TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-506-5p
miRNA Sequence: UAUUCAGGAAGGUGUUACUUAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr562046 1818 1588 708 692 674 11701 ----
NM_000052chrX93373 2948 2860 2774 2541 2509 1320 200 178 12788 1971 11129
NM_000053chr1331602 666 184 ----21553 122
NM_000055chr31442 ------
NM_000067chr81561 ------
NM_000068chr1941600 1450 1170 1036 ------
NM_000084chrX146561 6498 6353 6268 5750 5534 5473 5431 5268 5049 4502 1910 1682 830 15068 24774 1730 --
NM_000088chr1721178 294 ------
NM_000089chr73510 215 90 1331 ----
NM_000090chr22367 306 ------
NM_000091chr272402 692 491 470 421 341 308 22805 996 ----
NM_000103chr1541291 1161 1133 1092 ------
NM_000108chr76589 337 243 107 67 30 --21168 300 --
NM_000125chr693937 3830 3690 3586 3276 2896 2619 842 355 11088 13989 --
NM_000138chr1562434 2341 2233 2217 1930 245 --1992 --
NM_000163chr541838 791 382 298 ----11630
NM_000165chr621151 419 11536 11173 --
NM_000167chrX51590 1490 654 579 506 1515 ----
NM_000168chr762790 2243 1307 1248 216 166 --12097 --
NM_000176chr553473 3159 2859 454 372 33737 3032 2378 --12410
NM_000189chr262190 2064 1699 1610 596 363 --1613 11667
NM_000190chr112261 229 ------
NM_000202chrX83630 3427 1515 1150 848 767 149 109 23956 267 ----
NM_000210chr231916 278 136 11498 22193 804 --
NM_000214chr2031806 1596 1255 11249 --11793
NM_000216chrX93278 3012 2856 2564 1356 1199 845 476 293 23761 3086 21601 320 --
NM_000217chr12155262 4556 4390 3823 3693 3564 3554 3536 3261 1899 1824 1618 873 809 696 --11144 --
NM_000222chr462126 2007 1863 1747 1558 638 11983 --21440 345
NM_000223chr172165 147 ------
NM_000240chrX92189 2022 2014 1940 850 704 480 261 106 --11737 --
NM_000245chr762193 1696 1387 725 272 142 --1260 --
NM_000252chrX51132 1047 952 382 110 ----1136
NM_000254chr162379 2042 685 394 387 183 1400 ----
NM_000255chr62444 114 ------
NM_000259chr15145560 5119 4997 4947 4598 4523 2408 1710 1603 1549 1383 738 344 338 12188 25383 2468 --
NM_000267chr1752499 2236 1378 1106 703 ----22641 323
NM_000284chrX31767 1628 1571 ------
NM_000297chr42346 285 31432 679 670 155 11636
NM_000304chr171397 ----1781
NM_000314chr1082695 2626 2616 2563 2537 2314 2294 854 22730 1277 --21270 49
NM_000318chr8112943 2779 2680 2517 2246 2200 2194 1995 1120 1112 763 ------
NM_000328chrX152 ------
NM_000330chrX41632 1488 562 417 ------
NM_000332chr6147035 6673 6520 6230 6191 6111 5586 5330 4789 4622 4366 2619 2610 2002 12269 ----
NM_000334chr17111999 1772 1411 841 827 809 664 630 565 94 28 ------
NM_000337chr5125140 5118 5014 4965 4711 4002 2274 2061 1235 1205 967 638 --36114 1604 294 16584
NM_000338chr1521173 868 --1918 --
NM_000340chr341087 1030 966 347 1376 11017 --
NM_000358chr5178 ------
NM_000362chr2293445 3048 2715 2261 2247 1457 1192 849 752 --22581 683 --
NM_000367chr652123 1852 1530 416 70 ----1495
NM_000368chr9144327 4172 4134 3869 3745 3530 3095 1885 1727 1316 994 538 149 97 --1751 --
NM_000369chr1451629 1527 1345 662 220 1768 --21837 59
NM_000386chr171572 1794 ----
NM_000389chr661366 1285 557 424 202 29 11494 1439 --
NM_000391chr1181550 1450 1393 1333 618 246 135 41 11096 ----
NM_000393chr23830 97 88 21831 286 ----
NM_000397chrX31859 1678 894 12441 ----
NM_000408chr252651 2570 1245 657 84 23195 1313 ----
NM_000430chr17123501 3414 3390 2450 2361 2316 1281 513 423 276 119 41 1304 ----
NM_000439chr5142518 2387 2277 2174 2160 1775 1728 1621 1018 742 608 601 574 71 ------
NM_000441chr762358 2189 1479 1447 867 593 --11520 1396
NM_000442chr1761130 1004 878 303 208 28 --11061 1312
NM_000448chr1132430 2183 231 23298 450 22510 974 --
NM_000461chr3114382 3614 3553 3394 1730 1485 1414 1033 889 220 175 --21619 162 --
NM_000462chr152540 532 1309 ----
NM_000465chr22122 32 ------
NM_000484chr2141041 969 160 24 --1167 --
NM_000489chrX42789 1059 511 408 23030 221 11325 --
NM_000493chr651061 822 798 157 115 --1201 --
NM_000503chr851728 1702 1636 1339 640 ----1399
NM_000521chr5--193 ----
NM_000522chr73994 900 33 ------
NM_000523chr241042 889 462 294 ----175
NM_000527chr1992312 1954 1924 1802 1686 1652 697 596 43 --22466 662 --
NM_000533chrX41835 1271 312 294 ----11478
NM_000555chrX167507 6945 6656 6606 6331 6127 5469 5431 5303 5139 4929 2973 1600 854 475 450 37242 6377 2300 ----
NM_000572chr11810 11010 ----
NM_000586chr42219 78 ------
NM_000598chr761594 1358 510 479 232 178 ------
NM_000599chr263987 3656 1422 1212 679 601 --14457 --
NM_000609chr1092809 2757 2560 2166 2007 1198 772 558 48 12595 ----
NM_000610chr1183011 2574 2548 2319 1862 935 396 200 --2814 595 --
NM_000618chr12106516 6337 6085 5804 2483 1609 1472 983 354 204 12396 12387 15417
NM_000618chr12106516 6337 6085 5804 2483 1609 1472 983 354 204 12396 12387 15417
NM_000619chr12127 --1425 --
NM_000633chr1874533 4425 2097 1689 1017 569 403 34751 4273 854 31985 1959 344 --
NM_000686chrX51252 467 366 120 111 1574 ----
NM_000689chr93361 193 173 1508 ----
NM_000693chr1541501 336 270 135 ------
NM_000702chr132235 1404 516 ------
NM_000719chr12165982 5754 5661 5634 5169 5039 5014 4956 4690 2650 2322 1660 1626 1352 1304 91 --25997 1581 --
NM_000724chr1081923 1778 1738 1623 1561 811 800 275 ----1144
NM_000726chr221087 920 11081 ----
NM_000739chr71281 ------
NM_000740chr1--1154 ----
NM_000756chr81117 1474 ----
NM_000791chr552641 1737 451 207 44 ------
NM_000793chr14105099 4355 4160 4087 3463 1805 1435 1146 463 68 35149 1739 186 23439 3115 1347
NM_000801chr202700 143 --1895 --
NM_000809chr4168841 8461 8375 8325 8006 7890 6662 6518 5707 3298 2535 1730 1488 1045 620 247 37128 3459 2932 27661 163 18568
