918 1150 927 ------
NM_006091chr1581713 1397 712 367 252 190 66 55 31752 636 497 21647 472 --
NM_006095chr412848 11180 13974 --
NM_006096chr871262 1154 668 270 235 222 56 1279 ----
NM_006106chr1143197 1245 560 139 ------
NM_006133chr11142360 2273 2239 2157 1935 1738 1731 1608 1590 1543 977 964 781 156 22164 373 ----
NM_006139chr231962 1919 86 2656 514 ----
NM_006148chr17152867 2651 2611 2598 2385 2257 1946 1034 972 926 553 543 317 197 180 32576 892 782 32125 608 329 1417
NM_006158chr841817 1522 628 38 ------
NM_006160chr17111256 1234 1051 1040 460 395 340 328 229 215 55 41444 299 242 193 ----
NM_006167chr842032 1616 948 748 32173 204 46 1346 --
NM_006191chr121619 1140 3788 119 44 --
NM_006194chr1431312 67 39 2931 61 ----
NM_006203chr584083 2201 2189 1936 1666 1583 1272 1122 15439 14198 15344
NM_006206chr442738 2238 715 450 1916 ----
NM_006212chr1104837 4782 3783 3522 3514 1007 653 504 103 48 2950 491 ----
NM_006224chr1762141 2082 1966 906 864 225 1310 ----
NM_006237chr1352149 738 726 699 81 41510 550 181 145 ----
NM_006238chr6101991 1909 1703 1523 1456 1416 335 294 214 173 3833 415 183 ----
NM_006245chr651020 388 352 178 171 1266 1374 --
NM_006251chr563172 3018 1166 937 600 390 13188 2798 493 --
NM_006252chr146682 6326 6177 2642 25346 2462 16243 --
NM_006268chr1151106 973 370 323 87 151 1855 --
NM_006275chr2032486 2273 191 --12376 --
NM_006282chr2084324 4125 3410 1898 1374 1130 753 546 44641 3428 1541 319 --1403
NM_006283chr884547 4417 4027 3857 1862 1367 847 243 --1491 14078
NM_006306chrX65946 4575 989 267 83 35 152 24398 727 --
NM_006317chr5288 45 1361 --1597
NM_006328chr113471 255 233 2583 139 1589 --
NM_006358chr2241058 452 75 51 1377 1870 --
NM_006361chr1751746 1641 1295 572 397 1749 ----
NM_006371chr385211 4975 4796 3475 935 776 565 539 1596 25036 4820 25145 4623
NM_006373chr1791262 560 525 450 358 313 271 146 112 --11084 --
NM_006378chr931023 352 341 --11242 --
NM_006379chr72821 331 --12355 1309
NM_006380chr1754186 3642 2908 1411 144 --1966 21196 1124
NM_006389chr1171009 879 855 503 401 215 30 51129 899 541 414 44 --1548
NM_006390chr1251868 1498 662 549 157 ----11392
NM_006411chr69875 674 319 278 270 102 44 34 23 --1405 --
NM_006434chr1042376 1289 436 265 1516 --1540
NM_006449chr222127 543 31704 1580 1485 ----
NM_006458chr113344 332 137 ----1291
NM_006465chr1592268 2176 2142 1993 1425 904 831 423 358 52005 804 553 282 272 21768 594 --
NM_006517chrX102326 1971 1617 627 575 370 219 182 134 41 ------
NM_006521chrX21292 1282 61224 1106 511 356 194 79 ----
NM_006546chr17276519 6277 6246 6217 6002 5994 5959 5952 5159 5105 4525 4390 4351 4214 4117 2657 2645 2504 2152 1682 1549 1420 959 874 785 423 65 46019 5797 768 749 15065 15912
NM_006559chr131134 138 128 ----164
NM_006561chr10115120 4903 4761 4736 4275 4266 2450 2412 2252 1543 1186 25003 4283 ----
NM_006595chr1142039 1906 1354 441 ----11897
NM_006599chr16117547 7402 7390 7141 5731 5565 5502 1760 1154 1082 842 22581 1044 1773 --
NM_006609chr262257 2086 1947 1001 443 339 ----1987
NM_006618chr161594 1295 1245 1139 430 412 11485 ----
NM_006620chr663158 1919 1505 1149 908 530 ----11929
NM_006621chr131629 1419 1323 31609 603 244 --11445
NM_006626chr932425 1047 236 --191 --
NM_006628chr1534187 3192 1176 14222 --24247 4021
NM_006650chr5153906 3641 3552 3253 3236 2879 2541 2532 979 926 884 558 337 304 142 63608 3317 1065 594 235 158 13781 13412
NM_006654chr12104774 4168 4141 4134 3532 3031 1856 1845 765 222 33540 1214 1177 23198 1235 --
NM_006675chr12123161 3002 2851 2807 2374 1228 1139 1043 1020 991 984 340 43109 2824 2669 2590 12574 --
NM_006690chr2072284 1909 1640 954 937 463 432 41988 930 789 487 --2563 403
NM_006694chr13362 283 272 2261 118 1110 --
NM_006699chr12556 399 1578 1128 --
NM_006720chr1075037 4869 4533 3592 3532 1525 962 21489 1445 23833 1859 --
NM_006729chrX94986 4897 4667 4435 3815 1505 926 422 170 --34870 4051 1037 15455
NM_006732chr19102118 2025 1800 1783 1540 1338 682 555 502 125 31503 1360 463 1626 --
NM_006736chr281762 1435 1381 742 616 530 131 117 ------
NM_006742chr1691983 1781 1723 1436 781 457 440 318 222 41792 1497 425 339 21713 1457 1810
NM_006750chr16128000 7522 7305 7159 6013 5930 5761 4889 1744 1722 814 372 46059 3153 1999 1807 1578 --
NM_006761chr175736 726 713 706 45 1629 ----
NM_006766chr842653 1031 751 371 2658 448 1618 --
NM_006772chr6151692 1647 1579 1559 1395 1309 1073 676 668 588 458 433 321 305 299 21409 1222 21680 1325 --
NM_006777chrX52837 1002 842 548 355 12693 --12651
NM_006802chr12942 82 2375 71 --11143
NM_006814chr2082439 2252 2134 568 309 241 64 34 ----1686
NM_006823chr821072 47 1869 11341 --
NM_006827chr1462870 2238 923 779 745 22 33201 827 349 ----
NM_006852chr1762481 1143 694 591 554 450 22227 726 ----
NM_006854chr751956 1787 1559 681 526 11544 --1422
NM_006856chr1231158 874 363 --21048 75 1225
NM_006884chr311407 1141 21343 133 --
NM_006885chr1663442 2821 1677 1365 1227 1042 23513 1106 12935 11128
NM_006888chr1443252 2384 999 27 1195 23206 3175 --
NM_006924chr1773779 3766 3756 1729 990 699 160 --24028 138 11338
NM_006931chr1261664 1574 484 291 203 24 2355 52 ----
NM_006943chr20132842 2827 2816 2623 2034 1034 964 847 488 376 309 204 163 33059 979 742 2137 101 --
NM_006950chrX7866 356 204 169 142 87 29 3731 620 298 1103 --
NM_006990chr161878 772 671 660 239 187 22083 164 12155 --
NM_007005chr941006 387 79 34 --1134 --
NM_007006chr1652878 2771 2442 313 116 ------
NM_007007chr12--13252 --11102
NM_007011chr15116007 5848 4645 4581 4538 1890 1569 1560 1241 643 53 54179 2658 2378 1113 77 32715 1086 83 --
NM_007030chr5115075 4639 4491 4471 3148 1526 1186 187 162 149 37 33196 1444 973 11009 --
NM_007038chr2132130 401 299 23831 2240 2425 233 --
NM_007040chr196990 297 235 165 146 128 6936 911 724 423 364 46 1348 --
NM_007043chr1262167 1797 1601 332 296 33 ----1402
NM_007050chr20157400 5734 5590 5505 5048 2791 2733 2528 2374 1729 1674 1409 753 568 372 77779 7146 5605 3116 2825 1427 620 25940 3127 26667 5075
NM_007067chr1741437 1334 1209 1081 31535 1296 1123 1125 --
NM_007106chr1332628 1782 257 12169 12431 --
NM_007129chr136376 366 300 206 33 22 ------
NM_007146chr1742788 2668 558 380 22189 939 ----
NM_007150chrX81952 1886 1788 1493 408 104 87 61 196 ----
NM_007172chr2232047 1113 187 12294 1707 --
NM_007174chr1251965 1856 1843 1676 694 41555 950 787 631 1806 11527
NM_007185chr13809 682 221 2435 343 ----
NM_007192chr14--137 11001 1415
NM_007195chr1823339 3149 1901 --21407 1018
NM_007202chr173684 648 605 ------
NM_007212chr141751 418 358 154 2832 258 ----
NM_007236chr1562394 1921 679 503 376 59 31582 256 101 21715 93 --
NM_007249chr13138146 7410 7390 7271 6861 6214 5822 3198 2673 2081 1620 1200 409 35760 2822 2599 25751 75 1396
NM_007286chr562026 1422 1312 722 614 472 21318 664 2693 287 --
NM_007345chr1841836 262 250 74 ------
NM_007365chr171632 843 729 708 586 543 188 42046 1918 657 56 1484 --
NM_007373chr1031779 562 381 11156 ----
NM_007375chr162589 1762 1082 492 428 307 12040 ----
NM_012069chrX42561 984 403 232 --1273 --
NM_012072chr20144270 4149 3587 3555 3111 3034 2881 1577 1330 1297 327 256 135 46 1526 --1574
NM_012074chr146955 824 768 729 150 110 --2158 39 --
NM_012102chr142399 2250 2153 685 1221 1204 --
NM_012104chr1153464 3387 3162 1444 688 31430 1391 1024 22398 32 12643
NM_012104chr1153464 3387 3162 1444 688 31430 1391 1024 22398 32 12643
NM_012120chr632007 1862 527 ----11827
NM_012164chr9126691 6082 5396 4647 4613 2561 1665 1545 1327 1146 910 686 46510 5285 4571 2043 15809 26325 6254
NM_012166chr981504 1463 1133 1020 444 425 96 90 --21314 456 --
NM_012193chr11105151 4718 4633 3699 3692 3450 3281 2070 1346 333 44997 4730 4422 3579 14617 --
NM_012199chr1104489 4114 4080 4055 2877 1528 1478 1153 1085 673 43831 3131 605 216 24450 1787 --
NM_012214chr276157 6132 5629 5214 4518 4292 2422 --13952 1154
NM_012232chr17101893 1887 1849 1806 1796 459 400 334 322 241 ------
NM_012234chr3180 --11283 12690
NM_012244chr14101658 1631 1505 1274 1174 498 422 346 290 35 31649 1497 1431 --11192
NM_012249chr232902 2262 860 22459 2275 1384 13326
NM_012262chr144879 4299 3624 1532 24311 4254 ----
NM_012287chr343499 3269 1318 553 1345 --1766
NM_012288chr6125044 4522 4153 3635 2112 2019 1823 1257 535 226 82 28 84953 4898 4683 3939 2233 2011 1243 441 11912 --
NM_012294chr753236 1504 1213 481 22 ------
NM_012296chr11123573 3246 3239 3192 2824 1529 856 797 398 159 86 38 43433 3378 2848 850 33360 2714 61 12629
NM_012297chr431837 806 427 22086 167 ----
NM_012300chr542199 2074 700 213 2691 250 ----
NM_012301chr751870 1772 1547 587 317 ------
NM_012306chr12123055 2990 2669 2409 2276 1227 1064 826 434 374 205 60 53520 2922 2263 1161 28 ----
NM_012308chr11111672 803 794 590 576 471 365 350 195 109 41 2971 459 1908 1548
NM_012309chr1164618 4170 3816 1410 1400 1077 54196 3372 1504 1171 600 13975 14088
NM_012316chr153559 1962 1069 697 87 23796 3692 35352 902 745 12207
NM_012334chr574528 3968 3522 3516 2903 440 360 13080 ----
NM_012384chr2062126 2021 1985 972 617 219 22187 559 --11994
NM_012395chr773451 2583 2355 2315 2293 1081 312 12336 23002 2108 --
NM_012398chr19132784 2761 2684 2657 2649 2619 2541 2534 2511 2371 2018 1894 131 42843 2326 2281 737 12289 --
NM_012416chr93820 437 98 1250 ----
NM_012420chr1031965 635 84 11754 ----
NM_012448chr1742167 690 543 241 21840 550 ----
NM_012473chr225674 571 504 219 89 1266 2555 239 --
NM_012478chr174928 834 297 101 4681 346 327 233 1270 --
NM_013231chr1464326 3592 3537 3302 3237 1200 23439 1535 23198 1125 11155
NM_013238chr1341746 1660 1434 189 --21805 273 --
NM_013253chr113958 353 120 2166 55 ----
NM_013269chr1244242 3988 3965 1176 44299 4284 4264 200 14290 13512
NM_013279chr1192306 2220 1621 1575 814 612 500 372 361 --42140 2096 2043 1641 1929
NM_013286chr363639 3346 3212 3044 380 100 12690 167 13431
NM_013309chr1532032 1024 93 --12145 --
NM_013313chr2283512 3377 2616 2301 2264 2251 881 167 23414 2551 ----
NM_013341chr242791 2655 2022 290 11130 --12562
NM_013354chr841354 1326 375 101 --177 --
NM_013403chr196851 811 763 743 649 247 2182 152 1162 --
NM_013433chr1961947 1932 1924 1661 477 142 21881 1257 11430 --
NM_013434chr2101939 1742 1644 1536 1476 1297 696 452 442 370 --1606 --
NM_013434chr2101939 1742 1644 1536 1476 1297 696 452 442 370 --1606 --
NM_013438chr9--21607 1303 --1642
NM_013444chrX3234 225 158 21002 174 ----
NM_013449chr12132376 2089 2006 1991 1122 702 627 343 324 183 176 169 153 42117 1103 834 646 2727 37 --
NM_013951chr272432 2305 957 852 694 586 439 3621 506 198 1712 --
NM_013952chr272509 2382 1034 929 771 663 516 3698 583 275 1789 --
NM_013953chr272509 2382 1034 929 771 663 516 3698 583 275 1789 --
