TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-505-3p
miRNA Sequence: CGUCAACACUUGCUGGUUUCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1546014 3963 1547 576 14293 24752 856 1484
NM_000430chr1743542 3222 365 328 1311 12500 13177
NM_000809chr469228 8469 8274 7333 1272 615 18280 38180 2808 593 17909
NM_000875chr1566406 6070 5619 4741 4292 1448 12703 36438 4770 1032 11122
NM_001003652chr1858476 6773 3060 2873 2696 16972 21476 928 15548
NM_001003792chr3169 1290 --21117 792
NM_001003793chr3169 1290 --21117 792
NM_001009899chr365270 5177 4713 1128 486 475 1252 15413 1348
NM_001018065chr946034 5792 5066 1602 14399 15825 14053
NM_001018066chr946034 5792 5066 1602 14399 15825 14053
NM_001024948chr133493 1324 1026 --23448 2194 1878
NM_001025077chr1076679 5354 5337 4917 2143 1800 1146 --22825 2332 12199
NM_001039618chr1175607 4898 4133 3812 2212 1369 984 1712 24885 2054 --
NM_001040157chr43886 657 360 --12542 2300 290
NM_001040284chr1665490 2173 1924 1442 347 110 --11220 24230 3820
NM_001042555chr123608 332 277 24675 1078 12977 1795
NM_001042599chr237324 6744 2836 --12207 12214
NM_001198chr642271 1476 607 598 12127 --1735
NM_001650chr1834096 2858 814 --11020 23293 1101
NM_001858chr664346 3369 1935 1256 479 366 --23614 1287 14186
NM_002128chr1322014 271 ----32286 962 424
NM_002577chr311325 --13094 21415 513
NM_002613chr1644618 3773 1898 748 14295 25109 4430 24853 636
NM_002834chr1263401 3312 675 573 407 132 --1697 13840
NM_003112chr723186 160 1707 --1935
NM_003274chr2122840 1045 ----22227 722
NM_003590chr263909 2766 1374 1325 330 173 1876 22743 360 11391
NM_004028chr1834096 2858 814 --11020 23293 1101
NM_004171chr1156476 6224 6156 1092 624 12752 49481 8182 3690 1029 12760
NM_004685chr131855 12580 12766 22107 1844
NM_005235chr237324 6744 2836 --12207 12214
NM_005504chr1256527 5759 5123 4433 1309 14807 14409 14053
NM_005795chr242180 732 486 373 ----22105 149
NM_005840chrX117154 6647 5971 5628 5002 2846 2801 2771 2084 2044 1475 --15395 --
NM_005901chr1858476 6773 3060 2873 2696 16972 21476 928 15548
NM_006252chr177281 4684 2874 2723 1119 1037 488 17223 36886 6381 5957 --
NM_006526chr201566 ----22110 1543
NM_006654chr123608 332 277 24675 1078 12977 1795
NM_007214chr621279 99 2544 444 1934 1471
NM_013436chr21180 ----2718 655
NM_014423chr574764 4752 4499 1938 801 382 170 14893 15138 13649
NM_014820chr371599 1551 700 459 332 171 87 1326 2395 303 --
NM_014953chr1353652 3507 654 445 151 21751 1341 21297 1109 --
NM_015317chr252320 2055 1804 871 860 12621 11836 12393
NM_016009chr144047 2983 1099 1025 1746 --24638 1540
NM_016206chr388640 7649 6691 3008 2407 808 482 134 27873 825 17589 26726 3243
NM_016217chr653567 3335 3117 1360 812 12952 11130 13602
NM_017650chr766107 5706 5349 1382 290 140 11789 1798 14284
NM_018638chr1255143 1430 1094 590 574 25467 3681 --13722
NM_018970chr722032 1053 22526 374 1691 1393
NM_018999chr1054716 4060 3269 3046 1545 --23143 1327 14941
NM_020772chr1778680 2914 2184 1985 1669 717 627 --26418 1624 --
NM_020917chr1923610 1207 --2611 123 23311 3050
NM_020948chr132607 85 64 ----21210 601
NM_021033chr1322569 2484 2300 153 --12535
NM_021038chr343356 2441 2419 2396 ----12332
NM_021205chr132861 2362 734 12322 21144 1063 1688
NM_021629chr334835 3145 1326 21595 762 --14520
NM_022048chr1536222 5728 264 34867 4542 975 45737 5630 3940 659 --
NM_022166chr1644213 1242 1081 247 15255 15919 24502 1548
NM_024639chr662893 2703 2201 2141 1086 840 21833 1121 --11159
NM_024947chr398391 7082 6515 6447 3365 3122 1674 1257 712 17980 49407 8254 7503 1759 39197 7952 7242
NM_024989chr246903 6503 6426 5137 14941 26240 2380 13053
NM_025054chr843937 2595 2571 771 --41386 966 385 58 --
NM_031268chr1644618 3773 1898 748 14295 25109 4430 24853 636
NM_032424chr1121045 363 11416 --21506 1446
NM_032505chr342578 2110 1934 829 ----11721
NM_032968chrX14167 23890 2768 1984 1616
NM_032969chrX14167 23890 2768 1984 1616
NM_032973chrY14159 23882 2763 1984 1616
NM_033224chr736923 2335 1028 21284 783 37820 6797 1926 12803
NM_033389chr1754501 3419 2997 1778 1303 --11334 11312
NM_138468chr256209 6056 5623 5134 201 ----26365 4250
NM_144571chr486691 6041 4959 2563 2548 1311 1219 1022 14891 21202 634 --
NM_145307chr1054707 1871 924 854 249 13519 13727 1648
NM_145753chr311546 ----21682 436
NM_152608chr122391 1770 11812 --2383 89
NM_152903chr131115 22137 1860 11103 12649
NM_153686chr432434 1795 490 --11922 11651
NM_173075chr431168 637 525 21363 531 --1547
NM_181521chr1665699 2351 2080 1790 1113 438 --11563 11431
NM_182907chr642271 1476 607 598 12127 --1735
NM_194314chr155100 4405 3943 1828 1341 ----1830
NM_198273chr531264 1044 185 --22018 169 12354
NM_198859chr3115016 4764 4223 3617 1910 1435 1399 861 273 186 154 --1878 --
NM_199324chr443627 1337 694 359 --1224 12462
NM_205842chr21180 ----2718 655
NM_206855chr665830 5760 5013 2124 1802 366 --36243 1124 660 --
NM_207292chr343356 2441 2419 2396 ----12332
NM_207293chr343356 2441 2419 2396 ----12332
NM_207294chr343356 2441 2419 2396 ----12332
NM_207295chr343356 2441 2419 2396 ----12332
NM_207296chr343356 2441 2419 2396 ----12332
NM_207297chr343381 2466 2444 2421 ----12357
NM_207406chr466543 6213 4661 2389 2376 1133 15454 46500 6225 5906 622 1779