NM_000813chr545619 1951 1706 450 12045 25551 250 --
NM_000814chr15113874 3647 3603 3590 3385 2874 2855 2787 683 653 43 --13259 --
NM_000817chr241143 795 465 121 ------
NM_000824chr44666 338 155 87 ------
NM_000826chr452068 1591 641 408 253 21019 618 1303 --
NM_000829chr1162348 2149 2103 2088 1565 65 ----12055
NM_000838chr622557 675 --1221 12594
NM_000859chr561667 1451 1324 334 291 191 ------
NM_000864chr161136 1099 1086 991 801 166 ------
NM_000865chr6183 ------
NM_000868chrX62193 2107 2063 1605 887 106 ------
NM_000872chr1061555 1470 1420 323 231 40 1429 ----
NM_000875chr1586995 6956 6752 5303 5007 1878 1563 601 ------
NM_000885chr282114 2018 1547 825 342 311 293 282 1662 ----
NM_000891chr1793404 2381 1295 1207 1195 829 789 467 272 --13154 --
NM_000899chr1294363 4137 3890 3788 3560 3230 922 694 202 --11405 13380
NM_000901chr432361 741 199 11776 ----
NM_000921chr121534 ------
NM_000922chr1141101 736 705 446 1956 ----
NM_000926chr11199120 9081 8455 8238 8164 8144 7225 6802 6446 6002 3745 3323 3066 2679 2247 1552 1284 220 97 11699 49047 6420 5884 1132 --
NM_000933chr2031388 114 48 ------
NM_000935chr361194 1050 487 460 441 21 --1913 --
NM_000944chr431562 823 534 --1666 --
NM_000945chr272014 1711 1505 1463 1444 209 52 ------
NM_000949chr51814 ------
NM_000950chrX53221 3060 1041 452 361 ----1731
NM_000956chr1421114 292 ------
NM_000959chr183975 3411 3144 3114 3105 2643 2537 712 ------
NM_000963chr111976 21884 307 22038 265 --
NM_000983chr121115 1017 ----140
NM_001001132chr2121468 34 1140 ----
NM_001001323chr1252359 1190 663 567 299 --3655 607 71 --
NM_001001342chr1061405 1159 1022 554 172 73 --2234 67 11317
NM_001001389chr1183011 2574 2548 2319 1862 935 396 200 --2814 595 --
NM_001001390chr1183011 2574 2548 2319 1862 935 396 200 --2814 595 --
NM_001001391chr1183011 2574 2548 2319 1862 935 396 200 --2814 595 --
NM_001001392chr1193057 2620 2594 2365 1908 1881 981 442 246 --2860 641 --
NM_001001395chr1272791 2730 2502 2247 2112 228 187 21790 98 22542 2368 --
NM_001001396chr194366 3958 3585 3267 3159 1184 1176 629 285 13833 43401 622 112 71 11761
NM_001001419chr594478 4232 4209 3774 3473 3416 1494 1452 523 --14140 --
NM_001001420chr594478 4232 4209 3774 3473 3416 1494 1452 523 --14140 --
NM_001001481chr883068 2954 2491 2143 1241 1012 733 605 --12406 --
NM_001001521chr21299 ------
NM_001001549chr762533 2257 817 615 489 341 1510 ----
NM_001001550chr762533 2257 817 615 489 341 1510 ----
NM_001001555chr762533 2257 817 615 489 341 1510 ----
NM_001001660chr123545 250 113 ------
NM_001001664chr273470 3268 1617 1420 1082 1043 871 --23925 2883 22861 1102
NM_001001668chr1993951 3933 3678 3249 2831 1545 1126 650 92 13645 13742 1934
NM_001001740chr1--1283 ----
NM_001001740chr1--1283 ----
NM_001001872chr141446 ------
NM_001001875chr94411 161 50 34 --1293 --
NM_001001877chrY249 30 ------
NM_001001890chr2164201 3967 3809 3351 3210 2774 12688 ----
NM_001001971chr101970 ------
NM_001001974chr1032231 1597 237 12252 21541 542 --
NM_001002257chr282992 2704 2653 2608 2296 688 641 184 ------
NM_001002762chr1062405 2311 1946 1012 683 312 --32929 1160 991 --
NM_001002860chr1474281 4115 3701 3610 1430 646 29 14060 14559 --
NM_001003407chr10114796 4580 4487 3955 3670 3541 1916 1778 1692 1656 570 14135 21234 498 --
NM_001003408chr10114796 4580 4487 3955 3670 3541 1916 1778 1692 1656 570 14135 21234 498 --
NM_001003652chr18157940 7882 7743 7519 7289 7097 7020 6655 6549 3202 2957 2875 2516 2132 267 38479 3380 170 17389 17408
NM_001003674chr18116934 6284 6029 4865 4651 4627 4277 2278 2267 2165 687 25006 388 ----
NM_001003675chr18116934 6284 6029 4865 4651 4627 4277 2278 2267 2165 687 25006 388 ----
NM_001003679chr131999 1412 619 21459 555 ----
NM_001003688chr441068 901 398 53 --2944 757 --
NM_001003712chr1263788 3250 3102 1326 1259 1093 13004 ----
NM_001003760chr693268 3103 3024 2870 2649 2381 1076 977 71 12914 --13521
NM_001003792chr33335 314 26 --140 --
NM_001003793chr33335 314 26 --140 --
NM_001003800chr973351 3230 2491 2469 1207 911 600 13485 1378 --
NM_001004196chr341054 177 99 22 --146 --
NM_001004317chr684333 4077 3053 1477 1295 1032 598 440 --34104 1751 252 --
NM_001004342chr195995 5572 4896 4590 2350 2151 1556 984 385 11643 26066 4127 --
NM_001004360chr251972 1953 1749 1534 1267 1155 11681 --
NM_001004419chr1244095 1378 1019 620 23609 301 --14225
NM_001004720chr21690 ------
NM_001004722chr21859 ------
NM_001005366chr125945 908 776 344 28 ------
NM_001005375chrY2458 172 1134 ----
NM_001005386chr232217 705 186 12406 11975 11709
NM_001005404chr17104033 3688 3336 3253 3201 3003 901 653 481 459 11516 23016 1253 --
NM_001005463chr1032329 647 254 --1950 --
NM_001005473chr5186312 6265 5748 5346 5116 4689 4385 4137 2585 1349 1308 1292 1272 1191 827 424 103 96 ------
NM_001005476chr21514 ------
NM_001005502chr12165207 5067 4255 4146 3784 3265 3213 1750 1484 1045 887 602 475 257 122 37 --33918 1090 986 --
NM_001005612chrX4392 160 66 33 ------
NM_001005746chr221087 920 11081 ----
NM_001005747chr221087 920 11081 ----
NM_001005781chr21490 1605 ----
NM_001005782chr23939 370 131 11054 ----
NM_001005845chr871889 1681 1598 1301 750 543 463 1620 ----
NM_001005861chr34995 686 148 55 ------
NM_001006600chr552434 2155 497 434 197 12471 ----
NM_001006626chr71281 ------
NM_001006627chr71281 ------
NM_001006628chr71281 ------
NM_001006629chr71281 ------
NM_001006630chr71281 ------
NM_001006631chr71281 ------
NM_001006632chr71281 ------