NM_013989chr14104940 4926 4546 4538 3979 3841 3368 1272 1076 440 ----1611
NM_013992chr272509 2382 1034 929 771 663 516 3698 583 275 1789 --
NM_013993chr65290 267 203 177 94 2529 27 1821 --
NM_013994chr65290 267 203 177 94 2529 27 1821 --
NM_014001chr1771353 1300 547 485 458 399 23 ----1383
NM_014015chr164699 161 136 21 1119 ----
NM_014028chr653346 2968 2950 1330 1284 --12581 --
NM_014030chr1781123 985 953 867 860 479 227 78 2748 208 3811 416 245 --
NM_014112chr844739 1899 1104 129 --1904 --
NM_014117chr1652271 1044 1036 695 51 12324 21943 1053 --
NM_014155chr1156912 6359 2675 1831 1074 12118 11490 --
NM_014157chr1672997 2796 1563 1273 980 628 136 23179 547 --23934 3270
NM_014182chr121726 1245 2624 472 --
NM_014186chr114764 700 574 61 --21719 177 12129
NM_014190chr491361 741 699 592 477 408 282 75 63 --11721 --
NM_014231chr1271956 1843 1712 1612 1487 235 133 51805 269 167 99 85 11948 --
NM_014232chr17121619 1494 1213 1031 622 437 423 413 384 341 133 97 41637 363 63 44 11151 --
NM_014232chr17121619 1494 1213 1031 622 437 423 413 384 341 133 97 41637 363 63 44 11151 --
NM_014233chr1742027 1527 527 48 41636 223 110 78 21724 1372 --
NM_014240chr341475 636 447 306 --43364 2780 369 299 --
NM_014251chr72311 87 --2818 60 --
NM_014271chrX2179 74 ----1609
NM_014289chrX21183 489 11245 1354 1142
NM_014292chr2251782 1613 1231 500 94 21798 1496 11578 --
NM_014293chr22194005 3794 3737 3722 3279 3229 1363 767 580 570 563 541 487 421 189 182 133 99 67 32749 1386 397 23522 3366 --
NM_014299chr1961593 653 434 321 300 142 21762 714 2832 399 --
NM_014309chr22125186 5071 4953 4922 4701 4458 4369 3898 3467 2032 1863 600 55087 4976 3636 1286 942 ----
NM_014331chr4117537 7202 7120 7076 6460 6086 5162 2177 1622 803 503 12234 ----
NM_014333chr1142035 850 359 336 11990 --1396
NM_014345chr63947 906 179 1276 ----
NM_014372chr13693 660 380 1387 ----
NM_014376chr582253 2102 580 491 362 346 259 181 2522 171 11791 --
NM_014388chr1126032 5652 5579 4730 4149 3935 3865 3742 3707 3687 2310 1530 35805 4391 1167 --14876
NM_014400chr192132 25 2446 415 --1124
NM_014405chr17132262 2141 1960 902 857 702 634 537 385 336 215 77 35 --1262 --
NM_014415chr311630 11386 1557 --
NM_014423chr544782 2169 1654 1003 ----13994
NM_014431chr105591 461 361 195 21 21598 323 1112 --
NM_014447chr4------21636 1369
NM_014458chr121274 256 21282 883 ----
NM_014494chr1632074 2052 315 31912 958 135 ----
NM_014517chr351404 1244 1235 193 163 11460 ----
NM_014521chr22603 438 31693 1668 159 ----
NM_014554chr1242295 1606 1411 230 1554 ----
NM_014571chr172482 2269 2063 1976 1928 866 648 42762 2448 788 149 11165 1851
NM_014587chr1681509 1472 1253 1014 507 430 263 196 ------
NM_014591chr1031047 387 92 41284 377 350 289 ----
NM_014607chr231953 1728 829 2620 517 ----
NM_014612chr9----1138 11381
NM_014613chr582310 2133 1908 976 705 418 340 21 ------
NM_014615chr1663339 2771 2334 2277 1145 446 32507 1138 269 ----
NM_014634chr2263202 1289 1224 1108 33 27 53624 3093 2417 121 56 ----
NM_014636chr9143436 3421 3385 3137 2875 2714 1730 1365 1359 980 837 667 650 190 21101 845 ----
NM_014646chr1862493 2219 2116 1094 631 36 197 4861 645 240 137 --
NM_014663chr111057 ----1220
NM_014665chr8113359 3315 3296 2372 2324 1218 966 862 438 367 154 22757 2444 13501 12471
NM_014677chr831108 1058 1035 ------
NM_014686chr1952296 850 503 417 66 1425 ----
NM_014690chr7122926 2754 2739 2246 2115 2086 1169 1136 941 840 473 68 43048 2761 2341 1067 --22865 1988
NM_014702chr653290 3020 1399 776 204 13109 ----
NM_014721chr6137139 6941 6451 5764 5338 5284 5229 4893 4687 2836 2545 1180 772 14512 15186 --
NM_014730chr12145056 3745 3677 3535 3323 1926 1482 1442 1312 1183 925 814 627 290 34869 4448 3838 --12047
NM_014730chr12145056 3745 3677 3535 3323 1926 1482 1442 1312 1183 925 814 627 290 34869 4448 3838 --12047
NM_014731chr2081443 1355 701 497 480 144 64 55 31423 578 86 11251 11481
NM_014739chr642740 1687 1539 1096 24014 2654 ----
NM_014742chr2091448 1254 1194 1119 576 569 484 473 258 41472 1188 706 588 1680 --
NM_014747chr1215756 5417 5258 5141 4929 4919 4440 3968 3690 3647 2162 2104 2050 1608 1465 1024 901 796 720 485 63 14121 14107 13726
NM_014751chr822147 2092 2769 397 --1848
NM_014755chr263047 2830 2681 1528 1003 765 14126 21544 1237 11565
NM_014757chr572306 1954 1846 831 750 744 714 31835 1763 1722 ----
NM_014761chr164305 284 137 88 21059 160 ----
NM_014765chr132109 721 613 12078 12532 --
NM_014766chr773781 3523 1266 841 792 172 21 22832 401 ----
NM_014767chr10183571 3556 2842 2746 2533 2325 2250 1372 1286 1166 1081 1040 681 614 583 532 490 446 31401 1334 407 11067 1394
NM_014770chr1251296 994 289 180 30 41152 1103 1042 967 ----
NM_014772chr18113579 2803 2734 2218 905 822 605 530 288 268 169 13357 12633 1311
NM_014774chr143025 2199 1314 926 3867 729 94 1952 1594
NM_014776chr1263049 2624 2618 2383 484 314 32645 1062 771 ----
NM_014784chr110976 804 738 432 388 204 95 39 31 22 1814 ----
NM_014798chr1781791 1692 1640 1510 196 184 173 108 31797 1745 1281 ----
NM_014800chr731155 465 125 --1458 --
NM_014803chr1052692 873 796 353 183 2833 647 ----
NM_014807chr113600 76 53 1717 1617 2265 45
NM_014810chr163630 2814 2624 2609 2583 1415 1890 ----
NM_014812chr141754 1541 1323 117 --11934 11608
NM_014826chr174250 3783 3273 1424 1102 1008 73 13657 --11291
NM_014830chr12103669 2998 2872 2802 2623 2580 1574 927 497 75 43843 3433 2880 305 22483 2475 --
NM_014836chr10--1132 --1528
NM_014840chr1242617 2513 2298 1169 32364 1264 1148 ----
NM_014849chr181262 988 890 883 482 354 280 63 21174 346 ----
NM_014850chr3164851 4762 4700 4500 4436 4282 3698 3488 3478 3471 1344 1325 781 488 292 258 ----24332 545
NM_014858chr141204 938 847 168 1299 --11145
NM_014872chr931638 385 206 ----11625
NM_014873chr134204 3553 1176 11841 31726 370 139 --
NM_014890chr3----170 181
NM_014901chr56752 746 713 284 261 199 21891 325 1492 --
NM_014902chr2081528 1430 1388 1136 572 426 408 170 1417 ----
NM_014906chr1732731 1464 304 63375 1503 1372 1019 453 35 ----
NM_014909chr1483962 3943 3730 3195 3072 2940 2772 1104 23831 3168 13226 22660 413
NM_014914chr231256 405 124 1234 198 1176
NM_014920chr632534 1090 538 2641 55 ----
NM_014921chr19162964 2936 2909 2840 2664 2478 2052 2027 1085 1078 881 617 520 505 317 145 32868 891 325 1816 --
NM_014924chr1453113 1949 984 838 309 2618 51 --13142
NM_014925chr123655 245 184 1765 1809 --
NM_014935chr1173822 3465 2720 2708 2513 2436 2393 1349 1165 930 918 861 772 492 486 358 285 --43744 2816 2785 1243 12372
NM_014938chr1262016 1936 1682 717 497 401 1601 ----
NM_014944chr121075 292 21121 61 11114 11324
NM_014945chr561910 698 644 618 442 78 ------
NM_014948chr2082231 2048 1978 907 735 669 510 118 22502 2430 ----
NM_014952chr1561800 1621 586 448 386 245 11483 ----
NM_014964chr1742330 1533 776 365 1217 11638 --
NM_014982chr1453754 1411 1136 190 36 --11107 --
NM_014991chr452145 660 574 290 255 ----1536
NM_014992chr144682 352 329 292 ------
NM_014994chr1572335 2209 1471 838 631 568 467 31956 792 518 1886 --
NM_014996chr341003 210 147 126 1846 ----
NM_015002chr12--31665 797 170 1342 --
NM_015008chr383447 3082 2814 2762 1049 962 703 418 12319 --1630
NM_015023chr1181693 1674 1636 1544 1449 1425 1231 1220 1149 1136 1127 508 460 394 262 206 195 116 21244 93 ----
NM_015024chr81269 31125 976 149 ----
NM_015026chr1254742 4542 4470 3528 269 1958 ----
NM_015033chr9112695 2424 2157 2134 891 859 799 505 394 250 117 --12412 --
NM_015035chr20116569 6551 6368 6034 5736 2172 1380 1250 1122 227 138 34249 1632 1390 ----
NM_015039chr162884 943 589 398 163 86 44115 3854 3261 283 31428 359 320 --
NM_015042chr15144268 4109 4058 3847 3704 3643 3273 3224 2746 1490 892 858 805 609 43664 1435 1361 342 63109 2837 1742 1481 961 489 1833
NM_015051chr972937 2851 2808 970 786 235 144 1981 ----
NM_015063chr1910500 383 293 269 217 188 169 141 87 24 31351 878 391 1938 --
NM_015064chr1242729 2225 1321 1267 23112 991 22251 141 11408
NM_015071chr5136506 4655 4628 4100 2331 1989 1954 1842 1079 791 765 655 164 34788 1071 997 14497 --
NM_015074chr1114748 4677 3716 3128 1451 590 561 374 327 150 121 34590 3154 158 13145 --
NM_015075chrX82246 2093 1976 1759 856 820 809 585 21730 361 ----
NM_015076chr644077 3922 3913 3133 23183 202 14318 13207
NM_015078chr341124 1097 145 49 --11141 1388
NM_015079chr15113003 2961 2776 2547 2434 2347 2310 2267 832 614 353 11197 1450 --
NM_015080chr116621 402 223 176 98 72 1920 ----
NM_015082chr531649 484 437 22399 2096 12504 11851
NM_015085chr17104068 3790 3474 3395 1699 1656 1576 1390 1218 252 23643 1106 44118 1377 1015 40 11462
NM_015086chr1251230 1209 558 58 27 31050 957 69 21170 1003 --
NM_015090chr1165926 5753 5710 5678 4847 4675 4609 4256 2088 1694 1420 1383 1126 758 598 386 35200 2100 465 11557 25870 5209
NM_015092chr1653818 2838 992 677 657 23623 2847 ----
NM_015094chr22114323 4238 4154 3934 3249 3145 2988 2982 2867 1119 740 34335 3605 3478 1481 21858 1519
NM_015097chr352294 1518 1475 698 167 12309 ----
NM_015100chr151349 750 631 363 132 31721 1567 806 1828 11608
NM_015107chrX52165 1885 1799 1657 1632 2465 178 32442 1865 319 1873
NM_015116chr1361684 1543 588 301 295 96 ------
NM_015125chr194211 168 157 79 3524 375 218 1503 --
NM_015138chr1542600 470 199 61 32585 794 205 --1187
NM_015144chr1643341 2981 2689 285 23789 665 --1958
NM_015155chr1062266 976 593 424 156 123 32333 853 62 1904 --
NM_015156chr1433302 636 285 21567 177 1627 --
NM_015185chrX92741 2323 2211 960 942 632 515 382 310 22472 2452 ----
NM_015192chr2052744 1892 1003 161 106 ------
NM_015200chr472432 2293 1993 1761 710 432 235 21864 245 ----
NM_015205chr13244416 4123 4085 3971 1871 1318 1310 1294 1281 1265 1249 1241 1220 1183 1162 1154 1141 1133 979 972 764 661 123 38 13722 21192 420 --
NM_015209chr171958 1485 536 475 380 369 184 11501 --11477
NM_015215chr163212 2851 2795 2409 780 736 12294 1139 --
NM_015219chr1792316 2232 2192 1644 517 480 351 228 210 3531 388 176 ----
NM_015225chr952539 1932 552 439 424 12031 ----
NM_015236chr421275 230 1986 1201 --
NM_015250chr9263 56 ----1159
NM_015252chr22325 154 127 --1867
NM_015254chr842493 2470 721 408 1100 32743 932 633 --
NM_015264chr2294567 4547 4373 4282 3590 1806 1500 365 193 43644 1571 1253 1108 2828 503 --
NM_015270chr12112222 2193 2048 2036 2030 1639 636 533 489 396 244 21543 514 11481 --
NM_015271chr433456 2923 2860 11683 11008 --
NM_015272chr1661852 1626 401 328 185 25 11931 ----
NM_015288chr5112836 2799 2752 2643 2599 1076 992 639 461 252 39 33395 3297 1154 42578 1133 1113 706 --
NM_015291chr122579 934 33284 412 232 1271 1578
NM_015299chr14173781 3714 3591 3531 3399 3301 3287 3271 3094 1594 1359 1343 1319 969 820 374 76 23919 3447 13747 --
