TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-505-5p
miRNA Sequence: GGGAGCCAGGAAGUAUUGAUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1252056 1574 1510 1498 214 21551 298 1229 21632 1536
NM_000021chr14--1750 ----
NM_000037chr82829 462 1227 11657 --
NM_000038chr522090 546 --1488 --
NM_000051chr1142619 2588 1150 812 ------
NM_000061chrX124 ------
NM_000068chr192987 451 ------
NM_000084chrX126929 6576 6245 5879 4663 4646 4440 2616 2135 2074 949 202 ----16303
NM_000085chr11366 --2388 352 --
NM_000088chr1721215 865 11094 21144 25 --
NM_000089chr71324 ----1716
NM_000092chr264577 3899 3069 2915 397 257 --2155 115 --
NM_000093chr951947 1794 625 102 21 11592 ----
NM_000110chr121107 787 ------
NM_000111chr71140 ------
NM_000125chr643318 1716 694 121 1711 1434 1399
NM_000129chr621471 322 2422 129 ----
NM_000134chr41434 ------
NM_000138chr1552411 1661 1024 928 199 ------
NM_000141chr10----11117 --
NM_000142chr431486 1419 1249 --1359 --
NM_000163chr52958 360 ------
NM_000167chrX1152 ------
NM_000189chr242237 1566 244 99 ------
NM_000192chr12--1333 ----
NM_000196chr162445 44 --160 --
NM_000208chr1984428 4305 4024 1809 1295 1269 713 35 ------
NM_000214chr2041627 1389 265 134 ------
NM_000217chr1252028 1613 797 590 262 ------
NM_000222chr431941 1916 303 1192 153 --
NM_000237chr821697 316 --11659 --
NM_000244chr113186 125 41 ------
NM_000248chr32879 657 ------
NM_000252chrX11029 --1994 --
NM_000258chr3----1230 --
NM_000259chr1575714 2308 1706 1568 1056 499 182 ------
NM_000264chr93710 305 241 --22054 573 --
NM_000266chrX3949 929 228 --2262 23 --
NM_000278chr103804 738 468 22084 642 11561 --
NM_000297chr42341 170 ----21610 661
NM_000304chr17128 ------
NM_000314chr101398 --13136 --
NM_000330chrX2649 412 --12110 --
NM_000332chr6116376 6019 5353 4545 2845 2730 2695 2594 1881 1750 507 46151 5982 273 240 25200 31 16643
NM_000334chr1732176 586 426 1214 2712 114 --
NM_000337chr585261 5086 4854 4261 4131 1590 857 51 35894 5597 4613 --25800 5653
NM_000338chr1521102 274 ------
NM_000340chr321026 253 ------
NM_000345chr4----1790 1242
NM_000368chr954430 4044 3733 1402 991 --34200 1820 402 --
NM_000378chr11------1860
NM_000391chr1121401 26 ------
NM_000393chr211698 ----11436
NM_000399chr101471 ------
NM_000406chr443049 2518 2439 1969 ----1539
NM_000408chr212711 ------
NM_000411chr2153065 2853 2527 264 182 --1819 --
NM_000430chr1733187 3015 2900 ------
NM_000439chr541725 1687 1608 435 --11559 --
NM_000448chr1131296 485 66 1101 13102 --
NM_000461chr354275 4069 1855 785 445 --11759 --
NM_000462chr1511803 ------
NM_000476chr931376 550 429 --1605 --
NM_000489chrX22735 521 --11079 --
NM_000493chr61226 ------
NM_000503chr811178 ------
NM_000533chrX--2287 41 1219 --
NM_000555chrX55483 4975 4863 1605 997 --37817 5929 3143 15255
NM_000572chr13918 624 71 ------
NM_000578chr221801 1296 1377 11471 --
NM_000586chr4--1172 ----
NM_000599chr234475 3759 3664 --33741 3139 1556 --
NM_000609chr1052704 2572 2355 450 302 12522 1982 --
NM_000612chr1163239 2785 394 358 234 119 32846 102 80 33614 2680 691 --
NM_000621chr1311171 ----11069
NM_000633chr1834223 536 449 13931 25050 845 1337
NM_000641chr1921239 1045 1985 1287 --
NM_000678chr202586 251 ------
NM_000693chr1521565 405 1647 --11491
NM_000706chr12146 --1644 --
NM_000719chr1252132 1104 1030 663 306 16470 25616 2172 --
NM_000720chr3----2508 26 --
NM_000721chr141650 805 517 291 --2906 395 --
NM_000725chr122637 214 1858 --1965
NM_000738chr111791 --1110 --
NM_000739chr71291 1165 ----
NM_000767chr1921466 605 --171 --
NM_000793chr1444520 4092 3460 96 ----1406
NM_000801chr201988 --1962 --
NM_000806chr51275 ----11985
NM_000814chr1523600 549 --33926 1360 557 --
NM_000816chr5128 ------
NM_000817chr21269 ------
NM_000818chr10----1187 --
NM_000826chr422586 586 ------
NM_000827chr572553 2432 1943 1788 1676 555 42 ------
NM_000831chr185952 5707 5605 4160 1804 960 885 166 35513 5057 188 36057 5841 705 13885
NM_000833chr162593 524 1157 1141 --
NM_000834chr1241293 846 489 313 --2151 97 --
NM_000839chr31489 ------
NM_000841chr61122 ------
NM_000865chr6195 ------
NM_000870chr521284 399 --11396 --
NM_000875chr1566107 5860 5587 4654 1522 843 --34744 4666 4471 --
NM_000876chr621351 207 ------
NM_000891chr1723548 2274 ------
NM_000895chr121106 ------
NM_000899chr1223690 3363 --11703 2668 343
NM_000901chr432171 1696 671 --12295 --
NM_000919chr5----1157 --
NM_000921chr121442 ------
NM_000926chr1179332 8282 8038 7956 7881 6147 2373 --15823 12499
NM_000934chr172677 565 ------
NM_000942chr15164 ------
NM_000944chr421651 816 --11777 --
NM_000945chr241725 1524 375 266 ------
NM_000950chrX43511 3008 2300 485 ------
NM_000958chr51136 1367 ----
NM_000964chr173999 867 459 --31298 955 355 --
NM_000965chr3----21210 351 --
NM_000966chr122670 189 141 2986 358 --
NM_000983chr151407 1247 369 136 127 --11172 --
NM_001001132chr211272 ------
NM_001001323chr1212570 --12161 13032
NM_001001331chr322430 1076 --1274 --
NM_001001344chrX42621 2443 2178 199 ------
NM_001001394chr22701 685 --161 --
NM_001001396chr174330 3971 3390 1366 1322 1108 144 ------
NM_001001433chr2042694 2343 2097 1290 --23028 1067 --
NM_001001438chr211260 ------
NM_001001481chr832926 2521 176 ------
NM_001001484chr1021664 622 ------
NM_001001522chr111121 ------
NM_001001549chr732786 1919 283 11866 ----
NM_001001550chr732786 1919 283 11866 ----
NM_001001555chr732786 1919 283 11866 ----
NM_001001557chr821706 331 ------
NM_001001661chr72765 61 --1113 --
NM_001001664chr223451 2839 ------
NM_001001668chr1933840 574 467 ------
NM_001001786chr111155 ------
NM_001001852chr221774 ------
NM_001001890chr2113985 --13465 23720 3167
NM_001001924chr811374 ------
NM_001001925chr811374 ------
NM_001001931chr811374 ------
NM_001001974chr1021899 60 ------
NM_001001994chrX1499 ------
NM_001001995chrX11803 ------
NM_001001996chrX1499 ------
NM_001002255chr6------189
NM_001002257chr242292 970 664 453 ------
NM_001002814chr863428 2661 1024 793 489 99 --22863 468 --
NM_001002838chrX21265 652 ------
NM_001002860chr1454715 4277 3798 1178 658 31270 786 613 13126 --
NM_001002909chr1731827 1661 136 1861 ----
NM_001003407chr1055014 4854 3122 1806 1451 13499 44757 2011 755 504 --
NM_001003408chr1055014 4854 3122 1806 1451 13499 44757 2011 755 504 --
NM_001003652chr1866434 6199 6140 3045 2146 905 13021 18409 --
NM_001003676chr111256 --1360 1415
NM_001003679chr12627 274 ------
NM_001003681chr221546 11306 ----
NM_001003682chr131428 1362 409 ----11226
NM_001003712chr1224066 822 ------
NM_001003760chr623029 149 ------
NM_001003792chr3----172 --
NM_001003793chr3----172 --
NM_001003794chr373023 2494 2219 947 659 575 79 1323 21909 66 12986
NM_001003800chr922305 478 21123 443 ----
NM_001003940chr1583801 3175 2720 2483 1426 1091 484 271 --13339 --
NM_001003942chr1583801 3175 2720 2483 1426 1091 484 271 --13339 --
NM_001003943chr1583805 3179 2724 2487 1430 1095 488 275 --13343 --
NM_001004051chrX1300 ------
NM_001004065chr943383 3104 2713 885 ----11403
NM_001004127chr133909 248 178 ------
NM_001004304chr1242957 2683 2540 2411 11226 2601 308 --
NM_001004308chrX21485 451 ------
NM_001004317chr654050 3528 3108 1359 820 ----24146 1454
NM_001004342chr165269 4520 1605 1388 1311 1168 35467 5231 301 2976 641 --
NM_001004419chr1231324 898 488 ------
NM_001004439chr153535 289 111 --1489 --
NM_001005158chr3195 ------
NM_001005159chr3195 ------
NM_001005207chr17--152 ----
NM_001005209chr22199 84 ------
NM_001005266chr152756 617 ------
NM_001005267chr152756 617 ------
NM_001005268chr152756 617 ------
NM_001005269chr152756 617 ------
NM_001005375chrY21368 282 --11392 --
NM_001005386chr241879 759 415 284 ------
NM_001005404chr1744259 1189 911 640 13879 21097 220 193
NM_001005408chr171145 ------
NM_001005463chr1012288 ----1705
NM_001005505chr33507 486 257 --11360 --
NM_001005609chrX23566 2524 12944 --21275 249
NM_001005781chr2------1101
NM_001005849chr17------186
NM_001005910chr31559 ------
NM_001005911chr31559 ------
NM_001005920chr163402 271 258 ------
NM_001006115chr342575 624 432 206 --32685 781 222 11770
NM_001006600chr51477 ------
NM_001006617chr95996 521 217 138 114 ------
NM_001006619chr95996 521 217 138 114 ------
NM_001006620chr95996 521 217 138 114 ------
NM_001006621chr95996 521 217 138 114 ------
NM_001006626chr71291 1165 ----
NM_001006627chr71291 1165 ----
NM_001006628chr71291 1165 ----
NM_001006629chr71291 1165 ----
NM_001006630chr71291 1165 ----
NM_001006631chr71291 1165 ----
NM_001006632chr71291 1165 ----
NM_001006634chr161212 --1562 --
NM_001006636chr2--1171 ----
NM_001006656chr1931692 1234 199 --11490 --
NM_001007023chr1444520 4092 3460 96 ----1406
NM_001007027chr111195 ------
NM_001007098chr1------1309
NM_001007102chr61219 1288 ----
NM_001007156chr1531775 1515 745 21849 1652 21262 429 --
NM_001007237chr13913 326 47 1740 ----
NM_001007271chr104976 848 88 39 --2397 165 --
NM_001007466chr644517 4492 933 671 11680 ----
NM_001007471chr91329 ------
NM_001007538chr1321475 22 ----1117
NM_001007565chr31330 ------
NM_001008220chr53543 138 51 13562 2507 447 12712
NM_001008222chrX41165 997 370 255 ------
NM_001008239chr1823685 1294 --11409 --
NM_001008529chr1741302 1268 1080 160 ------
NM_001008564chr1321875 523 ------
NM_001008701chr1962825 2762 2151 2046 502 62 22141 1949 12573 --
NM_001008738chr552668 2503 2237 368 168 ------
NM_001009185chr52685 674 ------
NM_001009552chr8147 ------
NM_001009555chr411134 ------
NM_001009571chr731441 1111 537 --1271 --
NM_001009880chr2264275 3995 1274 1192 999 558 ------
NM_001009899chr354590 3960 2043 576 414 --11359 --
NM_001009993chr274274 3774 3632 1654 1637 1461 648 13843 ----
NM_001010861chr142614 2047 1071 729 ------
NM_001010867chr164764 4378 2579 1938 1742 1716 35599 2077 252 1805 1281
NM_001010891chr544862 929 422 299 --36436 5632 4512 --
NM_001010922chr143326 3097 1258 1063 14002 ----
NM_001010926chr12519 126 ------
NM_001010971chr12882 702 ------
NM_001010986chrX31976 986 223 ------
NM_001010989chr162363 199 ------
NM_001010990chr162363 199 ------
NM_001011513chr453604 3261 1413 1152 538 --13927 1168
NM_001011537chr31228 --1264 --
NM_001011663chr10142 ------
NM_001011666chr734793 635 121 11081 12355 --
NM_001011708chr222541 339 ------
NM_001011713chr14------11473
NM_001011885chr1511591 ------
NM_001012264chr142756 710 1848 ----
NM_001012329chr171840 1771 1589 716 667 636 200 --2329 59 12380
NM_001012393chr1143875 1731 1392 89 ------
NM_001012398chr16--1408 ----
NM_001012420chr1532001 843 184 ------
NM_001012423chr1532001 843 184 11057 ----
NM_001012426chr652841 1360 1296 1041 705 1859 22446 407 1632
NM_001012427chr652841 1360 1296 1041 705 1859 22446 407 1632
NM_001012644chr20----241 23 --
NM_001012732chr4----21262 298 11021
NM_001012755chrX34369 3098 55 ------
NM_001012756chr1922439 2405 ------
NM_001012761chr542638 2405 1926 931 ------
NM_001012968chrX12767 --22175 526 --
NM_001012977chrX3550 478 45 ------
NM_001012980chrX139 ------
NM_001012989chrX1638 ------
NM_001013031chr10------1342
NM_001013399chr611109 ------
NM_001013415chr41127 1235 ----
NM_001013635chr121234 11003 1981 --
NM_001013693chr162673 2547 2232 923 388 171 1795 1731 --
NM_001013693chr162673 2547 2232 923 388 171 1795 1731 --
NM_001013843chr15------1350
NM_001014435chr164438 148 84 51 ------
NM_001014443chr12171 57 ------
NM_001014797chr1078026 7316 6090 2899 2775 2495 2203 12926 ----
NM_001014809chr4--1720 2924 338 1316
NM_001014839chr13878 404 131 2932 335 1315 --
NM_001014841chr13878 404 131 2932 335 1315 --
NM_001015048chr1442682 2446 1139 927 --13137 --
NM_001015049chr1442682 2446 1139 927 --13137 --
NM_001015053chr1751511 1471 1161 1056 1026 129 21210 161 --
NM_001015877chrX13040 --1554 --
NM_001015881chrX21119 266 11006 174 11226
NM_001015887chr321718 1272 --11551 --
NM_001017365chr1159 ------
NM_001017366chr1159 ------
NM_001017367chr1159 ------
NM_001017368chr1762745 2622 866 712 239 110 --22162 872 --
NM_001017395chr352734 2543 1113 527 318 --23353 3024 13399
NM_001017424chr111828 ----11451
NM_001017425chr111828 ----11451
NM_001017440chr776420 6334 6037 5313 3101 2327 677 11790 57522 5361 3298 825 505 16561
NM_001017916chr1781686 1597 1432 833 770 632 526 79 --2215 92 --
NM_001017917chr1781686 1597 1432 833 770 632 526 79 --2215 92 --
NM_001017924chr10--2484 38 11341 --
NM_001017926chr821438 1426 ------
NM_001017977chr11330 ------
NM_001017995chr583764 3005 1355 727 604 463 378 45 24089 590 --21113 691
NM_001018050chr2232440 2106 751 ------
NM_001018052chr2232440 2106 751 ------
NM_001018054chr121335 905 ------
NM_001018057chr113307 128 89 1185 ----
NM_001018064chr91578 11528 1327 --
NM_001018065chr9125 ------
NM_001018066chr9125 ------
NM_001018067chr155304 5035 4998 1525 687 --34607 3997 28 --
NM_001018068chr155304 5035 4998 1525 687 --34607 3997 28 --
NM_001018069chr155304 5035 4998 1525 687 --34607 3997 28 --
NM_001018108chr1551964 1850 1459 820 812 --11899 --
NM_001023567chr152823 347 ------
NM_001023570chr32224 55 ------
NM_001023587chr3--192 ----
NM_001024455chrX32431 868 730 1824 --1681
NM_001024463chr151869 --1332 --
NM_001024649chr532028 794 333 1129 --1727
NM_001024660chr321107 364 ------
NM_001024680chr221569 630 ------
NM_001024688chr811785 --1329 1580
NM_001024808chr1242523 1901 503 464 --1889 --
NM_001024809chr173999 867 459 --31298 955 355 --
NM_001024847chr332227 670 496 1540 ----
NM_001024858chr14122832 2824 2628 2499 2012 1848 1817 882 837 636 568 229 22300 2184 1209 --
NM_001024934chr62691 191 ------
NM_001024935chr62691 191 ------
NM_001024936chr62691 191 ------
NM_001024937chr17161 ------
NM_001024948chr122753 1288 ------
NM_001024959chr3----2795 212 --
NM_001024960chr3----2795 212 --
NM_001025068chr341659 273 210 91 ----11277
NM_001025069chr341659 273 210 91 ----11277
NM_001025076chr1066225 5117 5020 976 573 164 ------
NM_001025077chr1097583 6475 6378 4977 4865 2334 1931 1522 1284 ------
NM_001025079chr31350 --1416 --
NM_001025108chr2248 30 --22788 2749 --
NM_001025201chr22707 196 ------
NM_001025233chr1212662 --1455 --
NM_001025252chr8----12268 --
NM_001025253chr8----12268 --
NM_001025266chr354272 3965 3699 890 607 --21650 878 --
NM_001025366chr61758 --11502 --
NM_001025366chr61758 --11502 --
NM_001025367chr61758 --11502 --
NM_001025367chr61758 --11502 --
NM_001025368chr61758 --11502 --
NM_001025368chr61758 --11502 --
NM_001025370chr61758 --11502 --
NM_001025370chr61758 --11502 --
NM_001025579chr172112 41 ----1910
NM_001025580chrX24189 3072 13405 ----
NM_001025595chr421479 1285 ------
NM_001025780chr911593 ------
NM_001029882chr1146 ------
NM_001029882chr1146 ------
NM_001029989chr151721 --1611 --
NM_001030006chr1752355 2344 2153 284 259 11651 ----
NM_001030007chr1643416 1083 757 572 13500 1543 23586 1599
NM_001030055chr1434714 1430 1148 ------
NM_001031628chr12------137
NM_001031677chr52386 212 ------
NM_001031680chr162066 744 654 541 80 72 ------
NM_001031690chr732010 658 270 13059 22059 591 --
NM_001031692chr71335 ------
NM_001031695chr2245381 4174 4014 821 --11607 --
NM_001031702chr3127 1145 ----
NM_001031711chr52361 146 ----11456
NM_001031716chr2------11009
NM_001031717chr31717 3896 812 174 ----
NM_001031720chr41160 ------
NM_001031723chr4----2156 122 --
NM_001031732chr443482 2794 2416 681 ------
NM_001031740chr141731 1425 1366 338 ------
NM_001031801chr221117 --130 1104
NM_001031804chr1653544 2690 1430 1039 268 ------
NM_001032282chr82897 167 ------
NM_001032293chr171273 191 1221 --
NM_001032296chr1342776 2525 2356 2195 ------
NM_001032380chr1011951 ------
NM_001033045chr254353 4003 3071 1205 360 ----1284
NM_001033047chr412449 12301 1974 --
NM_001033049chr211323 11855 11508 --
NM_001033057chr31642 ------
NM_001033081chr12691 464 2769 349 31481 1430 241 --
NM_001033082chr12691 464 2769 349 31481 1430 241 --
NM_001033087chr203740 559 300 11272 23128 34 --
NM_001033112chr51214 --1790 --
NM_001033117chr354142 4036 3406 1091 40 --2288 70 14086
NM_001033506chr11152 ------
NM_001033507chr131261 70 31 11467 11485 --
NM_001033518chr732018 920 193 ----147
NM_001033519chr732018 920 193 ----147
NM_001033520chr732018 920 193 ----147
NM_001033551chr17173995 3818 3738 3439 3179 3040 2650 2489 1408 987 862 826 676 638 549 528 388 33293 2545 623 --13533
NM_001033561chr17----1821 --
NM_001033602chr1331780 1039 33 --32298 2245 1890 --
NM_001033756chr61692 --11436 --
NM_001033756chr61692 --11436 --
NM_001033925chr10141 ------
NM_001034954chr1041098 864 790 766 1388 1748 11015
NM_001034955chr1041098 864 790 766 1388 1748 11015
NM_001034956chr1041098 864 790 766 1388 1748 11015
NM_001034957chr1041098 864 790 766 1388 1748 11015
NM_001035003chr4----1282 11058
NM_001035004chr4----1282 11058
NM_001035254chr941703 1043 428 356 ------
NM_001035511chr131991 1384 328 --2254 212 --
NM_001035512chr132098 1491 435 --2361 319 --
NM_001035513chr132098 1491 435 --2361 319 --
NM_001035521chr24570 245 225 201 ------
NM_001037132chr721688 640 --1622 --
NM_001037133chr721688 640 --1622 --
NM_001037163chr71101 ------
NM_001037174chr232005 843 781 ------
NM_001037317chr142614 2047 1071 729 ------
NM_001037334chr182668 396 --11521 --
NM_001037339chr131423 1417 263 ------
NM_001037340chr131423 1417 263 ------