NM_001006634chr166713 582 268 201 186 166 ------
NM_001006636chr25988 375 351 339 46 --1391 --
NM_001006945chr12729 84 2279 98 ----
NM_001007023chr14105099 4355 4160 4087 3463 1805 1435 1146 463 68 35149 1739 186 23439 3115 1347
NM_001007024chr1764242 4128 3847 3222 1635 1560 ------
NM_001007025chr1764242 4128 3847 3222 1635 1560 ------
NM_001007094chr1073555 3378 2842 1513 1378 362 83 34134 3784 1014 23085 1570 --
NM_001007097chr9145084 4624 4465 4438 4088 2011 1894 1846 1577 1454 1310 984 509 329 1448 23660 1217 --
NM_001007102chr641404 604 502 352 1578 ----
NM_001007214chr141946 1638 436 399 ------
NM_001007246chr2161719 1340 423 372 305 143 21962 639 1223 --
NM_001007277chr117881 784 708 401 344 124 46 ------
NM_001007466chr684762 4268 4136 3848 3563 3551 3387 3165 13999 14221 --
NM_001007471chr9--1886 183 --
NM_001007559chr1821422 1340 11479 --11743
NM_001007565chr31430 ------
NM_001008225chr73747 609 56 ----1756
NM_001008239chr1832940 755 350 13440 ----
NM_001008388chr41384 1290 ----
NM_001008392chr343473 2221 804 410 1964 22695 2393 --
NM_001008405chr761555 1470 679 517 488 111 11169 ----
NM_001008495chr831744 1705 549 ----11968
NM_001008539chr864944 4938 4468 1965 1484 396 155 23502 191 23632 931
NM_001008564chr1352030 1883 705 574 419 12106 ----
NM_001008566chr223389 176 156 1485 ----
NM_001008707chr1421419 489 1224 ----
NM_001008711chr84533 497 339 180 165 1585 --
NM_001008738chr532028 2020 108 1971 22368 2329 --
NM_001008744chr1461610 1357 569 325 281 74 ------
NM_001008860chr153721 333 71 152 ----
NM_001008892chr153721 333 71 152 ----
NM_001008894chr153721 333 71 152 ----
NM_001008895chr132422 401 11439 ----
NM_001008925chr452930 1427 659 376 172 13368 ----
NM_001009555chr461688 1386 1149 682 138 44 ------
NM_001009571chr721312 551 --1140 --
NM_001009881chr1----1589 --
NM_001009882chr1----1589 --
NM_001009899chr3156427 5856 5238 4845 4796 4642 4508 2193 1280 1259 995 896 853 610 134 ----11956
NM_001009958chr7--1551 ----
NM_001009960chr752148 1874 881 255 165 ----12845
NM_001009993chr2124435 3836 3780 3149 3001 2845 1433 1000 987 479 289 273 ------
NM_001010853chr662823 2799 2784 2046 1312 298 2900 882 12975 --
NM_001010870chr63479 435 46 1509 ----
NM_001010891chr5156693 6614 6425 6151 4882 4677 4566 4415 4211 2718 1630 1607 1438 1337 336 26910 407 ----
NM_001010895chr951691 663 616 379 63 11917 ----
NM_001010923chr631150 581 354 1341 ----
NM_001010934chr74330 319 228 212 1773 ----
NM_001010942chr12137 --11290 --
NM_001010971chr14985 766 714 168 ------
NM_001010984chr162157 1716 846 700 405 301 --1840 --
NM_001010986chrX52049 679 640 563 449 22148 824 ----
NM_001011513chr483500 3182 2720 1561 1335 724 326 118 13901 --12948
NM_001011537chr362346 906 567 177 55 47 ------
NM_001011553chr71908 --1174 --
NM_001011657chrX41095 441 156 30 ------
NM_001011663chr1041000 958 757 240 ------
NM_001011666chr7126126 6084 4297 2335 2293 1833 1722 1701 1635 334 325 92 35800 4603 915 --25072 1454
NM_001011708chr272471 1957 1113 1095 470 353 73 ------
NM_001011713chr144993 619 417 179 11423 --1484
NM_001011720chr84923 587 313 239 ------
NM_001011885chr1531807 1506 1312 ------
NM_001012329chr1152349 2177 2110 1997 1815 1484 853 833 800 737 725 548 503 335 73 --21776 27 --
NM_001012393chr1184516 4200 3821 3615 3202 2012 1319 386 --35111 1467 172 --
NM_001012398chr164986 952 443 84 1273 ----
NM_001012420chr1582707 2652 2458 2170 2044 1136 1039 96 ------
NM_001012423chr1582707 2652 2458 2170 2044 1136 1039 96 ------
NM_001012478chr192410 78 ------
NM_001012507chr6123 ------
NM_001012751chr1061936 1778 1468 1408 529 135 1184 ----
NM_001012755chrX93658 3343 3293 3102 1680 1151 1097 785 384 15110 ----
NM_001012756chr1973145 3066 2885 2771 2680 452 278 --22554 2119 --
NM_001012761chr522410 1917 ------
NM_001012968chrX52809 1973 1913 897 836 1596 12180 --
NM_001013031chr1082953 2728 2587 2565 1274 1112 808 443 --23495 2517 --
NM_001013398chr761594 1358 510 479 232 178 ------
NM_001013406chr731700 1627 153 1698 ----
NM_001013438chr33856 827 303 --1142 --
NM_001013717chr52484 115 ------
NM_001013746chr711981 21868 1848 22186 809 --
NM_001014434chr1--1275 ----
NM_001014797chr10138130 7323 7282 7244 6445 5481 3082 2858 2104 1153 1082 1008 212 26383 6366 46757 5650 2807 672 1291
NM_001014812chr151115 ------
NM_001015045chr452128 1854 1601 788 774 ----2966 363
NM_001015048chr1443240 2380 1205 909 ------
NM_001015049chr1443240 2380 1205 909 ------
NM_001015508chr81685 1165 1742 --
NM_001015877chrX52829 2810 2430 2106 181 12183 ----
NM_001015881chrX41261 938 865 204 ------
NM_001017368chr1782484 1952 1776 1088 1078 1029 314 148 --11938 --
NM_001017369chr451103 1059 921 326 24 --2971 44 --
NM_001017371chr21263 ------
NM_001017395chr3113390 3249 3092 2772 2330 972 780 562 467 321 81 ------
NM_001017405chr42235 182 ------
NM_001017440chr7177624 7250 6662 6622 6256 6242 6196 6190 5912 3143 3078 2714 2529 2132 1869 1716 1297 17032 ----
NM_001017923chr1441666 487 333 309 --1204 --
NM_001017926chr841600 1205 737 292 11670 --21840 1319
NM_001017930chrX2971 259 1391 ----
NM_001017979chr44687 527 234 208 ------
NM_001018008chr153523 251 29 ------
NM_001018037chr93563 238 117 11201 1426 --
NM_001018064chr971907 1743 1470 1391 1384 785 315 11329 ----
NM_001018065chr9105218 5112 4364 3761 2104 2045 1210 998 548 338 --45346 5281 4543 703 --
NM_001018066chr9105218 5112 4364 3761 2104 2045 1210 998 548 338 --45346 5281 4543 703 --
NM_001018067chr194952 4611 4237 4165 3257 2012 638 312 137 15123 13834 14088