NM_015305chr1441981 290 263 119 11295 21421 110 --
NM_015310chr8137835 7224 7155 6754 6256 6228 5474 2959 1716 1517 1462 1447 270 ------
NM_015313chr1164798 4416 4094 3344 746 685 33543 3474 219 12976 --
NM_015315chr5123168 2940 2680 2347 1331 1119 863 650 641 549 402 380 --22664 196 --
NM_015326chr162709 2092 2072 1016 331 179 42300 786 204 142 12202 1793
NM_015328chr762697 2686 2285 421 365 297 22325 673 12547 1283
NM_015332chr793547 3351 2938 1381 1010 998 326 162 52 22869 2834 1555 --
NM_015346chr1421431 435 2608 82 --11595
NM_015347chr1252135 2065 1877 1113 551 12843 ----
NM_015349chr642149 1953 1225 547 22091 1013 ----
NM_015365chrX43258 1445 706 319 43933 3606 3208 3148 ----
NM_015367chr221480 --21663 539 1419
NM_015385chr1042376 1289 436 265 1516 --1540
NM_015387chr221962 300 21564 462 ----
NM_015393chr43675 167 140 1282 --13536
NM_015443chr1791257 1016 968 541 503 477 431 273 216 1326 ----
NM_015455chr562958 2800 2591 1001 933 402 ------
NM_015457chr112241 87 2852 75 1797 --
NM_015470chr291116 1050 968 952 780 428 171 126 63 41123 1096 1057 292 1417 2373 255
NM_015481chr1291088 1073 1012 877 813 315 227 112 82 2933 234 ----
NM_015488chr291683 1601 1516 1507 1347 1202 551 290 264 31574 1430 409 21556 124 --
NM_015493chr1961461 205 137 78 62 53 11452 --1492
NM_015509chr1241157 208 167 93 21542 1140 ----
NM_015526chr19111450 1135 1129 1003 965 266 245 213 90 47 35 1466 --1582
NM_015527chr164618 260 251 152 3587 128 44 1593 1207
NM_015550chr763125 2636 2386 844 643 404 22278 379 13601 --
NM_015553chr654710 3607 3406 1930 816 21692 1243 ----
NM_015557chr1103550 3344 2801 2788 2757 2659 1289 741 720 656 43434 3076 2713 520 11069 --
NM_015567chr1351214 521 415 389 380 ------
NM_015569chr143871 1917 1723 1443 --14501 --
NM_015575chr263151 3135 2696 2652 523 398 22997 311 32516 709 28 --
NM_015576chr332308 885 453 --12716 1293
NM_015609chr1112458 2442 2102 2092 1884 1132 955 867 735 190 182 12450 1134 --
NM_015686chrX102421 2383 2090 2082 2005 1874 1000 458 442 79 32372 405 55 1136 11798
NM_015695chr661825 1724 800 462 133 99 31676 708 222 2618 443 --
NM_015711chr196686 670 657 223 29 23 --1100 --
NM_015713chr853204 3174 2895 1005 589 13059 ----
NM_015716chr1710712 698 609 573 281 247 219 179 82 45 2519 186 2565 511 --
NM_015726chr151870 1690 1674 489 249 11851 1335 --
NM_015831chr78915 873 854 769 591 362 352 106 1343 ----
NM_015840chr172315 2266 1752 1728 884 504 453 1216 1631 --
NM_015841chr172315 2266 1752 1728 884 504 453 1216 1631 --
NM_015850chr831931 173 93 32445 1822 877 1244 --
NM_015872chr1131775 1769 1757 1709 1455 1410 1388 1208 732 717 585 268 132 11792 11156 1204
NM_015881chr113958 353 120 2166 55 ----
NM_015898chr19192314 2118 1917 1846 1743 1705 1659 1594 1583 1573 943 884 630 577 528 441 248 215 195 22495 901 22307 589 11728
NM_015904chr23711 235 201 3698 286 242 ----
NM_015906chr184508 4269 3719 3659 3349 1321 792 432 13647 ----
NM_015912chr842027 1970 469 302 1719 ----
NM_015981chr5132968 2502 2454 2116 2084 1192 691 586 552 465 436 281 225 72797 2355 2202 538 412 103 78 32372 2349 201 --
NM_016009chr154534 4244 3994 3712 1737 13323 --13122
NM_016021chr652396 2217 1905 1896 1848 12077 ----
NM_016025chr1661981 1392 1384 1226 751 309 22009 542 ----
NM_016057chr1271123 1104 995 889 374 126 30 31058 160 76 ----
NM_016072chr1222326 1708 ----11991
NM_016096chr862130 1935 1899 1341 426 146 ------
NM_016131chr251880 1822 948 795 769 ------
NM_016147chr113930 270 224 1209 --11186
NM_016169chr1052540 2479 946 643 86 --31172 1125 595 11304
NM_016201chr3102277 2003 813 772 717 652 327 231 124 38 22163 107 11502 --
NM_016206chr388558 7281 6465 5451 3360 2592 2355 1129 38627 1596 787 17492 --
NM_016248chr1371300 1293 1286 1266 1248 1085 757 44002 1321 627 554 ----
NM_016250chr142279 236 3786 243 46 1175 --
NM_016255chr673063 2193 1133 879 596 325 66 1496 ----
NM_016260chr276590 6256 5637 5075 1477 1169 1033 25975 567 25611 1493 15358
NM_016272chr22112564 2426 1955 1769 1741 713 622 564 492 363 355 52435 1863 1816 793 774 22452 1941 --
NM_016281chr125984 905 894 882 186 --1978 183
NM_016287chr141925 1606 1344 664 2277 111 ----
NM_016320chr113317 224 119 ----2288 145
NM_016322chr932994 1228 242 --22894 2405 --
NM_016376chr17114222 3635 3432 3013 2670 1020 921 866 499 324 279 11726 21718 1078 14206
NM_016422chr1121052 144 22198 109 --12414
NM_016436chr2032048 1939 784 --1231 --
NM_016448chr161849 1708 1698 1301 720 424 --1700 --
NM_016507chr1743066 2272 685 195 32342 2282 598 ----
NM_016513chr632534 1090 538 2641 55 ----
NM_016526chr11112385 2274 2154 2136 1897 1806 1767 656 527 405 138 22176 413 --11933
NM_016530chr1543486 2498 978 612 --13099 --
NM_016531chr451338 1076 898 812 755 --21588 181 --
NM_016544chr273800 2852 2777 1443 1253 1168 1160 ------
NM_016559chr32326 31 11466 11124 --
NM_016577chr3154393 4381 4369 4094 3743 3006 2963 2769 2763 1494 1012 973 445 438 396 ------
NM_016604chr52834 235 1914 --1502
NM_016605chr5142538 2495 2349 1932 1920 1878 1863 1753 1745 1035 989 933 260 70 12061 ----
NM_016620chr111453 ----1365
NM_016621chr11134293 4081 4042 3378 3317 3262 3139 3129 3035 1684 888 745 657 24324 3155 13018 --
NM_016654chr151980 1455 11283 --
NM_016829chr34788 586 308 166 2236 180 1254 --
NM_016929chr693993 3778 3671 3272 3076 1652 1378 178 24 21457 52 23727 1514 14014
NM_016946chr153328 2935 1438 565 187 --2552 172 1241
NM_016952chr11113624 3610 3067 2904 2809 2793 2708 2638 1584 544 210 1199 --11236
NM_017409chr125830 87 54 42 21 1590 --1617
NM_017410chr1251064 478 289 188 169 1897 ----
NM_017413chrX102292 2186 2166 2048 1815 970 701 415 294 194 41672 941 159 54 ----
NM_017415chr594421 3623 3614 3513 1254 1228 969 237 189 24210 1065 14216 22883 1698
NM_017420chr1452840 2789 2709 2532 2470 ------
NM_017447chr2112699 33984 3951 46 ----
NM_017449chr161681 1603 1450 1154 672 368 21592 32 ----
NM_017450chr174499 200 73 51 ----1163
NM_017452chr2061404 1301 1123 1059 339 283 ------
NM_017453chr2061404 1301 1123 1059 339 283 ------
NM_017454chr2061404 1301 1123 1059 339 283 ------
NM_017488chr281480 1445 1294 1169 379 359 235 140 31307 394 263 ----
NM_017540chr552830 2382 2052 298 245 32230 1237 893 1704 --
NM_017563chr3125395 5178 5096 5055 4525 4015 2377 2188 1182 1163 146 47 --24748 68 25355 57
NM_017582chr121505 23 21512 101 1509 --
NM_017590chr22112437 2176 829 634 542 423 407 394 372 360 150 1233 ----
NM_017594chr972780 2623 2550 2313 551 236 36 53066 2796 887 528 53 ----
NM_017596chr1144326 4314 3460 3381 1492 1422 840 829 708 443 312 170 56 40 94548 4424 1763 1301 1287 987 745 510 66 44003 3969 3083 751 --
NM_017602chrX6372 252 141 126 114 85 ----131
NM_017610chr153448 38 30 11992 ----
NM_017626chr1051746 1336 1099 229 44 31498 1429 371 ----
NM_017628chr441563 496 230 155 13615 11230 --
NM_017637chr9129029 8707 8207 8139 7990 7508 6606 6299 6289 6270 1989 1344 59036 8319 3543 1575 372 26143 3104 28869 2449
NM_017643chr1731159 851 454 12659 ----
NM_017650chr774627 4207 4076 1776 863 728 46 172 ----
NM_017658chr1433628 2991 1569 1264 ----
NM_017700chr45510 180 132 29 23 1421 ----
NM_017712chr19186208 6186 6012 5732 5719 5709 5695 5610 5570 5458 5335 4881 2435 2333 672 624 217 150 45748 5702 4203 208 22006 1870 --
NM_017737chr14566 501 349 221 1617 ----
NM_017761chr121128 1098 11562 ----
NM_017770chr63745 575 240 --12591 --
NM_017772chr681794 1612 1364 1323 1212 1203 461 437 11669 11474 --
NM_017797chr196988 962 768 391 351 29 1109 --1248
NM_017811chr973080 2707 2500 2465 799 638 140 23162 2059 12145 --
NM_017848chrX94475 4397 4177 3126 1814 1768 1531 278 147 --23977 3861 --
NM_017860chr13610 176 168 1232 ----
NM_017893chr1021448 561 61483 1323 1235 357 241 117 31241 926 318 1284
NM_017921chr1782237 1591 799 731 577 538 272 170 31826 1778 1714 ----
NM_017954chr751652 1557 1286 674 234 11356 ----
NM_018003chr151409 12418 --1852
NM_018010chr321613 516 ----11096
NM_018011chr132436 153 ----1622
NM_018026chr11111108 1093 1075 1022 380 280 226 219 204 166 27 41340 1328 405 296 21059 973 1963
NM_018027chr1092731 2245 2101 850 367 343 305 243 36 42292 2252 2046 2008 ----
NM_018028chr1971216 1198 886 523 514 342 287 31028 893 318 --1537
NM_018036chr1464087 3787 3337 3297 3155 2982 --13258 --
NM_018045chr142545 2455 2364 2255 22344 699 23069 1967 --
NM_018071chr143656 177 109 3767 720 605 1258 --
NM_018085chr1147786 7438 6656 5934 2689 2377 1979 1916 1493 958 627 439 249 214 36734 823 776 37763 7121 815 26841 5998
NM_018110chr161939 1300 1277 1385
NM_018121chr1072713 2614 2237 2223 2213 2033 450 --1652 --
NM_018150chr13833 649 74 3614 577 103 ----
NM_018157chr1273039 2922 2412 682 622 349 321 12505 --1793
NM_018172chr11101406 1338 1224 1184 584 532 480 428 376 196 11263 1318 --
NM_018178chr131604 191 29 3804 663 258 1641 --
NM_018182chr17102065 1841 1827 1792 1772 798 743 694 421 174 1766 11999 22175 1651
NM_018195chr1131783 1742 1433 --1172 12003
NM_018200chr1551945 1587 481 246 112 1565 ----
NM_018205chr1072031 1991 1957 1607 744 307 259 ----1697
NM_018207chr161497 1442 1157 324 285 162 21208 567 ----
NM_018214chr61195 1146 1323 1361
NM_018239chr1072031 1991 1957 1607 744 307 259 ----1697
NM_018240chr14843 321 211 116 2707 146 1676 1348
NM_018244chr205890 844 426 228 213 31040 964 258 ----
NM_018299chr833019 2616 685 13154 ----
NM_018315chr431426 99 58 ------
NM_018320chr1161039 1010 992 951 506 62 ------
NM_018322chr621336 542 11226 1928 --
NM_018351chr1264333 4238 3953 3797 1214 833 24155 4147 43408 2896 1840 1032 --
NM_018362chr1143497 3392 3324 750 22708 863 ----
NM_018364chr123071 793 12940 11275 --
NM_018374chr743686 1851 1526 454 21415 275 --1250
NM_018400chr11154603 4390 4262 4024 3928 3830 3774 3765 3636 3395 3209 649 484 361 313 21824 1644 --11488
NM_018416chr1252291 990 957 112 86 11036 --22011 1817
NM_018424chr931350 484 429 1451 ----
NM_018440chr897683 7286 5536 5472 5272 1912 705 577 443 86896 6502 5964 5608 2455 2029 771 147 21782 242 16557
NM_018449chr95787 726 711 690 99 --1551 --
NM_018452chr6_random63828 3286 3014 2477 1380 901 193 12563 --
NM_018457chr121522 249 25 --1421
NM_018489chr131500 420 339 --11557 --
NM_018509chr1741327 689 650 388 31519 1455 623 ----
NM_018566chr1--34333 1954 996 11096 --
NM_018644chr1182092 1949 1644 1396 704 76 54 25 21671 740 --11607
NM_018660chr862264 2004 870 588 301 211 42018 1029 621 160 22440 2064 --
NM_018667chr1692148 1112 976 958 788 531 327 66 53 42273 2092 983 739 11016 --
NM_018717chr482724 2599 1170 936 913 757 730 369 22097 453 ----
NM_018718chr741964 651 234 158 21804 1685 ----
NM_018898chr52264 73 22060 60 ----
NM_018899chr52264 73 22060 60 ----