NM_001037341chr131423 1417 263 ------
NM_001037341chr131423 1417 263 ------
NM_001037582chr42297 52 ------
NM_001037954chr1143444 2674 2138 663 ------
NM_001038493chr21106 --137 --
NM_001038640chr151913 ------
NM_001039199chr20114905 4743 3477 3070 1410 1272 1126 1107 904 708 306 ----13274
NM_001039350chr7----21118 32 --
NM_001039479chr1421801 787 --127 --
NM_001039538chr243289 2722 213 64 13536 ----
NM_001039547chr367389 5877 5492 5350 2907 2070 11264 ----
NM_001039550chr21690 --1202 --
NM_001039577chr1103980 3867 3722 2811 2796 1439 1242 874 145 76 ----195
NM_001039583chr222157 106 ------
NM_001039584chr222157 106 ------
NM_001039590chrX------2663 24
NM_001039591chrX------2663 24
NM_001039618chr1164364 4237 4033 1464 1162 245 21090 580 25085 3889 --
NM_001039690chr1641619 883 403 83 --1286 1239
NM_001039711chr13846 365 191 ------
NM_001039712chr13846 365 191 ------
NM_001039802chr111188 ----1375
NM_001039840chrX13724 13982 14573 --
NM_001039888chr11570 1715 1502 --
NM_001039916chr12------1108
NM_001039917chr12------1108
NM_001039918chr12------1108
NM_001039919chr12------1108
NM_001039920chr12------1108
NM_001039937chr1322751 2634 ------
NM_001040001chr621575 578 ------
NM_001040057chr7--11086 ----
NM_001040108chr1442455 2107 1180 137 ------
NM_001040118chr111157 ----125
NM_001040144chr1641619 883 403 83 --1286 1239
NM_001040146chr1641619 883 403 83 --1286 1239
NM_001040152chr753886 3130 1790 1755 1694 --11968 12012
NM_001040157chr42754 403 ------
NM_001040172chr521284 399 --11396 --
NM_001040173chr521284 399 --11396 --
NM_001040179chr62932 384 1242 ----
NM_001040202chr421690 882 ------
NM_001040214chr61919 ------
NM_001040272chr92729 269 21685 625 ----
NM_001040284chr1654909 4861 1620 1361 312 --21553 1060 14673
NM_001040409chr22836 743 ------
NM_001040424chr2152556 1950 929 415 385 1226 32879 2600 1110 --
NM_001040427chr163118 56 40 ------
NM_001040429chr1343417 2920 2732 475 --12280 --
NM_001040439chr1621306 374 1951 --1327
NM_001040441chr155020 4467 1646 792 227 12109 ----
NM_001040455chr11--1958 21026 295 --
NM_001040624chr842560 2127 1888 607 ------
NM_001040625chr842560 2127 1888 607 ------
NM_001040626chr842560 2127 1888 607 ------
NM_001040627chr842560 2127 1888 607 ------
NM_001040628chr842560 2127 1888 607 ------
NM_001040629chr842560 2127 1888 607 ------
NM_001040630chr842560 2127 1888 607 ------
NM_001040709chr122144 60 1386 2351 178 --
NM_001040712chr933443 3333 1206 --23253 390 --
NM_001042355chr1625427 4547 ------
NM_001042361chr101201 --1586 --
NM_001042364chr101201 --1586 --
NM_001042365chr101201 --1586 --
NM_001042387chr101201 --1586 --
NM_001042393chr101201 --1586 --
NM_001042396chr101201 --1586 --
NM_001042397chr101201 --1586 --
NM_001042412chr1625427 4547 ------
NM_001042413chr933086 1148 743 ------
NM_001042424chr42825 285 --32465 1093 416 --
NM_001042472chr20----1229 1451
NM_001042476chr1672104 1983 1544 1432 539 524 515 2284 102 11856 --
NM_001042479chrX22025 654 12042 12063 11665
NM_001042480chrX22025 654 12042 12063 11665
NM_001042486chr201157 --1993 --
NM_001042494chr1573414 3015 2575 1371 819 750 387 ------
NM_001042495chr1573414 3015 2575 1371 819 750 387 ------
NM_001042496chr1573414 3015 2575 1371 819 750 387 ------
NM_001042497chr1573414 3015 2575 1371 819 750 387 ------
NM_001042506chrX3550 478 45 ------
NM_001042510chr81449 1156 --1634
NM_001042511chr81449 1156 --1634
NM_001042537chrX22205 432 ------
NM_001042539chr161117 --11121 --
NM_001042548chr21325 129 --1863
NM_001042555chr1244242 3447 482 334 ------
NM_001042599chr255530 2524 1369 971 703 --27718 5936 --
NM_001042601chr311303 12615 1659 1788
NM_001042632chr2041938 1778 531 313 1577 ----
NM_001042633chr2041938 1778 531 313 1577 ----
NM_001042681chr162090 2053 1962 1744 523 289 --22425 2026 --
NM_001042682chr162090 2053 1962 1744 523 289 --22425 2026 --
NM_001042682chr162090 2053 1962 1744 523 289 --22425 2026 --
NM_001042683chr61150 --11149 --
NM_001042728chr122670 189 141 2986 358 --
NM_001042749chrX1258 ------
NM_001042750chrX1258 ------
NM_001042751chrX1258 ------
NM_001043318chr1452674 966 611 224 118 1651 11261 --
NM_001043351chr132150 1488 1453 11588 ----
NM_001044305chr611370 11524 ----
NM_001045556chr83647 82 22 ------
NM_001045557chr83647 82 22 ------
NM_001050chr1721227 57 --2102 74 --
NM_001068chr32214 86 ------
NM_001071775chr131168 ------
NM_001079874chr12297 193 ------
NM_001080418chr12576 405 1462 ----
NM_001083620chr422584 585 ------
NM_001083621chr154355 2950 1252 1136 556 13732 44627 941 852 773 1294
NM_001095chr1221920 464 --11827 --
NM_001099678chr324748 2308 ------
NM_001100108chr197624 6065 5425 5198 2481 1065 802 747 374 36403 5216 2419 11677 --
NM_001106chr3119163 7999 7498 6638 3413 3262 3008 2742 2691 1546 1178 12948 21388 1139 16946
NM_001113490chrX169 --22311 652 11262
NM_001116chr1652816 2769 2232 1138 313 --11205 --
NM_001117chr182801 600 12226 ----
NM_001121chr101195 --11506 --
NM_001128chr1643416 1083 757 572 13500 1543 23586 1599
NM_001130chr191197 ------
NM_001135chr153802 635 563 ------
NM_001146chr81214 --11914 --
NM_001156chr101487 ------
NM_001163chr91990 ------
NM_001173chr1434714 1430 1148 ------
NM_001189chr4145 1264 ----
NM_001198chr632339 975 73 ------
NM_001199chr8170 ------
NM_001204chr237068 6930 4837 1727 ----
NM_001206chr942837 2531 2282 2109 ------
NM_001218chr15165 ------
NM_001222chr1041721 1610 1299 356 --163 --
NM_001234chr31221 ----1294
NM_001241chr22951 456 --11507 --
NM_001241chr22951 456 --11507 --
NM_001256chr1732516 2177 397 --2797 201 --
NM_001257chr1611263 ------
NM_001259chr734891 136 52 ----11682
NM_001260chr131262 ------
NM_001265chr131218 1259 1125 --
NM_001273chr12--1475 ----
NM_001275chr141399 --149 --
NM_001280chr192696 444 ------
NM_001282chr1752355 2344 2153 284 259 11651 ----
NM_001304chr1741111 576 564 340 ------
NM_001310chr1221122 1087 ----187
NM_001313chr4--1720 2924 338 1316
NM_001326chr112338 138 ------
NM_001331chr1111060 --1921 11847
NM_001332chr53582 449 387 1432 ----
NM_001343chr51208 ------
NM_001357chr11278 ------
NM_001358chr4189 ------
NM_001364chr1133082 1783 1038 --23642 2962 --
NM_001365chr173616 236 195 --185 --
NM_001380chr101774 --1267 --
NM_001385chr81139 ------
NM_001386chr812128 1622 11615 --
NM_001392chr18----163 --
NM_001396chr21----1696 --
NM_001397chr142434 2255 1082 258 --22588 159 --
NM_001399chrX23566 2524 12944 --21275 249
NM_001401chr91383 ------
NM_001402chr611996 ------
NM_001406chr171619 1660 1482 --
NM_001408chr141466 1434 1244 32 1512 11065 --
NM_001416chr171189 ------
NM_001419chr1984778 4578 4110 3699 3134 3096 1378 534 --1880 --
NM_001420chr1952878 2854 2576 361 270 22691 372 ----
NM_001422chr11--181 ----
NM_001423chr1211987 ------
NM_001427chr72685 464 1642 ----
NM_001438chr132263 962 170 23467 2789 ----
NM_001440chr8102555 2468 2291 2270 1772 540 490 304 212 61 --32580 892 52 --
NM_001448chrX21204 598 --1202 --
NM_001451chr1621003 950 1114 ----
NM_001458chr72625 569 ------
NM_001489chr9160 ------
NM_001493chrX2206 140 159 ----
NM_001494chr101228 --1671 1740
NM_001495chr831209 1197 979 21240 265 1789 1503
NM_001497chr952621 2237 1885 183 137 11722 ----
NM_001498chr61251 ------
NM_001521chr24570 245 225 201 ------
NM_001542chr13913 326 47 1740 ----
NM_001543chr5114784 4618 4382 4376 4081 3919 1862 1778 892 634 466 11786 2605 558 --
NM_001552chr1731042 952 877 ------
NM_001570chr3----1305 --
NM_001616chr232147 772 556 ------
NM_001619chr112309 160 ------
NM_001642chr112841 429 ------
NM_001650chr1811011 ----11537
NM_001654chrX1352 ------
NM_001659chr1212187 22306 1803 ----
NM_001662chr71345 ------
NM_001663chr1431903 437 219 ------
NM_001664chr31940 ----1901
NM_001665chr113364 188 118 ------
NM_001668chr131398 475 360 ------
NM_001678chr1731304 622 176 --41367 1268 1186 543 11462
NM_001681chr121278 ------
NM_001682chr1212284 --11875 12746
NM_001683chr322430 1076 --1274 --
NM_001684chr164047 3688 3107 1083 1039 825 ------
NM_001693chr84948 438 77 44 ------
NM_001699chr191334 ------
NM_001707chr7155 ------
NM_001709chr1131956 522 144 --12470 --
NM_001723chr6146 ------
NM_001730chr132223 39 11445 ----
NM_001730chr132223 39 11445 ----
NM_001731chr12167 ------
NM_001743chr21220 ------
NM_001746chr532028 794 333 1129 --1727
NM_001753chr711698 ------
NM_001754chr2113985 --13465 23720 3167
NM_001755chr161804 ------
NM_001759chr1244523 3901 3860 930 13450 24268 676 --
NM_001773chr121090 563 --11226 --
NM_001777chr31350 --1416 --
NM_001782chr9179 ------
NM_001791chr111188 ----1375
NM_001800chr192220 128 ------
NM_001806chr1922904 35 --11886 --
NM_001822chr22707 196 ------
NM_001830chrX63407 2821 2501 1588 605 436 --11615 12544
NM_001843chr12--192 ----
NM_001858chr613294 14750 125 --
NM_001865chr6129 ------
NM_001884chr51440 1356 ----
NM_001893chr172401 65 ------
NM_001904chr311078 ------
NM_001915chr1781686 1597 1432 833 770 632 526 79 --2215 92 --
NM_001921chr4----21262 298 11021
NM_001927chr21713 --1258 --
NM_001931chr11183 --1318 --
NM_001933chr1421174 184 ------
NM_001935chr21343 ------
NM_001936chr7----21118 32 --
NM_001938chr121714 1237 --11421 --
NM_001945chr521411 1031 ------
NM_001949chr652958 1173 1143 330 206 1238 12813 --
NM_001951chr81179 ------
NM_001962chr51575 --1233 --
NM_001964chr541142 1093 802 93 ------
NM_001967chr31184 ------
NM_001969chr1452923 1586 1460 953 98 --2350 321 --
NM_001981chr112317 ----12081
NM_001987chr1233799 1695 499 13650 11375 --
NM_001991chr1772228 1623 1547 887 810 310 50 22189 1853 ----
NM_002006chr445247 3888 1930 695 ------
NM_002009chr1531044 853 431 11896 ----
NM_002010chr131185 ------
NM_002014chr121133 ------
NM_002015chr1323291 727 ------
NM_002017chr111287 --11407 --
NM_002019chr131748 --2829 597 --
NM_002023chr171606 1423 1261 432 277 68 50 ----11518
NM_002025chrX99103 8846 8511 8469 2948 2149 1167 1059 349 --28736 6958 --
NM_002032chr112395 352 ------
NM_002039chr41648 ------
NM_002040chr2131950 636 365 --1847 --
NM_002048chr92158 86 ------
NM_002061chr121853 1240 ----11608
NM_002062chr641505 1050 409 321 --1422 --
NM_002063chrX1375 ------
NM_002069chr71361 1235 ----
NM_002074chr121383 1144 11203 11514 --
NM_002077chr921508 469 11900 21791 1558 --
NM_002078chr3----143 --
NM_002088chr19----2167 143 --
NM_002092chr434593 3925 737 ----21079 835
NM_002095chr8----2294 287 --
NM_002103chr193989 834 365 --1887 1212
NM_002130chr51246 --1610 --
NM_002131chr631293 430 188 --1405 1940
NM_002135chr12----1395 --
NM_002137chr7--127 ----
NM_002146chr171114 1263 ----
NM_002147chr171101 --1163 --
NM_002187chr5----11085 11191
NM_002189chr102466 263 195 ----
NM_002198chr51285 --1338 --
NM_002199chr4241 34 ------
NM_002201chr15------1103
NM_002214chr715470 --14680 --
NM_002221chr142864 999 916 463 1642 22796 1006 --
NM_002229chr191492 ------
NM_002241chr122319 271 --1931 --
NM_002247chr1012296 ------
NM_002249chr11413 ------
NM_002254chr23827 576 62 --12259 --
NM_002264chr353910 1301 799 515 177 --23148 308 14946
NM_002265chr171870 ------
NM_002267chr1311798 192 ----
NM_002268chr341597 533 492 119 ------
NM_002270chr554965 2188 1994 1471 886 15086 ----
NM_002271chr1342159 953 696 529 --12253 --
NM_002283chr122551 23 ------
NM_002285chr2248 30 --22788 2749 --
NM_002313chr1055014 4854 3122 1806 1451 13499 44757 2011 755 504 --
NM_002336chr12----14042 --
NM_002347chr8125 --1127 --
NM_002351chrX31585 1202 464 ------
NM_002355chr1221041 986 --1876 11192
NM_002356chr622696 2210 ------
NM_002359chr1743191 2704 1298 484 ------
NM_002373chr151850 ------
NM_002374chr243289 2722 213 64 13536 ----
NM_002375chr342258 1512 496 204 12050 ----
NM_002382chr1421306 1108 ------
NM_002390chr1712075 --31898 1284 131 --
NM_002401chr1732104 1755 790 22181 1709 1543 --
NM_002406chr53856 794 785 --1368 --
NM_002408chr141718 ------
NM_002448chr4----1676 --
NM_002449chr5----1243 --
NM_002451chr923490 2667 ------
NM_002465chr12128 ------
NM_002473chr221274 --2525 179 --
NM_002480chr1221338 468 ------
NM_002485chr811785 --1329 1580
NM_002499chr1522443 537 11699 --1154
NM_002505chr621579 142 --1481 11221
NM_002507chr1731804 1598 741 --11528 --
NM_002509chr202825 638 1139 ----
NM_002518chr221126 100 ------
NM_002522chr1753491 3440 1157 585 399 13068 ----
NM_002523chr74859 768 165 105 ------
NM_002537chr153929 391 83 ------
NM_002538chr52426 225 ------
NM_002541chr731041 388 205 --1360 --
NM_002544chr17--1264 ----
NM_002545chr1143875 1731 1392 89 ------
NM_002553chr7------1100
NM_002569chr1521512 445 --11180 --
NM_002570chr151279 --1167 1222
NM_002572chr111398 ------
NM_002576chr1121157 1119 ------
NM_002581chr924802 725 12101 ----
NM_002586chr63384 65 34 ------
NM_002588chr531760 1568 1235 ------
NM_002595chr121383 ------
NM_002600chr131423 1417 263 ------
NM_002601chr2----1174 --
NM_002603chr81211 ------
NM_002609chr53246 169 82 ------
NM_002613chr16105258 3992 3965 3687 2063 1940 1875 1095 824 719 --63646 2006 1702 1631 601 428 --
NM_002623chr20--1232 ----
NM_002632chr141781 ------
NM_002634chr171116 1869 ----
NM_002636chr6----1182 --
NM_002641chrX2653 524 ------
NM_002643chr2----1203 --
NM_002648chr611121 --21079 927 --
NM_002651chr12557 210 ------
NM_002655chr835332 5011 372 11890 11979 1354
NM_002657chr2043787 3039 1461 1336 21538 164 135 1468
NM_002677chr821994 27 12960 ----
NM_002687chr1411069 1210 --1856
NM_002697chr1----194 --
NM_002707chr21151 1322 --1126
NM_002709chr21832 ------
NM_002714chr62888 145 --173 1258
NM_002716chr1133057 2563 282 --23214 865 --
NM_002717chr81452 ------
NM_002719chr1432336 843 352 --22348 504 --
NM_002726chr61167 ------
NM_002731chr132866 1005 427 ------
NM_002734chr1721965 574 ------
NM_002736chr722068 1726 ------
NM_002737chr1746113 5816 4120 1525 14240 55857 4143 2381 1650 1116 1257
NM_002745chr2244276 4118 157 101 --1317 1400
NM_002753chr4--1645 ----
NM_002755chr151213 1597 ----
NM_002756chr173854 685 193 --1143 --
NM_002779chr102514 375 ------
NM_002787chr7----1586 --
NM_002806chr14143 ------
NM_002809chr172321 43 ------
NM_002811chr161546 ------
NM_002819chr1951355 1149 567 438 198 --1325 --
NM_002833chr151647 --11159 --
NM_002836chr201124 ------
NM_002837chr1214532 23844 3022 ----
NM_002839chr933443 3333 1206 --23253 390 --
NM_002843chr1133128 3046 1132 ------
NM_002844chr61505 ------
NM_002845chr181246 --1121 --
NM_002849chr122930 67 --1710 --
NM_002850chr192784 391 ------
NM_002855chr1163639 2339 1055 568 235 174 43334 748 737 415 ----
NM_002857chr12975 933 11747 --12701
NM_002858chr1--1278 --1348
NM_002859chr1251814 1501 1440 1239 461 1268 ----
NM_002865chr81101 ------
NM_002868chr1242168 2059 1831 1633 --3841 718 114 --
NM_002869chr1142157 650 341 86 --1742 --
NM_002874chr921582 432 ------
NM_002886chr31579 --1222 --
NM_002893chrX2359 107 --1115 --
NM_002896chr11199 ------
NM_002897chr21764 ------
NM_002906chr1121620 728 ------
NM_002907chr12----1421 --
NM_002911chr1941364 1265 413 34 ------
NM_002918chr1921054 390 --173 --
NM_002924chr1------1404
NM_002928chr11263 --1304 --
NM_002938chr421530 1380 ----1277
NM_002941chr321163 424 ----1632
NM_002942chr3----11337 --
NM_002959chr133193 983 429 12762 1204 169
NM_002973chr121503 ------
NM_002977chr221329 426 ----12840
NM_002996chr1641696 1385 575 267 --11761 --
NM_002999chr2051719 1577 1311 544 23 11375 ----
NM_003001chr132098 1491 435 --2361 319 --
NM_003003chr171257 ------
NM_003010chr1721968 1595 ------
NM_003011chr921325 150 --1583 --
NM_003017chr631328 1210 1173 ------
NM_003024chr211860 --1248 --
NM_003028chr973317 2934 2744 2401 1201 1061 478 23188 934 ----
NM_003030chr32324 208 --1216 --
NM_003034chr1267964 7017 433 394 270 164 16245 ----
NM_003039chr13538 54 42 ------
NM_003043chr374018 3198 1734 1501 943 618 523 --12995 23904 3180
NM_003045chr1344051 4016 3279 169 --45064 3641 950 607 1664
NM_003047chr15918 369 303 271 71 ------
NM_003060chr5----1919 --
NM_003070chr9----1695 --
NM_003074chr332098 1952 1460 --1749 11822
NM_003076chr1231341 544 117 21290 554 1447 --
NM_003079chr171157 --1195 --
NM_003081chr201404 --1435 1229
NM_003088chr73311 193 42 186 ----
NM_003101chr131625 1312 409 --11024 --
NM_003106chr31979 ------
NM_003107chr621889 565 --1138 --
NM_003108chr277171 6309 6176 5664 5438 2878 50 --35100 2658 2579 --
NM_003112chr712176 --1118 --
NM_003131chr661796 840 619 569 501 278 --32122 1607 465 --
NM_003139chr112798 658 --1134 --
NM_003150chr1722042 607 ----1113
NM_003155chr81151 ------
NM_003157chr33635 206 57 ------
NM_003161chr1742518 1285 933 688 --13127 --
NM_003162chr21269 ------
NM_003173chrX11374 --21045 476 11130
NM_003178chr312015 ----11465
NM_003179chrX11069 1577 21018 413 --
NM_003183chr21812 --1594 --
NM_003185chr2021102 1030 ------
NM_003186chr111121 ------
NM_003189chr132068 168 93 2824 63 --12557
NM_003199chr1835505 4014 3902 ------
NM_003200chr1931904 915 462 183 12032 --
NM_003204chr1741599 1481 692 173 --1461 11538
NM_003211chr1231749 601 503 1668 ----
NM_003215chr421131 63 --122 --
NM_003216chr2293126 2469 2457 2393 2343 2029 1208 642 60 --32725 1294 667 --
NM_003217chr1241630 1575 761 208 1336 21439 1360 21258 193
NM_003221chr663795 2599 2564 1046 645 92 23222 1658 ----
NM_003239chr141120 --1176 1808