NM_001018068chr194952 4611 4237 4165 3257 2012 638 312 137 15123 13834 14088
NM_001018069chr194952 4611 4237 4165 3257 2012 638 312 137 15123 13834 14088
NM_001018074chr553473 3159 2859 454 372 33737 3032 2378 --12410
NM_001018075chr553473 3159 2859 454 372 33737 3032 2378 --12410
NM_001018076chr553473 3159 2859 454 372 33737 3032 2378 --12410
NM_001018077chr553473 3159 2859 454 372 33737 3032 2378 --12410
NM_001018090chr1532182 928 175 21882 193 ----
NM_001018091chr1542292 1038 285 111 21992 303 ----
NM_001018102chr1532182 928 175 21882 193 ----
NM_001018108chr1551773 1619 618 519 49 --21554 127 --
NM_001018111chr7143920 3602 3367 3048 1379 1299 1015 699 684 531 323 231 215 162 --13436 --
NM_001020658chr12498 488 11496 ----
NM_001020658chr12498 488 11496 ----
NM_001023567chr1532391 2094 96 ------
NM_001024094chr553473 3159 2859 454 372 33737 3032 2378 --12410
NM_001024218chr141126 ------
NM_001024226chr11446 ------
NM_001024227chr11446 ------
NM_001024228chr11446 ------
NM_001024380chr862291 2043 1934 496 419 52 --1398 --
NM_001024381chr862291 2043 1934 496 419 52 --1398 --
NM_001024382chr112261 229 ------
NM_001024457chr24565 387 191 95 ------
NM_001024463chr15242 21 ----1356
NM_001024647chr12217590 6935 6321 6017 5991 5414 5316 5199 4961 2854 1550 1517 1427 1352 1227 1195 756 402 280 258 25 155 46856 6399 6297 638 --
NM_001024649chr542829 2296 1840 1814 1571 ----
NM_001024660chr351647 1220 212 111 61 ------
NM_001024668chr121975 ------
NM_001024680chr231187 1128 622 ------
NM_001024847chr351696 693 371 97 82 12488 1792 --
NM_001024934chr65537 468 211 66 34 --1490 --
NM_001024935chr65537 468 211 66 34 --1490 --
NM_001024936chr65537 468 211 66 34 --1490 --
NM_001024947chr531100 961 55 ------
NM_001024948chr1133160 3008 2896 2868 2805 2736 1292 1277 971 746 441 389 132 1373 21081 860 --
NM_001024956chr1174916 4834 4654 4019 3684 3608 1809 25787 782 --25139 498
NM_001025068chr341503 683 593 75 --11738 --
NM_001025069chr341503 683 593 75 --11738 --
NM_001025076chr1086045 5241 4546 4151 2229 1746 1264 365 11972 14742 --
NM_001025077chr10127403 6599 5904 5509 2622 1723 1033 970 765 427 397 265 --16100 --
NM_001025079chr344043 2925 1219 720 13888 11052 --
NM_001025105chr521567 1062 11201 1186 --
NM_001025108chr273760 3537 3495 3433 3147 1433 1262 1558 11029 13301
NM_001025266chr384678 3659 3546 1905 1430 1068 524 462 ----34129 3838 1705
NM_001025580chrX54087 4016 3947 2929 553 11625 21251 494 --
NM_001025596chr111137 ------
NM_001025780chr941131 545 375 76 11396 11380 11038
NM_001029839chr351129 565 557 432 257 11259 --11107
NM_001029840chr351129 565 557 432 257 11259 --11107
NM_001029851chr51826 1205 1135 --
NM_001029852chr51826 1205 1135 --
NM_001029853chr51826 1205 1135 --
NM_001029854chr51826 1205 1135 --
NM_001029858chr652912 2628 2452 496 266 22234 2159 ----
NM_001029860chr8--171 ----
NM_001029875chr582883 2759 2284 1863 1028 830 167 36 --22919 1929 --
NM_001029884chr662495 1853 1011 652 259 224 11703 2970 25 11947
NM_001030006chr1782313 2266 2000 1887 1750 785 495 93 --32511 2424 701 --
NM_001030007chr16103709 3509 3386 3205 2825 1613 1466 1106 305 158 22518 1574 ----
NM_001030055chr1484684 4624 4221 3785 3610 3338 3322 28 24510 3029 33653 3450 990 --
NM_001031623chr631194 267 37 ------
NM_001031679chr1283248 3082 2744 2317 1107 1051 1027 596 ------
NM_001031684chr251403 365 192 169 123 --2479 458 --
NM_001031690chr7112611 2416 2302 964 856 538 401 345 311 138 39 ------
NM_001031695chr22114525 4414 4206 4178 3807 1922 1370 1141 657 492 426 1177 24867 1773 --
NM_001031710chr71226 --1265 --
NM_001031716chr25962 901 869 845 50 11134 --21148 710
NM_001031732chr462237 1404 1320 1271 1249 213 12927 13140 --
NM_001031804chr1643781 3690 3608 286 13885 43821 3549 3002 642 14096
NM_001032221chr911717 ------
NM_001032280chr63628 551 442 ------
NM_001032282chr83953 886 297 1247 ----
NM_001032288chr2021474 1060 --11195 --
NM_001032296chr1372512 1183 1153 1032 982 593 314 11806 ----
NM_001032393chrX--164 ----
NM_001032394chr632516 567 400 32751 2017 513 ----
NM_001032395chr632383 434 267 32618 1884 380 ----
NM_001032999chr20104875 4832 4566 4398 3327 2136 1076 1063 1007 223 14415 --2436 142
NM_001033045chr283520 3468 1699 1105 882 604 411 295 13911 33978 3726 549 --
NM_001033047chr42504 194 ------
NM_001033049chr214937 614 258 73 1316 --1370
NM_001033059chr631946 1525 153 ------
NM_001033081chr151859 1372 459 296 178 11681 1447 --
NM_001033082chr151859 1372 459 296 178 11681 1447 --
NM_001033085chr21217 1130 ----
NM_001033117chr384526 4407 4115 3661 3280 1800 1672 1660 24794 1515 11939 --
NM_001033503chr51149 --178 --
NM_001033507chr141722 1357 1348 738 1173 ----
NM_001033557chr21138 1153 1400 --
NM_001033566chr174771 681 290 55 ------
NM_001033568chr174771 681 290 55 ------
NM_001033578chr842162 957 794 660 ------
NM_001033723chr8112686 2633 2612 2455 2321 2165 2069 1097 696 367 34 191 ----
NM_001033925chr1062027 1806 1538 1373 450 62 --1423 --
NM_001034025chr124888 829 310 244 ------
NM_001034155chr9190 --148 --
NM_001034954chr1073232 3079 2791 721 439 381 297 11081 22010 1261 --
NM_001034955chr1073232 3079 2791 721 439 381 297 11081 22010 1261 --
NM_001034956chr1073232 3079 2791 721 439 381 297 11081 22010 1261 --
NM_001034957chr1073232 3079 2791 721 439 381 297 11081 22010 1261 --
NM_001035003chr43446 381 203 --121 --
NM_001035004chr43446 381 203 --121 --
NM_001035511chr151638 665 632 625 223 ------
NM_001035512chr151745 772 739 732 330 ------