NM_018900chr52264 73 22060 60 ----
NM_018901chr52264 73 22060 60 ----
NM_018902chr52264 73 22060 60 ----
NM_018903chr52264 73 22060 60 ----
NM_018904chr52264 73 22060 60 ----
NM_018905chr52264 73 22060 60 ----
NM_018906chr52264 73 22060 60 ----
NM_018907chr52264 73 22060 60 ----
NM_018908chr52264 73 22060 60 ----
NM_018909chr52264 73 22060 60 ----
NM_018910chr52264 73 22060 60 ----
NM_018911chr52264 73 22060 60 ----
NM_018912chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018913chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018914chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018915chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018916chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018917chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018918chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018919chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018920chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018921chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018922chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018923chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018924chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018925chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018926chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018927chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018928chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018929chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_018945chr683387 1367 1012 819 260 155 137 32 12636 ----
NM_018976chr1242802 2216 2114 783 12108 ----
NM_018977chrX4709 436 37 27 1767 ----
NM_018979chr122462 174 1402 12329 1394
NM_018999chr1044123 3096 1849 402 23177 1858 44602 4228 3545 998 11346
NM_019000chr521320 134 --1317 --
NM_019004chr742331 1831 1734 214 --11759 11727
NM_019009chr1172468 2454 2171 2137 782 207 87 ----1423
NM_019106chr2262400 1379 1250 784 757 749 33031 766 263 23183 2801 22375 1317
NM_019116chr1673408 2819 2775 1266 803 646 74 12601 --1760
NM_019592chr92329 244 1125 1843 --
NM_019594chr991561 1441 1424 1105 1074 455 399 275 189 31183 209 79 --1368
NM_019857chrX61623 1306 1153 1122 619 207 --1111 --
NM_019885chr2162441 2344 2325 1998 1909 1822 1042 1009 934 819 640 421 339 207 188 131 1553 2699 651 --
NM_020039chr1261669 1494 1321 1282 1273 504 41226 468 279 265 1588 --
NM_020062chr205957 899 252 164 39 2882 385 ----
NM_020063chr1374 43 30 136 2227 197 --
NM_020131chr171617 1487 1371 600 433 89 29 41630 1335 1139 107 ----
NM_020134chr271166 1062 1052 1020 920 877 206 1432 ----
NM_020150chr1032144 1474 549 21922 1850 1375 --
NM_020163chr351995 1626 1617 1459 541 1734 --166
NM_020177chr553265 2386 2371 2167 400 ------
NM_020182chr20153518 3358 3169 2978 2603 2476 2294 1430 1423 1412 1237 1034 875 851 119 33005 2359 1324 23025 2246 --
NM_020205chr183428 3386 3360 1353 1100 1077 523 77 13485 ----
NM_020211chr1591379 1324 1305 1297 989 346 243 161 86 21250 49 2456 282 --
NM_020239chr172007 1902 728 693 454 173 164 11434 21540 84 --
NM_020245chr645059 4083 3297 932 24823 387 22001 1667 --
NM_020248chr142094 1735 1575 103 42161 1914 1666 111 22154 1583 --
NM_020309chr197930 426 402 357 232 148 123 2895 795 1219 --
NM_020310chr17162500 2253 1966 1947 1877 1795 1121 856 849 842 795 783 715 412 336 282 32197 2047 55 ----
NM_020337chr472991 2965 2570 1183 1115 939 905 22839 2439 ----
NM_020338chr10102908 2401 1396 1181 1073 1029 430 367 330 137 11335 126 12930
NM_020382chr1261463 1260 1063 991 545 383 1472 11411 --
NM_020383chr104151 107 79 66 ------
NM_020384chrX81649 1633 490 340 308 283 257 244 31735 1614 1476 21715 1233 11881
NM_020416chr442282 1937 880 50 2914 427 22048 989 --
NM_020423chr1138 ----1580
NM_020440chr143187 2945 2864 301 23143 284 ----
NM_020443chr1147028 6977 6845 6731 6543 6340 6329 6307 5648 2656 2226 1510 70 64 65661 5447 4442 2774 858 490 25459 4813 --
NM_020455chr622472 25 32359 2036 1118 ----
NM_020457chr164426 235 163 150 ------
NM_020475chr852452 2106 1904 548 118 22394 2133 12011 12423
NM_020476chr852452 2106 1904 548 118 22394 2133 12011 12423
NM_020477chr852452 2106 1904 548 118 22394 2133 12011 12423
NM_020478chr852515 2169 1967 611 181 22457 2196 12074 12486
NM_020480chr852452 2106 1904 548 118 22394 2133 12011 12423
NM_020526chr191767 1697 1653 1492 1210 1192 1137 687 574 1222 ----
NM_020530chr226843 696 395 358 101 88 2223 169 ----
NM_020638chr1241907 1317 717 261 1293 11763 137
NM_020648chr1852784 2255 2066 669 538 12472 ----
NM_020673chr20126778 6537 6484 4774 2301 1986 1966 1863 1819 1675 1339 1273 22404 1373 ----
NM_020686chr1672822 2386 940 743 689 432 192 1472 21155 640 2734 727
NM_020689chr204513 218 168 155 1177 1337 --
NM_020699chr193840 3364 3355 3273 1890 863 381 185 45 114983 4857 4114 3790 3374 1953 1805 1751 1670 949 413 33768 985 62 13908
NM_020703chr12202 107 ----1564
NM_020713chr20143090 3077 2868 2800 2421 2390 2262 1271 658 640 584 393 169 146 42838 820 703 86 --1101
NM_020717chrX73561 3504 1878 1235 1196 1065 29 13289 14145 11144
NM_020718chr1675382 5361 5104 2545 2370 2066 1638 35397 4199 1020 ----
NM_020742chrX41924 1057 945 811 --128 11865
NM_020749chr811870 31432 1390 206 11482 11833
NM_020760chr221448 390 21337 1239 ----
NM_020766chrX34563 2835 1001 23408 1468 --12994
NM_020772chr1778362 6725 5980 2297 491 481 250 17946 43447 3083 2285 1527 12532
NM_020774chr1855117 2031 1449 1429 1294 34595 3989 2296 ----
NM_020783chr183780 668 231 2965 461 ----
NM_020792chr331909 734 93 12260 22130 101 --
NM_020795chr17151977 1970 1948 1791 1714 1700 1292 1274 1268 1259 588 432 228 143 25 3791 424 412 ----
NM_020796chr542921 2761 655 136 22776 238 12527 22931 322
NM_020804chr6192449 2373 2274 2226 2126 2057 1924 1628 1618 966 949 857 843 411 381 339 74 53 34 81998 1964 1764 1650 612 589 488 434 ----
NM_020810chr1421125 178 12747 23236 24 --
NM_020813chr1942217 863 765 669 21961 335 3914 440 328 146
NM_020830chr242873 1077 522 59 32716 719 248 ----
NM_020850chr16142844 2838 2767 2144 2137 1027 890 883 728 616 198 140 133 117 11193 12038 13166
NM_020861chr62127 53 ----1492
NM_020870chr44651 481 473 424 11459 ----
NM_020888chr142005 1738 1309 484 11749 --1428
NM_020898chr129791 776 754 743 721 649 636 281 174 1538 1239 --
NM_020899chr1792508 1843 1700 916 619 350 260 203 177 52368 944 653 537 219 11607 --
NM_020918chr1043092 1343 146 124 ----1891
NM_020922chrX41787 670 440 238 1104 1350 --
NM_020948chr152977 2937 2707 2497 2485 12715 ----
NM_020951chr1932308 1520 496 1389 41868 1739 564 93 --
NM_020956chr19154616 4410 3496 3276 1405 1295 843 698 649 606 583 365 287 163 103 54445 4256 1086 954 305 23659 498 --
NM_020962chr1562278 1720 638 562 357 170 4782 695 678 324 1918 --
NM_020964chr1854494 4137 1478 784 641 21372 436 44290 3965 3668 3083 13360
NM_020967chr2061190 1057 241 49 30 22 --139 --
NM_020977chr421828 116 1323 --11660
NM_020983chr12112222 2193 2048 2036 2030 1639 636 533 489 396 244 21543 514 11481 --
NM_020993chr1272749 2424 1039 732 685 539 310 1865 22543 475 --
NM_021012chr1793024 2800 2462 2412 2250 998 839 583 562 21200 1125 22364 1071 --
NM_021020chr8163015 2914 2854 2572 2537 2350 2305 2178 1070 1033 954 387 357 309 162 56 33106 3027 322 21210 67 --
NM_021072chr52187 78 --191 --
NM_021079chr1783013 2560 2195 1181 843 547 236 100 53071 2891 2805 2706 486 22218 754 --
NM_021096chr22113218 2944 2859 2849 2654 2328 1256 1186 1075 803 454 23135 2937 1674 11030
NM_021097chr252173 847 726 572 173 21159 475 1462 1867
NM_021120chrX103094 2881 2845 2566 1991 424 111 78 56 49 ------
NM_021135chr682692 2292 2078 793 758 569 41 28 22736 225 11174 --
NM_021136chr143288 103 95 ------
NM_021144chr93416 124 117 ------
NM_021155chr19112445 2235 2050 1885 1855 1214 1171 944 301 146 94 22473 2405 32904 1961 437 11129
NM_021191chr1242543 1989 1732 94 ----11676
NM_021200chr1181152 1117 1078 1050 164 108 71 57 1323 1142 --
NM_021202chr20132916 2866 577 467 457 290 281 275 209 161 130 58 45 1149 11967 22587 376
NM_021215chr2032194 789 95 31763 356 241 22148 541 --
NM_021218chr91665 ----1292
NM_021238chr1221964 165 31784 660 379 21829 516 --
NM_021253chr631382 1346 202 ----11135
NM_021255chr1443808 3599 3593 2698 22928 2594 ----
NM_021638chr4164336 3715 3469 3254 3190 3155 1930 1796 1778 1272 1039 825 806 539 405 56 65051 1650 1524 1399 1046 152 14223 --
NM_021649chr52679 411 ----21544 1529
NM_021809chr2082280 2099 2070 2057 2043 1907 286 115 12350 ----
NM_021813chr695415 5086 4049 1827 1654 1510 1359 1085 155 24334 38 ----
NM_021905chr652019 1992 1502 647 50 32069 1942 1399 32276 2011 1600 --
NM_021911chr545050 1790 506 39 13812 ----
NM_021912chr1583940 3887 3594 3254 1187 956 522 394 ------
NM_021923chr471549 1267 1254 1126 1114 1102 1090 21178 1069 ----
NM_021939chr175599 524 313 212 93 2506 300 ----
NM_021945chr673391 2524 2313 826 793 371 271 22882 800 ----
NM_021946chrX81332 1308 1235 1221 1053 1010 588 70 31067 940 53 2414 192 --
NM_021949chrX42294 2179 2170 292 51887 1149 627 254 170 ----
NM_021950chr1142217 2123 2112 850 ----11494
NM_021954chr1343481 3224 2766 1242 1815 ----
NM_021961chr11126471 5897 5365 5158 2707 2423 2035 1914 1333 1120 686 667 52926 2625 2145 1875 1589 26615 2790 --
NM_021964chr325367 832 25376 2527 --14953
NM_021984chrX51165 1057 601 556 240 2173 42 1517 1128
NM_021987chrX51165 1057 601 556 240 2173 42 1517 1128
NM_021988chr2071285 1243 625 568 381 283 29 1579 11056 --
NM_021990chrX51165 1057 601 556 240 2173 42 1517 1128
NM_022003chr1151276 1029 802 453 381 3168 140 111 1151 --
NM_022048chr15105642 5170 4351 4228 4061 2005 1643 589 335 190 56127 5966 2216 1444 235 16246 14162
NM_022058chr221894 270 1188 11509 21719 23
NM_022059chr172811 702 2747 724 2771 79 1373
NM_022060chr1441173 1160 904 878 1427 11317 1434
NM_022062chr1161568 1514 1337 1328 451 293 41848 1592 1521 122 1598 --
NM_022075chr15685 677 658 237 182 1283 1128 --
NM_022114chr1204346 4152 3730 3616 3595 3506 3456 3230 3206 3184 1907 1894 1864 1606 1461 1352 1303 976 883 202 43515 1327 1096 1060 1116 23103 898
NM_022117chrX4560 535 199 65 2543 428 1447 140
NM_022131chr371469 1454 1273 1050 1039 606 360 4976 587 398 262 ----
NM_022166chr16185812 5564 5451 5177 5169 4930 4523 2327 1909 1774 1372 1356 1297 479 462 434 278 251 35061 5047 818 55067 5009 1952 1766 1014 15037
NM_022169chr11121441 1420 1398 1270 1115 1078 986 525 394 243 119 113 41405 1232 1221 132 ----
NM_022336chr252140 1900 1869 1467 25 ------
NM_022340chr332407 539 498 22573 1117 23320 1162 --
NM_022442chr2071285 1243 625 568 381 283 29 1579 11056 --