NM_003242chr332227 670 496 1540 ----
NM_003246chr15----2652 105 1779
NM_003247chr61130 1727 183 --
NM_003250chr171328 ------
NM_003253chr2131721 1560 134 ----11745
NM_003255chr1762315 2102 2061 947 278 240 ------
NM_003262chr354171 3609 3524 1436 320 --23540 683 --
NM_003275chr91113 --11480 --
NM_003290chr19----1313 --
NM_003291chr131163 ------
NM_003295chr13----150 --
NM_003298chr376213 5603 5304 3849 1705 733 638 --11308 --
NM_003320chr1163790 3740 1683 1423 626 130 --23495 158 12785
NM_003334chrX167 --178 --
NM_003339chr511391 1361 ----
NM_003341chr31638 ------
NM_003342chr1752864 2652 1275 1141 799 1503 ----
NM_003348chr1231118 628 400 ------
NM_003360chr4134 ------
NM_003370chr19----2584 159 --
NM_003376chr61758 --11502 --
NM_003376chr61758 --11502 --
NM_003380chr101295 ------
NM_003385chr22943 744 ------
NM_003387chr221957 1090 ----1508
NM_003389chr92478 387 147 ----
NM_003400chr21794 ------
NM_003404chr2031318 645 145 ------
NM_003406chr8------31567 387 291
NM_003410chrX3814 627 566 1736 ----
NM_003412chr352453 1938 339 333 323 --11171 --
NM_003418chr31311 ------
NM_003420chr31257 ------
NM_003432chr51491 --1485 --
NM_003442chr111786 ------
NM_003453chr131692 ------
NM_003455chr1151708 1317 1210 496 231 --1309 --
NM_003457chr171273 191 1221 --
NM_003466chr272377 2167 1972 1779 1557 535 473 21589 809 2571 352 1394
NM_003468chr243569 994 866 358 ------
NM_003472chr621150 1144 ------
NM_003474chr102559 516 1495 1587 --
NM_003482chr12----22624 2170 --
NM_003483chr1222345 2152 ------
NM_003485chr1421030 181 --11268 125
NM_003488chr172236 226 --1823 1964
NM_003489chr2121305 842 --22847 582 --
NM_003498chr1652116 1739 853 174 128 --11044 --
NM_003507chr222008 333 ----11336
NM_003509chr6150 ------
NM_003511chr6136 ------
NM_003512chr6149 ------
NM_003520chr6153 ------
NM_003521chr6150 ------
NM_003522chr6134 ------
NM_003525chr6141 ------
NM_003527chr6132 ------
NM_003529chr6137 ------
NM_003532chr6136 ------
NM_003536chr6137 ------
NM_003559chr173774 760 277 --32854 1353 1199 --
NM_003566chr1232383 1186 523 ------
NM_003575chr711080 ------
NM_003576chr1342776 2525 2356 2195 ------
NM_003583chr1243646 2577 2554 353 --12687 13227
NM_003590chr213251 ------
NM_003601chr4--1223 ----
NM_003603chr411346 11848 12019 1357
NM_003607chr143687 1187 431 392 21264 768 11371 --
NM_003612chr15132 ------
NM_003615chr343826 3658 473 202 ------
NM_003618chr21953 --11188 --
NM_003626chr1111122 --1887 --
NM_003629chr142252 1285 998 26 23077 607 1400 --
NM_003632chr172726 233 --2100 86 --
NM_003633chr512462 --22027 1888 --
NM_003634chr222782 755 --197 --
NM_003637chr121030 458 ----1256
NM_003644chr17116051 5713 4498 1985 1901 978 541 408 350 167 51 36069 4703 857 44954 1048 590 366 --
NM_003660chr191530 --1647 --
NM_003663chr333055 2615 70 ------
NM_003670chr31405 ------
NM_003671chr932909 2583 481 ------
NM_003705chr21780 ------
NM_003716chr3----11029 --
NM_003722chr342264 710 466 187 ----11710
NM_003735chr531760 1568 1235 ------
NM_003736chr531760 1568 1235 ------
NM_003737chr11--1371 ----
NM_003741chr31281 ------
NM_003743chr2----1304 1543
NM_003749chr1321954 431 ------
NM_003763chr2042694 2343 2097 1290 --23028 1067 --
NM_003766chr171506 ------
NM_003768chr1----11571 --
NM_003773chr3150 ------
NM_003779chr12457 164 --2375 335 --
NM_003783chr11270 ------
NM_003791chr161167 --1220 --
NM_003800chr6199 11737 ----
NM_003806chr12----195 --
NM_003818chr201874 2748 97 --1323
NM_003822chr132949 2201 851 1227 ----
NM_003825chr1511023 190 --11057
NM_003829chr9--1820 --1361
NM_003848chr3159 ------
NM_003860chr111371 --1310 --
NM_003861chr1452776 2343 1874 279 193 --2865 572 --
NM_003872chr232171 846 832 --11875 --
NM_003877chr121834 1342 ----
NM_003883chr53533 444 145 --2450 76 --
NM_003884chr3----1596 --
NM_003885chr172432 24 --1400 --
NM_003893chr101400 ------
NM_003902chr1----1553 --
NM_003907chr3----2324 49 --
NM_003913chr613337 13963 --1340
NM_003916chrX------11055
NM_003924chr43659 274 114 11203 1237 --
NM_003930chr712362 ------
NM_003931chr62691 191 ------
NM_003932chr2211831 --1447 --
NM_003934chr91372 ------
NM_003936chr21837 ------
NM_003947chr331249 342 197 ------
NM_003948chr41286 12096 12422 --
NM_003966chr553066 2900 1933 1785 1102 183 32939 2469 22 --
NM_003969chr191232 ------
NM_003980chr621335 234 ------
NM_003981chr151965 1117 2685 32 --
NM_003987chr103804 738 468 22084 642 11561 --
NM_003988chr104881 815 545 38 22161 719 11638 --
NM_003989chr103740 674 404 22020 578 11497 --
NM_003990chr103740 674 404 22020 578 11497 --
NM_003994chr1223690 3363 --11703 2668 343
NM_004004chr131444 1363 ----
NM_004028chr1811011 ----11537
NM_004034chr101487 ------
NM_004035chr17105058 5010 4999 4654 4374 1720 1261 1045 925 452 ------
NM_004050chr142797 673 11980 12370 --
NM_004052chr10126 ------
NM_004055chr1142206 1818 1461 474 21985 1936 32033 463 23 --
NM_004062chr16------143
NM_004081chrY21368 282 --11392 --
NM_004086chr141673 1213 1226 --
NM_004089chrX21119 266 11006 174 11226
NM_004093chr1352856 2523 1308 523 396 ------
NM_004094chr141431 ------
NM_004100chr611739 ----21772 81
NM_004112chr1751660 1106 647 520 26 11620 ----
NM_004114chrX2461 25 --1837 --
NM_004116chr23477 92 77 ------
NM_004156chr8147 ------
NM_004161chr211443 ------
NM_004162chr3--11029 ----
NM_004171chr1168391 8259 8035 7485 3082 2952 --49213 6785 1290 921 --
NM_004172chr511982 11801 ----
NM_004180chr21599 ------
NM_004183chr111726 ------
NM_004185chr1--1546 2720 163 --
NM_004186chr33884 806 796 1928 1951 --
NM_004187chrX21129 557 ------
NM_004200chr1153015 2828 2337 2215 210 ------
NM_004209chr161946 2785 28 2841 826 --
NM_004225chr8--11047 1297 --
NM_004227chr722680 2011 1810 ----
NM_004232chr1832520 1509 186 ------
NM_004240chr191246 --198 --
NM_004241chr102763 729 ------
NM_004263chr251696 1516 1143 417 239 ----11510
NM_004273chr1074626 4333 4259 3913 3267 1344 363 --44690 3074 1467 1008 --
NM_004274chr1442843 2262 1061 213 ----1105
NM_004279chr711456 ----1313
NM_004290chr511139 ----11059
NM_004293chr942998 2745 2698 44 1936 ----
NM_004296chr1473967 3424 3219 1085 813 321 219 ------
NM_004301chr3------1154
NM_004302chr1232235 1954 590 ------
NM_004305chr2163 --1407 --
NM_004309chr172961 145 --1705 1327
NM_004311chr1022167 1188 1502 1895 --
NM_004319chr1----12638 1216
NM_004321chr273559 3533 3423 3403 1209 810 603 22989 2965 43586 3393 2649 816 --
NM_004323chr962568 2160 1696 646 376 140 ------
NM_004326chr1----31138 931 353 --
NM_004329chr1021457 97 ------
NM_004331chr842412 1855 954 261 12383 ----
NM_004337chr832082 1739 76 ------
NM_004343chr193519 439 114 ------
NM_004349chr8--1932 --11007
NM_004350chr162066 744 654 541 80 72 ------
NM_004358chr2021128 725 ------
NM_004367chr631755 1749 1310 --11111 --
NM_004373chr121173 ------
NM_004379chr231524 622 47 ------
NM_004385chr52525 451 ------
NM_004392chr131191 ------
NM_004393chr321679 705 --2362 279 --
NM_004395chr53711 496 224 --1502 --
NM_004397chr1144207 4164 3264 2860 14279 ----
NM_004399chr122703 293 --1592 --
NM_004405chr23397 378 73 ------
NM_004411chr7----1790 --
NM_004417chr5123 ------
NM_004418chr2166 1148 ----
NM_004420chr1152172 2062 800 695 476 1640 11801 1951
NM_004423chr331714 968 913 --42105 705 651 179 --
NM_004429chrX3233 162 127 ------
NM_004430chr81155 11016 11094 --
NM_004432chr922040 944 ------
NM_004433chr121472 617 41741 1540 448 396 ----
NM_004437chr153469 2352 2305 1013 776 ------
NM_004438chr243047 527 482 468 ------
NM_004440chr621633 1258 ------
NM_004441chr331147 888 859 --198 --
NM_004450chr14------1271
NM_004451chr112534 206 ------
NM_004454chr32584 394 ------
NM_004463chrX1481 167 ----
NM_004468chr12596 189 1121 155 --
NM_004469chrX1167 ------
NM_004472chr5268 48 --1180 --
NM_004494chr131249 1010 297 --1189 --
NM_004496chr141506 ------
NM_004501chr153359 2685 2520 759 117 13098 12691 --
NM_004504chr222646 2233 1172 ----
NM_004506chr61504 1594 ----
NM_004516chr192863 116 --21013 957 --
NM_004519chr8----1234 --
NM_004529chr921213 351 ------
NM_004535chr2031605 1490 171 ------
NM_004539chr18149 ----1901
NM_004554chr141520 1363 21434 109 --
NM_004555chr162406 76 1124 ----
NM_004556chr61222 133 ----
NM_004566chr102805 432 --1605 --
NM_004573chr153653 624 61 ------
NM_004575chr441660 1471 563 263 ------
NM_004583chr17----2636 503 --
NM_004586chrX33644 1495 691 13498 --14277
NM_004588chr1183571 3362 3006 1142 973 827 659 244 31598 928 800 1669 1373
NM_004596chr192200 63 ------
NM_004598chr51248 --3838 553 394 --
NM_004602chr2031218 382 279 --11019 --
NM_004603chr72937 101 --1770 --
NM_004606chrX2394 55 ------
NM_004621chr1121258 381 ----1850
NM_004622chr232158 1889 972 ------
NM_004626chr111247 ------
NM_004630chr113956 414 211 ----1467
NM_004631chr121335 905 ------
NM_004642chr121125 --1135 --
NM_004661chr511225 ------
NM_004663chr15------1205
NM_004687chr1781977 1971 1807 1584 602 565 87 75 ------
NM_004690chr61682 ------
NM_004709chrX1142 ----1506
NM_004711chr2273043 3004 2640 2564 1361 697 445 23447 950 12831 --
NM_004713chr141619 ------
NM_004716chr112585 31 ------
NM_004718chr22168 97 ------
NM_004725chr101511 ------
NM_004726chrX24426 2168 ------
NM_004730chr531745 1607 815 ------
NM_004732chr172276 141 ------
NM_004736chr11372 ------
NM_004738chr2032279 829 665 12202 22618 1755 --
NM_004739chr111629 ------
NM_004745chr876511 6134 5926 5186 4814 572 234 11401 34622 4266 246 14944
NM_004747chr1011190 1369 11143 --
NM_004748chr1522578 849 ------
NM_004755chr141261 ------
NM_004757chr42611 91 ------
NM_004758chr171197 --1383 --
NM_004762chr1731771 1611 1479 1220 ----
NM_004765chr16145 ------
NM_004774chr172928 126 ------
NM_004776chr2052407 2207 2048 1038 231 --21029 848 21180 669
NM_004779chr52431 276 ------
NM_004781chr111395 --21695 1166 --
NM_004781chr111395 --21695 1166 --
NM_004788chr1132231 201 78 ------
NM_004796chr144914 602 556 373 ----1302
NM_004798chr201372 23582 3497 23504 1145 12901
NM_004801chr21548 ------
NM_004805chr21536 --1226 --
NM_004808chr1032918 1338 728 22824 2732 --12688
NM_004821chr5293 86 ------
NM_004822chr1761504 1222 1162 1119 720 279 --43473 1570 1487 1250 --
NM_004824chr621198 480 162 ----
NM_004834chr252723 2700 2576 2526 737 ------
NM_004838chr191159 ------
NM_004840chrX42319 2027 529 92 ------
NM_004863chr1495244 4672 4237 3516 3445 1572 1528 925 711 13247 45017 3767 3663 388 --
NM_004866chr524110 463 --1638 --
NM_004873chr1442682 2446 1139 927 --13137 --
NM_004884chr151104 11606 2707 445 --
NM_004897chr10----1774 --
NM_004904chr734793 635 121 11081 12355 --
NM_004905chr13708 224 129 --1718 --
NM_004922chr102916 696 ------
NM_004924chr192188 152 ------
NM_004926chr141219 ------
NM_004929chr831484 509 136 ------
NM_004932chr521613 88 ------
NM_004937chr1772335 1677 697 621 502 272 108 32367 2260 253 ----
NM_004947chr321027 600 --22050 205 --
NM_004952chr1----1230 --
NM_004953chr31156 ------
NM_004955chr61583 ------
NM_004964chr12417 385 --124 --
NM_004965chr212707 252 ------
NM_004968chr71572 ------
NM_004969chr10--1390 ----
NM_004973chr631632 628 472 ------
NM_004974chr11100 ------
NM_004975chr202331 149 ----1377
NM_004976chr11105034 4152 4082 3228 3167 2075 1627 1406 1068 281 --1408 --
NM_004978chr131257 1097 407 --2474 264 --
NM_004979chrX41117 955 321 233 ------
NM_004992chrX107951 6931 3046 2638 1432 1152 1040 563 263 79 35742 1673 1346 35257 2787 2233 38165 5530 153
NM_004992chrX107951 6931 3046 2638 1432 1152 1040 563 263 79 35742 1673 1346 35257 2787 2233 38165 5530 153
NM_004993chr143483 409 389 ------
NM_004995chr142422 309 11162 ----
NM_004998chr153639 313 74 ------
NM_004999chr633843 2843 808 ------
NM_005006chr22836 290 ------
NM_005010chr721688 640 --1622 --
NM_005020chr7----1526 --
NM_005028chr101686 --153 --
NM_005030chr161276 --172 --
NM_005032chrX2775 83 ------
NM_005055chr11124 ------
NM_005056chr1294953 4612 3743 3685 3627 3569 1046 983 585 11168 35028 1739 386 11303
NM_005057chr121856 685 ------
NM_005066chr11814 ------
NM_005068chr631458 587 563 11292 ----
NM_005078chr1541519 564 290 51 21784 1618 1284 --
NM_005079chr8----12268 --
NM_005080chr224826 761 723 272 ------
NM_005094chr9154 1464 1239 --
NM_005095chr111574 ------
NM_005096chrX41111 879 337 158 ------
NM_005102chr21325 129 --1863
NM_005104chr6131 --1137 --
NM_005105chr11886 --21762 1525 --
NM_005109chr342146 1806 756 361 ------
NM_005110chr51698 ------
NM_005116chr2093865 3814 3192 1703 1646 1427 1324 1306 338 11785 2849 561 14486
NM_005119chr11968 ------
NM_005121chr17------1374
NM_005124chr62867 307 ------
NM_005126chr31734 ------
NM_005135chr1573414 3015 2575 1371 819 750 387 ------
NM_005147chr164990 864 760 269 1438 ----
NM_005148chr17--2422 32 ----
NM_005151chr182668 396 --11521 --
NM_005153chr16----2519 85 --
NM_005154chr151575 ------
NM_005160chr2266600 5875 5501 5080 2484 111 12054 24912 878 --
NM_005168chr22714 609 ------
NM_005182chr164438 148 84 51 ------
NM_005184chr1911375 --21306 326 --
NM_005187chr1641782 709 437 324 ------
NM_005188chr11117605 6305 6207 5318 5250 2967 2655 2543 1339 1319 554 37703 5625 2358 12331 37428 6278 142
NM_005190chr611109 ------
NM_005197chr1454288 4143 4111 2286 1860 ------
NM_005201chr3--1360 ----
NM_005214chr21916 1456 ----
NM_005219chr521765 1353 ------
NM_005220chr1731335 305 295 ------
NM_005233chr31352 ------
NM_005234chr19----2311 105 --
NM_005235chr255530 2524 1369 971 703 --27718 5936 --
NM_005238chr1132838 1035 268 ------
NM_005240chr12545 315 --1190 --
NM_005241chr31942 --151 --
NM_005252chr14196 ------
NM_005264chr102875 178 ------
NM_005266chr12578 169 --2546 109 --
NM_005273chr71294 ------
NM_005276chr1251519 1406 695 621 464 --11463 --
NM_005276chr1251519 1406 695 621 464 --11463 --
NM_005277chr441794 1690 1632 544 ------
NM_005278chrX1499 ------
NM_005279chr2133 ------
NM_005281chr13111 68 58 1186 --1178
NM_005311chr732786 1919 283 11866 ----
NM_005321chr6150 ------
NM_005324chr1732037 1988 1926 1767 ----
NM_005326chr163118 56 40 ------
NM_005347chr911666 ------
NM_005349chr4--1530 ----
NM_005359chr1836468 4199 208 --25906 5150 --
NM_005374chr1722191 24 --11749 1152
NM_005380chr141251 1032 476 235 1936 1271 1116
NM_005387chr111524 ------
NM_005388chr921439 85 ----11736
NM_005398chr102387 198 ------
NM_005399chr132996 1444 1207 --1403 --
NM_005402chr7------1185
NM_005406chr1821329 58 1113 ----
NM_005407chr1421352 132 11523 11503 --
NM_005410chr5----1138 --
NM_005413chr22372 359 ------
NM_005415chr2--2287 208 1216 --
NM_005424chr1----127 --
NM_005425chr16121 ------
NM_005430chr123991 921 327 ------
NM_005433chr1832088 1101 284 ------
NM_005436chr1062972 2795 860 487 329 71 22651 125 33009 2590 2544 --
NM_005439chr12----1450 --
NM_005440chr1783137 2301 2048 951 888 560 349 74 22743 2502 22843 2260 --
NM_005450chr17----1166 --
NM_005455chr1----181 --
NM_005458chr952326 2278 1518 374 84 ------
NM_005461chr201352 --1533 --
NM_005474chr1751511 1471 1161 1056 1026 129 21210 161 --
NM_005475chr1272855 2656 1073 1040 1014 726 200 --11298 12465
NM_005479chr1061401 1151 1030 1011 97 52 --21056 429 --
NM_005487chr221546 11306 ----
NM_005497chr1795778 5481 5024 4789 4237 3765 2318 461 118 --191 --
NM_005501chr1721183 987 --11006 --
NM_005502chr922247 977 --1216 1715
NM_005507chr11----1438 --
NM_005512chr1111713 2670 432 --11513
NM_005515chr72168 55 ------
NM_005523chr721566 254 134 1994 11527
NM_005539chr101345 --11421 --
NM_005540chr141387 1204 1124 641 ------
NM_005544chr21686 ------
NM_005558chr12806 390 --1923 --
NM_005575chr5158 ------
NM_005578chr343879 3739 1853 326 ------
NM_005594chr12----195 --
NM_005596chr945552 2318 2299 2187 1775 ----
NM_005602chr311224 1102 ----
NM_005603chr1831731 519 220 1668 ----
NM_005604chr621808 35 ----1800
NM_005631chr73764 148 56 11048 ----
NM_005632chr162908 697 11089 11075 --
NM_005639chr12------1721
NM_005647chrX63255 2520 2403 2140 1140 311 12597 12608 --
NM_005652chr16----142 --
NM_005664chr151231 ------
NM_005668chr513736 34295 2896 987 --14339
NM_005678chr151804 151 1760 --
NM_005688chr32860 136 ----1911
NM_005717chr11974 ------
NM_005718chr3----2795 212 --
NM_005722chr241879 759 415 284 ------
NM_005724chr153608 551 135 ------
NM_005730chr1252755 2592 2264 1065 925 ------
NM_005731chr2------1121
NM_005737chr21506 --11985 --
NM_005746chr721815 651 --12192 1775
NM_005748chr1233423 3091 2687 --1997 --
NM_005751chr7163 ------
NM_005754chr511184 ----142
NM_005759chr234560 776 525 ------
NM_005761chr12--1109 ----
NM_005779chr553279 2965 2564 2490 885 --13600 --
NM_005785chr1231842 1563 101 11685 11584 21645 289
NM_005786chr1811242 ------
NM_005789chr1742016 1828 517 39 ------
NM_005819chr143296 1079 808 681 12416 1157 13330
NM_005826chr12568 79 1258 --147
NM_005828chr1743919 1762 1608 853 --54550 3291 816 734 258 --
NM_005839chr1----2778 295 --
NM_005840chrX136221 5973 5526 5008 4736 2991 2261 2087 1787 1622 1111 354 325 24899 1361 24673 1507 --
NM_005868chr742276 2012 686 44 21598 947 --22526 236
NM_005871chr101205 ----1128
NM_005895chr1263956 3723 1274 464 229 44 --1280 --
NM_005897chr131100 1010 957 ------
NM_005898chr1122384 323 ------
NM_005901chr1866434 6199 6140 3045 2146 905 13021 18409 --