NM_001035513chr151745 772 739 732 330 ------
NM_001037132chr732221 1923 1537 ------
NM_001037133chr732221 1923 1537 ------
NM_001037164chr741647 1379 794 292 --1103 --
NM_001037165chr7278786 8597 8353 8240 8228 7988 7857 7636 7199 6565 6490 6426 6392 6231 6112 5490 3431 2984 2876 2152 1639 1599 1488 1227 1050 621 133 13293 56480 5474 2699 1274 823 --
NM_001037172chr351290 1136 536 410 283 11395 ----
NM_001037174chr251448 1440 343 302 58 21919 867 ----
NM_001037339chr141464 1398 452 266 1446 11214 --
NM_001037340chr141464 1398 452 266 1446 11214 --
NM_001037341chr141464 1398 452 266 1446 11214 --
NM_001037341chr141464 1398 452 266 1446 11214 --
NM_001037872chr22584 558 ------
NM_001037954chr1153281 2664 2627 807 563 ------
NM_001038702chr571851 1032 913 804 769 174 84 ----12693
NM_001038707chr182045 1609 367 304 264 193 90 32 --22088 325 --
NM_001038707chr182045 1609 367 304 264 193 90 32 --22088 325 --
NM_001039199chr20155055 5037 4786 4418 3817 3528 3234 3092 1919 1185 927 866 764 567 131 11983 33284 1687 801 --
NM_001039538chr252931 2918 379 331 310 --13176 2831 544
NM_001039547chr3138011 6159 5678 5543 5282 5204 5052 2386 2190 1978 1959 1480 1180 28056 3188 25262 2252 --
NM_001039573chr172170 69 ------
NM_001039585chr194232 3668 3401 3371 3362 2900 2794 969 225 ------
NM_001039590chrX43477 2818 1440 1139 13531 11324 --
NM_001039591chrX43477 2818 1440 1139 13531 11324 --
NM_001039615chr872246 1943 1599 1585 913 836 105 --11666 11924
NM_001039618chr11175903 5594 5319 4993 4804 4595 4535 4111 3752 3679 2296 1969 1816 1248 644 438 125 33929 3723 975 31947 1641 1222 --
NM_001039690chr1642076 1670 553 112 --21876 537 --
NM_001039709chr20104875 4832 4566 4398 3327 2136 1076 1063 1007 223 14415 --2436 142
NM_001039762chr1032140 1642 239 ----11779
NM_001039840chrX75950 5625 5040 1811 1041 828 688 14707 ----
NM_001039935chr52460 343 1383 ----
NM_001039937chr1353834 3739 3487 937 638 --22582 1106 --
NM_001040057chr741300 324 186 123 21468 331 ----
NM_001040097chr7--1172 ----
NM_001040098chr7--1172 ----
NM_001040099chr7--1172 ----
NM_001040101chr441310 1186 1083 350 21485 297 1554 --
NM_001040142chr222303 1784 1543 21877 965 --
NM_001040143chr222303 1784 1543 21877 965 --
NM_001040144chr1642076 1670 553 112 --21876 537 --
NM_001040146chr1642076 1670 553 112 --21876 537 --
NM_001040151chr11124606 4181 3668 3497 1478 1311 1216 578 488 306 40 32 34066 3376 903 33541 3126 815 --
NM_001040152chr7114555 4350 3439 3378 1839 1451 1275 1259 906 683 635 1427 --1928
NM_001040153chr133625 184 22 ----1270
NM_001040157chr432938 2575 1801 22723 154 --1810
NM_001040202chr461955 1904 1847 943 847 788 21753 253 --1863
NM_001040214chr632336 260 95 1694 11739 --
NM_001040284chr1685817 5763 5661 5652 5246 4449 4223 1498 25469 3789 34963 4526 284 --
NM_001040402chr452733 2329 372 321 144 12515 21150 932 1682
NM_001040429chr1363440 2852 2410 1435 491 136 ------
NM_001040441chr1135376 5207 4653 3717 3569 1830 1389 1297 982 542 513 168 145 --14022 --
NM_001040446chr572696 2280 1814 992 934 817 805 --161 --
NM_001040450chr15102845 2710 2639 2510 1026 971 894 763 413 384 12163 ----
NM_001040453chr15102845 2710 2639 2510 1026 971 894 763 413 384 12163 ----
NM_001040633chr76973 737 264 220 175 38 --1429 --
NM_001040665chr7124698 4401 4253 4116 4089 3205 1776 1734 1468 1341 602 390 ------
NM_001040708chr8--1765 ----
NM_001040712chr963067 2533 327 237 199 22 ------
NM_001040876chr461410 1224 669 354 199 112 11571 21609 77 --
NM_001042355chr16185130 4652 4645 4352 3729 3678 3270 3264 2095 2046 1874 1712 1657 1165 678 485 256 170 13359 11197 14059
NM_001042357chr1051322 1308 993 151 28 21332 498 11274 --
NM_001042358chr1051322 1308 993 151 28 21332 498 11274 --
NM_001042360chr1051322 1308 993 151 28 21332 498 11274 --
NM_001042361chr1051353 1339 1024 182 59 21363 529 11305 --
NM_001042363chr1051322 1308 993 151 28 21332 498 11274 --
NM_001042364chr1051353 1339 1024 182 59 21363 529 11305 --
NM_001042365chr1051353 1339 1024 182 59 21363 529 11305 --
NM_001042368chr93632 616 126 1743 --1840
NM_001042387chr1051353 1339 1024 182 59 21363 529 11305 --
NM_001042388chr183686 648 282 --1293 --
NM_001042389chr1051322 1308 993 151 28 21332 498 11274 --
NM_001042390chr1051322 1308 993 151 28 21332 498 11274 --
NM_001042392chr1051322 1308 993 151 28 21332 498 11274 --
NM_001042393chr1051353 1339 1024 182 59 21363 529 11305 --
NM_001042395chr1051322 1308 993 151 28 21332 498 11274 --
NM_001042396chr1051353 1339 1024 182 59 21363 529 11305 --
NM_001042397chr1051353 1339 1024 182 59 21363 529 11305 --
NM_001042412chr16185130 4652 4645 4352 3729 3678 3270 3264 2095 2046 1874 1712 1657 1165 678 485 256 170 13359 11197 14059
NM_001042413chr993202 1468 1264 1245 984 797 360 213 152 13572 34065 4012 854 1272
NM_001042414chr131206 ------
NM_001042424chr4113146 2703 2509 2398 2339 2255 926 766 664 348 224 --2475 264 --
NM_001042425chr63628 551 442 ------
NM_001042473chr1071814 1634 628 268 262 61 41 ----1209
NM_001042492chr1752499 2236 1378 1106 703 ----22641 323
NM_001042506chrX21436 1305 ------
NM_001042517chr13169 ------
NM_001042533chr3123363 2958 2500 2481 2390 2346 2250 2101 2087 574 291 66 --12820 --
NM_001042537chrX52208 2200 2129 214 93 --12103 --
NM_001042550chr952065 1325 768 553 273 ------
NM_001042552chr14937 286 170 83 1888 11115 --
NM_001042555chr1284708 4502 3450 3276 1600 1310 769 754 34737 3399 122 ----
NM_001042599chr2146705 6479 5808 5035 2918 1920 1748 1138 1118 1042 933 515 449 163 12589 11373 --