NM_022456chr1287417 6407 6046 5729 4911 1086 569 111 13085 15196 --
NM_022459chr13106318 6012 4255 4197 4102 1835 1264 613 531 407 24171 1313 --11916
NM_022462chr19113670 3565 2859 2580 1324 1290 863 690 523 293 240 33547 3363 36 21416 1203 --
NM_022465chr12142894 2825 2479 2044 1951 1874 1160 1134 1050 775 655 525 67 61 62492 2258 1903 1887 990 319 52913 2252 748 708 687 --
NM_022474chr1422403 2209 1788 12760 --
NM_022552chr251150 1040 991 262 198 ------
NM_022572chr291683 1601 1516 1507 1347 1202 551 290 264 31574 1430 409 21556 124 --
NM_022574chr7132212 2152 2121 2051 2017 1844 1741 1735 1629 1445 1427 1369 119 42188 1930 1487 809 11942 --
NM_022648chr2104595 4390 4351 4129 3414 3395 2866 1210 601 390 84457 4339 3784 3700 3349 1576 986 306 33506 1270 231 --
NM_022719chr2243880 3869 3091 538 21359 656 22837 2621 1857
NM_022730chr28837 402 299 262 181 167 112 73 2820 189 ----
NM_022748chr762355 1934 1035 368 326 277 42697 2035 959 463 --11114
NM_022749chr881414 1375 1304 1214 952 559 480 84 11205 ----
NM_022753chr152610 608 599 495 188 ------
NM_022755chr942235 942 891 875 32645 2329 446 12401 --
NM_022756chr131177 1033 277 2301 113 ----
NM_022776chr321595 1555 --158 1303
NM_022781chr973293 3027 2668 2308 845 681 259 --1675 --
NM_022832chr432491 2299 902 32349 1729 85 --12407
NM_022841chr1531826 1029 994 22668 987 ----
NM_022898chr1494861 3858 3629 3530 3208 3098 1850 329 110 13623 --13559
NM_022912chr262883 835 673 230 199 42 12840 12711 --
NM_022917chr931219 975 139 --1947 1102
NM_022918chr11--1199 --11373
NM_023000chr14152 --1147 11225
NM_023001chr14152 --1147 11225
NM_023009chr14285 153 147 126 2629 170 ----
NM_023067chr391341 1110 1033 999 420 243 203 187 141 11145 ----
NM_023079chr1781736 1630 1447 1286 1268 656 501 51 2518 27 191 --
NM_023105chr831931 173 93 32445 1822 877 1244 --
NM_023106chr831931 173 93 32445 1822 877 1244 --
NM_023110chr831931 173 93 32445 1822 877 1244 --
NM_023111chr831931 173 93 32445 1822 877 1244 --
NM_023923chr133734 2573 109 1322 23041 1123 --
NM_023930chr112838 558 1831 --1236
NM_024007chr542809 1964 861 715 22852 949 ----
NM_024016chr178542 536 525 317 263 208 155 139 1599 ----
NM_024017chr1781475 1449 1212 1135 1059 632 154 26 21462 40 ----
NM_024019chr44337 78 71 55 1907 ----
NM_024046chr331237 1027 327 3427 384 108 1352 --
NM_024090chr42244 215 1689 --11297
NM_024095chr1241169 1086 386 158 1263 1270 1194
NM_024103chr19141689 1639 1505 1409 1357 618 596 582 504 344 272 219 81 21 21426 536 41383 1275 722 249 2352 31
NM_024295chr83522 271 45 21468 392 ----
NM_024345chr986098 4566 3828 1876 490 338 326 181 55848 5577 5003 4355 1228 ----
NM_024408chr162866 1018 773 602 581 435 --22632 2326 --
NM_024411chr2061403 1285 1098 535 517 75 41537 430 209 95 ----
NM_024491chr31220 --1119 1462
NM_024522chr161563 1331 587 544 324 84 41786 1714 1540 1323 ----
NM_024524chr333041 606 540 32712 2498 2469 ----
NM_024551chr1262454 2448 1904 1735 1717 363 --12181 --
NM_024551chr1262454 2448 1904 1735 1717 363 --12181 --
NM_024594chr511945 21485 547 21417 1326 --
NM_024639chr632100 2067 182 ----12637
NM_024676chr151114 982 545 318 216 31143 840 190 1166 --
NM_024740chr1173332 3014 2939 2728 1157 1113 485 32810 1297 752 ----
NM_024749chr131679 1437 545 32143 524 233 ----
NM_024761chr9125038 4572 4299 3587 3455 3399 3370 2125 1704 1062 595 43 14286 1577 1151
NM_024770chr266374 5193 4918 4861 1791 1646 2759 509 25656 1905 --
NM_024779chr1271608 1480 1283 479 300 223 214 31061 1022 274 21601 1336 11330
NM_024811chr11101911 1808 1639 1619 1582 1557 600 180 122 50 21628 106 --21889 393
NM_024850chr55838 572 343 266 205 2640 287 ----
NM_024874chr1111258 1232 1112 1100 1024 967 472 417 266 233 55 2861 160 ----
NM_024881chr1962392 1046 971 546 471 41 1747 33022 2936 583 1319
NM_024887chr191599 1587 1442 1358 807 691 522 356 58 2571 212 ----
NM_024889chr1021176 555 71199 1184 1148 1133 717 632 71 21223 325 --
NM_024896chr921838 60 --21879 446 --
NM_024909chr671468 1304 562 524 491 458 421 21418 1226 41555 1547 1321 484 --
NM_024939chr1641378 463 455 38 1179 --1157
NM_024947chr389135 8967 8752 8675 6881 2480 2085 126 28158 3547 28954 3066 --
NM_024949chr464895 4827 4788 4310 4126 1268 11215 ----
NM_024991chr1042376 1289 436 265 1516 --1540
NM_025061chr194847 389 316 298 2961 431 ----
NM_025083chr1561832 1821 630 618 412 34 31885 534 424 ----
NM_025146chr331997 464 104 32640 2585 72 ----
NM_025151chr821448 195 11589 1114 1381
NM_025160chr184022 3126 3079 1564 1455 1444 1293 879 12840 1233 13791
NM_025164chr11102225 1822 1814 1752 1694 1614 1520 788 524 444 11405 1479 --
NM_025179chr1144600 4484 4437 4258 3881 3315 3188 1938 999 480 456 214 149 110 54694 3554 1817 961 473 13649 13298
NM_025222chr352933 1223 799 465 364 1981 ----
NM_025224chr2072149 2070 1923 724 453 268 122 31814 1459 459 ----
NM_025236chr64711 683 673 632 4748 566 266 235 --171
NM_025248chr17143188 2996 2759 2741 2719 2072 1078 711 607 449 379 75 57 32 32961 339 40 ----
NM_025251chr881047 900 812 805 495 475 463 70 1124 ----
NM_025263chr661233 584 541 436 392 141 1343 1636 --
NM_030576chr1762453 2260 669 397 250 175 2362 300 11721 --
NM_030582chr212229 142 1485 --1377
NM_030621chr1454249 3482 3340 1395 932 ------
NM_030623chr251191 589 564 491 297 21426 622 ----
NM_030627chr543799 3499 3174 515 1440 --1661
NM_030640chr124870 727 276 61 --1232 1326
NM_030647chr794921 4754 4559 3839 2523 1743 1374 712 77 15078 11981 1811
NM_030648chr465200 4865 4779 1776 918 111 14312 ----
NM_030660chr1421366 505 ----11354
NM_030661chr741396 586 153 36 11634 ----
NM_030664chr1032357 843 298 1500 --1275
NM_030674chr12104290 3867 1806 1728 1386 764 643 181 50 27 75603 5113 4689 4554 3893 1304 1249 24029 1486 --
NM_030758chr2261416 1119 956 389 140 102 192 1912 --
NM_030761chr132223 2194 2096 51900 1036 955 810 71 --22661 1759
NM_030762chr122239 230 ----1296
NM_030802chr174919 99 69 58 3756 653 289 --1252
NM_030806chr1219209 9173 9002 8739 8324 8244 7879 7745 7435 6399 6341 6096 3469 3452 3265 1880 1641 1634 1028 435 416 37059 2548 786 1721 --
NM_030808chr1721041 441 31092 395 38 ----
NM_030809chr1252463 1740 950 521 45 31826 616 374 12116 11749
NM_030884chr3151830 1702 1664 1622 723 624 540 481 294 166 76 63 54 43 32 12142 1368 12154
NM_030914chr96921 851 256 131 90 83 2786 122 160 --
NM_030918chr1114790 4607 4546 4295 4124 4094 3517 2068 1330 856 509 55018 4277 4212 3440 1727 24253 832 --
NM_030920chr172070 1763 1719 1401 810 227 87 ------
NM_030952chr141276 436 397 332 2320 80 --1921
NM_030964chr593563 3060 2408 1381 1060 815 695 636 361 22554 508 --22578 178
NM_030981chr1191136 1038 1020 970 809 390 316 136 78 1818 1884 --
NM_031215chr2061654 1539 357 207 191 82 2564 502 21695 514 --
NM_031216chr1841782 1743 1681 80 2107 87 --11637
NM_031309chr8102219 1882 1755 1470 823 645 589 344 288 218 3693 390 248 ----
NM_031314chr1441925 530 120 83 2742 90 11479 --
NM_031411chr52264 73 22060 60 ----
NM_031417chr19152763 2169 2096 1118 923 871 800 717 707 598 513 414 361 309 254 --11796 --
NM_031426chr992104 1071 565 538 311 227 220 202 45 12167 11023 --
NM_031439chr831650 1230 93 51545 1326 271 247 189 1183 --
NM_031444chr2251918 1669 775 331 42 1669 --1437
NM_031445chr232880 662 351 22403 254 1409 --
NM_031468chr7167449 7390 6552 6187 3217 3029 2889 1994 1918 1853 1739 1629 1516 899 882 180 87616 2944 2253 2096 1095 737 514 73 11601 15583
NM_031469chr654104 4031 3301 2768 622 1875 ----
NM_031474chr1241624 1601 250 21 1149 --1436
NM_031483chr2033327 799 482 --12360 1152
NM_031844chr173545 1551 1256 1103 974 487 349 22655 849 --11507
NM_031845chr231033 925 118 --11375 --
NM_031847chr231033 925 118 --11375 --
NM_031849chr52264 73 22060 60 ----
NM_031857chr52264 73 22060 60 ----
NM_031860chr52264 73 22060 60 ----
NM_031866chr103751 389 245 2947 223 11044 --
NM_031890chr22132870 2692 2634 2377 2173 2146 1212 956 656 615 341 298 42 12080 --11103
NM_032012chr955128 4407 4315 1374 630 1511 24763 1812 --
NM_032017chr1151867 1834 1764 1600 1515 1382 1287 848 783 734 714 670 480 433 97 41453 584 450 344 ----
NM_032041chr83529 136 111 41915 1864 539 512 --1457
NM_032042chr53610 411 385 12514 ----
NM_032088chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_032092chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_032105chr1167698 7528 7391 6978 6802 6588 5653 5332 3137 2930 2121 2055 2005 1971 1737 1050 107766 7364 7238 7020 6694 6631 1038 852 767 37 36813 1831 737 26606 6023
NM_032109chr581188 462 433 424 347 228 220 191 2443 147 ----
NM_032121chrX42569 591 211 175 22059 897 ----
NM_032160chr1853295 1540 1028 874 321 43347 2870 2691 1316 1756 --
NM_032186chr111453 ----1365
NM_032193chr11111886 1829 1817 1778 1619 812 614 363 333 151 34 21351 322 1509 --
NM_032217chr42250 244 ----1183
NM_032228chr1162712 2566 2357 2153 1268 891 13031 ----
NM_032242chr393058 2912 2826 2546 671 596 423 384 136 12153 23198 823 --
NM_032268chr16132871 2584 2433 2263 2199 662 569 535 472 355 223 158 151 11087 ----
NM_032271chr1661529 513 260 247 169 29 --1569 --
NM_032281chr1972581 2556 2529 2510 2459 2371 458 22669 1156 2221 209 --
NM_032287chr2284158 3611 2882 1288 897 390 242 134 13768 23986 3720 --
NM_032316chr331838 1534 274 41998 1511 464 332 22439 2325 --
NM_032325chr1171895 1287 708 680 576 517 68 21905 598 --11859
NM_032345chr121392 2160 141 --1403
NM_032364chr1231007 747 195 2215 85 177 --
NM_032389chr1171070 990 759 751 425 419 214 31084 345 313 ----
NM_032403chr5101653 1487 1420 1324 718 590 357 176 132 39 41397 1365 505 316 ----
NM_032408chr741113 997 990 160 --1139 --
NM_032420chr55758 668 620 219 181 4367 237 159 33 --1198
NM_032431chr112982 83 1302 --1139
NM_032434chr241020 251 182 131 21364 1226 1174 --
NM_032439chr1041621 1183 179 39 ------
NM_032449chr162673 2160 2100 813 716 526 --1515 --
NM_032452chr1471451 1443 1305 1289 1247 1069 513 21353 229 11227 1552
NM_032457chr453217 2738 528 375 232 1254 ----
NM_032491chr123530 508 291 ----176
NM_032552chr961856 1795 1685 718 159 107 21657 281 1787 --
NM_032569chr1661475 792 487 469 168 106 1442 21366 36 1477
NM_032575chr1691950 1531 1349 711 512 462 418 296 281 62025 1363 363 328 311 247 ----
NM_032581chr761896 1307 774 237 212 132 122 ----
NM_032595chr1791577 1348 1332 1292 1179 468 118 85 53 51172 1120 549 373 142 11367 --
NM_032632chr1421545 813 11500 --11434
NM_032711chr17103736 3323 2827 2786 1684 930 385 358 97 72 23472 109 ----
NM_032741chr69875 674 319 278 270 102 44 34 23 --1405 --
NM_032804chr1052530 952 807 741 630 1313 ----
NM_032810chr1011566 ----1626
NM_032826chr7104878 4783 4709 3725 3693 3326 1572 579 566 409 44442 3368 537 420 25106 1223 --