NM_005907chr6------11532
NM_005909chr523618 1309 --22799 1217 --
NM_005910chr1793279 3159 3089 3060 2998 1413 905 348 162 13866 --13730
NM_005911chr211455 ------
NM_005920chr163703 2988 2864 2531 265 80 ------
NM_005933chr1132278 2239 694 12462 12215 --
NM_005934chr19102292 2223 2042 936 781 501 415 241 232 156 1859 12185 --
NM_005935chr41580 --13547 13529
NM_005937chr1754006 3574 3349 1466 666 --23745 3127 --
NM_005938chrX31336 1256 515 ------
NM_005941chr812569 --23313 1505 --
NM_005955chr185159 4678 3902 3391 1915 854 764 641 21014 731 34264 2196 667 21323 1007
NM_005964chr171128 ------
NM_005967chr122751 46 1158 ----
NM_005968chr191254 ------
NM_005994chr172861 631 1880 ----
NM_005999chr12556 95 ------
NM_006003chr19127 ------
NM_006007chr943739 3658 2956 890 ------
NM_006010chr3195 ------
NM_006011chr1553037 693 681 346 29 11281 33114 2950 2729 11690
NM_006015chr121266 351 ------
NM_006016chr6----1338 11682
NM_006030chr33507 486 257 --11360 --
NM_006033chr1822213 582 --1361 --
NM_006034chr1132132 2096 63 --2464 74 --
NM_006037chr294725 3352 3244 3077 2997 1869 1291 635 100 ------
NM_006038chr203684 451 271 --21659 559 --
NM_006039chr171751 --1815 --
NM_006040chr162450 46 11099 ----
NM_006043chr16232 22 --1763 1100
NM_006047chr2033451 2943 1063 21423 1303 ----
NM_006051chr5132 --1204 1261
NM_006054chr1111418 --11637 --
NM_006058chr5--1183 1530 125
NM_006062chr26883 360 260 208 74 55 ------
NM_006064chrX173 ----1280
NM_006070chr31330 ------
NM_006083chr5------1130
NM_006089chrX11350 ------
NM_006094chr8----31595 825 712 --
NM_006095chr424100 26 ------
NM_006106chr1133458 2842 1234 ----1205
NM_006108chr112563 120 --1619 --
NM_006113chr12297 193 ------
NM_006129chr81529 ------
NM_006133chr1141654 1587 758 546 --22114 1836 11557
NM_006134chr211340 11438 ----
NM_006139chr252701 2316 1862 1802 839 ------
NM_006141chr1631010 264 149 --32723 1724 235 12802
NM_006158chr841618 731 215 207 --11633 --
NM_006161chr5--1470 ----
NM_006178chr1721414 421 --11286 --
NM_006180chr91578 11528 1327 --
NM_006191chr123948 850 201 ------
NM_006194chr1421213 1125 21010 860 ----
NM_006201chrX11179 ------
NM_006203chr535116 4231 530 --13839 --
NM_006224chr1722314 1963 --42428 2119 1923 702 --
NM_006237chr131317 ------
NM_006243chr12893 867 ------
NM_006245chr6--1921 2810 762 --
NM_006246chr1411193 ------
NM_006251chr523301 425 ------
NM_006252chr134874 1620 1476 --15733 --
NM_006255chr142965 345 ------
NM_006256chr131967 1930 1851 --22772 177 --
NM_006257chr10275 54 --1325 --
NM_006267chr231731 1465 725 ------
NM_006275chr2052231 2030 1893 874 440 1162 ----
NM_006277chr21132 ------
NM_006282chr2044553 2899 151 61 11859 21342 627 --
NM_006283chr831775 482 256 ------
NM_006285chr91107 --1279 --
NM_006287chr222448 2411 ------
NM_006292chr111159 ------
NM_006293chr153220 107 39 ------
NM_006296chr21110 ------
NM_006302chr2270 64 --147 --
NM_006306chrX55068 4550 2242 736 597 15837 13648 --
NM_006310chr1731235 507 364 --2969 144 --
NM_006313chr1211533 ------
NM_006315chr444212 3675 3172 612 12825 1946 --
NM_006321chr341617 1373 708 79 ------
NM_006325chr121151 ------
NM_006328chr11------1217
NM_006352chr11293 ------
NM_006353chr6197 ------
NM_006357chr21407 ------
NM_006359chrX22205 432 ------
NM_006364chr142937 228 ------
NM_006366chr621273 969 ------
NM_006369chr12354 301 ------
NM_006375chrX21696 562 11545 11576 --
NM_006380chr1743583 3509 2984 1409 13536 ----
NM_006383chr151538 ------
NM_006386chr2212288 12205 --12130
NM_006389chr111516 --1171 --
NM_006391chr11177 ----167
NM_006393chr1024539 3048 14504 14391 --
NM_006416chr62735 637 ------
NM_006430chr21414 ------
NM_006434chr1041098 864 790 766 1388 1748 11015
NM_006449chr23665 292 73 ------
NM_006454chr4102963 2841 2598 2522 2178 1032 1007 866 588 478 12017 22279 2264 --
NM_006457chr453604 3261 1413 1152 538 --13927 1168
NM_006458chr11124 ------
NM_006460chr1721404 130 ------
NM_006465chr1531598 535 279 1151 ----
NM_006469chr111525 ------
NM_006482chr1243646 2577 2554 353 --12687 13227
NM_006492chr12338 93 ------
NM_006497chr173792 311 289 1128 ----
NM_006510chr641004 408 356 336 --2851 347 --
NM_006516chr11120 3504 302 173 21575 1430 1317
NM_006517chrX22006 1809 11652 22045 516 --
NM_006520chrX11576 ------
NM_006534chr2033122 2988 638 ----12404
NM_006538chr244083 3726 1141 996 --23409 3017 13714
NM_006540chr8--1377 1143 --
NM_006544chr1422323 1112 --15340 --
NM_006546chr1796567 4662 4421 4044 2626 2092 1228 764 386 24084 978 11054 15393
NM_006547chr721804 349 ------
NM_006548chr31243 1254 ----
NM_006549chr1231983 1925 839 --32749 2490 454 --
NM_006559chr1----1174 --
NM_006561chr1066225 5117 5020 976 573 164 ------
NM_006562chr10134 --1256 --
NM_006565chr163915 338 91 ------
NM_006570chr9------1394
NM_006572chr17--12320 1234 --
NM_006593chr2--1711 ----
NM_006599chr1698100 7321 6195 6181 5160 2879 2432 1833 419 --21489 1230 2919 62
NM_006601chr121909 1158 ----
NM_006602chr201697 ------
NM_006603chrX1258 ------
NM_006609chr222393 253 ------
NM_006614chr343554 2546 399 31 11052 --12685
NM_006621chr151874 1297 1267 555 208 --1181 --
NM_006624chr1011826 ------
NM_006626chr91643 ------
NM_006628chr1593503 3416 2915 2882 1678 1490 479 314 271 11132 --11874
NM_006636chr22836 743 ------
NM_006650chr53543 138 51 13562 2507 447 12712
NM_006654chr1244242 3447 482 334 ------
NM_006658chr72413 345 --145 11088
NM_006660chr151241 ------
NM_006662chr161322 ------
NM_006670chr61474 ------
NM_006675chr1283384 3249 2879 2601 2424 1017 711 304 ------
NM_006690chr2032182 2069 1685 1268 12080 --
NM_006699chr132126 1950 967 ------
NM_006706chr51339 ------
NM_006708chr611148 --1873 --
NM_006713chr52681 67 ------
NM_006717chr911157 22960 2373 23125 2439 --
NM_006720chr1055014 4854 3122 1806 1451 13499 44757 2011 755 504 --
NM_006722chr32879 657 ------
NM_006729chrX45380 4706 1876 1494 15054 13695 --
NM_006732chr1942132 2057 1714 728 --41356 699 286 122 --
NM_006734chr621410 1056 ------
NM_006736chr211700 --21433 1212 --
NM_006738chr1534297 4180 3440 13588 14584 12974
NM_006743chrX2728 313 ------
NM_006748chr83647 82 22 ------
NM_006749chr81106 21144 145 1827 --
NM_006750chr1635747 3088 294 23001 211 --21941 1208
NM_006761chr171128 ------
NM_006769chr11490 ------
NM_006771chr171231 --2652 83 --
NM_006775chr633029 2522 223 --12437 --
NM_006783chr131248 ------
NM_006788chr1831996 1516 81 1169 21961 298 --
NM_006791chr152525 502 ------
NM_006795chr1161536 1369 1043 1031 583 539 --2477 460 --
NM_006800chrX2520 124 157 1617 --
NM_006801chr19----1648 --
NM_006805chr5--11238 ----
NM_006807chr1721133 93 ------
NM_006814chr204988 955 874 30 --12553 --
NM_006816chr52329 218 ------
NM_006823chr831407 404 219 ------
NM_006826chr211032 ------
NM_006827chr142371 307 ----11316
NM_006832chr1421052 788 ------
NM_006833chr7----1133 --
NM_006851chr12152 --12826 --
NM_006852chr17--1232 --1298
NM_006854chr721579 1418 --1134 --
NM_006861chr1261859 1849 1755 477 336 67 --21888 734 --
NM_006874chr4----1814 --
NM_006876chr112541 529 1583 142 --
NM_006884chr32324 208 --1216 --
NM_006885chr1632694 1336 463 ------
NM_006892chr201290 ------
NM_006892chr201290 ------
NM_006914chr93580 539 180 ------
NM_006915chrX----12279 --
NM_006920chr211954 11860 ----
NM_006924chr1733940 3385 1016 ------
NM_006930chr531823 1813 1230 ------
NM_006931chr1242149 1720 1644 176 --12056 --
NM_006937chr17------186
NM_006940chr1231637 385 54 ----11266
NM_006941chr2241178 857 789 148 3821 743 185 --1898
NM_006946chr11----2548 394 --
NM_006950chrX2912 616 ------
NM_006959chr191350 ------
NM_006981chr9----1153 --
NM_006990chr162132 2078 1609 406 328 211 12541 22234 1619 --
NM_006991chr32872 154 ------
NM_006996chr1--1393 1628 --
NM_007011chr1595395 5030 5014 4577 2498 2456 2146 904 489 15972 32428 939 509 --
NM_007013chr81781 ----1293
NM_007026chr171100 ------
NM_007030chr585127 3292 1725 1378 1295 982 706 686 --24402 1733 --
NM_007033chr131922 747 570 ------
NM_007042chr32897 163 --12598 1606
NM_007050chr20127686 6768 6327 5807 2997 2590 2021 591 444 369 214 154 22798 1474 47655 6485 5601 291 --
NM_007064chr321107 364 ------
NM_007067chr172301 174 1514 1144 --
NM_007074chr161100 ------
NM_007078chr1042942 2539 2349 657 21962 646 ----
NM_007084chr1321408 1248 --1547 --
NM_007106chr1312202 ----11991
NM_007111chr13--128 ----
NM_007118chr52862 670 ------
NM_007125chrY------1509
NM_007137chrX65078 4973 3980 3709 1766 1258 --15043 --
NM_007144chr1711302 ------
NM_007146chr1712184 --12116 --
NM_007159chr321316 289 ------
NM_007162chr61469 ------
NM_007173chr111167 ------
NM_007174chr1231981 181 114 ------
NM_007185chr12299 273 --1679 1205
NM_007187chr13----1171 --
NM_007191chr121623 ------
NM_007192chr1431012 391 243 --1311 --
NM_007197chr122752 341 ------
NM_007200chr1534297 4180 3440 13588 14584 12974
NM_007203chr943383 3104 2713 885 ----11403
NM_007207chr1----1667 --
NM_007212chr11694 ------
NM_007213chrX--1270 ----
NM_007216chr1111065 --1358 --
NM_007219chr201861 ----2847 778
NM_007222chr821438 1426 ------
NM_007232chr203735 707 359 ----1241
NM_007238chr2084810 4715 3504 1498 544 364 119 29 1674 14753 2689 220
NM_007245chr162710 292 --1116 --
NM_007249chr1348079 6343 6306 3598 ----22023 1122
NM_007271chr61565 11327 ----
NM_007275chr321135 802 --2308 73 --
NM_007278chr171136 ------
NM_007283chr373023 2494 2219 947 659 575 79 1323 21909 66 12986
NM_007286chr531729 572 253 1460 21391 485 --
NM_007292chr17105058 5010 4999 4654 4374 1720 1261 1045 925 452 ------
NM_007294chr173854 360 336 ------
NM_007295chr173854 360 336 ------
NM_007296chr173854 360 336 ------
NM_007297chr173854 360 336 ------
NM_007298chr173854 360 336 ------
NM_007299chr173854 360 336 ------
NM_007300chr173854 360 336 ------
NM_007302chr173854 360 336 ------
NM_007303chr173854 360 336 ------
NM_007304chr173854 360 336 ------
NM_007305chr173854 360 336 ------
NM_007308chr4------1242
NM_007347chr151429 ------
NM_007358chr121959 77 --21969 1569 --
NM_007365chr12705 550 --12040 --
NM_007371chr9171 ------
NM_007373chr1011795 ----11176
NM_007375chr12920 462 ------
NM_012074chr142765 65 ------
NM_012096chr313238 23711 2701 --13431
NM_012097chr232005 843 781 ------
NM_012102chr162090 2053 1962 1744 523 289 --22425 2026 --
NM_012104chr1141483 1378 991 53 1173 --22490 1320
NM_012104chr1141483 1378 991 53 1173 --22490 1320
NM_012105chr211327 1262 ----
NM_012110chr4192 ------
NM_012134chr11202 1588 11669 --
NM_012141chr1322751 2634 ------
NM_012156chr2083002 2656 2248 1375 1109 1051 718 418 ----12543
NM_012158chr1321378 234 ------
NM_012164chr945868 5769 4568 2275 12399 15497 --
NM_012175chr11----1962 --
NM_012191chr32193 34 --1157 --
NM_012193chr1164846 3995 3617 1964 1897 1284 12049 24342 3689 --
NM_012199chr143320 3293 1749 1554 11431 34682 2949 1144 --
NM_012207chr1021023 348 ------
NM_012215chr1041782 752 585 224 ------
NM_012216chrX----131 --
NM_012224chr42483 53 ------
NM_012238chr101686 ------
NM_012248chr16159 --2494 112 --
NM_012249chr273592 2853 2493 1193 1095 712 328 12628 13398 --
NM_012257chr71940 --1391 --
NM_012281chr7------11872
NM_012282chrX125 ------
NM_012287chr343447 3112 461 117 11787 ----
NM_012288chr635439 636 269 22287 1052 23964 170 --
NM_012297chr442478 2464 1735 78 --1424 --
NM_012300chr541774 1702 185 114 1220 --12513
NM_012301chr73568 213 57 11405 ----
NM_012302chr11116 ------
NM_012304chr521998 1863 --12484 --
NM_012307chr182817 808 ------
NM_012308chr1161028 967 603 380 295 87 ------
NM_012309chr1193594 3447 1487 1009 905 646 509 314 182 --1630 13623
NM_012323chr2231528 1367 1233 ------
NM_012325chr201224 ------
NM_012326chr21720 ------
NM_012329chr1731403 1159 466 ------
NM_012334chr534088 1462 1357 11425 --2917 66
NM_012345chr131160 ------
NM_012382chr523730 771 --24223 3339 --
NM_012384chr2052218 2183 784 726 91 22084 918 12202 --
NM_012392chr12574 472 1627 149 --
NM_012402chr1131142 112 105 1222 ----
NM_012407chr222157 106 ------
NM_012417chr17--1570 ----
NM_012421chr1------134
NM_012428chr15282 27 ------
NM_012430chr31517 ----132
NM_012437chr13475 323 199 ------
NM_012448chr1741986 1627 989 643 --12039 --
NM_012471chrX21276 578 ------
NM_012473chr22--1130 2101 24 --
NM_012475chr12171 57 ------
NM_012479chr71432 --12040 1361
NM_013227chr153802 635 563 ------
NM_013230chrY2384 294 ------
NM_013233chr211227 1145 1966 --
NM_013247chr23385 141 26 ------
NM_013252chr73767 513 474 ------
NM_013253chr113307 128 89 1185 ----
NM_013261chr4--1725 12429 --
NM_013267chr121418 ------
NM_013269chr1231251 825 415 ------
NM_013279chr1151842 1694 529 497 302 11938 31817 1549 629 --
NM_013286chr36978 880 812 806 252 116 --22732 2323 --
NM_013304chr16154 ------
NM_013309chr1522097 1816 --1952 --
NM_013312chr19--280 32 146 --
NM_013316chr71692 ------
NM_013323chr1741150 933 852 794 ----1417
NM_013341chr222541 339 ------
NM_013348chr1921018 70 11046 --1964
NM_013354chr8--11475 ----
NM_013357chr81803 1792 ----
NM_013368chr192589 400 1137 ----
NM_013372chr1552261 545 390 318 85 ----13323
NM_013382chr1422066 1815 12249 31851 725 625 --
NM_013390chr931698 637 332 ----11224
NM_013392chr23278 146 139 ------
NM_013411chr132373 1090 532 32071 460 377 ----
NM_013433chr1941958 1770 1253 342 1265 ----
NM_013434chr221728 439 11678 11966 11671
NM_013434chr221728 439 11678 11966 11671
NM_013438chr931408 534 50 ------
NM_013443chr92974 319 11135 21052 873 --
NM_013444chrX----152 --
NM_013449chr1252800 2766 1980 809 624 --12097 --
NM_013450chr21346 1165 ----
NM_013943chr122740 225 ------
NM_013951chr272377 2167 1972 1779 1557 535 473 21589 809 2571 352 1394
NM_013952chr272454 2244 2049 1856 1634 612 550 21666 886 2648 429 1471
NM_013953chr272454 2244 2049 1856 1634 612 550 21666 886 2648 429 1471
NM_013958chr8----1166 --
NM_013959chr8----1166 --
NM_013961chr8----1166 --
NM_013962chr8----1166 --
NM_013989chr1444520 4092 3460 96 ----1406
NM_013992chr272454 2244 2049 1856 1634 612 550 21666 886 2648 429 1471
NM_013995chrX21973 1698 11789 ----
NM_014011chr212487 ------
NM_014016chr3129 ------
NM_014021chr133229 2299 220 ------
NM_014038chr72421 124 --187 --
NM_014089chr1321875 523 ------
NM_014106chr151390 ------
NM_014112chr814813 --11608 --
NM_014117chr1651958 853 842 415 187 --1445 12144
NM_014154chr321477 365 --1602 --
NM_014155chr1146959 6670 4807 2320 15220 16198 26586 290
NM_014157chr1663466 2972 1224 1086 970 75 11005 22995 1285 --
NM_014181chr222482 1919 --21173 855 11883
NM_014182chr124703 629 556 168 ------
NM_014190chr42645 103 11203 2738 396 --
NM_014191chr1211046 ------
NM_014213chr21224 ------
NM_014216chr1421440 1338 --21171 440 --
NM_014217chr111828 ----11451
NM_014232chr173533 496 249 ------
NM_014232chr173533 496 249 ------
NM_014233chr1722125 298 ------
NM_014238chr1721423 455 --2556 344 1694
NM_014240chr363687 3659 3013 2798 1217 481 --11376 11268
NM_014250chr221546 11306 ----
NM_014253chrX12398 ------
NM_014255chr12126 ------
NM_014268chr1831060 978 266 --1158 --
NM_014284chr13878 404 131 2932 335 1315 --
NM_014286chr962357 2319 2251 1391 1291 150 1198 12583 12196
NM_014288chr1----1221 --
NM_014289chrX1267 ------
NM_014292chr2271729 1702 1203 497 441 272 120 --21466 608 --
NM_014294chr8--11098 11127 --
NM_014309chr2245371 4164 4004 811 --11597 --
NM_014316chr1672104 1983 1544 1432 539 524 515 2284 102 11856 --
NM_014319chr1241277 570 344 59 1145 ----
NM_014331chr437464 2589 1359 --12343 16331
NM_014333chr1122756 2312 ------
NM_014345chr641029 741 342 309 --142 --
NM_014368chr91145 ------
NM_014372chr111377 ----1575
NM_014381chr1442455 2107 1180 137 ------
NM_014382chr31214 ------
NM_014393chr812305 ------
NM_014399chr7----1953 --
NM_014415chr321406 389 ------
NM_014417chr191379 ------
NM_014423chr533775 486 125 --11308 --
NM_014432chr62312 167 ------
NM_014447chr421478 1284 ------
NM_014456chr1021445 612 ------
NM_014458chr111045 ------
NM_014462chr8----126 --
NM_014469chr11----2849 290 --
NM_014488chr111119 --187 --
NM_014491chr71285 --1309 --
NM_014494chr1631691 1546 938 ------
NM_014496chrX155 ------
NM_014498chr3----1332 --
NM_014507chr222853 266 ----11193
NM_014515chr1231044 136 93 ------
NM_014554chr1211842 1294 ----
NM_014572chr1321163 571 ------
NM_014574chr14----11110 --
NM_014575chr31534 ------
NM_014577chr221666 ------
NM_014586chr2144407 3799 1823 949 33140 1777 1705 --1205
NM_014591chr1031320 1044 286 11163 1426 --
NM_014601chr1921696 191 21142 562 134 --
NM_014612chr91526 ------
NM_014613chr51639 ------
NM_014614chr2129 --175 --
NM_014615chr16--2301 144 22810 2273 --
NM_014621chr2--193 ----
NM_014630chr1583964 2532 1178 917 592 354 227 85 11131 ----
NM_014646chr1822084 999 12445 2393 67 --
NM_014653chr1221546 374 2871 304 ----
NM_014659chr151869 --1332 --
NM_014661chr1093941 3870 3749 3331 1389 1374 1327 1307 213 --31203 865 784 --
NM_014663chr1--21011 57 ----
NM_014665chr833514 3199 920 13207 12703 --
NM_014666chr5------11021
NM_014667chr342300 1717 428 405 --11620 --
NM_014670chr22998 73 --11070 --
NM_014671chr731218 321 102 ------
NM_014683chr1732113 1736 1637 --1248 1836
NM_014685chr162363 199 ------
NM_014686chr1952586 1926 1848 917 134 --22014 181 --