NM_001042601chr3113205 3020 2993 2712 2511 2219 2189 1062 539 360 40 22691 842 ----
NM_001042603chr1295063 4898 4641 4471 4012 3583 3560 2066 1952 11045 14035 --
NM_001042632chr20112614 2441 2419 2357 2281 2113 1006 998 550 434 218 12189 ----
NM_001042633chr20112614 2441 2419 2357 2281 2113 1006 998 550 434 218 12189 ----
NM_001042646chr341819 1764 1674 637 ------
NM_001042681chr162532 2210 1965 1025 241 187 ------
NM_001042682chr162532 2210 1965 1025 241 187 ------
NM_001042682chr162532 2210 1965 1025 241 187 ------
NM_001042749chrX61726 709 449 394 318 264 11885 --1171
NM_001042750chrX61726 709 449 394 318 264 11885 --1171
NM_001042751chrX61726 709 449 394 318 264 11885 --1171
NM_001044305chr621629 1420 --11249 --
NM_001044385chr293984 3256 2703 2643 1490 1243 797 507 454 1424 23077 1066 23936 3777
NM_001046chr552915 2600 2269 2255 341 11113 12068 1267
NM_001048183chr1143477 3457 3234 3149 2894 2578 2440 1368 901 790 691 589 273 141 13305 22563 1231 --
NM_001050chr1731469 1413 172 ----1267
NM_001079874chr151419 1409 1400 830 627 ------
NM_001083620chr452066 1590 640 407 252 21018 617 1302 --
NM_001085487chr1167 ------
NM_001099678chr365344 4934 4799 4663 4234 72 25532 1342 ----
NM_001100108chr1218305 6844 6689 6676 6245 5824 5323 2936 2811 2763 2663 2510 2468 2249 1831 1663 1403 1025 652 584 305 33036 1939 1859 25128 138 --
NM_001106chr3199660 9367 9280 8376 8301 8290 7915 7577 7550 7321 6902 6476 6278 6026 5899 3150 2624 1301 41 38680 7611 3880 28673 1957 --
NM_001113490chrX51007 998 754 660 246 12431 ----
NM_001116chr1692997 2990 2918 2558 2284 2025 1052 824 201 ------
NM_001117chr1852397 1567 941 919 443 1381 21981 834 --
NM_001121chr1041549 572 280 200 ------
NM_001126chr12943 780 ------
NM_001128chr16103709 3509 3386 3205 2825 1613 1466 1106 305 158 22518 1574 ----
NM_001146chr831543 801 526 ----1830
NM_001148chr461587 1359 806 379 153 69 22150 1483 --12079
NM_001160chr1242475 1817 1090 44 --12373 --
NM_001167chrX166467 6360 6210 6077 5357 5266 4856 4217 4083 2436 1488 1077 326 163 88 50 --25698 2286 21977 1591
NM_001173chr1484684 4624 4221 3785 3610 3338 3322 28 24510 3029 33653 3450 990 --
NM_001177chr1262368 2359 2179 1827 1623 24 22134 329 21936 192 --
NM_001186chr2173245 2956 2646 1125 345 61 42 --1541 1200
NM_001198chr6--1280 ----
NM_001201chr493925 3549 3435 3139 895 434 408 192 23 23251 1047 13019 12930
NM_001204chr2217508 7295 7049 6845 6170 6089 2947 2829 2720 2468 2181 1929 1909 1735 1437 1171 1118 756 718 507 462 46402 2677 2395 1049 ----
NM_001206chr962668 1122 695 650 233 217 --1546 --
NM_001218chr15102598 2577 2258 1071 971 931 907 628 371 273 --32418 2394 2086 --
NM_001219chr752148 2045 1718 713 403 --22209 2099 --
NM_001222chr1061982 1939 1724 1495 470 372 --176 --
NM_001227chr1041269 450 166 75 ------
NM_001233chr732231 1473 472 22114 1732 ----
NM_001238chr192175 100 ------
NM_001241chr272380 2292 2008 891 883 462 247 1429 11529 --
NM_001241chr272380 2292 2008 891 883 462 247 1429 11529 --
NM_001253chr6------1310
NM_001254chr172116 90 ------
NM_001256chr1751913 1178 319 75 30 --21893 941 --
NM_001257chr165582 483 414 216 75 --1228 --
NM_001259chr7206329 6223 6184 5874 5706 5591 5221 4875 3848 2389 2257 1941 1908 1872 1447 1139 1051 745 349 245 --25994 310 --
NM_001271chr1572862 2575 1226 1124 941 839 531 1778 1723 --
NM_001278chr1041083 918 862 485 1238 1930 --
NM_001282chr1782313 2266 2000 1887 1750 785 495 93 --32511 2424 701 --
NM_001300chr101393 ------
NM_001304chr1782832 2817 2426 1391 1233 1206 932 518 13753 22803 727 --
NM_001310chr1282961 2784 2633 2046 1966 992 939 264 22585 2456 12949 11133
NM_001315chr632182 2110 1649 12040 11830 1850
NM_001329chr1051540 1509 1196 564 322 ------
NM_001330chr162965 360 ------
NM_001331chr1152355 2337 912 766 303 --22703 983 12481
NM_001332chr521444 1337 ------
NM_001333chr93235 102 62 ------
NM_001338chr213364 224 214 1295 11059 21047 354
NM_001343chr561635 1567 1268 605 297 199 1377 ----
NM_001349chr21459 --1612 --
NM_001351chr341764 1464 1253 84 2361 46 ----
NM_001356chrX52366 2060 1908 842 557 --21901 957 1635
NM_001364chr11114415 3988 3839 3597 3495 3206 1458 1106 890 841 425 11129 13584 --
NM_001390chr1863066 2300 1138 694 589 490 --23013 606 --
NM_001396chr2172821 2005 1838 808 651 623 150 12636 186 --
NM_001412chrX83543 2733 1471 1458 1026 632 171 36 22643 2375 ----
NM_001417chr125763 538 341 109 45 1449 --11840
NM_001418chr112654 613 ------
NM_001418chr112654 613 ------
NM_001419chr19184000 3862 3794 3729 3643 3435 3308 3221 3150 3083 3046 1717 1339 740 421 298 283 118 ------
NM_001426chr22743 482 ------
NM_001429chr224984 775 175 81 ------
NM_001431chr65467 453 387 135 48 ------
NM_001432chr463774 2383 895 831 240 128 22810 2498 11414 13171
NM_001446chr61203 1289 ----
NM_001455chr6114674 4164 3959 3930 3815 3606 3452 1867 1345 745 414 ------
NM_001460chr152825 2683 1265 586 98 --13325 12795
NM_001482chr151343 ----1278
NM_001483chr73308 298 292 ----1693
NM_001489chr91200 ------
NM_001491chr682683 2535 2511 2336 1886 1758 791 526 1908 1502 --
NM_001497chr952586 681 576 103 29 --32341 2122 852 --
NM_001498chr631206 1135 1020 --1481 --
NM_001499chr9--1145 ----
NM_001527chr664892 4866 4271 1907 676 454 1920 --13023
NM_001560chrX32020 310 216 ------
NM_001608chr22601 250 ------
NM_001609chr1053860 3768 2885 1411 632 21100 495 33487 3173 2831 11140
NM_001616chr222790 41 1646 ----
NM_001619chr1121050 733 --1397 --
NM_001621chr772860 2407 2338 2172 963 390 340 12551 ----