NM_032832chr651130 1094 447 415 389 --1592 --
NM_032837chr1712022 ----11610
NM_032840chr127995 975 880 810 733 295 30 2402 305 ----
NM_032846chr1441267 405 191 170 --21083 218 --
NM_032900chr1063784 3689 3091 2394 748 523 43737 3535 3338 3123 12899 --
NM_032918chr12256 45 11116 ----
NM_032968chrX54087 4024 1566 1392 524 12629 1232 --
NM_032969chrX54087 4024 1566 1392 524 12629 1232 --
NM_032973chrY54079 4016 1565 1392 524 12628 1232 --
NM_032982chr772079 2018 1850 934 852 841 405 12141 2917 431 32423 319 122
NM_032983chr752893 2832 2664 2228 1219 22955 2352 21245 478 33237 1133 936
NM_032998chr151049 896 828 747 194 1904 --1161
NM_033016chr2281511 1451 1399 563 424 340 189 96 21360 145 ----
NM_033020chr184508 4269 3719 3659 3349 1321 792 432 13647 ----
NM_033089chr202503 347 21136 510 146 --
NM_033127chr11544 ----270 31
NM_033129chr20122010 1972 1709 1558 1503 1480 1332 1313 325 299 202 152 32016 469 194 31703 530 233 1551
NM_033133chr17103733 3519 3490 2835 2617 1359 797 725 499 178 13720 1612 11515
NM_033136chr551220 541 463 436 159 --2691 570 --
NM_033137chr551220 541 463 436 159 --2691 570 --
NM_033141chr1431843 447 337 31511 461 265 21850 1501 --
NM_033161chr941336 387 106 95 1246 21462 471 --
NM_033224chr7147544 6565 6312 6222 5698 1198 1113 974 911 454 312 240 77 61 15416 145 12765
NM_033225chr862858 2300 972 957 576 85 1374 1773 --
NM_033274chr5153342 3181 3115 3000 2911 1079 1046 822 810 613 596 583 135 106 22 43349 939 287 118 22352 146 --
NM_033278chr113344 332 137 ----1291
NM_033285chr853571 3194 3017 1577 941 44016 1198 1166 574 ----
NM_033290chrX33715 2345 1205 23023 929 ----
NM_033315chr17102207 2072 1992 1809 1785 1648 1389 1380 880 450 21815 1638 22018 491 --
NM_033326chr1132302 1628 893 11904 --11822
NM_033331chr953093 2755 2299 1072 852 12743 22709 2419 --
NM_033360chr1274222 1180 972 703 630 476 314 ------
NM_033375chr1751416 512 475 467 52 --1147 1130
NM_033389chr1774747 4330 3301 1017 838 807 408 24140 1004 ----
NM_033397chr1051980 1812 441 243 26 31639 1545 741 --32068 1896 50
NM_033419chr1791546 1205 1091 504 412 332 322 307 64 1440 21224 1171 --
NM_033425chr1143397 2943 2344 889 --11346 --
NM_033430chr423206 2742 14018 11544 --
NM_033437chr423206 2742 14018 11544 --
NM_033449chr541876 1679 1640 1440 62146 1494 1461 1365 731 323 ----
NM_033503chr15123855 3705 3648 2887 2762 2572 2509 2386 1256 1041 1032 262 33028 2400 1177 --12604
NM_033505chr265641 2441 1133 931 720 521 35635 1026 59 ----
NM_033512chr861211 1196 1167 1147 1012 356 12299 --21139 337
NM_033551chr5123168 2940 2680 2347 1331 1119 863 650 641 549 402 380 --22664 196 --
NM_033624chr12--31665 797 170 1342 --
NM_033626chrX41318 1202 407 395 21754 511 1458 --
NM_033631chr1103921 3863 1284 984 974 874 844 745 510 303 21376 217 1680 1998
NM_033632chr431426 99 58 ------
NM_033637chr10133991 3822 3808 2657 2552 1529 1499 1186 735 556 479 286 276 43430 1395 904 668 13328 --
NM_033644chr542199 2074 700 213 2691 250 ----
NM_033645chr542199 2074 700 213 2691 250 ----
NM_052818chr1351620 1597 1520 1460 382 --12039 --
NM_052840chr1571606 1523 1515 1458 1111 565 482 1583 ----
NM_052845chr1283126 2629 2579 2511 2326 2086 900 716 1211 133 --
NM_052847chr19133799 3563 3358 3279 3120 3014 2771 2292 1465 729 691 156 120 23166 3002 22580 149 1311
NM_052851chr1362130 2087 1662 686 367 205 ------
NM_052854chr11----1455 1430
NM_052876chr19132510 2498 2396 2119 1856 1689 1029 1019 869 499 281 89 35 32423 1998 157 21648 877 --
NM_052885chr1254749 1816 1622 978 564 ------
NM_052896chr172529 2057 2039 1996 1962 1937 83 2424 60 ----
NM_052897chr123682 655 589 3296 265 144 ----
NM_052906chr22154995 4809 4776 4690 3856 3761 3612 3557 3372 1698 1250 1095 1080 986 668 45003 4258 4238 586 21860 1176 13599
NM_052910chr1361475 1450 1349 399 182 96 31815 1404 52 11497 --
NM_052918chr10102616 2591 2582 1294 1185 1017 884 781 428 181 12276 ----
NM_052925chr1911998 984 972 883 862 856 765 714 706 663 133 ------
NM_052934chr192198 1833 1464 772 607 171 160 148 136 21750 502 11858 1110
NM_052961chr63338 331 323 --146 --
NM_053016chr965302 4933 2357 1697 1034 795 57081 7017 5592 4893 1353 ----
NM_053023chr1182156 950 647 620 405 397 193 179 12364 52793 577 562 321 171 --
NM_053024chr341036 1001 334 176 --1137 --
NM_053043chr786190 5620 5489 4629 4069 3942 3926 992 26206 5798 15598 14152
NM_053279chr872610 1089 727 709 699 345 95 1160 1292 --
NM_054025chr1182092 1949 1644 1396 704 76 54 25 21671 740 --11607
NM_054027chr56855 805 580 397 319 302 21800 74 1641 --
NM_057159chr951288 1181 217 211 58 ------
NM_057161chr67558 450 360 353 213 187 24 --1374 --
NM_057169chr1263049 2624 2618 2383 484 314 32645 1062 771 ----
NM_057170chr1263049 2624 2618 2383 484 314 32645 1062 771 ----
NM_057178chr1772216 2005 767 407 356 338 309 --32489 2320 929 --
NM_057749chr831198 850 237 1933 ----
NM_058164chr193329 177 115 178 --1358
NM_058240chr1441409 1377 281 80 41282 1226 663 65 1269 --
NM_078471chr1761247 1207 1098 858 425 323 291 63 ----
NM_078487chr962851 2771 2064 1063 990 849 22366 317 22433 1199 22752 668
NM_079834chr1991646 1425 1214 1196 663 544 498 369 39 21578 1230 2554 100 --
NM_080415chr175940 854 658 634 193 2698 27 ----
NM_080491chr11123573 3246 3239 3192 2824 1529 856 797 398 159 86 38 43433 3378 2848 850 33360 2714 61 12629
NM_080538chr341510 1158 1061 1042 21342 244 ----
NM_080539chr331158 1061 1042 31511 1342 244 ----
NM_080541chr341510 1158 1061 1042 21342 244 ----
NM_080546chr922151 2090 1518 --1767
NM_080607chr206885 801 769 693 389 107 3877 760 350 --1405
NM_080621chr2071275 1192 1072 1021 893 319 260 31015 438 380 1356 --
NM_080625chr204820 424 122 30 2954 903 1909 --
NM_080654chr113370 342 116 --1264 --
NM_080669chr1754688 3749 3184 577 268 11320 33015 1982 1492 14017
NM_080738chr151874 1401 414 310 249 1128 ----
NM_080792chr2071952 728 677 487 398 200 148 1587 11486 --
NM_080836chr20123989 3914 3463 3244 2938 2891 1492 1456 1420 842 404 171 43555 1322 1165 78 43969 3548 3014 127 24714 3534
NM_080867chr1454698 3345 1117 464 458 ------
NM_080872chr883838 3647 3321 1635 1147 1072 793 217 --1128 --
NM_080927chr342823 2816 2426 761 23217 843 ----
NM_130438chr2161276 994 805 410 295 258 2819 533 11004 --
NM_130442chr731155 465 125 --1458 --
NM_130445chr212229 142 1485 --1377
NM_130446chr331102 956 435 169 43576 1685 947 123 --
NM_130459chr961539 1485 1420 415 172 93 31372 1138 515 2628 601 --
NM_130463chr65782 665 314 175 84 3854 797 43 --2103 56
NM_130797chr761283 239 222 174 82 75 1278 11097 --
NM_130809chr543062 2395 1903 1070 136 12641 --
NM_130811chr2021147 978 125 ----
NM_133170chr20157400 5734 5590 5505 5048 2791 2733 2528 2374 1729 1674 1409 753 568 372 77779 7146 5605 3116 2825 1427 620 25940 3127 26667 5075
NM_133264chr1762967 2523 2445 1372 797 142 33722 3392 237 173 12553
NM_133265chrX52596 2498 1162 655 56 13574 ----
NM_133266chr1131065 862 791 1272 1153 1322
NM_133330chr482776 2290 2091 2032 635 342 288 166 ----22571 2528
NM_133331chr482776 2290 2091 2032 635 342 288 166 ----22571 2528
NM_133335chr482776 2290 2091 2032 635 342 288 166 ----22571 2528
NM_133367chr643351 2959 630 540 --22395 970 13306
NM_133370chr453495 2892 2839 725 659 62997 2914 2785 2770 1180 496 ----
NM_133372chr542346 1051 996 754 ------
NM_133445chr962372 1198 1140 890 806 140 23542 3395 --33060 1153 1090
NM_133452chr1971191 1126 987 873 767 276 259 --21171 914 --
NM_133496chr141731 442 352 196 1233 13142 14508
NM_133499chrX7936 632 274 239 212 157 99 3801 690 368 1173 --
NM_133647chr1573652 3521 3497 3490 1250 902 474 33643 210 54 23331 596 --
NM_134268chr17101156 1133 1127 1115 1109 1094 968 155 124 110 1954 ----
NM_134325chr151733 1368 498 307 142 31285 655 37 11393 1675
NM_138282chr65782 665 314 175 84 3854 797 43 --2103 56
NM_138288chr141790 ----11809
NM_138300chr191649 1591 1101 574 523 463 337 107 40 51480 1366 1329 1273 552 ----
NM_138319chr1551184 1114 433 369 199 162 2402 121 --
NM_138333chr942663 2222 278 127 32610 2135 216 --12020
NM_138434chr731504 132 80 1113 1406 --
NM_138444chr1374766 3011 1685 185 156 112 88 1304 ----
NM_138457chr6163290 3232 3199 2875 2510 2114 1332 1113 962 944 917 796 548 325 280 183 83241 2449 2396 1190 1084 909 709 314 166 --
NM_138459chr632610 2387 111 11284 ----
NM_138468chr286220 6070 4853 4719 1078 873 740 707 ------
NM_138473chr1295081 4986 4779 4759 4629 4295 4130 3734 1235 54637 4533 4232 4210 1314 33800 935 332 --
NM_138479chr151396 1355 733 222 49 2719 57 ----
NM_138576chr1494861 3858 3629 3530 3208 3098 1850 329 110 13623 --13559
NM_138578chr2071335 1153 1118 570 487 453 443 21401 382 159 --
NM_138609chr51427 --169 1388
NM_138610chr51427 --169 1388
NM_138619chr1771353 1300 547 485 458 399 23 ----1383
NM_138635chr773032 2415 2013 1026 616 479 341 ------
NM_138713chr16117547 7402 7390 7141 5731 5565 5502 1760 1154 1082 842 22581 1044 1773 --
NM_138714chr16117547 7402 7390 7141 5731 5565 5502 1760 1154 1082 842 22581 1044 1773 --
NM_138717chr62694 449 3514 211 185 --2597 119
NM_138732chr116621 402 223 176 98 72 1920 ----
NM_138734chr116621 402 223 176 98 72 1920 ----
NM_138959chr184661 4312 2160 2112 1850 1301 903 343 26749 2177 16761 --
NM_138967chr15132235 1908 989 979 944 935 921 731 614 583 538 258 92 62429 2007 1916 1732 681 590 1556 --
NM_138971chr1153464 3387 3162 1444 688 31430 1391 1024 22398 32 12643
NM_138971chr1153464 3387 3162 1444 688 31430 1391 1024 22398 32 12643
NM_138972chr1153464 3387 3162 1444 688 31430 1391 1024 22398 32 12643
NM_138972chr1153464 3387 3162 1444 688 31430 1391 1024 22398 32 12643
NM_138973chr1153464 3387 3162 1444 688 31430 1391 1024 22398 32 12643
NM_138973chr1153464 3387 3162 1444 688 31430 1391 1024 22398 32 12643
NM_138981chr4228 21 2301 51 ----
NM_139012chr672169 1956 1935 1892 1873 1612 351 3789 491 108 ----
NM_139014chr672249 2036 2015 1972 1953 1692 431 3869 571 188 ----
NM_139057chr1572577 2361 2166 1885 1828 1789 380 12094 ----
NM_139071chr12121655 1602 1434 1416 1406 1039 666 575 505 481 241 166 11324 11371 --
NM_139125chr371376 1350 1260 1027 624 561 32 2635 594 ----
NM_139132chr113317 224 119 ----2288 145
NM_139135chr181246 912 897 225 175 162 128 21 ------
NM_139276chr1772207 1880 1599 1580 967 310 130 ------
NM_139279chr282828 2688 2377 1255 1232 1028 925 509 2666 522 ----
NM_139280chr1741367 1259 1151 137 1151 --11387
NM_139283chr1242399 840 731 47 ------
NM_139316chr72205 195 --2400 271 --
NM_139321chr2063117 2647 1484 1350 749 725 63069 1529 1497 1321 172 23 13180 --
NM_139323chr2031967 1444 58 21497 1365 11753 --
NM_144571chr477012 6997 6989 6599 5654 2202 1192 11726 ----