NM_014690chr732010 658 270 13059 22059 591 --
NM_014701chr1542805 2497 887 408 --12451 --
NM_014702chr61756 --23502 3272 --
NM_014709chr22403 253 ------
NM_014713chr2179 ------
NM_014720chr10----134 --
NM_014726chr173567 424 207 --1183 --
NM_014729chr83643 488 385 --1865 --
NM_014730chr1285186 4937 4819 4444 4302 3553 2008 795 --32027 1760 226 --
NM_014730chr1285186 4937 4819 4444 4302 3553 2008 795 --32027 1760 226 --
NM_014731chr2031163 1144 141 1468 ----
NM_014737chr2024108 3321 --11638 --
NM_014743chr463056 2612 2161 1184 639 458 11986 11105 --
NM_014751chr8------11484
NM_014755chr233921 1355 989 12610 1209 --
NM_014757chr521975 1906 ------
NM_014761chr1631071 821 145 1414 1234 --
NM_014762chr152510 2299 2193 1624 852 1432 1152 --
NM_014765chr131917 959 300 --22497 1903 --
NM_014767chr1062751 2593 1473 1397 1348 464 --21037 443 --
NM_014772chr1843533 2888 2229 1127 --1937 12358
NM_014774chr163190 2994 2795 2346 711 690 --1907 --
NM_014779chr3----1303 --
NM_014781chr81302 ----1157
NM_014782chrX1279 ------
NM_014784chr11364 ----1699
NM_014787chr121063 445 ------
NM_014793chr15------1603
NM_014795chr22986 237 ------
NM_014803chr1032559 916 527 --1866 --
NM_014804chr172307 187 ------
NM_014807chr113827 729 108 --1674 --
NM_014810chr132478 1108 729 22733 2343 ----
NM_014819chr532011 484 312 --11957 11869
NM_014824chr111416 --1498 --
NM_014826chr143687 1187 431 392 21264 768 11371 --
NM_014827chr11340 --11262 --
NM_014828chr1432285 413 83 1627 ----
NM_014836chr1011951 ------
NM_014839chr111863 --2878 614 --
NM_014840chr121178 --23281 1121 --
NM_014841chr621332 1108 ------
NM_014847chr1144 ------
NM_014849chr13411 334 191 2929 323 ----
NM_014850chr354142 4036 3406 1091 40 --2288 70 14086
NM_014857chr1178 ------
NM_014858chr131049 458 358 ------
NM_014870chr154355 2950 1252 1136 556 13732 44627 941 852 773 1294
NM_014871chr12--1534 170 --
NM_014872chr942193 2169 1783 88 --21745 106 --
NM_014873chr154871 4417 1454 1173 1043 ------
NM_014876chr221664 ------
NM_014877chr1766944 6835 6614 6156 5219 1738 27512 5998 1899 17660
NM_014891chr731250 550 484 11672 ----
NM_014892chr6------1451
NM_014893chrY12164 --1425 --
NM_014897chr1732531 2052 903 --1940 --
NM_014901chr512074 --31424 564 531 --
NM_014902chr201157 --1993 --
NM_014903chr12--1462 ----
NM_014904chr10----1243 --
NM_014906chr1733358 3136 116 ------
NM_014909chr1473473 2799 2530 1017 772 603 346 12550 23086 371 --
NM_014920chr632832 820 490 21049 346 --11371
NM_014921chr1962825 2762 2151 2046 502 62 22141 1949 12573 --
NM_014923chr1311869 --1788 --
NM_014931chr191571 ------
NM_014932chr3169 ------
NM_014934chr1333570 3289 2712 --13228 12907
NM_014935chr111536 11461 2644 94 --
NM_014937chr1041198 846 496 30 ------
NM_014947chr112933 1390 1765 --
NM_014949chr12995 151 ------
NM_014950chr1411598 ------
NM_014952chr1541708 1479 1276 580 21560 164 3710 532 243 --
NM_014961chr412170 ------
NM_014964chr1741954 1827 689 243 1431 --21756 585
NM_014969chr11860 ------
NM_014974chr1011410 --11668 --
NM_014977chr14--1479 ----
NM_014978chr1031355 629 527 --1328 --
NM_014982chr1425212 4286 ------
NM_014988chr43674 121 91 ------
NM_014989chr6------1167
NM_014990chr142156 28 ------
NM_014991chr412614 --1223 --
NM_014996chr32699 80 ------
NM_014999chr1221231 291 ------
NM_015000chr122567 321 --1188 --
NM_015002chr121244 12037 11661 --
NM_015008chr352734 2543 1113 527 318 --23353 3024 13399
NM_015009chr31599 ------
NM_015015chr1951875 741 673 439 349 ------
NM_015017chr111249 ------
NM_015020chr1621412 777 --1483 --
NM_015023chr13669 287 171 11285 --11170
NM_015024chr8----2200 98 --
NM_015025chr212018 ------
NM_015026chr1224667 184 13019 ----
NM_015033chr932564 2154 227 11052 13074 12532
NM_015039chr1114107 3169 2672 1447 1378 1007 545 423 384 345 306 --21649 429 --
NM_015040chr223333 1083 --22821 2141 --
NM_015042chr1594310 3930 3884 3811 3799 2706 1464 737 52 1719 21616 930 --
NM_015044chr1633078 2323 121 12810 13144 12709
NM_015045chr101826 ------
NM_015051chr932884 1116 783 ------
NM_015052chr71193 11362 ----
NM_015059chr1593314 2852 2588 1233 793 735 532 453 323 --13537 --
NM_015060chr71190 ------
NM_015061chr9----1649 --
NM_015063chr194958 366 214 146 ------
NM_015064chr1223413 972 --1664 --
NM_015068chr742738 642 607 546 --1820 1864
NM_015071chr516473 14566 14662 --
NM_015074chr153854 3795 1087 493 108 13740 21769 354 14633
NM_015075chrX41867 1437 727 106 21630 401 ----
NM_015076chr622805 955 147 ----
NM_015077chr1773377 3296 1668 1532 792 315 105 24289 1507 64156 3598 1894 817 474 122 --
NM_015078chr31306 133 ----
NM_015080chr112909 115 ------
NM_015090chr1105721 5290 5169 4277 4076 3926 2425 1780 1373 1181 --1652 --
NM_015092chr1644500 3610 3181 1526 ------
NM_015100chr152000 1883 1712 1394 680 ------
NM_015103chr331021 856 250 ------
NM_015107chrX11537 ------
NM_015110chr921782 62 ------
NM_015129chrX21605 54 1671 11730 --
NM_015132chr72361 148 --21727 766 --
NM_015133chr1621306 374 1951 --1327
NM_015137chr842077 639 475 225 ----1797
NM_015150chr32164 113 ----1279
NM_015153chr6----1625 --
NM_015155chr1032730 2470 637 13050 1319 --
NM_015161chr163579 399 158 ----1214
NM_015170chr8------12329
NM_015171chr16----2179 107 --
NM_015176chr11425 11425 ----
NM_015185chrX12337 22351 1866 ----
NM_015191chr1162728 2474 855 824 234 175 ------
NM_015192chr2042908 920 884 525 2282 175 ----
NM_015193chr821240 49 1208 11148 --
NM_015199chr312990 ------
NM_015200chr41591 150 --1299
NM_015205chr1393931 3783 3658 1914 1812 1600 1330 1125 132 ------
NM_015206chr1533822 2512 1001 --1431 1826
NM_015215chr121948 305 ------
NM_015225chr952620 2221 1952 44 37 ------
NM_015231chr112600 346 ------
NM_015233chr1331780 1039 33 --32298 2245 1890 --
NM_015236chr411170 ------
NM_015242chr111157 ----125
NM_015245chr682717 2306 2243 675 609 394 320 55 12099 ----
NM_015246chr1652024 774 736 119 38 1438 31522 1440 321 --
NM_015247chr1625427 4547 ------
NM_015250chr93607 575 305 ------
NM_015251chr1632103 2070 743 ------
NM_015256chr52685 674 ------
NM_015264chr2264275 3995 1274 1192 999 558 ------
NM_015265chr242344 2223 561 114 --1664 11042
NM_015267chr1211992 ------
NM_015268chr31545 ------
NM_015271chr442755 1352 670 253 ------
NM_015272chr1611814 --11772 11469
NM_015275chr1221393 491 21889 176 ----
NM_015278chr632200 1325 742 12711 ----
NM_015284chr1--21514 463 21881 595 --
NM_015285chr18----22004 281 12391
NM_015288chr573817 3574 2685 695 682 281 214 1845 ----
NM_015293chr6------1159
NM_015296chr13190 ------
NM_015299chr1443711 1176 900 708 --33695 3318 529 22713 304
NM_015305chr1441793 1315 671 260 --11248 --
NM_015310chr897742 7180 5821 2976 2500 2353 2121 1287 1086 --15844 11605
NM_015313chr1154710 4429 3160 2934 681 --1641 175
NM_015315chr543248 1268 1091 477 13264 ----
NM_015316chr14--11183 ----
NM_015317chr232761 2336 377 --12752 --
NM_015321chr19104423 4336 3997 3758 3495 3095 1956 1747 1682 1236 --74758 4387 3315 1846 1467 444 277 --
NM_015326chr11862 --22705 934 --
NM_015327chr131226 1005 930 --11243 --
NM_015332chr783544 3423 2829 1424 1230 1203 916 714 12764 2768 71 --
NM_015335chr122297 28 ------
NM_015336chr121232 ------
NM_015345chr642173 1877 761 181 22058 558 22276 1112 --
NM_015346chr1431559 554 403 --1106 --
NM_015347chr122767 485 1102 1464 --
NM_015354chr9--1322 ----
NM_015358chr211995 --1354 --
NM_015361chr2162 --134 --
NM_015365chrX24189 3072 13405 ----
NM_015374chr2231472 1004 169 1189 11283 --
NM_015375chr153912 3906 3494 1587 705 --24871 495 2397 276
NM_015385chr1041098 864 790 766 1388 1748 11015
NM_015386chr16290 25 ------
NM_015387chr231871 1525 784 ------
NM_015393chr423527 274 --12492 22792 538
NM_015397chr951191 685 360 237 93 --1305 --
NM_015401chr123325 239 47 1395 2359 319 --
NM_015404chr9----1493 170
NM_015428chr1931692 1234 199 --11490 --
NM_015443chr171445 --21005 451 --
NM_015446chr12633 229 ------
NM_015455chr521073 679 ------
NM_015460chr331608 790 215 --1253 --
NM_015461chr181309 ------
NM_015464chr71328 ------
NM_015477chr1521037 634 ----1888
NM_015481chr122416 65 3680 174 139 ----
NM_015492chr1511043 1120 ----
NM_015497chr151932 180 ----
NM_015503chr162583 515 1563 ----
NM_015508chr331368 1009 334 ------
NM_015530chr21247 --1726 --
NM_015534chr1------1169
NM_015535chr233011 806 183 --141 --
NM_015537chr94953 732 158 145 1826 196 --
NM_015541chr31574 ------
NM_015542chr101282 1461 ----
NM_015553chr645044 3391 1619 172 1274 ----
NM_015554chr1532085 1804 56 22552 630 12622 --
NM_015557chr143564 3547 2536 804 1429 23121 2708 --
NM_015565chr2112085 --11650 --
NM_015567chr131446 ------
NM_015568chr20114243 3603 3361 3123 2849 1321 307 241 184 110 42 23818 2950 13954 --
NM_015570chr72425 85 ------
NM_015575chr263479 3286 2862 2770 2709 2449 --32992 1465 1188 --
NM_015576chr321972 469 ------
NM_015577chr531514 426 319 ------
NM_015605chr101201 --1586 --
NM_015609chr152945 2368 2169 1100 691 --1892 --
NM_015610chr732018 920 193 ----147
NM_015630chr21810 ------
NM_015635chr941573 1425 872 187 ------
NM_015640chr155304 5035 4998 1525 687 --34607 3997 28 --
NM_015651chr922024 64 ----11923
NM_015657chr2------143
NM_015658chr11363 ------
NM_015678chr131553 1637 ----
NM_015680chr21586 ------
NM_015686chrX22120 76 11966 11917 --
NM_015691chrX32782 1081 586 2776 740 ----
NM_015695chr65854 661 389 320 174 ------
NM_015716chr17161 ------
NM_015719chr191177 --1238 --
NM_015833chr211323 11855 11508 --
NM_015850chr831945 621 501 --31928 1784 1695 --
NM_015853chr11154 ------
NM_015872chr151407 1370 1182 652 183 ------
NM_015874chr4--1530 ----
NM_015878chr831852 689 306 --12227 --
NM_015881chr113307 128 89 1185 ----
NM_015898chr1921605 715 --42248 1931 738 245 --
NM_015904chr21674 ------
NM_015906chr123356 1469 --31865 1399 869 --
NM_015912chr821803 321 ------
NM_015913chr11540 1640 ----
NM_015975chrX--1184 ----
NM_015976chr11239 ------
NM_015981chr542033 2006 243 73 22448 2343 --12883
NM_015995chr1545434 4298 2093 1710 24956 1297 15127 24912 1843
NM_016003chr732018 920 193 ----147
NM_016025chr1621973 799 1634 --1566
NM_016032chrX41165 997 370 255 ------
NM_016035chr92416 67 ------
NM_016045chr20--1231 ----
NM_016048chr54723 379 197 119 ------
NM_016061chr221604 491 1385 ----
NM_016063chr61558 ------
NM_016072chr123923 555 180 ------
NM_016073chr15------11148
NM_016076chr1----22786 107 --
NM_016096chr81449 1156 --1634
NM_016120chrX----1321 --
NM_016132chr1512634 ------
NM_016141chr31741 ------
NM_016144chr51123 ------
NM_016147chr112221 205 --2826 116 --
NM_016152chr3----21210 351 --
NM_016156chr1122136 170 --11766 --
NM_016169chr1033180 2688 2671 12272 33024 2680 2285 --
NM_016201chr342150 1537 689 428 --11438 2896 473
NM_016206chr347742 6199 3021 1233 --39049 2978 2387 --
NM_016219chr92130 112 1441 2452 123 --
NM_016223chr113354 299 42 ------
NM_016230chr61166 ------
NM_016231chr1731548 1144 260 ------
NM_016248chr1343912 2528 1400 895 21160 364 ----
NM_016252chr23858 794 37 ------
NM_016256chr16----159 --
NM_016258chr12544 256 ------
NM_016260chr235968 2589 232 ------
NM_016271chr181150 ----1853
NM_016277chr611386 --1111 --
NM_016281chr12--11134 ----
NM_016284chr161287 1946 ----
NM_016287chr111973 --11649 --
NM_016300chr31537 ------
NM_016312chr12261 26 ------
NM_016315chr221596 1247 ------
NM_016320chr112190 55 ------
NM_016322chr912882 ----1849
NM_016329chr3195 ------
NM_016333chr162200 133 ------
NM_016339chr1711204 --21611 220 --
NM_016351chr71182 ------
NM_016374chr131598 628 473 ------
NM_016374chr131598 628 473 ------
NM_016376chr1734276 1198 435 11003 13707 --
NM_016395chr1521368 781 --122 --
NM_016396chr1542971 2371 1193 927 ------
NM_016410chr9----1556 --
NM_016422chr113958 758 305 ------
NM_016424chr1721818 1382 ------
NM_016436chr2032161 1710 636 12043 ----
NM_016441chr22351 146 --12263 --
NM_016480chr51214 --1790 --
NM_016488chr1211692 ----2405 360
NM_016490chr2130 ----138
NM_016507chr1753079 1961 499 371 359 ------
NM_016512chr81230 ------
NM_016513chr632832 820 490 21049 346 --11371
NM_016522chr11----11297 --
NM_016530chr1553978 3823 2590 1262 454 ------
NM_016559chr31994 --11216 --
NM_016577chr354070 3261 3153 1309 1233 32807 654 492 34299 1491 22 13550
NM_016588chr61640 ------
NM_016596chr123325 239 47 1395 2359 319 --
NM_016604chr52813 75 ------
NM_016605chr552216 1945 1742 897 115 11674 11872 --
NM_016619chr41237 ------
NM_016620chr11353 ------
NM_016621chr1154252 3923 3642 3205 111 --13993 1121
NM_016628chr101624 ------
NM_016656chrX173 ----1280
NM_016824chr101195 --11506 --
NM_016829chr31580 ----1261
NM_016830chr12171 --1163 --
NM_016834chr1793279 3159 3089 3060 2998 1413 905 348 162 13866 --13730
NM_016835chr1793279 3159 3089 3060 2998 1413 905 348 162 13866 --13730
NM_016836chr21764 ------
NM_016839chr21764 ------
NM_016841chr1793279 3159 3089 3060 2998 1413 905 348 162 13866 --13730
NM_016936chr1642137 1760 406 311 --11429 --
NM_016938chr111333 1387 ----
NM_016946chr1103175 1317 1230 1222 1179 1095 931 716 397 389 --32514 2491 1288 --
NM_017409chr121159 ------
NM_017412chr8----1968 --
NM_017420chr1423521 1051 ------
NM_017423chr41694 11807 ----
NM_017452chr2031218 382 279 --11019 --
NM_017453chr2031218 382 279 --11019 --
NM_017454chr2031218 382 279 --11019 --
NM_017455chr15282 27 ------
NM_017456chr1731771 1611 1479 1220 ----
NM_017482chr241571 1537 1439 176 11241 --11062
NM_017488chr221178 356 11384 11601 --
NM_017519chr611291 ------
NM_017522chr121335 905 ------
NM_017544chrX1675 ------
NM_017545chr201399 ------
NM_017553chr152350 75 ------
NM_017575chr1741496 1218 1048 551 ------
NM_017582chr111718 --193 --
NM_017583chr11172 ------
NM_017586chr9102097 1888 1704 1643 1494 1399 741 528 348 153 --142 --
NM_017594chr922642 1302 22761 2353 ----
NM_017596chr164536 3434 3173 3166 1703 883 14527 13095 --
NM_017602chrX----178 --
NM_017610chr15--11720 2250 122 --
NM_017617chr941344 1038 558 28 11431 ----
NM_017622chr173684 195 119 ------
NM_017633chr633703 3615 3042 ------
NM_017634chr811923 ------
NM_017635chr1121179 450 --1354 --
NM_017637chr948479 7714 3358 2704 --28733 7784 --
NM_017643chr1712197 ------
NM_017644chr314016 25039 3309 1747 --
NM_017650chr734947 1366 213 1115 15239 --
NM_017651chr6----11366 --
NM_017658chr1423211 1030 --11124 --
NM_017666chrX21370 703 --1230 --
NM_017672chr151255 --1482 --
NM_017686chr1--1975 129 --
NM_017694chr221438 42 --1404 --
NM_017709chr143550 1426 92 52 --22644 844 --
NM_017719chr341757 1003 616 401 ------
NM_017730chr31626 --1213 --
NM_017736chr1642393 2319 849 267 265 44 ----
NM_017737chr121462 371 ------
NM_017739chr11155 --1409 --
NM_017742chr1821455 197 ------
NM_017747chr5------1368
NM_017748chr17----1872 --
NM_017752chrX22141 870 11429 ----
NM_017753chr91882 --11015 --
NM_017754chr665033 4074 3172 1692 1043 701 --33878 3863 883 --
NM_017755chr5----151 --
NM_017758chr173941 480 33 ------
NM_017769chr1422976 850 ------
NM_017770chr622854 47 12112 11862 --
NM_017778chr8----11000 --
NM_017786chr82554 280 ----1195
NM_017787chr1042674 676 656 228 12210 42564 1115 815 112 12892
NM_017789chr22797 182 ------
NM_017799chr1421722 733 --11682 --
NM_017805chr19147 ------
NM_017824chr1021707 612 ------
NM_017848chrX43811 3538 1852 1242 13010 ----
NM_017856chrX22025 654 12042 12063 11665
NM_017857chr111676 ------
NM_017893chr101368 ------
NM_017919chr934799 4387 4234 --25117 603 --
NM_017921chr1752280 1677 535 244 137 --12234 --
NM_017933chr231216 1064 250 ------
NM_017938chrX41832 1740 745 38 ------
NM_017944chr1132978 883 54 1949 ----
NM_017945chr3------2880 148
NM_017954chr731441 1111 537 --1271 --
NM_017955chr142881 221 --159 --
NM_017988chr122320 79 ------
NM_017994chr752320 2184 2025 487 377 22850 846 --22032 863
NM_017998chr931352 1165 1022 ------
NM_018017chr10------11164
NM_018018chr1231885 1867 1358 ------
NM_018024chr84583 568 238 95 ------
NM_018027chr1031228 1102 286 --1363 --
NM_018028chr19399 70 33 ------
NM_018031chr32420 124 ------
NM_018036chr1434048 3850 2955 13323 ----
NM_018045chr162696 2382 2289 994 660 179 --22196 448 --
NM_018046chr531504 1318 693 11757 ----
NM_018047chr5125 ------
NM_018054chr161212 --1562 --
NM_018056chr1149 137 ----
NM_018061chr121181 542 ------
NM_018072chr11160 ------
NM_018077chr72389 62 ------
NM_018092chr1611244 ------
NM_018103chr11258 ------
NM_018105chr8--1935 ----
NM_018111chr19181 ------
NM_018116chr1------1550
NM_018133chr3166 ------
NM_018150chr13675 302 100 --1211 --
NM_018151chr21790 ------
NM_018155chr311387 ------
NM_018167chr141368 1841 ----
NM_018176chr421449 566 ------
NM_018178chr11150 --11800 --
NM_018181chr1831898 1386 772 ------
NM_018182chr1721393 905 ----1685
NM_018184chr341647 767 609 219 ------
NM_018193chr152108 36 ------
NM_018195chr1131972 1949 1941 ----11757
NM_018198chr121401 270 --1474 --
NM_018208chr13809 466 215 --21136 792 --
NM_018214chr61949 ------
NM_018244chr201850 --137 --
NM_018254chr12429 360 ----11550
NM_018263chr232391 1848 634 --1642 --
NM_018268chr51619 --1350 --
NM_018286chr173865 287 144 ------
NM_018287chr101412 ------
NM_018293chr331861 984 176 ------
NM_018299chr832926 2521 176 ------
NM_018302chr43944 864 497 ----12457