NM_001621chr772860 2407 2338 2172 963 390 340 12551 ----
NM_001634chr631946 1525 153 ------
NM_001639chr12106 27 ------
NM_001650chr1823629 409 21246 389 14106 --
NM_001656chr561922 1599 1273 726 438 211 1232 ----
NM_001658chr11446 ------
NM_001663chr14102643 2581 2322 2188 2140 1707 726 704 105 26 ------
NM_001668chr192288 2259 2237 1515 1486 1427 382 276 223 12145 ----
NM_001678chr17101716 1449 1427 1332 730 588 531 323 161 45 21570 1160 ----
NM_001682chr1242073 904 377 281 --2369 321 --
NM_001684chr184083 3675 3302 2984 2876 901 893 346 13550 23118 339 11478
NM_001688chr12828 332 1228 ----
NM_001690chr332470 2202 222 --168 12511
NM_001695chr863433 3100 977 916 466 419 2800 409 12785 --
NM_001707chr71819 1909 ----
NM_001709chr1142021 1946 1787 924 12216 ----
NM_001729chr41330 ------
NM_001742chr771534 1269 724 608 398 391 146 ----11243
NM_001746chr542829 2296 1840 1814 1571 ----
NM_001753chr751329 734 595 198 107 --11363 1628
NM_001754chr2164201 3967 3809 3351 3210 2774 12688 ----
NM_001759chr1255298 4789 4538 3743 1826 24254 1028 23312 1405 --
NM_001777chr344043 2925 1219 720 13888 11052 --
NM_001788chr71908 --1174 --
NM_001792chr181309 11166 1209 --
NM_001794chr20----1250 --
NM_001798chr123722 326 101 ------
NM_001799chr51228 ------
NM_001806chr1972760 2464 2054 1082 987 406 386 --21946 39 --
NM_001830chrX104026 3706 3337 3209 3199 1619 1494 622 464 441 21483 1412 ----
NM_001842chr91572 ------
NM_001845chr1341183 1053 1036 962 ------
NM_001854chr141324 1287 1254 268 185 21034 445 --
NM_001855chr92770 668 ------
NM_001858chr6114586 4516 4325 4277 4124 1937 1684 1205 481 380 149 25046 1148 11986 --
NM_001859chr9163938 3762 3627 3411 2802 2614 2498 1383 1277 1130 710 575 567 355 175 58 --12812 --
NM_001874chr12165207 5067 4255 4146 3784 3265 3213 1750 1484 1045 887 602 475 257 122 37 --33918 1090 986 --
NM_001880chr21120 ------
NM_001891chr42110 39 ------
NM_001892chr521567 1062 11201 1186 --
NM_001896chr16--1447 ----
NM_001903chr51892 ----144
NM_001908chr882392 2257 2080 1815 899 807 112 103 ------
NM_001931chr1151250 977 368 360 155 --1451 --
NM_001935chr24851 780 309 210 ------
NM_001938chr131579 476 224 ------
NM_001939chrX113624 3446 3181 2457 2334 1455 987 849 830 780 509 11284 13842 --
NM_001949chr632231 622 491 13238 ----
NM_001955chr62927 23 ------
NM_001957chr432155 929 782 11540 22291 1948 --
NM_001966chr341594 187 98 54 1474 21497 1429 --
NM_001967chr33600 447 93 146 --1410
NM_001969chr1473926 3719 3373 2726 2627 2468 324 11202 11239 --
NM_001977chr441642 1387 651 52 ----1688
NM_001981chr162096 1919 1770 1629 1475 675 ----149
NM_001987chr1264222 3268 3201 1714 882 160 13660 14066 13000
NM_001995chr421429 1242 184 ----
NM_002006chr465578 5262 5102 4528 4241 3870 11045 1780 11735
NM_002013chr14157 ------
NM_002017chr115223 180 94 76 42 ------
NM_002024chrX32222 1409 489 ------
NM_002025chrX249292 8872 8609 8358 8050 7856 7181 7105 7028 6703 6206 6194 5802 3593 3008 2442 2384 2216 2024 1966 1593 1185 1062 353 26692 6609 16591 --
NM_002026chr22699 183 11044 ----
NM_002035chr18104010 3448 3333 2685 2547 2432 1276 874 813 572 --22732 1296 --
NM_002039chr43179 40 24 1700 ----
NM_002040chr2142875 323 84 78 ------
NM_002056chr22851 94 1209 ----
NM_002061chr141898 1764 1423 662 ----11188
NM_002063chrX31152 963 939 ------
NM_002069chr731853 1784 393 ------
NM_002076chr12133148 2576 2256 2063 905 890 810 701 502 481 324 248 99 --21121 971 --
NM_002077chr932095 1930 168 --2350 288 --
NM_002078chr3158 1488 ----
NM_002092chr484757 3725 3406 3214 3147 1867 1816 1248 21556 1403 23636 842 --
NM_002114chr6--1355 ----
NM_002126chr1764175 3690 2871 1294 1230 1206 14165 --1763
NM_002128chr1372555 2092 900 788 540 490 431 1373 ----
NM_002136chr121524 1617 ----
NM_002137chr731982 1688 1564 ------
NM_002146chr174160 134 81 73 --11342 11443
NM_002148chr2--1435 ----
NM_002158chr222487 1363 --12824 12732
NM_002163chr1621245 986 --31198 834 209 --
NM_002166chr23771 642 118 ------
NM_002182chr32797 650 12113 ----
NM_002202chr54995 388 105 67 ------
NM_002205chr127781 729 301 273 141 88 31 ------
NM_002210chr253147 2526 2190 1278 1068 ----1774
NM_002214chr7185475 5286 5278 4826 4795 4744 4260 4076 3694 3617 3487 2231 1839 1723 975 794 711 287 25409 475 11618 34138 1287 835
NM_002222chr341218 1039 925 274 1104 ----
NM_002223chr1253863 3699 2802 2636 1524 32719 1030 58 --23889 3462
NM_002229chr191465 ------
NM_002232chr141360 1210 1148 113 21041 448 ----
NM_002239chr23943 931 88 21032 978 ----
NM_002245chr12601 279 ------
NM_002264chr394366 3672 3406 3325 3213 3152 1681 1528 1142 --24966 408 --
NM_002267chr1332261 827 804 1573 --1862
NM_002270chr5135559 5489 5342 4794 4295 4175 3974 3734 3658 2215 2015 1770 1103 11956 ----
NM_002271chr1362030 1976 1897 771 268 208 1657 1592 --
NM_002285chr273760 3537 3495 3433 3147 1433 1262 1558 11029 13301
NM_002310chr5116133 5156 5135 4811 4163 2413 2113 2035 1417 1185 976 25382 4945 14338 15709
NM_002313chr10114796 4580 4487 3955 3670 3541 1916 1778 1692 1656 570 14135 21234 498 --
NM_002336chr1255052 3865 3580 1760 1704 21162 308 14246 --
NM_002356chr632324 2124 1795 21972 1917 ----
NM_002358chr44554 515 431 54 ------
NM_002374chr252931 2918 379 331 310 --13176 2831 544
NM_002381chr22839 23 1139 --1129
NM_002389chr141998 1586 1283 463 2117 65 1242 --
NM_002392chr12166 ----1186
NM_002402chr741052 920 489 346 11079 ----
NM_002408chr141302 169 ----
NM_002409chr2283245 3147 2902 2835 2036 1129 712 702 --1652 --
NM_002427chr11134 21130 137 ----