NM_144578chr1485227 5089 4233 1679 981 971 875 394 15237 ----
NM_144579chr272653 2245 2176 1108 968 727 691 11176 1853 --
NM_144590chr1032485 539 467 ----12405
NM_144599chr1553989 2056 1518 523 199 13578 ----
NM_144609chr17125 2296 112 1366 --
NM_144617chr194892 835 810 49 2932 695 1765 1879
NM_144628chr2042182 1963 1924 684 31936 1055 227 ----
NM_144667chr1241082 796 453 35 --11063 --
NM_144732chr196990 297 235 165 146 128 6936 911 724 423 364 46 1348 --
NM_144973chr1254715 4281 4041 1405 129 145 1965 --
NM_145013chr116971 823 792 649 111 72 42830 870 176 47 22748 2405 12086
NM_145055chr1853226 790 149 138 52 32530 2508 219 11400 --
NM_145056chr195626 325 247 129 26 1164 ----
NM_145112chr1461309 492 234 227 214 118 2347 184 155 --
NM_145113chr1451581 506 499 486 390 3619 456 44 1327 --
NM_145176chr643089 2727 2232 162 11029 1156 --
NM_145206chr1053313 3059 2293 2261 1255 32243 705 119 ----
NM_145239chr1641184 414 266 201 --3481 242 63 --
NM_145254chr16------150
NM_145259chr285374 4855 4414 2414 799 573 448 55 --15389 14725
NM_145296chr194815 606 112 47 5696 685 626 589 213 1582 --
NM_145307chr1013527 24254 4164 12968 --
NM_145320chr763125 2636 2386 844 643 404 22278 379 13601 --
NM_145321chr763125 2636 2386 844 643 404 22278 379 13601 --
NM_145322chr763125 2636 2386 844 643 404 22278 379 13601 --
NM_145733chr221189 1820 1972 1164
NM_145798chr177820 622 609 562 282 133 42 2802 216 --1647
NM_145799chrX7710 507 483 451 367 264 108 22095 302 1289 23009 1029
NM_145800chrX1156 ----1820
NM_145802chrX1105 ----1769
NM_145804chr11101067 1025 882 519 288 272 231 160 130 111 1121 ----
NM_145861chr151874 1401 414 310 249 1128 ----
NM_145868chr10----1274 1217
NM_145869chr10----1274 1217
NM_145888chr1971938 737 608 187 106 86 79 11577 2176 159 1697
NM_147202chr972593 2566 2500 1940 607 529 146 12145 32374 2163 846 --
NM_147223chr242485 1968 1942 1656 11785 12188 --
NM_147233chr242302 1785 1759 1473 11602 12005 --
NM_148414chr16140 2170 128 3317 161 26 --
NM_148921chr1742330 1533 776 365 1217 11638 --
NM_152237chr22121528 1515 1392 1254 1146 532 488 450 395 333 322 143 21159 1138 ----
NM_152253chr2244171 3988 3846 300 24178 1271 11021 23707 1367
NM_152265chr131296 418 182 --1363 11056
NM_152280chr152946 2744 2308 824 26 42795 2275 764 338 23456 1228 --
NM_152341chr1671118 476 414 382 251 206 60 ------
NM_152388chr263805 3072 1487 1333 1205 415 --1880 --
NM_152409chr532800 2778 2462 13024 ----
NM_152424chrX114611 4286 4208 4182 4003 3683 3645 3638 3216 2994 1667 64554 4189 4011 3823 3061 492 34201 802 597 --
NM_152437chr1271996 1556 608 557 541 366 102 ------
NM_152455chr153248 206 167 1967 ----
NM_152470chr1863684 3197 2976 2865 208 46 22984 1251 21220 934 13602
NM_152527chr242340 1838 1543 913 --1612 --
NM_152563chr11101406 1338 1224 1184 584 532 480 428 376 196 11263 1318 --
NM_152594chr1542332 1942 1447 559 ------
NM_152622chr51478 2316 283 --1269
NM_152629chr964060 2886 2681 1594 1158 424 13170 33822 2756 1124 12981
NM_152636chr1131993 1922 40 12708 ----
NM_152699chr353241 2473 764 517 64 22804 230 ----
NM_152716chr1151472 1405 1373 1200 307 51450 1164 369 172 104 1317 --
NM_152734chr6145104 5070 4644 4422 4399 3955 3734 3602 3317 1024 758 714 708 691 44574 2050 1962 1582 ----
NM_152740chr73269 259 135 ----1576
NM_152745chr71451 ----1188
NM_152749chr721000 258 ----1801
NM_152754chr753565 1516 892 346 69 1627 ----
NM_152787chrX33607 1448 395 21565 1494 ----
NM_152789chr741253 544 450 23 ------
NM_152860chr1261438 1371 235 157 128 118 21023 383 31426 1068 999 --
NM_152866chr1142217 2123 2112 850 ----11494
NM_152924chr15116007 5848 4645 4581 4538 1890 1569 1560 1241 643 53 54179 2658 2378 1113 77 32715 1086 83 --
NM_152999chr774898 4460 4220 3711 3566 3491 1010 --11657 --
NM_153013chr522290 359 22353 1629 --11744
NM_153029chr16193965 3906 3820 3810 3759 3707 3537 3468 3397 3383 2903 2879 2867 2816 2621 1390 1086 924 677 53893 3178 3095 3078 2633 --23308 2687
NM_153035chr142167 2015 554 456 1328 32924 2106 418 --
NM_153188chr545515 5056 1572 1380 14043 15450 --
NM_153234chr542498 2414 2121 1792 ----1358
NM_153246chr6171972 1908 1870 1849 1806 1760 1684 1570 1511 1455 1417 1378 1339 1259 486 441 65 71784 1650 1612 1551 1535 662 185 11723 --
NM_153257chr191302 2780 311 ----
NM_153262chr122269 2239 23009 248 --12914
NM_153273chr372386 2354 2127 1814 1127 875 719 3918 627 417 ----
NM_153343chr452286 2173 910 472 431 12154 --11686
NM_153367chr1083778 3717 1463 1418 1163 935 761 303 23534 952 1469 11205
NM_153371chr1321477 689 2574 472 --1370
NM_153487chr6144718 4509 4220 3995 3899 3836 3827 3302 3162 3155 1226 1166 1135 686 64764 4068 3911 3796 761 399 44404 3441 3051 1779 11600
NM_153499chr1262935 2849 2642 2560 2121 50 ------
NM_153500chr1262935 2849 2642 2560 2121 50 ------
NM_153619chr15112297 2285 2259 1258 1091 923 860 826 812 663 491 ----1470
NM_153620chr751363 428 351 315 180 --1638 11418
NM_153631chr741396 586 153 36 11634 ----
NM_153632chr741396 586 153 36 11634 ----
NM_153645chr2232047 1113 187 12294 1707 --
NM_153685chr1291114 1086 1067 1021 1010 1002 881 305 223 1485 ----
NM_153693chr126779 257 205 112 38 30 3332 172 62 ----
NM_153705chr112759 109 --1698 22280 161
NM_153759chr251150 1040 991 262 198 ------
NM_153810chr1074482 4277 4042 3362 829 765 650 34318 570 324 ----
NM_153827chr1710712 698 609 573 281 247 219 179 82 45 2519 186 2565 511 --
NM_170663chr1710712 698 609 573 281 247 219 179 82 45 2519 186 2565 511 --
NM_170665chr1222786 572 63574 3103 1797 1789 1295 529 24243 3126 --
NM_170692chr151153 1124 921 880 54 1195 11162 --
NM_170706chr162884 943 589 398 163 86 44115 3854 3261 283 31428 359 320 --
NM_170743chr192815 2596 2065 1948 1175 893 310 181 96 2485 449 --1833
NM_170769chr64711 683 673 632 4748 566 266 235 --171
NM_171825chr5132968 2502 2454 2116 2084 1192 691 586 552 465 436 281 225 72797 2355 2202 538 412 103 78 32372 2349 201 --
NM_172016chr631382 1346 202 ----11135
NM_172070chr21622 32034 899 298 ----
NM_172071chr1107016 6419 6352 6130 6056 5521 5510 4845 4772 593 15826 ----
NM_172130chr141189 422 314 40 3585 528 296 --2275 146
NM_172226chr1262935 2849 2642 2560 2121 50 ------
NM_172230chr112982 83 1302 --1139
NM_173054chr7------1708
NM_173064chr192815 2596 2065 1948 1175 893 310 181 96 2485 449 --1833
NM_173191chr1031047 387 92 41284 377 350 289 ----
NM_173192chr1031047 387 92 41284 377 350 289 ----
NM_173193chr1031047 387 92 41284 377 350 289 ----
NM_173194chr1031047 387 92 41284 377 350 289 ----
NM_173195chr1031047 387 92 41284 377 350 289 ----
NM_173214chr16117547 7402 7390 7141 5731 5565 5502 1760 1154 1082 842 22581 1044 1773 --
NM_173358chrX2561 399 1500 1574 1486
NM_173475chr1621674 573 21569 676 --1219
NM_173511chr253919 2674 2413 1041 952 21490 611 1151 --
NM_173552chr342456 2148 573 457 --1707 --
NM_173595chr12365237 5168 5141 5080 4982 4768 4635 4345 4313 4205 3927 3788 3646 3593 3586 3434 3211 2070 2004 1752 1603 1561 1394 1159 997 724 660 507 500 444 437 366 358 325 305 22 84774 4691 3447 2023 1872 1635 573 277 35215 1847 393 13638
NM_173602chr1243399 3125 2857 803 22556 377 ----
NM_173653chr331007 369 149 1900 1183 --
NM_173681chr7102042 1932 1882 1753 1640 1477 1431 655 365 88 11459 ----
NM_173822chr24746 601 358 206 1753 21759 177 --
NM_173825chr352921 2840 2826 558 399 1709 ----
NM_173829chr565578 4566 4124 3743 2344 2173 --1147 --
NM_173832chr8123384 2738 2672 2491 2364 2341 695 651 612 525 490 69 ----13443
NM_173833chr881613 1241 1167 492 457 419 169 55 ------
NM_173851chr843723 3610 3233 2890 13355 2604 303 --
NM_173854chr1102255 1935 1800 1479 1472 800 776 729 670 65 51966 866 760 78 24 130 --
NM_174911chr84830 230 79 68 32507 1112 670 21134 1118 --
NM_174934chr11112833 2532 1347 1276 983 932 921 871 576 310 274 32632 1199 344 2605 167 1545
NM_174975chr22295 67 ----1282
NM_175623chr1287417 6407 6046 5729 4911 1086 569 111 13085 15196 --
NM_175629chr251150 1040 991 262 198 ------
NM_175733chr1121694 628 22160 1950 11708 11727
NM_175736chr12237849 7622 7153 6955 6404 6343 6120 6059 5479 5381 5150 4998 4781 4771 3024 3013 2709 2698 2537 2366 2144 1112 856 45281 2753 2458 310 46663 6426 6237 5599 25958 5589
NM_175767chr521897 178 ----1230
NM_175852chr142036 1868 1168 636 22734 2500 11880 --
NM_175859chrX61623 1306 1153 1122 619 207 --1111 --
NM_175861chr1245688 1360 650 428 55918 5399 4895 3935 1894 35774 2225 576 14673
NM_175907chr1882184 2051 1797 1048 542 473 206 151 12313 ----
NM_175931chr1691645 1616 1496 1432 1306 524 379 359 268 1600 --11626
NM_176792chr1051409 920 374 152 141 1461 11110 --
NM_176801chr491361 741 699 592 477 408 282 75 63 --11721 --
NM_176863chr1791919 1575 1519 1511 1491 792 706 313 303 11804 22147 486 --
NM_176871chr873053 2432 2322 2196 2165 1132 371 33354 3020 2494 22695 1251 --
NM_177401chr1971370 706 619 407 388 304 251 41329 1240 320 113 --11197
NM_177438chr1454249 3482 3340 1395 932 ------
NM_177452chr1451864 1544 935 763 720 --22129 1577 --
NM_177559chr2061099 1014 1004 369 277 225 21022 384 --1792
NM_177560chr2061099 1014 1004 369 277 225 21022 384 --1792
NM_177925chr1252917 2593 2045 1176 737 32146 965 34 12176 --
NM_177972chr1184182 4164 3603 3521 1581 1328 951 82 32745 1270 831 14153 --
NM_177977chr1792003 1857 1791 1269 752 578 513 271 175 --21874 113 1302
NM_178006chr1362130 2087 1662 686 367 205 ------
NM_178007chr1362130 2087 1662 686 367 205 ------
NM_178011chr1033204 2792 2766 --1112 12758
NM_178013chr14132553 2306 2281 2231 2111 938 794 585 575 498 422 365 234 51192 1157 982 972 930 3991 657 257 12676
NM_178014chr65898 829 745 657 298 3853 641 74 ----
NM_178037chr1242729 2225 1321 1267 23112 991 22251 141 11408
NM_178038chr1242729 2225 1321 1267 23112 991 22251 141 11408
NM_178120chr271089 1037 921 512 130 45 30 ------
NM_178126chr1782233 1810 1420 374 294 169 93 48 21826 228 12023 --
NM_178140chr552374 2239 2144 1085 120 2355 246 ----
NM_178151chrX117628 7297 6996 6619 5662 5627 5239 5033 4934 3136 2701 47655 3087 2575 1620 15840 --
NM_178152chrX117628 7297 6996 6619 5662 5627 5239 5033 4934 3136 2701 47655 3087 2575 1620 15840 --
NM_178153chrX117628 7297 6996 6619 5662 5627 5239 5033 4934 3136 2701 47655 3087 2575 1620 15840 --
NM_178426chr1102223 2209 725 696 600 301 248 196 86 66 22370 209 ----
NM_178427chr182123 2109 625 596 500 201 148 96 22270 109 ----
NM_178502chr123493 239 152 1159 --1166
NM_178505chr1033556 2540 2520 23257 77 11295 --
NM_178539chr1242075 830 775 24 ------
NM_178568chr171544 ----21731 294
NM_178578chr2082439 2252 2134 568 309 241 64 34 ----1686
NM_178585chr452145 660 574 290 255 ----1536