NM_018312chr1141699 804 770 58 --21906 1864 11821
NM_018315chr41127 1235 ----
NM_018327chr20----1110 --
NM_018334chr7------1203
NM_018351chr1254630 3976 3830 3070 1286 --13466 --
NM_018362chr1133614 3551 2513 --12764 1165
NM_018364chr133851 694 72 --22966 548 --
NM_018368chr61223 ------
NM_018371chr8--1418 21133 1126 --
NM_018373chr1446106 1833 737 214 22572 2049 --11258
NM_018374chr743944 3623 1913 750 1870 ----
NM_018375chr141402 --1435 --
NM_018387chr9----1398 --
NM_018388chrX31157 937 341 ------
NM_018403chr353149 1529 1329 783 679 156 33892 1383 906 --
NM_018419chr20------1110
NM_018424chr921878 1597 ------
NM_018440chr857129 6150 2679 1925 470 ------
NM_018442chr11330 ------
NM_018444chr812218 ------
NM_018448chr121145 ------
NM_018452chr6_random23787 1477 11087 32771 514 50 --
NM_018462chr32759 151 ------
NM_018469chr1721060 281 ------
NM_018482chr82936 309 ------
NM_018489chr11497 ----1452
NM_018490chr11----11446 --
NM_018492chr8126 ------
NM_018553chr1711641 --11814 --
NM_018555chr191922 2830 179 ----
NM_018566chr124831 53 ------
NM_018569chr411557 ------
NM_018584chr13475 200 193 ------
NM_018590chr101645 ------
NM_018602chr1531396 307 149 ------
NM_018638chr1222146 1432 11319 ----
NM_018639chr122512 447 --21299 399 --
NM_018650chr1----22238 1509 --
NM_018657chr31176 ------
NM_018660chr872767 2394 2331 2129 995 617 122 --1659 --
NM_018683chr2051703 1364 617 248 185 ------
NM_018688chr82312 111 ------
NM_018695chr51477 ------
NM_018699chr4139 --1277 --
NM_018704chr12348 187 ------
NM_018715chr132031 2012 141 --1786 --
NM_018717chr42726 662 22906 2074 ----
NM_018719chr721231 1174 11281 21292 362 --
NM_018834chr5143 ------
NM_018841chr142822 2808 1294 232 1784 --12591
NM_018898chr52283 220 ------
NM_018899chr52283 220 ------
NM_018900chr52283 220 ------
NM_018901chr52283 220 ------
NM_018902chr52283 220 ------
NM_018903chr52283 220 ------
NM_018904chr52283 220 ------
NM_018905chr52283 220 ------
NM_018906chr52283 220 ------
NM_018907chr52283 220 ------
NM_018908chr52283 220 ------
NM_018909chr52283 220 ------
NM_018910chr52283 220 ------
NM_018911chr52283 220 ------
NM_018912chr531760 1568 1235 ------
NM_018913chr531760 1568 1235 ------
NM_018914chr531760 1568 1235 ------
NM_018915chr531760 1568 1235 ------
NM_018916chr531760 1568 1235 ------
NM_018917chr531760 1568 1235 ------
NM_018918chr531760 1568 1235 ------
NM_018919chr531760 1568 1235 ------
NM_018920chr531760 1568 1235 ------
NM_018921chr531760 1568 1235 ------
NM_018922chr531760 1568 1235 ------
NM_018923chr531760 1568 1235 ------
NM_018924chr531760 1568 1235 ------
NM_018925chr531760 1568 1235 ------
NM_018926chr531760 1568 1235 ------
NM_018927chr531760 1568 1235 ------
NM_018928chr531760 1568 1235 ------
NM_018929chr531760 1568 1235 ------
NM_018948chr12494 47 --1999 --
NM_018951chr7168 ------
NM_018952chr172262 84 ------
NM_018959chr192489 220 ----1708
NM_018963chr211143 ------
NM_018970chr712870 ----1582
NM_018976chr1252839 2200 1114 797 125 ------
NM_018993chr2051392 1362 1139 286 233 ----1399
NM_018999chr1034054 3492 541 21619 822 1877 --
NM_019004chr722077 378 ------
NM_019009chr1192451 2421 2152 2097 1721 678 574 204 176 --11817 --
NM_019027chr42861 228 ------
NM_019032chr1----2690 81 --
NM_019042chr711093 --155 --
NM_019044chr244074 3801 204 78 11110 --13138
NM_019045chrX----1362 --
NM_019050chr4143 21798 560 ----
NM_019058chr101250 ------
NM_019071chr71550 ------
NM_019074chr155830 658 634 304 292 ------
NM_019084chr10----21606 355 --
NM_019088chr192219 25 ------
NM_019096chr641006 778 247 85 ------
NM_019106chr2221265 527 --22594 259 11200
NM_019114chr952416 2409 2254 2000 147 --12362 --
NM_019116chr1673531 3205 3055 2790 2742 1275 643 --12301 --
NM_019590chr1031454 1385 1366 --1504 --
NM_019592chr92601 144 ------
NM_019593chr2022327 97 --11989 --
NM_019595chr21132 ------
NM_019605chr12621 482 ------
NM_019610chr121513 1407 --11889 --
NM_019613chr17--21056 314 1285 --
NM_019850chr23730 116 72 1503 1632 --
NM_019854chr122160 150 --1731 --
NM_019860chr101609 ------
NM_019885chr262966 2760 940 541 264 185 --12954 1198
NM_019903chr101195 --11506 --
NM_020039chr1221920 464 --11827 --
NM_020122chr255958 4714 4506 1686 254 14218 15149 --
NM_020126chr191474 ------
NM_020148chr1873117 3007 2554 2492 1190 665 258 --174 --
NM_020178chr1721003 828 ----1868
NM_020179chr11174 ------
NM_020182chr2052954 2933 2756 2538 2268 --13415 --
NM_020184chr2----12073 --
NM_020198chr171191 ------
NM_020211chr15245 31 11152 11065 --
NM_020228chr1122057 1635 ------
NM_020245chr644423 4398 839 577 11586 ----
NM_020248chr171840 1771 1589 716 667 636 200 --2329 59 12380
NM_020309chr191229 ------
NM_020310chr1732366 728 597 --42411 1853 881 874 --
NM_020336chr2032683 2458 190 ------
NM_020342chr232453 694 101 12146 --12215
NM_020362chr12807 208 184 ----
NM_020363chrY21368 282 --11392 --
NM_020381chr631723 1287 508 ------
NM_020390chr324048 61 --23727 1685 --
NM_020420chrY21368 282 --11392 --
NM_020423chr11504 ------
NM_020429chr732633 964 264 --1177 --
NM_020432chr71163 ------
NM_020440chr162892 2527 2485 1088 512 189 --1709 --
NM_020452chr132032 1560 657 ------
NM_020457chr16--1274 ----
NM_020463chr21169 ------
NM_020466chr655047 3625 3075 1006 310 ------
NM_020473chrX2653 524 ------
NM_020474chr181718 ------
NM_020475chr82766 399 1164 11594 --
NM_020476chr82766 399 1164 11594 --
NM_020477chr82766 399 1164 11594 --
NM_020478chr82829 462 1227 11657 --
NM_020480chr82766 399 1164 11594 --
NM_020526chr141689 1130 727 139 ------
NM_020630chr101705 ------
NM_020640chr312016 1677 ----
NM_020647chr832131 211 190 ----1510
NM_020651chr21341 ------
NM_020654chr3--1503 ----
NM_020673chr2066481 5958 5871 5289 355 236 ----14716
NM_020689chr2031655 573 152 --11146 --
NM_020692chr141990 --3416 188 60 --
NM_020699chr133428 1949 1877 1697 --11571
NM_020708chr2042478 2435 905 48 --2774 418 --
NM_020713chr2062834 2599 554 408 336 208 12963 21268 956 --
NM_020717chrX44696 4226 1921 1310 2762 602 ----
NM_020718chr1634710 4364 845 --14641 --
NM_020727chr2123459 203 1738 1279 --
NM_020728chr732618 1275 700 ------
NM_020732chr611291 ------
NM_020734chr1253214 2937 609 527 238 ------
NM_020739chr1522578 849 ------
NM_020742chrX12233 11807 32645 1891 443 --
NM_020749chr811374 ------
NM_020752chr1022831 705 ------
NM_020762chr123970 933 120 ------
NM_020765chr1141 ------
NM_020766chrX74552 3777 3684 2889 1618 212 89 --13441 --
NM_020769chrX1381 --160 --
NM_020771chr611501 ------
NM_020772chr17107883 7756 7633 7287 6513 6019 5415 3405 817 341 12204 28199 739 11563
NM_020778chr15123844 3750 3317 1601 1357 1175 862 769 312 228 171 143 13192 33892 1414 742 13831
NM_020791chr1711143 ----1368
NM_020794chr1------1631
NM_020795chr1721998 83 ------
NM_020796chr533018 2385 1115 ------
NM_020801chr552581 1969 1789 929 36 ------
NM_020803chr412193 ----11834
NM_020804chr692528 2477 2076 2054 1884 1694 1047 797 484 21005 273 ----
NM_020808chr12705 297 ------
NM_020819chr61307 ------
NM_020824chr10----1690 --
NM_020826chr1133287 2616 338 --22390 130 --
NM_020830chr21601 --1213 --
NM_020832chr11597 ------
NM_020836chr14129 ------
NM_020841chr1224066 822 ------
NM_020845chr1262547 2337 1944 1876 969 921 1580 ----
NM_020850chr1632718 2464 2365 --121 --
NM_020854chr18----156 --
NM_020856chr1911380 ------
NM_020858chr153756 182 29 ------
NM_020860chr41782 ------
NM_020871chrX32141 2035 505 ------
NM_020886chr1111252 --2469 32 --
NM_020899chr1762416 2209 1660 1566 518 201 ------
NM_020921chr1422930 464 ------
NM_020922chrX21265 652 ------
NM_020925chr131393 1064 208 ------
NM_020927chr1632328 2270 1891 --1616 --
NM_020935chr243161 1171 1131 463 14198 ----
NM_020940chr102208 194 --1951 --
NM_020952chr91329 ------
NM_020956chr19113413 2893 1913 1835 1757 1679 1548 1044 1002 639 525 24549 4220 ----
NM_020962chr1542189 1968 1638 487 --21007 559 --
NM_020971chr191887 ------
NM_020974chr113494 444 210 ------
NM_020981chr21307 ------
NM_020993chr1242523 1901 503 464 --1889 --
NM_021005chr151462 ----1441
NM_021020chr8123012 2841 2782 1379 1121 847 702 526 354 274 227 53 --12347 --
NM_021025chr51352 ------
NM_021035chr201118 11176 ----
NM_021044chr121141 ------
NM_021061chr854465 4281 4159 1329 703 13865 ----
NM_021064chr63726 586 56 --1317 --
NM_021065chr6252 23 ------
NM_021069chr411346 11848 12019 1357
NM_021077chr15134 ------
NM_021079chr1783261 2732 2300 2243 2036 805 573 502 13096 12848 --
NM_021090chr2284822 4747 4651 1594 1551 1197 746 337 1952 ----
NM_021097chr23999 647 336 ------
NM_021120chrX52932 2194 2107 1217 1206 11230 ----
NM_021132chr1031069 979 284 ------
NM_021148chr732282 2275 1638 ------
NM_021155chr1952669 2544 2133 998 638 1477 31082 983 525 --
NM_021174chr82758 478 1205 2649 623 --
NM_021183chrX22375 1959 ------
NM_021189chr11424 --1233 --
NM_021190chr121151 468 ------
NM_021195chr162182 22 ------
NM_021202chr2062811 2123 2079 1019 368 55 --12605 --
NM_021224chr9165 ------
NM_021228chr19------161
NM_021238chr121146 --21780 1389 --
NM_021239chr1421163 197 ----11468
NM_021240chr91207 ------
NM_021242chrX--1855 ----
NM_021245chr10------145
NM_021248chr20----1255 --
NM_021249chr1411282 ------
NM_021253chr621410 1073 --1229 --
NM_021255chr1443642 2861 488 457 13113 ----
NM_021269chr19----21647 110 --
NM_021614chr5184 ------
NM_021620chr6------1763
NM_021622chr1021899 60 ------
NM_021627chr32795 37 --11065 --
NM_021629chr375074 4974 4020 3571 3202 1728 726 13648 ----
NM_021637chrX1142 ------
NM_021638chr443262 3145 1750 724 1119 33187 896 216 23040 355
NM_021639chr11150 ------
NM_021643chr231339 699 126 21649 32 ----
NM_021644chr1021023 348 ------
NM_021648chr661690 354 310 250 164 128 1405 --12499
NM_021705chr621579 142 --1481 11221
NM_021723chr71182 ------
NM_021785chrX------1136
NM_021813chr631727 1388 254 1552 21759 1248 --
NM_021814chr631471 606 206 ------
NM_021825chr11----134 --
NM_021872chr2021128 725 ------
NM_021873chr2021128 725 ------
NM_021905chr62422 33 1153 21499 120 --
NM_021912chr1523600 549 --33926 1360 557 --
NM_021913chr191334 ------
NM_021914chr1431853 1791 1614 ------
NM_021935chr32262 226 ------
NM_021940chr611370 11524 ----
NM_021943chr641823 1538 762 399 ------
NM_021945chr642432 1126 508 393 126 22492 1420 1811
NM_021946chrX21427 1103 ------
NM_021947chr171385 --11350 --
NM_021949chrX52916 2738 2473 1817 494 ------
NM_021956chr62310 231 ------
NM_021960chr132679 1094 564 ------
NM_021961chr1197178 6990 5907 5677 2901 2610 2275 2228 1838 --26929 831 --
NM_021963chrX1548 ------
NM_021964chr322536 465 12020 ----
NM_021977chr623288 726 1633 2754 699 --
NM_021991chr173551 40 24 ------
NM_021998chrX11289 ------
NM_021999chr131699 ------
NM_022037chr2132 ------
NM_022048chr1585529 4840 4569 4083 2416 1764 579 206 12065 25962 1687 --
NM_022060chr1421377 359 1404 31283 1138 954 --
NM_022062chr1161774 1511 1476 1334 1259 1239 1587 ----
NM_022073chr14146 --11093 --
NM_022080chr2052763 1926 1078 178 90 ------
NM_022085chr621452 83 --1341 --
NM_022117chrX1229 ------
NM_022130chr51134 --1109 --
NM_022133chr811755 ------
NM_022138chr631371 1020 336 ----1184
NM_022157chr1124 ------
NM_022166chr16115408 4562 4480 2457 2158 1838 579 509 431 267 208 --24885 4750 --
NM_022170chr72467 296 ----1625
NM_022171chr321596 390 --149 --
NM_022173chr2132 ------
NM_022307chr71572 ------
NM_022336chr2156 --12092 --
NM_022338chr11--1229 ----
NM_022340chr363385 2676 2404 1471 1345 787 --1394 --
NM_022343chr941245 1118 1088 852 ------
NM_022346chr4----11196 --
NM_022351chr81747 ----130
NM_022369chr152174 78 ------
NM_022373chr72339 132 ------
NM_022444chr7------174
NM_022459chr1374399 4127 3965 2529 1309 1119 676 16075 --13859
NM_022462chr19143359 3143 3080 2739 2494 1486 1388 1362 1306 788 642 552 313 185 11456 23758 2723 32556 1521 1332
NM_022465chr1241167 1040 1030 839 ------
NM_022469chr142356 1089 894 630 13043 ----
NM_022473chr1573970 3267 3152 3118 2789 1290 566 11767 ----
NM_022474chr1432411 2102 205 --12036 --
NM_022476chr16--1408 ----
NM_022488chr3136 ------
NM_022552chr221216 986 ------
NM_022553chr63511 343 127 ------
NM_022574chr731412 790 81 --21636 649 --
NM_022716chr122268 285 ------
NM_022720chr223567 309 201 --11350 --
NM_022726chr6----11729 --
NM_022730chr2--1217 1702 --
NM_022731chr11104 ------
NM_022735chr131794 1552 436 ------
NM_022737chr1921199 881 --11287 --
NM_022739chr171746 ------
NM_022742chr7----161 --
NM_022745chr132832 861 567 ----11046
NM_022749chr841069 494 201 100 --1380 --
NM_022750chr71506 --2580 495 --
NM_022755chr911667 --42324 2232 1805 510 --
NM_022758chr631994 681 73 22227 2153 32444 899 111 --
NM_022768chr12319 116 ------
NM_022771chr12------1729
NM_022776chr311221 ------
NM_022781chr922685 2644 --186 --
NM_022821chr1----1175 --
NM_022824chr53484 255 191 ------
NM_022841chr1512325 1535 ----
NM_022845chr161758 ------
NM_022893chr223071 758 12028 ----
NM_022898chr1464685 3000 2966 1048 1039 832 --11416 --
NM_022912chr242718 1237 528 521 11168 ----
NM_022965chr431486 1419 1249 --1359 --
NM_022970chr10----11117 --
NM_023008chr193728 719 32 ------
NM_023035chr191254 ------
NM_023074chr192867 229 --175 --
NM_023076chr1632685 1829 971 --32559 2421 2172 143
NM_023079chr1731203 483 209 --11315 --
NM_023105chr831945 621 501 --31928 1784 1695 --
NM_023106chr831945 621 501 --31928 1784 1695 --
NM_023110chr831945 621 501 --31928 1784 1695 --
NM_023111chr831945 621 501 --31928 1784 1695 --
NM_023112chr1462708 2477 1866 1815 477 70 --32912 2803 927 --
NM_023927chr521170 176 ----1477
NM_023929chr832309 2089 512 ------
NM_023940chr43981 827 660 --1666 1100
NM_023943chr31201 ------
NM_024007chr512869 ------
NM_024019chr43198 171 42 --1407 --
NM_024029chr19182 --1272 --
NM_024046chr351138 456 313 241 65 ------
NM_024076chr1962295 1885 1724 1552 836 199 1530 12345 --
NM_024087chrX1670 125 --1624
NM_024090chr411624 ------
NM_024094chr81277 --1885 --
NM_024117chr95996 521 217 138 114 ------
NM_024294chr631994 681 73 22227 2153 32444 899 111 --
NM_024295chr831305 1271 833 11403 ----
NM_024306chr162851 92 --21023 484 --
NM_024345chr955342 5035 1555 1332 116 ----12350
NM_024348chr9--1261 --1232
NM_024408chr12635 350 ------
NM_024423chr1831145 930 111 ------
NM_024424chr11------1860
NM_024425chr11------1860
NM_024426chr11------1860
NM_024490chr151424 1456 ----
NM_024494chr1--1546 2720 163 --
NM_024503chr1----131 --
NM_024511chr433309 3121 384 ------
NM_024519chr16------187
NM_024525chr11490 --1251 --
NM_024528chrX--158 ----
NM_024529chr12328 166 ------
NM_024536chr21159 --1142 --
NM_024539chrX21096 151 ------
NM_024551chr1252114 1804 352 272 243 22516 835 2297 141 12541
NM_024551chr1252114 1804 352 272 243 22516 835 2297 141 12541
NM_024554chr13456 405 104 --11487 --
NM_024556chr112420 180 --1369 --
NM_024558chr142800 763 129 ----
NM_024563chr51726 140 ----
NM_024586chr11486 1648 1115 --
NM_024646chr122747 1560 13356 23087 718 --
NM_024659chr2--1171 ----
NM_024664chr1277 41 ------
NM_024665chr31811 --1626 --
NM_024674chr122444 935 --12337 --
NM_024676chr12937 258 1346 ----
NM_024689chrX2239 117 --21386 492 --
NM_024692chr22586 188 1236 ----
NM_024704chr203369 328 56 ------
NM_024713chr1511245 ------
NM_024721chr8--12035 ----
NM_024751chr442031 854 577 160 1272 ----
NM_024755chr15------1350
NM_024757chr91120 --11118 --
NM_024770chr265962 5458 2659 2250 656 168 15635 ----
NM_024779chr1241346 381 158 121 ------
NM_024787chr83391 343 142 ------
NM_024830chr541683 1411 258 82 ------
NM_024834chr101791 11497 1608 --
NM_024859chrX2226 199 --1133 --
NM_024866chr2223115 1058 1812 --1569
NM_024881chr1932692 1064 139 --11514 --
NM_024887chr131612 750 183 2718 51 1533 1423
NM_024911chr1----1109 --
NM_024920chr411402 --2156 122 --
NM_024922chr1621642 1478 ------
NM_024939chr161103 11238 11031 --
NM_024944chr21182 --11203 --
NM_024946chr1631199 438 314 --1186 --
NM_024949chr454886 4814 3828 831 353 13310 ----
NM_024953chr1221999 699 --1510 --
NM_024971chr91329 ------
NM_024991chr1041098 864 790 766 1388 1748 11015
NM_025054chr853544 3348 3309 721 253 --22829 193 1970
NM_025057chr1411226 ----1527
NM_025076chr2161 ------
NM_025079chr11172 ----1504
NM_025083chr152402 193 11306 ----
NM_025106chr141872 1413 1225 183 ------
NM_025138chr131444 ------
NM_025146chr312094 ------
NM_025160chr12515 60 22735 2611 24117 3344 --
NM_025164chr1131736 571 140 ------
NM_025179chr133313 3277 256 21866 1065 23517 1978 24077 1903
NM_025182chr9--1724 --1906
NM_025191chr132912 1383 422 13239 ----
NM_025221chr4----1282 11058
NM_025222chr342266 2046 1003 296 ------
NM_025230chr1451468 1332 724 689 130 1577 1696 --
NM_025235chr1022010 1395 ------
NM_025244chr2----1204 --
NM_025248chr1752983 1293 1250 1136 962 13027 33081 2305 1983 12734
NM_030569chr1052910 2805 1248 1224 36 ----11046
NM_030571chr521247 1083 ------
NM_030576chr1752295 1808 994 908 144 32350 1628 928 11860 --
NM_030594chr151232 --198 --
NM_030621chr1434022 3354 3321 ------
NM_030625chr1011627 --12063 --
NM_030627chr521656 1115 ------
NM_030629chr161413 11607 ----
NM_030637chr14------1740
NM_030645chr141076 335 204 24 ------
NM_030647chr711800 --15774 --
NM_030648chr484308 2026 1801 1708 701 652 510 265 11530 ----
NM_030650chr234021 3487 2808 23698 3665 ----
NM_030651chr6150 ------
NM_030653chr122703 293 --1592 --
NM_030660chr143483 409 389 ------
NM_030661chr731137 630 468 11079 1365 --
NM_030664chr1021664 622 ------
NM_030674chr1234511 3695 161 --2583 299 --
NM_030758chr2231470 1389 1145 ------
NM_030761chr132679 1770 1660 21841 1721 21896 1792 --
NM_030762chr1231972 1931 539 --21443 280 --
NM_030774chr1121315 37 ------
NM_030796chr722171 2118 ------
NM_030806chr1108566 7382 6974 6746 3238 2837 2578 875 674 394 --12284 --
NM_030808chr17126 ----1824
NM_030809chr1232442 1960 1880 ------
NM_030810chr621452 83 --1341 --
NM_030877chr20178 ------
NM_030881chr2212288 12205 --12130
NM_030884chr342258 1512 496 204 12050 ----
NM_030913chr12524 305 ------
NM_030914chr93659 286 254 ------
NM_030915chr221852 120 --11602 --
NM_030918chr1104710 4373 4164 4022 1741 1668 1618 498 468 130 25230 613 ----
NM_030940chr91319 131 11122 --
NM_030964chr573533 3362 2923 2687 2664 2549 44 --1411 --
NM_030978chr91464 ------
NM_030981chr1151134 836 300 128 110 1915 ----
NM_031203chr191254 ------
NM_031216chr1821517 780 ------
NM_031243chr7--127 ----
NM_031268chr16105258 3992 3965 3687 2063 1940 1875 1095 824 719 --63646 2006 1702 1631 601 428 --
NM_031296chr411958 --1659 --
NM_031309chr831846 685 33 11794 --11519
NM_031371chr131598 628 473 ------
NM_031371chr131598 628 473 ------
NM_031409chr631755 1749 1310 --11111 --
NM_031411chr52283 220 ------
NM_031412chr121234 --188 --
NM_031426chr972692 2579 1907 1897 724 296 172 --22573 386 1479
NM_031427chr1475645 4435 4145 3662 2204 2154 1536 14352 15812 --
NM_031445chr262915 2857 2443 575 250 234 --12603 --
NM_031459chr111635 ------
NM_031468chr776420 6334 6037 5313 3101 2327 677 11790 57522 5361 3298 825 505 16561
NM_031477chr16----164 129
NM_031483chr201752 --196 --
NM_031844chr153359 2685 2520 759 117 13098 12691 --
NM_031845chr243289 2722 213 64 13536 ----
NM_031847chr243289 2722 213 64 13536 ----
NM_031849chr52283 220 ------
NM_031857chr52283 220 ------
NM_031860chr52283 220 ------
NM_031958chr172251 23 165 ----
NM_031990chr1951355 1149 567 438 198 --1325 --
NM_031991chr1951355 1149 567 438 198 --1325 --
NM_031992chr72467 296 ----1625
NM_032012chr9104922 4739 4730 3974 3312 3291 1433 570 283 248 ------
NM_032017chr121745 598 --2797 774 --
NM_032028chr52563 158 ------
NM_032041chr842560 2127 1888 607 ------
NM_032047chr3--12149 ----
NM_032048chr182602 506 ------
NM_032051chr222610 222 --196 --
NM_032052chr222255 216 1951 176 --
NM_032088chr531760 1568 1235 ------
NM_032092chr531760 1568 1235 ------
NM_032105chr1127680 7662 6324 5802 5572 5342 5326 5112 2194 2049 1977 1088 26030 144 15521 1808
NM_032124chr1811115 ------
NM_032139chr191107 ------
NM_032144chr21191 ------
NM_032145chr621920 286 ------
NM_032153chr342676 2307 1864 1070 1872 ----
NM_032154chr10142 ------
NM_032160chr1853771 3490 2993 1367 1174 --11312 --
NM_032175chr531757 1303 590 1564 ----
NM_032182chr101567 ------
NM_032186chr11353 ------
NM_032192chr172472 116 ------
NM_032193chr1121538 1493 --31771 360 179 11857
NM_032199chr10172 --12882 --
NM_032208chr231136 783 26 21306 252 --1874
NM_032217chr421119 1031 1453 ----
NM_032229chr1311118 ------
NM_032233chr141850 --1740 --
NM_032242chr3113232 3077 3052 2845 2702 2228 2196 1080 954 663 166 11255 22593 718 22178 1242
NM_032246chr151472 ------
NM_032268chr1632714 2124 147 32414 2298 1130 1669 --
NM_032281chr1952878 2854 2576 361 270 22691 372 ----
NM_032283chr161809 1277 1159 466 190 140 1568 11335 --
NM_032288chr31228 --1264 --
NM_032294chr1731546 416 211 --1657 --
NM_032298chr192134 36 ------
NM_032325chr1121957 117 --2194 49 --
NM_032327chr10----1380 --
NM_032339chr17121 ------
NM_032345chr122107 48 --1362 --
NM_032360chr1143 ------
NM_032373chr1033904 1769 349 ------
NM_032403chr531760 1568 1235 ------
NM_032413chr151137 ------
NM_032420chr53277 258 232 ------
NM_032430chr192295 171 1144 ----
NM_032438chr61219 1288 ----
NM_032439chr101336 --11049 --
NM_032440chr1021893 197 ------
NM_032442chr171145 ------
NM_032445chr1522118 773 ----198
NM_032446chr521349 56 23689 3523 --1771
NM_032452chr1431434 27 21 --1487 --
NM_032458chrX13370 --1884 --
NM_032486chr1662316 2228 2121 1653 913 653 32243 2156 158 22201 1956 --
NM_032491chr121916 ------
NM_032501chr2041431 232 51 21 ------
NM_032503chr62932 384 1242 ----
NM_032538chr642577 2188 1126 357 1510 --1661
NM_032547chr4------196
NM_032557chr41904 ------
NM_032560chr14146 ------
NM_032569chr163682 349 308 ------
NM_032575chr162495 415 --21629 1388 11961
NM_032580chr17----1185 --
NM_032581chr721305 129 --11420 --
NM_032582chr171663 ------
NM_032595chr171369 --11284 --
NM_032645chr11124 ------
NM_032682chr331265 1167 995 ------
NM_032689chr1931532 1034 98 ------
NM_032711chr1743191 2704 1298 484 ------
NM_032727chr101587 1117 ----
NM_032737chr1931720 583 70 --11812 --
NM_032789chr82277 40 1129 ----
NM_032808chr152725 624 ------
NM_032812chr101305 ------
NM_032817chr1052910 2805 1248 1224 36 ----11046
NM_032818chr942484 1860 971 191 1943 ----
NM_032825chr191903 ------
NM_032829chr121318 --1448 --
NM_032833chr11409 --12593 --
NM_032838chr192504 47 ------
NM_032840chr124796 286 134 82 ------
NM_032857chr151174 ------
NM_032873chr1134552 3480 2959 ------
NM_032875chr171220 ------
NM_032880chr1----1116 --
NM_032884chr1154 ------
NM_032918chr121117 ------
NM_032947chr52831 370 ------
NM_032998chr13846 365 191 ------
NM_033018chrX11179 ------
NM_033020chr123356 1469 --31865 1399 869 --
NM_033025chr193947 840 265 ------
NM_033027chr341102 208 101 65 --3975 381 294 --
NM_033030chr2------11387
NM_033071chr6------1159
NM_033089chr2021458 1014 --1470 --
NM_033116chr142232 89 ------
NM_033121chr1221685 268 ------
NM_033132chr1312256 ------
NM_033133chr1763298 2473 1414 1324 1195 575 --42646 1097 861 462 --
NM_033141chr1441974 1714 1568 486 ------
NM_033158chr3150 ------
NM_033161chr961573 1288 496 443 172 55 --11359 11515
NM_033222chr911204 ------
NM_033224chr777246 6945 6651 5101 2922 2412 1423 ------
NM_033225chr8199 ------
NM_033226chr163273 198 38 ------
NM_033259chr32328 26 --2581 569 --
NM_033274chr552945 2688 696 548 172 --32305 1368 947 --
NM_033278chr11124 ------
NM_033285chr844329 4068 1684 1037 ------
NM_033290chrX33783 3656 1395 182 --13542
NM_033300chr121335 905 ------
NM_033309chr165900 836 413 378 79 --1142 --
NM_033310chr11264 35 ------
NM_033315chr1731888 651 474 1867 21806 206 --
NM_033326chr1122339 1899 ----193
NM_033331chr932909 2583 481 ------
NM_033334chr9160 ------
NM_033375chr171432 --11199 --
NM_033378chr191149 ------
NM_033387chr952511 2232 997 912 160 1892 --1829
NM_033389chr1783628 3380 3248 1831 1430 611 537 486 --24232 804 --
NM_033393chr421184 405 12216 1686 11081
NM_033394chr231546 621 280 ------
NM_033401chr16------1149
NM_033420chr192941 779 ------
NM_033421chr2011282 1556 ----
NM_033425chr1143444 2674 2138 663 ------
NM_033426chr143302 121 35 --22799 887 --
NM_033449chr512006 ----1334
NM_033503chr1583801 3175 2720 2483 1426 1091 484 271 --13339 --
NM_033505chr286470 6354 5798 1544 738 695 533 258 --26401 4169 --
NM_033551chr543248 1268 1091 477 13264 ----
NM_033624chr121244 12037 11661 --
NM_033626chrX21750 1374 --1687 --
NM_033631chr193817 3809 3001 2943 1382 1192 613 339 142 12674 43889 2904 2696 607 --
NM_033632chr41127 1235 ----
NM_033642chrX2461 25 --1837 --
NM_033644chr541774 1702 185 114 1220 --12513
NM_033645chr541774 1702 185 114 1220 --12513
NM_044472chr11288 ------
NM_052818chr1321863 1720 --32074 1903 1842 --
NM_052820chr92478 387 147 ----
NM_052828chr631426 1364 386 ------
NM_052834chr18----22004 281 12391
NM_052840chr1521603 284 ------
NM_052845chr1252993 2647 1038 842 614 --22699 84 --
NM_052846chr2021280 1148 1986 21225 498 --
NM_052875chr1142174 1991 1741 1711 --41413 855 338 331 --
NM_052877chr1148 --1126 --
NM_052879chr1253955 3316 2648 2585 455 ------
NM_052885chr1263943 1679 1330 1274 470 92 1795 --11575
NM_052896chr142526 2478 1695 80 1380 ----
NM_052899chr52337 46 ----1616
NM_052900chr811256 ----11480
NM_052905chr211176 ------
NM_052906chr2284872 3609 1834 1695 1421 1220 1128 962 14599 ----
NM_052910chr131524 --1424 --
NM_052918chr10------1541
NM_052923chr6134 ------
NM_052925chr192763 743 ------
NM_052937chr832589 2008 1822 ------
NM_052951chr201168 ------
NM_052968chr113735 709 72 --2533 54 --
NM_052978chr144480 291 184 170 1280 ----
NM_053002chr33955 890 839 ------
NM_053016chr976595 6320 5371 4876 3042 1703 584 17696 17276 1471
NM_053023chr1152731 1031 755 702 426 1284 31304 670 433 --
NM_053025chr31394 --1654 --
NM_053026chr31394 --1654 --
NM_053027chr31394 --1654 --
NM_053028chr31394 --1654 --
NM_053031chr31394 --1654 --
NM_053032chr31394 --1654 --
NM_053053chr11991 ------
NM_053056chr11--1399 ----
NM_053064chr1422277 35 --12343 --
NM_053067chr9150 ------
NM_053281chrX1289 ------
NM_054016chr121916 501 ------
NM_054016chr121916 501 ------
NM_054016chr121916 501 ------
NM_054033chr23606 221 206 ------
NM_057159chr91383 ------
NM_057175chr41867 ------
NM_057178chr1762745 2622 866 712 239 110 --22162 872 --
NM_057749chr81455 ------
NM_058167chr13509 399 105 --21017 920 --
NM_058241chr22851 356 ------
NM_058241chr22851 356 ------
NM_078629chrX2520 124 157 1617 --
NM_078630chrX2520 124 157 1617 --
NM_079421chr192220 128 ------
NM_080415chr172830 33 ------
NM_080489chr202153 35 ------
NM_080546chr92926 231 1933 ----
NM_080552chr20----1124 --
NM_080596chr6136 ------
NM_080599chr101282 1461 ----
NM_080604chr61586 ----1623
NM_080607chr202756 212 ------
NM_080611chr20----241 23 --
NM_080616chr201267 --164 --
NM_080617chr201931 ------
NM_080654chr1131294 125 35 ------
NM_080669chr1743523 1258 771 404 --11582 --
NM_080670chr53752 681 376 --1942 --
NM_080676chr203740 559 300 11272 23128 34 --
NM_080678chr21218 ------
NM_080679chr63608 204 89 ------
NM_080680chr63608 204 89 ------
NM_080681chr63608 204 89 ------
NM_080717chr12--1333 ----
NM_080743chr632452 1798 942 12321 ----
NM_080759chr131191 ------
NM_080760chr131191 ------
NM_080764chr2262843 2825 2788 914 746 219 ------
NM_080792chr2052286 1935 1904 1688 115 --2165 140 --
NM_080827chr20--1239 169 --
NM_080832chrX2353 57 ------
NM_080840chr201124 ------
NM_080841chr201124 ------
NM_080867chr1434668 4288 3280 13658 --11153
NM_080872chr823021 460 1209 ----
NM_080881chr53711 496 224 --1502 --
NM_080927chr332990 903 402 --22917 348 --
NM_100264chr101624 ------
NM_100486chr101624 ------
NM_130387chr32850 51 ------
NM_130391chr933443 3333 1206 --23253 390 --
NM_130392chr933443 3333 1206 --23253 390 --
NM_130393chr933443 3333 1206 --23253 390 --
NM_130434chr151405 ------
NM_130436chr21----1696 --
NM_130438chr2112119 --11273 --
NM_130459chr931469 1341 665 --2412 200 --
NM_130466chr1241519 1384 279 30 --11824 11835
NM_130468chr151104 --189 1282
NM_130781chr52386 212 ------
NM_130797chr7----21118 32 --
NM_130798chr1511023 190 --11057
NM_130799chr113186 125 41 ------
NM_130800chr113186 125 41 ------
NM_130801chr113186 125 41 ------
NM_130802chr113186 125 41 ------
NM_130803chr113186 125 41 ------
NM_130804chr113186 125 41 ------
NM_130811chr201404 --1435 1229
NM_130838chr1511803 ------
NM_130839chr1511803 ------
NM_130846chr122930 67 --1710 --
NM_133170chr20127686 6768 6327 5807 2997 2590 2021 591 444 369 214 154 22798 1474 47655 6485 5601 291 --
NM_133172chr5132 --1204 1261
NM_133173chr5132 --1204 1261
NM_133174chr5132 --1204 1261
NM_133264chr1733760 1434 1061 11443 23404 981 13943
NM_133265chrX169 --22311 652 11262
NM_133266chr111310 --1182 --
NM_133330chr42825 285 --32465 1093 416 --
NM_133331chr42825 285 --32465 1093 416 --
NM_133334chr455600 4764 1921 1888 1208 --45988 2145 1384 1220 13967
NM_133335chr42825 285 --32465 1093 416 --
NM_133370chr443482 2794 2416 681 ------
NM_133372chr552668 2503 2237 368 168 ------
NM_133433chr51359 ------
NM_133446chr101247 ------
NM_133476chr12------1108
NM_133486chrX1370 ------
NM_133498chr191238 ----1121
NM_133499chrX2982 686 ------
NM_133631chr321163 424 ----1632
NM_133638chr521297 528 --11359 1197
NM_133647chr1573414 3015 2575 1371 819 750 387 ------
NM_133650chr6------1159
NM_134325chr1127 ------
NM_134442chr231524 622 47 ------
NM_138270chrX22735 521 --11079 --
NM_138292chr1142619 2588 1150 812 ------
NM_138319chr151279 --1167 1222
NM_138333chr922046 167 ------
NM_138338chr2232440 2106 751 ------
NM_138385chr431261 1099 122 1324 ----
NM_138415chr2251655 1334 1228 1193 1183 --1293 --
NM_138426chr732473 2451 820 --11823 --
NM_138437chrX1300 ------
NM_138455chr8153 ------
NM_138457chr652841 1360 1296 1041 705 1859 22446 407 1632
NM_138459chr611226 ------
NM_138473chr1274547 4197 4145 3213 1344 1190 1020 --21392 593 13992
NM_138479chr111677 11979 11734 --
NM_138492chr511253 ------
NM_138493chr62176 33 ------
NM_138571chr63722 286 37 ------
NM_138576chr1464685 3000 2966 1048 1039 832 --11416 --
NM_138621chr244083 3726 1141 996 --23409 3017 13714
NM_138638chr1431853 1791 1614 ------
NM_138693chr7----1116 --
NM_138713chr1698100 7321 6195 6181 5160 2879 2432 1833 419 --21489 1230 2919 62
NM_138714chr1698100 7321 6195 6181 5160 2879 2432 1833 419 --21489 1230 2919 62
NM_138731chr1413413 23608 1607 ----
NM_138732chr112909 115 ------
NM_138734chr112909 115 ------
NM_138735chr21548 ------
NM_138766chr5----1157 --
NM_138768chr111808 1654 1893 --
NM_138769chr162493 58 1349 1187 --
NM_138771chr7178 ------
NM_138775chr11----1589 --
NM_138782chr522205 970 ----127
NM_138795chr131244 597 294 ------
NM_138799chr221842 1596 ------
NM_138821chr5----1157 --
NM_138822chr5----1157 --
NM_138923chrX2394 55 ------
NM_138927chr21178 ------
NM_138967chr1542143 1551 665 90 11656 12025 22171 1799
NM_138970chr144914 602 556 373 ----1302
NM_138971chr1141483 1378 991 53 1173 --22490 1320
NM_138971chr1141483 1378 991 53 1173 --22490 1320
NM_138972chr1141483 1378 991 53 1173 --22490 1320
NM_138972chr1141483 1378 991 53 1173 --22490 1320
NM_138973chr1141483 1378 991 53 1173 --22490 1320
NM_138973chr1141483 1378 991 53 1173 --22490 1320
NM_138980chr4--1514 ----
NM_138981chr4--1645 ----
NM_138982chr4--1514 ----
NM_138991chr211327 1262 ----
NM_138992chr21--1459 ----
NM_138994chr16------1149
NM_139045chr9----1695 --
NM_139057chr152953 193 --1472 --
NM_139062chr172483 147 --151 --
NM_139071chr1231341 544 117 21290 554 1447 --
NM_139072chr2----1775 --
NM_139131chr111524 ------
NM_139132chr112190 55 ------
NM_139135chr121266 351 ------
NM_139159chr1931101 509 348 1878 ----
NM_139168chr51360 ------
NM_139177chr1721279 618 --159 --
NM_139181chr111157 ----125
NM_139207chr121245 --11420 --
NM_139244chr61157 ------
NM_139273chr11----1226 --
NM_139276chr1722042 607 ----1113
NM_139283chr1232349 935 496 ------
NM_139321chr2011214 --13934 13715
NM_139323chr2031318 645 145 ------
NM_139343chr2163 --1407 --
NM_139344chr2163 --1407 --
NM_139345chr2163 --1407 --
NM_139346chr2163 --1407 --
NM_139347chr2163 --1407 --
NM_139348chr2163 --1407 --
NM_139349chr2163 --1407 --
NM_139350chr2163 --1407 --
NM_139351chr2163 --1407 --
NM_144568chr14293 84 1279 1431 --
NM_144571chr456613 6560 5923 5516 5492 15241 ----
NM_144575chr2128 --166 --
NM_144578chr1444964 3404 1877 947 ------
NM_144582chr292612 2259 1765 1715 1703 733 389 168 110 --32363 2217 995 --
NM_144586chr21426 1509 ----
NM_144588chr1021110 125 --11179 --
NM_144599chr1585236 5109 4612 3774 1122 331 151 25 --23714 2108 --
NM_144600chr161623 ------
NM_144605chr16131 ------
NM_144632chr221708 341 --1476 --
NM_144633chr321218 330 ------
NM_144635chr341233 1140 114 85 --2825 482 --
NM_144636chr31633 --1690 --
NM_144644chr4121 ------
NM_144664chr1111575 12165 --11015
NM_144671chr123761 631 155 --3750 712 517 --
NM_144721chr41517 12501 1911 1353
NM_144723chr5----1621 --
NM_144728chr1----1667 --
NM_144729chr1----1667 --
NM_144767chr1534297 4180 3440 13588 14584 12974
NM_144949chr212487 ------
NM_144963chr842244 2081 1663 433 ------
NM_144967chrX1277 ------
NM_145008chr11------1113
NM_145052chrX1986 ------
NM_145055chr1823685 1294 --11409 --
NM_145056chr192160 23 ------
NM_145058chr12----130 --
NM_145065chr111423 1745 ----
NM_145074chr23385 141 26 ------
NM_145109chr173854 685 193 --1143 --
NM_145112chr1421306 1108 ------
NM_145113chr1421578 1380 ------
NM_145117chr111443 12618 ----
NM_145166chr382798 2711 2701 2460 2391 1931 1848 1797 ----11078
NM_145175chr231328 1189 1022 11447 ----
NM_145203chr131731 ------
NM_145206chr1032848 2239 1075 ------
NM_145234chrX1697 ------
NM_145239chr161172 --1765 1213
NM_145266chr51131 ------
NM_145284chrX22385 1764 ------
NM_145296chr194827 603 595 108 ------
NM_145307chr1054679 4312 3754 1656 491 --1500 --
NM_145341chr1021445 612 ------
NM_145647chr81162 --1174 --
NM_145658chr151220 ------
NM_145659chr161106 ------
NM_145686chr252723 2700 2576 2526 737 ------
NM_145687chr252723 2700 2576 2526 737 ------
NM_145690chr8------31567 387 291
NM_145793chr102875 178 ------
NM_145798chr174798 619 86 26 --2312 32 --
NM_145799chrX42936 1157 237 51 22002 857 13061 --
NM_145800chrX--1118 ----
NM_145802chrX--167 ----
NM_145808chr722258 1099 ------
NM_145891chr162550 213 ------
NM_145892chr162550 213 ------