NM_178835chr44717 669 555 547 --1799 --
NM_178858chr107479 400 243 84 78 51 33 21262 407 1508 --
NM_180976chr651020 388 352 178 171 1266 1374 --
NM_180977chr651020 388 352 178 171 1266 1374 --
NM_181332chrX41924 1057 945 811 --128 11865
NM_181351chr1152869 1845 894 583 186 12421 11177 --
NM_181358chr133977 1611 1005 13558 2534 82 11383
NM_181359chr121991 779 41835 634 210 111 196 11924
NM_181361chr341439 1064 990 973 ------
NM_181481chr18116879 5815 5467 5454 4708 4305 2663 1406 1139 1127 696 11432 --1978
NM_181482chr18116879 5815 5467 5454 4708 4305 2663 1406 1139 1127 696 11432 --1978
NM_181483chr18116879 5815 5467 5454 4708 4305 2663 1406 1139 1127 696 11432 --1978
NM_181521chr16157139 7100 7017 6317 6038 5659 5405 5336 2835 1922 1722 1404 1287 1202 22 ----11530
NM_181672chrX31845 1269 211 --1264 --
NM_181673chrX31845 1269 211 --1264 --
NM_181689chr206881 814 591 194 108 97 --1583 --
NM_181715chr15353 105 97 66 59 --122 141
NM_181746chr15685 677 658 237 182 1283 1128 --
NM_181784chr271930 1045 784 331 185 74 22 ------
NM_181833chr22103475 3344 2606 2368 2340 1063 981 728 561 403 2787 130 1436 --
NM_181836chr53942 882 144 12133 ----
NM_181839chr821072 47 1869 11341 --
NM_181844chr1761854 1846 1837 1381 399 282 1209 ----
NM_181876chr442282 1937 880 50 2914 427 22048 989 --
NM_182493chr1674319 3959 3577 2134 1676 1055 607 24282 383 14365 --
NM_182507chr12112278 2245 2176 2098 2069 1825 1655 1582 671 656 650 1327 11899 --
NM_182509chr1431495 1253 411 31414 1035 605 11533 --
NM_182526chr14133097 2759 2694 2479 2215 1976 1062 839 682 660 627 566 380 43022 2786 2038 574 ----
NM_182557chr11122074 2041 2033 1503 1420 798 702 678 442 300 254 67 41734 527 388 247 1710 --
NM_182580chr1122445 2437 2424 2292 2271 2056 1969 1828 1724 1655 921 621 22371 566 ----
NM_182700chr73311 38 27 1320 --1664
NM_182705chr1752879 2715 2391 353 36 1261 ----
NM_182728chr14101658 1631 1505 1274 1174 498 422 346 290 35 31649 1497 1431 --11192
NM_182830chr142597 585 32000 629 102 ----
NM_182898chr776122 4961 4698 2466 1825 1577 576 14786 11417 --
NM_182899chr776122 4961 4698 2466 1825 1577 576 14786 11417 --
NM_182936chr1441409 1377 281 80 41282 1226 663 65 1269 --
NM_182970chr20163888 3735 3557 3416 2898 2828 2680 1534 1508 1264 597 540 388 325 301 192 44187 3898 198 107 ----
NM_183002chr1441409 1377 281 80 41282 1226 663 65 1269 --
NM_183006chr2081528 1430 1388 1136 572 426 408 170 1417 ----
NM_183050chr632235 1707 285 11681 ----
NM_183238chr1283529 2635 2532 2429 2401 2385 915 691 22678 2410 --22879 200
NM_194071chr7154934 4863 4451 4158 4092 3448 1875 1549 1517 1276 1156 1132 717 447 51 34921 1166 682 64224 3655 2028 1744 218 174 --
NM_194247chr263736 3091 2827 1325 942 574 --12917 --
NM_194283chr544044 3590 3202 700 13703 12913 --
NM_194285chr1123032 865 21082 881 ----
NM_194286chr12185997 5983 5795 5001 4509 4436 4375 4254 2326 2255 2233 1931 1617 1299 1261 1079 997 393 76092 5864 4495 2448 1695 362 54 34049 1558 1395 24858 917
NM_194313chr931762 1504 85 31332 197 176 11581 --
NM_194328chr973293 3027 2668 2308 845 681 259 --1675 --
NM_194329chr973293 3027 2668 2308 845 681 259 --1675 --
NM_194330chr973293 3027 2668 2308 845 681 259 --1675 --
NM_194332chr973293 3027 2668 2308 845 681 259 --1675 --
NM_194434chr1885134 4857 4122 1979 1695 516 475 346 --24143 1689 15146
NM_194449chr184823 679 667 232 2104 61 ----
NM_194452chr1161039 1010 992 951 506 62 ------
NM_194453chr1161039 1010 992 951 506 62 ------
NM_197941chr532818 2049 907 --32373 932 613 12274
NM_198040chr16813 460 412 290 114 41 3305 257 154 --11158
NM_198225chr10--1132 --1528
NM_198236chr110976 804 738 432 388 204 95 39 31 22 1814 ----
NM_198240chr1231272 959 166 --11018 --
NM_198268chr133977 1611 1005 13558 2534 82 11383
NM_198269chr133977 1611 1005 13558 2534 82 11383
NM_198291chr2081752 1634 1567 1430 765 755 261 250 21583 370 11806 --
NM_198321chr552830 2382 2052 298 245 32230 1237 893 1704 --
NM_198334chr114727 659 600 185 2340 197 1231 --
NM_198335chr114727 659 600 185 2340 197 1231 --
NM_198392chr651499 898 770 592 453 11452 --2505 213
NM_198395chr52763 160 1325 1899 --
NM_198485chr392125 1795 1636 1607 823 738 591 462 456 --12165 --
NM_198490chr393033 3011 2635 2617 2425 2399 993 299 49 53298 2782 1338 942 34 1561 --
NM_198560chr3103120 2690 1417 1330 1324 1296 1126 1087 535 312 42466 2423 1456 225 11387 --
NM_198568chr6191 2863 52 21062 154 --
NM_198581chr247460 7255 4618 2863 47058 5244 4706 2326 --11089
NM_198595chr4164336 3715 3469 3254 3190 3155 1930 1796 1778 1272 1039 825 806 539 405 56 65051 1650 1524 1399 1046 152 14223 --
NM_198679chr9111978 1950 1857 1067 1006 966 945 541 382 323 298 1906 1955 12194
NM_198686chr1451879 593 553 330 279 61842 773 757 528 373 184 22572 887 --
NM_198793chr383722 2950 1128 1104 896 733 618 562 23093 1135 1627 --
NM_198834chr1742102 1948 1551 531 22016 245 1181 --
NM_198836chr1742102 1948 1551 531 22016 245 1181 --
NM_198837chr1742102 1948 1551 531 22016 245 1181 --
NM_198838chr1742102 1948 1551 531 22016 245 1181 --
NM_198839chr1742102 1948 1551 531 22016 245 1181 --
NM_198859chr374936 4648 4317 3365 886 847 322 34914 4840 3795 11561 --
NM_198889chr42250 244 ----1183
NM_198896chr1131753 444 415 21775 859 11713 --
NM_198900chr12237849 7622 7153 6955 6404 6343 6120 6059 5479 5381 5150 4998 4781 4771 3024 3013 2709 2698 2537 2366 2144 1112 856 45281 2753 2458 310 46663 6426 6237 5599 25958 5589
NM_198904chr5184 3729 521 429 ----
NM_198956chr73311 38 27 1320 --1664
NM_198993chr176607 398 358 203 113 102 31589 1454 349 11468 11723
NM_199054chr19101803 1534 1332 762 632 480 445 289 277 114 21610 41 --2604 491
NM_199129chr2061131 988 979 365 259 111 1510 ----
NM_199144chr2071285 1243 625 568 381 283 29 1579 11056 --
NM_199169chr20153518 3358 3169 2978 2603 2476 2294 1430 1423 1412 1237 1034 875 851 119 33005 2359 1324 23025 2246 --
NM_199170chr20153518 3358 3169 2978 2603 2476 2294 1430 1423 1412 1237 1034 875 851 119 33005 2359 1324 23025 2246 --
NM_199171chr20153518 3358 3169 2978 2603 2476 2294 1430 1423 1412 1237 1034 875 851 119 33005 2359 1324 23025 2246 --
NM_199203chr2071285 1243 625 568 381 283 29 1579 11056 --
NM_199245chr12102362 2249 2118 2018 1893 1709 641 539 179 47 52211 675 573 505 491 22354 1656 --
NM_199262chr17132271 2222 2156 1712 1482 1476 1461 944 804 542 344 256 237 12046 11929 1872
NM_199415chr2082231 2048 1978 907 735 669 510 118 22502 2430 ----
NM_199421chr1454698 3345 1117 464 458 ------
NM_199454chr1204346 4152 3730 3616 3595 3506 3456 3230 3206 3184 1907 1894 1864 1606 1461 1352 1303 976 883 202 43515 1327 1096 1060 1116 23103 898
NM_199482chr221962 300 21564 462 ----
NM_199487chr205890 844 426 228 213 31040 964 258 ----
NM_201263chr152073 1605 1501 697 25 11490 ----
NM_201266chr272751 2708 2676 2663 2174 1024 526 1881 12433 --
NM_201269chr111453 ----1365
NM_201279chr272751 2708 2676 2663 2174 1024 526 1881 12433 --
NM_201428chr1151421 1379 1373 1034 1027 1142 ----
NM_201429chr1151421 1379 1373 1034 1027 1142 ----
NM_201432chr17176324 6150 5673 5616 5565 4899 4170 4008 3990 2183 2123 2035 1350 1277 1258 957 178 76363 4505 4492 4295 740 357 171 25977 2134 11039
NM_201433chr17176324 6150 5673 5616 5565 4899 4170 4008 3990 2183 2123 2035 1350 1277 1258 957 178 76363 4505 4492 4295 740 357 171 25977 2134 11039
NM_201535chr142279 236 3786 243 46 1175 --
NM_201536chr142279 236 3786 243 46 1175 --
NM_201537chr142279 236 3786 243 46 1175 --
NM_201538chr142279 236 3786 243 46 1175 --
NM_201539chr142279 236 3786 243 46 1175 --
NM_201540chr142279 236 3786 243 46 1175 --
NM_201541chr142279 236 3786 243 46 1175 --
NM_201559chr624839 3924 33655 3445 473 ----
NM_201567chr351465 1383 1276 213 39 --147 --
NM_201570chr1051635 1453 746 225 63 11386 ----
NM_201571chr1051635 1453 746 225 63 11386 ----
NM_201572chr1051635 1453 746 225 63 11386 ----
NM_201590chr1051635 1453 746 225 63 11386 ----
NM_201593chr1051635 1453 746 225 63 11386 ----
NM_201596chr1051635 1453 746 225 63 11386 ----
NM_201597chr1051635 1453 746 225 63 11386 ----
NM_201599chrX2881 134 51021 896 451 226 61 ----
NM_201632chr52447 106 21200 63 1581 1591
NM_201634chr53546 205 115 21299 162 1680 1690
NM_203305chr992454 2141 2122 2088 731 661 646 405 79 31947 832 121 11989 --
NM_203318chr1761247 1207 1098 858 425 323 291 63 ----
NM_203327chr20114091 3914 3538 3130 1684 1430 1004 976 564 267 187 24193 991 1520 --
NM_203342chr193601 2780 2774 2411 1163 1113 792 634 436 42665 2420 2274 39 1450 1374
NM_203343chr193601 2780 2774 2411 1163 1113 792 634 436 42665 2420 2274 39 1450 1374
NM_203346chr2112203 2153 2079 2066 1879 1861 1853 1593 730 419 115 41926 1800 477 172 ----
NM_203351chr1732113 1888 1691 61903 1700 881 647 525 86 ----
NM_203454chr141113 1037 1020 901 --1975 --
NM_203458chr133854 1496 267 32724 226 191 ----
NM_203504chr431837 806 427 22086 167 ----
NM_203505chr431837 806 427 22086 167 ----
NM_205848chr162707 2414 2399 1825 733 101 32508 752 323 --12246
NM_205860chr142538 1100 490 348 32555 1172 425 --1736
NM_205861chr191599 1587 1442 1358 807 691 522 356 58 2571 212 ----
NM_206594chr142581 644 435 383 1162 1428 --
NM_206595chr142581 644 435 383 1162 1428 --
NM_206852chr143288 103 95 ------
NM_206853chr643456 1427 1012 701 ------
NM_206854chr634717 1962 1219 23548 196 1687 --
NM_206855chr635682 2184 139 34513 1161 34 11652 --
NM_206857chr143288 103 95 ------
NM_206907chr563172 3018 1166 937 600 390 13188 2798 493 --
NM_206909chr8137835 7224 7155 6754 6256 6228 5474 2959 1716 1517 1462 1447 270 ------
NM_206914chr1251919 1830 508 501 170 --11432 --
NM_207111chr782512 2027 1038 841 651 565 513 242 21944 71 22290 378 2975 253
NM_207116chr782512 2027 1038 841 651 565 513 242 21944 71 22290 378 2975 253
NM_207119chr1072031 1991 1957 1607 744 307 259 ----1697
NM_207171chr151349 750 631 363 132 31721 1567 806 1828 11608
NM_207330chr41261 ----1185
NM_207372chr1062386 2291 2228 1760 853 538 ------
NM_207387chr1731354 1256 724 41157 638 562 29 ----
NM_207391chr1941299 912 242 37 --2941 280 --
NM_207406chr475937 5523 5278 5241 5003 2308 333 14859 33996 1119 1053 --
NM_207411chr8103261 3168 3108 1179 1167 757 642 354 133 25 33150 3087 3011 12569 --
NM_207518chr1981267 1250 1240 1029 999 925 910 195 61167 1133 1113 977 249 227 1204 1870
NM_207577chr1182131 2026 934 363 351 255 201 40 22646 2196 22296 317 --
NM_207645chr118528 520 475 402 347 151 133 23 11218 ----
NM_212464chr153642 613 204 31708 338 258 1830 --
NM_212551chr16911 882 691 348 328 106 --1123 --
NM_213594chr123530 508 291 ----176
NM_213648chr52447 106 21200 63 1581 1591
NM_213662chr1762301 1974 1693 1674 404 224 289 47 ----