NM_145893chr162672 335 ------
NM_145899chr631293 430 188 --1405 1940
NM_145901chr631293 430 188 --1405 1940
NM_145902chr631293 430 188 --1405 1940
NM_145903chr631293 430 188 --1405 1940
NM_145904chr631293 430 188 --1405 1940
NM_145905chr631293 430 188 --1405 1940
NM_145909chr61150 ------
NM_147150chr943383 3104 2713 885 ----11403
NM_147171chr7163 ------
NM_147175chrX2830 597 ------
NM_147181chr4----1282 11058
NM_147182chr4----1282 11058
NM_147183chr4----1282 11058
NM_147185chr7163 ------
NM_147189chr841642 624 359 302 --21790 161 11604
NM_147192chr161464 1356 1322 1312 399 273 11094 173 --
NM_147202chr942415 2243 2236 1919 --12497 1932
NM_147223chr2----1487 1726
NM_147233chr2----1304 1543
NM_148174chr831852 689 306 --12227 --
NM_148571chr1721607 253 --21852 1410 11436
NM_148894chr42968 78 ------
NM_148898chr71285 --1309 --
NM_148899chr71285 --1309 --
NM_148904chr11486 1648 1115 --
NM_148905chr11486 1648 1115 --
NM_148906chr11486 1648 1115 --
NM_148907chr11486 1648 1115 --
NM_148908chr11486 1648 1115 --
NM_148909chr11486 1648 1115 --
NM_148921chr1741954 1827 689 243 1431 --21756 585
NM_152233chr1411282 ------
NM_152238chr11239 ------
NM_152244chr1741150 933 852 794 ----1417
NM_152253chr2254287 3770 3372 992 185 24060 1424 --12686
NM_152261chr121138 ------
NM_152263chr175628 4846 4791 4022 910 587 288 ------
NM_152265chr1------2579 59
NM_152267chr2262167 1701 728 466 449 35 --2637 76 --
NM_152271chr82364 145 ------
NM_152277chr5151 ----11373
NM_152280chr133017 2943 746 --22608 731 --
NM_152283chr5180 2316 172 ----
NM_152289chr1921705 1057 ------
NM_152296chr192319 275 ------
NM_152335chr151621 ------
NM_152341chr1631357 1086 1048 11351 2473 86 --
NM_152344chr171546 --1110 160
NM_152345chr171937 11172 ----
NM_152346chr1711000 1862 ----
NM_152371chr161929 1770 1359 808 553 183 ------
NM_152374chr161716 1588 1381 1269 1225 1193 ------
NM_152375chr112471 32340 2327 50 1413 32254 2194 1787
NM_152387chr2--1181 1419 --
NM_152407chr543019 912 390 128 ----2978 789
NM_152410chr61126 ------
NM_152423chrX21524 1188 ------
NM_152424chrX44271 3784 1563 1383 ------
NM_152441chr121139 --126 --
NM_152442chr123554 367 44 --11370 --
NM_152470chr1832606 892 724 12595 11268 --
NM_152478chr191488 ------
NM_152493chr11563 --11461 --
NM_152520chr21352 --1995 --
NM_152529chr254353 4003 3071 1205 360 ----1284
NM_152538chr321718 1272 --11551 --
NM_152545chr41262 ------
NM_152556chr722397 35 1776 ----
NM_152586chr102799 73 ------
NM_152594chr1522222 1491 ------
NM_152624chr567402 6532 5514 5488 1489 517 21408 928 15980 --
NM_152629chr933086 1148 743 ------
NM_152636chr1132321 885 112 ------
NM_152641chr12----12468 --
NM_152652chr162281 48 --1222 --
NM_152678chr31788 ----21903 202
NM_152694chrX3171 140 77 ------
NM_152695chrX1901 --11958 --
NM_152699chr322624 217 --11114 --
NM_152713chr111215 ------
NM_152716chr1111596 11436 ----
NM_152733chr676412 5953 4270 4254 1714 1104 913 --56318 4887 4614 4574 1115 --
NM_152739chr71178 1130 ----
NM_152745chr71340 ------
NM_152749chr72470 73 --1386 --
NM_152756chr522936 1705 ------
NM_152758chr822457 361 ------
NM_152787chrX63905 3640 938 684 440 130 ------
NM_152789chr7--11086 ----
NM_152832chr113418 411 387 1438 1344 --
NM_152835chr112607 ------
NM_152836chr811755 ------
NM_152837chr811755 ------
NM_152838chr2033451 2943 1063 21423 1303 ----
NM_152855chr221276 ------
NM_152857chr6--1682 ----
NM_152858chr6--1682 ----
NM_152860chr1251019 308 262 205 113 1397 154 --
NM_152862chr2------1121
NM_152878chr2231528 1367 1233 ------
NM_152896chr9135 ------
NM_152902chr131493 802 724 11656 1418 --
NM_152924chr1595395 5030 5014 4577 2498 2456 2146 904 489 15972 32428 939 509 --
NM_152989chr1231637 385 54 ----11266
NM_152995chr41278 ------
NM_153029chr1693854 3475 3163 3043 3024 2944 2789 2514 779 --23902 836 --
NM_153035chr123006 677 1412 ----
NM_153038chr21672 ------
NM_153050chr2284822 4747 4651 1594 1551 1197 746 337 1952 ----
NM_153051chr2284822 4747 4651 1594 1551 1197 746 337 1952 ----
NM_153188chr554965 2188 1994 1471 886 15086 ----
NM_153207chr12--11608 1691 11591
NM_153228chr17192 ------
NM_153235chr62958 25 ------
NM_153260chr1541318 601 275 164 ------
NM_153262chr132862 2494 2309 ------
NM_153267chr91167 ------
NM_153273chr342575 624 432 206 --32685 781 222 11770
NM_153280chrX167 --178 --
NM_153321chr17128 ------
NM_153322chr17128 ------
NM_153334chr224740 490 306 140 ------
NM_153347chr1132380 901 179 1992 ----
NM_153350chr1631147 1073 511 ------
NM_153367chr1053891 3443 3429 1571 137 ------
NM_153450chr113662 616 169 ------
NM_153499chr1252081 2023 1885 937 47 --32847 2588 552 --
NM_153500chr1252081 2023 1885 937 47 --32847 2588 552 --
NM_153607chr5------1835
NM_153616chr153756 182 29 ------
NM_153617chr153756 182 29 ------
NM_153618chr153756 182 29 ------
NM_153619chr1532385 1420 1267 ------
NM_153620chr711121 1401 --1216
NM_153631chr731137 630 468 11079 1365 --
NM_153632chr731137 630 468 11079 1365 --
NM_153649chr132150 1488 1453 11588 ----
NM_153685chr122948 106 --21134 113 --
NM_153686chr422403 2366 --1932 --
NM_153690chr31892 --1200 --
NM_153697chr21570 --1124 --
NM_153705chr1132373 809 117 1198 ----
NM_153715chr7168 ------
NM_153756chr161943 1864 404 370 145 72 21888 1415 ----
NM_153759chr221216 986 ------
NM_153809chr92161 42 ------
NM_153810chr1084541 3709 3150 1684 1295 1116 1007 771 --35042 4571 4171 --
NM_153812chr172266 2229 1471 605 566 499 266 --12161 --
NM_153827chr17161 ------
NM_153836chr22726 415 11871 ----
NM_170610chr6138 ------
NM_170662chr3----1188 --
NM_170663chr17161 ------
NM_170665chr1254113 1521 972 885 621 13336 1599 --
NM_170675chr151397 ------
NM_170676chr151397 ------
NM_170679chr541128 1118 535 436 ------
NM_170706chr1114107 3169 2672 1447 1378 1007 545 423 384 345 306 --21649 429 --
NM_170707chr13755 307 38 ------
NM_170708chr13755 307 38 ------
NM_170711chr193665 590 41 1160 129 1884
NM_170719chr131444 ------
NM_170720chr1921018 70 11046 --1964
NM_170731chr1131956 522 144 --12470 --
NM_170732chr1131956 522 144 --12470 --
NM_170733chr1131956 522 144 --12470 --
NM_170734chr1131956 522 144 --12470 --
NM_170735chr1131956 522 144 --12470 --
NM_170751chr621198 480 162 ----
NM_170752chr621198 480 162 ----
NM_170774chr2024108 3321 --11638 --
NM_170775chr5184 ------
NM_170782chr11413 ------
NM_171825chr542033 2006 243 73 22448 2343 --12883
NM_172016chr621410 1073 --1229 --
NM_172020chr741423 691 470 452 ----1122
NM_172058chr811178 ------
NM_172059chr811178 ------
NM_172060chr811178 ------
NM_172071chr147366 2620 2017 1718 ------
NM_172103chr611739 ----21772 81
NM_172105chr611739 ----21772 81
NM_172169chr1041721 1610 1299 356 --163 --
NM_172170chr1041721 1610 1299 356 --163 --
NM_172171chr1041721 1610 1299 356 --163 --
NM_172173chr1041721 1610 1299 356 --163 --
NM_172200chr102466 263 195 ----
NM_172206chr1731546 416 211 --1657 --
NM_172216chr1231983 1925 839 --32749 2490 454 --
NM_172225chr161464 1356 1322 1312 399 273 11094 173 --
NM_172226chr1252081 2023 1885 937 47 --32847 2588 552 --
NM_173076chr2------143
NM_173083chr121203 70 ------
NM_173156chr11657 133 ----
NM_173157chr12----1395 --
NM_173191chr1031320 1044 286 11163 1426 --
NM_173192chr1031320 1044 286 11163 1426 --
NM_173193chr1031320 1044 286 11163 1426 --
NM_173194chr1031320 1044 286 11163 1426 --
NM_173195chr1031320 1044 286 11163 1426 --
NM_173198chr9----1153 --
NM_173199chr9----2485 472 --
NM_173200chr9----1153 --
NM_173214chr1698100 7321 6195 6181 5160 2879 2432 1833 419 --21489 1230 2919 62
NM_173353chr12197 ------
NM_173354chr2121406 129 ------
NM_173359chr31245 ------
NM_173468chr425000 130 --22345 733 --
NM_173470chrX22782 2635 --32772 2006 501 --
NM_173475chr1611566 1141 --11592
NM_173476chr1631869 1659 1422 --12108 11579
NM_173478chr1721094 437 ------
NM_173489chr5126 ------
NM_173500chr1521170 497 1934 ----
NM_173510chr2242865 2837 2535 2185 --1586 --
NM_173511chr243443 3217 162 133 ------
NM_173515chr61202 --133 --
NM_173531chr1922530 1563 ----13226
NM_173546chr31508 --294 63 --
NM_173552chr31317 ------
NM_173584chr112124 51 ------
NM_173587chr11198 132 ----
NM_173595chr12105297 5228 4688 4416 3924 1903 1580 1156 693 33 --64614 2085 826 668 302 273 13807
NM_173602chr1252969 1461 1323 821 605 177 ----
NM_173609chr152756 617 ------
NM_173642chr1168863 8091 7656 6125 6028 5968 5956 5622 3099 2719 2503 2497 2406 2045 1809 1360 --68593 8570 6334 6310 3584 334 12302
NM_173683chr831524 1499 310 ------
NM_173694chrX22042 289 ------
NM_173822chr221475 378 ------
NM_173829chr544388 4314 2063 320 14010 ----
NM_173832chr882853 2836 2520 1516 1083 742 373 245 --63795 3739 2668 1399 604 66 --
NM_173848chr81101 ------
NM_173851chr853840 3395 2684 1294 484 ------
NM_174909chr51668 ----1820
NM_174911chr822841 719 --1706 --
NM_174934chr11113409 3065 2829 2430 2223 1027 975 667 350 183 109 --22672 432 --
NM_174938chr92468 72 ------
NM_175038chr12--192 ----
NM_175058chr111112 ------
NM_175629chr221216 986 ------
NM_175630chr2--1716 1216 --
NM_175634chr8--1932 --11007
NM_175635chr8--1932 --11007
NM_175636chr8--1932 --11007
NM_175733chr1142090 2039 2014 1692 --21676 1607 11853
NM_175736chr1266669 5638 2965 2528 2175 2109 36739 6564 1044 24942 4742 16765
NM_175747chr63890 376 113 --1948 --
NM_175847chr1951355 1149 567 438 198 --1325 --
NM_175848chr201290 ------
NM_175848chr201290 ------
NM_175849chr201290 ------
NM_175849chr201290 ------
NM_175850chr201290 ------
NM_175850chr201290 ------
NM_175854chr1312667 ------
NM_175863chr611291 ------
NM_175866chr121248 409 ----11028
NM_175898chr152466 230 --11243 --
NM_175907chr1822844 620 --1371 --
NM_175920chr5158 ------
NM_175931chr1641782 709 437 324 ------
NM_176792chr1031363 1015 281 --1991 --
NM_176801chr42645 103 11203 2738 396 --
NM_176863chr1742016 1828 517 39 ------
NM_176871chr8123157 3080 3050 3012 2913 2749 2414 2299 800 536 487 151 11143 --22655 109
NM_177398chr131261 70 31 11467 11485 --
NM_177399chr131261 70 31 11467 11485 --
NM_177438chr1434022 3354 3321 ------
NM_177949chrX1279 ------
NM_177968chr221911 463 ------
NM_177972chr1163790 3740 1683 1423 626 130 --23495 158 12785
NM_177983chr21151 1322 --1126
NM_177985chr232005 843 781 ------
NM_177989chr3------1154
NM_177991chr20----241 23 --
NM_177996chr2083002 2656 2248 1375 1109 1051 718 418 ----12543
NM_177999chr9103536 3390 3334 2698 2681 1051 920 749 219 196 22440 454 33281 2864 545 --
NM_178010chr1231637 385 54 ----11266
NM_178013chr1452181 2122 2024 610 362 12263 ----
NM_178026chr201570 ------
NM_178037chr1223413 972 --1664 --
NM_178038chr1223413 972 --1664 --
NM_178042chr3------1154
NM_178126chr1732036 501 239 --1292 11477
NM_178151chrX55483 4975 4863 1605 997 --37817 5929 3143 15255
NM_178152chrX55483 4975 4863 1605 997 --37817 5929 3143 15255
NM_178153chrX55483 4975 4863 1605 997 --37817 5929 3143 15255
NM_178313chr221860 669 --164 11600
NM_178426chr131498 575 460 ------
NM_178427chr131398 475 360 ------
NM_178470chrX1100 ------
NM_178496chr32156 136 --11281 --
NM_178509chr17--12645 --1792
NM_178544chr193475 377 296 ------
NM_178554chr331408 1208 1035 1179 22689 221 --
NM_178565chr831341 1075 230 --1654 --
NM_178566chr91577 ------
NM_178568chr1721650 340 --2484 386 11149
NM_178578chr204988 955 874 30 --12553 --
NM_178585chr412614 --1223 --
NM_178586chr1432336 843 352 --22348 504 --
NM_178812chr831419 1323 624 ------
NM_178815chr1032427 2020 1042 ------
NM_178818chr1662251 1835 1713 1684 1530 175 11758 1875 --
NM_178830chr192300 65 1125 --173
NM_178835chr42666 584 ------
NM_178860chr173796 636 72 1977 ----
NM_178863chr16187 ------
NM_180976chr6--1921 2810 762 --
NM_180977chr6--1921 2810 762 --
NM_181077chr151347 --1185 --
NM_181332chrX12233 11807 32645 1891 443 --
NM_181336chr62896 186 31351 1317 1021 ----
NM_181349chr732633 964 264 --1177 --
NM_181354chr811380 ------
NM_181357chr1451468 1332 724 689 130 1577 1696 --
NM_181358chr133188 3078 2626 ------
NM_181459chr2----1871 --
NM_181460chr2----1918 --
NM_181486chr12--1333 ----
NM_181504chr533246 1526 68 ----1990
NM_181505chr172472 116 ------
NM_181507chr1111065 --1358 --
NM_181508chr1111065 --1358 --
NM_181521chr1697032 6616 6494 6465 6311 4956 2267 397 271 16539 25656 555 26228 838
NM_181523chr533246 1526 68 ----1990
NM_181524chr533246 1526 68 ----1990
NM_181528chr202313 71 ------
NM_181571chr10----183 --
NM_181659chr2033122 2988 638 ----12404
NM_181659chr2033122 2988 638 ----12404
NM_181671chr17--1881 ----
NM_181701chr93626 616 424 --1431 1141
NM_181703chr12578 169 --2546 109 --
NM_181783chr1261817 1742 1592 1376 490 95 ------
NM_181784chr22471 440 ------
NM_181825chr22----1308 --
NM_181836chr532412 2231 2006 ------
NM_181838chr511391 1361 ----
NM_181839chr831407 404 219 ------
NM_181842chr6159 ------
NM_181843chr11------1314
NM_182314chrX21696 562 11545 11576 --
NM_182485chr433451 1371 52 ------
NM_182498chr191260 1368 ----
NM_182501chr272881 2513 2279 1303 1184 1126 672 --1596 --
NM_182507chr1282164 1711 1627 550 530 435 339 320 ------
NM_182509chr1421665 601 ------
NM_182526chr1462006 1905 1235 1197 936 724 --21973 560 1418
NM_182537chr33303 245 71 ------
NM_182551chr242292 970 664 453 ------
NM_182553chr113474 379 230 ------
NM_182557chr111857 --11428 1218
NM_182620chr172547 396 11668 11875 1122
NM_182643chr8----31595 825 712 --
NM_182646chr433451 1371 52 ------
NM_182663chr12609 377 --31903 1399 652 --
NM_182664chr12739 507 --32033 1529 782 --
NM_182665chr12609 377 --31903 1399 652 --
NM_182666chr31638 ------
NM_182678chr21407 ------
NM_182691chr7------1104
NM_182692chr7------1104
NM_182700chr72548 218 ----1520
NM_182705chr1772950 1042 805 756 719 713 33 ------
NM_182717chr10----1488 --
NM_182718chr10----183 --
NM_182719chr10----183 --
NM_182720chr10----1488 --
NM_182721chr10----1488 --
NM_182722chr10----1488 --
NM_182723chr10----1488 --
NM_182724chr10----183 --
NM_182725chr10----183 --
NM_182744chr141251 1032 476 235 1936 1271 1116
NM_182760chr32756 306 1280 ----
NM_182765chr1021841 505 ------
NM_182767chr1222049 33 181 ----
NM_182769chr10----183 --
NM_182770chr10----183 --
NM_182771chr10----183 --
NM_182772chr10----183 --
NM_182848chr1321308 193 ------
NM_182850chr10----183 --
NM_182853chr10----1488 --
NM_182895chr224740 490 306 140 ------
NM_182896chr31440 ----11631
NM_182898chr734793 635 121 11081 12355 --
NM_182899chr734793 635 121 11081 12355 --
NM_182907chr632339 975 73 ------
NM_182911chr2----1204 --
NM_182917chr31156 ------
NM_182948chr132866 1005 427 ------
NM_182961chr6------1159
NM_182964chr111443 12618 ----
NM_182970chr2054320 3701 1486 101 22 23154 3053 --1626
NM_183004chr1452923 1586 1460 953 98 --2350 321 --
NM_183006chr201157 --1993 --
NM_183011chr10----1488 --
NM_183012chr10----1488 --
NM_183013chr10----1488 --
NM_183060chr10----183 --
NM_183079chr2021250 1066 --1359 --
NM_183227chr611386 --1111 --
NM_183353chrX----1321 --
NM_183393chr3----11029 --
NM_183394chr3----11029 --
NM_183397chr2095034 4939 3728 3176 1722 768 588 343 253 1898 24977 96 2913 444
NM_183398chr511139 ----11059
NM_183399chr511139 ----11059
NM_183400chr511139 ----11059
NM_183401chr511139 ----11059
NM_183415chr1241519 1384 279 30 --11824 11835
NM_194247chr233518 3151 1271 ----13792
NM_194272chr152443 31 ------
NM_194277chrX1308 ------
NM_194278chr1452674 966 611 224 118 1651 11261 --
NM_194283chr553250 2663 1387 1075 271 --23856 461 --
NM_194285chr1142716 2135 862 722 --12497 --
NM_194286chr1284762 4108 3763 2062 1951 1413 1190 100 34955 2337 158 11200 --
NM_194313chr921556 55 1426 21212 782 1153
NM_194315chr13509 399 105 --21017 920 --
NM_194328chr922685 2644 --186 --
NM_194329chr922685 2644 --186 --
NM_194330chr922685 2644 --186 --
NM_194332chr922685 2644 --186 --
NM_194358chr1231842 1563 101 11685 11584 21645 289
NM_194359chr1231842 1563 101 11685 11584 21645 289
NM_194449chr181326 ------
NM_194457chr13509 399 105 --21017 920 --
NM_194458chr13509 399 105 --21017 920 --
NM_194460chr193399 367 171 ------
NM_194463chrX21096 151 ------
NM_197939chr172460 313 --2829 196 --
NM_197941chr531019 951 618 ------
NM_197955chr151137 ------
NM_197968chr131692 ------
NM_197970chr2------11387
NM_198043chr10----1380 --
NM_198044chr10----1380 --
NM_198045chr10----1380 --
NM_198046chr10----1380 --
NM_198047chr21528 ------
NM_198057chrX21119 266 11006 174 11226
NM_198074chr121057 458 --1478 --
NM_198123chr811256 ----11480
NM_198124chr811256 ----11480
NM_198128chr181150 ----1853
NM_198158chr32879 657 ------
NM_198159chr32879 657 ------
NM_198177chr32879 657 ------
NM_198178chr32879 657 ------
NM_198213chr122519 189 ------
NM_198215chr101531 ------
NM_198225chr1011951 ------
NM_198236chr11364 ----1699
NM_198241chr31156 ------
NM_198242chr31156 ------
NM_198244chr31156 ------
NM_198268chr133188 3078 2626 ------
NM_198269chr133188 3078 2626 ------
NM_198270chrX42812 2494 2402 1300 ------
NM_198273chr532712 2186 1056 ------
NM_198334chr11--1166 1933 --
NM_198335chr11--1166 1933 --
NM_198381chr11--181 ----
NM_198390chr161413 11607 ----
NM_198395chr511184 ----142
NM_198399chr341659 273 210 91 ----11277
NM_198401chr831553 1415 527 --21698 47 --
NM_198485chr311743 ------
NM_198504chr3129