NM_002449chr521264 977 ------
NM_002451chr9123909 3324 3202 3100 2921 2828 2770 2733 945 850 585 73 --1170 --
NM_002481chr1177822 7724 7615 7399 6942 5725 5596 5527 5450 5177 5096 2900 2600 1995 1741 860 478 44951 3100 2612 960 --17159
NM_002486chr941850 915 168 75 --1854 --
NM_002499chr1551950 726 573 189 61 --134 12095
NM_002508chr15502 172 126 94 55 --21663 263 11686
NM_002509chr202337 224 ------
NM_002515chr1491719 1610 1588 1455 1434 1324 741 614 303 --11278 --
NM_002522chr1793202 3051 1530 1304 1225 924 630 272 190 23396 2745 ----
NM_002539chr21332 --141 --
NM_002545chr1184516 4200 3821 3615 3202 2012 1319 386 --35111 1467 172 --
NM_002547chrX83724 3423 2868 1006 950 421 344 52 --23069 308 11384
NM_002567chr126725 660 568 268 32 22 1761 1778 --
NM_002570chr1541264 1251 829 313 ----11121
NM_002577chr393696 3029 2862 2713 2466 599 434 225 139 --2359 112 12611
NM_002581chr9114783 4363 4253 4032 2090 1667 1660 1594 1264 1049 192 1873 14508 --
NM_002583chr12149 --1602 --
NM_002586chr621416 50 ------
NM_002592chr201299 --1319 --
NM_002594chr2081569 1541 941 725 510 460 274 125 1625 ----
NM_002595chr1251281 520 472 367 360 1752 ----
NM_002600chr141464 1398 452 266 1446 11214 --
NM_002605chr153823 59 26 11017 --11119
NM_002612chr731588 533 260 12035 2243 63 --
NM_002613chr1695159 4268 4261 3736 3492 3368 1437 936 455 23538 2124 35212 4664 4481 --
NM_002623chr20------143
NM_002628chr31222 ------
NM_002635chr12127 1304 ----
NM_002645chr1143113 2240 279 201 ----33096 971 819
NM_002648chr681255 1186 887 485 442 348 270 160 11320 ----
NM_002649chr751655 1229 1186 148 136 ----11713
NM_002655chr864820 4771 4063 1965 1133 558 21811 1474 ----
NM_002661chr16--1277 ----
NM_002670chr321224 65 11043 --1559
NM_002687chr14--11191 ----
NM_002703chr431792 1785 150 21493 387 ----
NM_002706chr2193 ------
NM_002709chr253458 3143 3068 2544 2320 ------
NM_002710chr122887 388 1771 ----
NM_002711chr73693 221 110 ------
NM_002718chr342334 836 772 429 1157 2352 264 --
NM_002720chr161200 ------
NM_002727chr103502 203 113 ----1635
NM_002731chr172945 2924 2830 2598 2528 430 120 22819 2764 --12391
NM_002737chr17126234 6212 5765 5522 4896 4057 2207 1409 1149 1137 538 121 15415 11079 12278
NM_002740chr362294 1943 1868 1072 999 791 --12688 174
NM_002745chr22104183 4081 3846 3688 3563 1711 1698 1464 1176 985 --1331 --
NM_002748chr1521094 319 11200 190 --
NM_002755chr152732 269 ------
NM_002760chrY155710 5061 4718 4498 4406 3920 3742 1775 1637 1567 1186 663 288 233 122 13837 ----
NM_002763chr12444 24 ------
NM_002776chr1962052 1743 1400 1339 1279 363 11431 21955 757 --
NM_002806chr14--1350 ----
NM_002827chr2031247 453 327 --1369 --
NM_002829chr95860 818 309 122 50 11164 ----
NM_002834chr1253427 2974 1500 1108 557 1749 21481 993 --
NM_002837chr12114637 4306 4284 4014 3959 3671 3261 2951 2889 1340 589 --12806 22930 26
NM_002838chr131017 464 402 ------
NM_002839chr963067 2533 327 237 199 22 ------
NM_002841chr32559 40 ------
NM_002843chr1173426 3020 2613 2555 1275 581 530 1380 ----
NM_002849chr126969 864 794 352 213 109 1849 ----
NM_002852chr3274 22 1159 ----
NM_002857chr182718 2425 1985 1676 1066 528 74 26 ------
NM_002858chr111295 21146 907 --11029
NM_002869chr1151982 1637 1611 1448 89 21834 691 1637 --
NM_002873chr52505 166 ------
NM_002874chr952490 2343 1768 639 61 22115 425 ----
NM_002881chr241339 970 554 530 11432 ----
NM_002886chr3115177 4119 4041 3484 1970 1933 1731 1157 691 675 337 ------
NM_002893chrX131 ------
NM_002897chr21120 ------
NM_002906chr1152054 2016 1856 1724 917 ------
NM_002912chr63833 362 117 2968 173 ----
NM_002923chr14613 258 239 50 1644 189 --
NM_002940chr461410 1224 669 354 199 112 11571 21609 77 --
NM_002942chr33922 500 33 11368 ----
NM_002948chr321151 455 --1108 --
NM_002956chr1241172 1152 1130 1085 ------
NM_002958chr34995 686 148 55 ------
NM_002959chr154385 3494 3051 884 183 ----11361
NM_002968chr161824 ------
NM_002985chr172108 23 ------
NM_002994chr431344 569 70 11970 2336 147 --
NM_003001chr151745 772 739 732 330 ------
NM_003003chr171263 ------
NM_003017chr641046 908 249 145 11353 ----
NM_003030chr331996 1376 772 ------
NM_003034chr1267500 5148 4963 3177 2525 675 21023 704 35061 2810 2799 1524
NM_003036chr131230 392 325 ------
NM_003043chr373574 2979 2779 1539 994 686 269 --23297 373 --
NM_003045chr1374328 4271 4019 1748 1423 1399 264 13937 --24656 823
NM_003046chr864944 4938 4468 1965 1484 396 155 23502 191 23632 931
NM_003048chr272141 1883 979 297 245 62 26 11080 1284 --
NM_003051chr172019 1692 1634 1306 1249 342 52 --1174 --
NM_003054chr101300 ------
NM_003059chr51251 ------
NM_003068chr82963 908 ------
NM_003070chr94809 577 561 34 1664 ----
NM_003079chr172851 394 11010 ----
NM_003099chr15126473 6214 6093 5848 5334 5261 4731 4631 1846 1344 977 799 26331 1770 15581 --
NM_003101chr131674 365 150 ------
NM_003107chr632142 436 353 ------
NM_003108chr296955 6869 6633 5181 4797 2117 1364 713 374 1874 26510 6157 --
NM_003111chr21263 ------
NM_003112chr742625 1146 544 162 ------
NM_003128chr242779 2524 2122 999 --22580 2259 12829
NM_003133chr1154 ------
NM_003135chr51284 ------
NM_003137chr641849 1681 646 488 21638 691 ----
NM_003150chr1761888 1828 1712 794 788 92 ------
NM_003161chr1763629 3596 3413 3176 2906 320 13106 1506 --
NM_003165chr911816 173 ----
NM_003184chr83986 896 124 1207 11086 --
NM_003188chr61110 --1223 --
NM_003189chr192545 2403 2102 1262 732 313 133 115 96 1896 42272 2192 929 126 --
NM_003199chr1894898 4392 3722 2086 1393 1014 508 441 379 65054 4078 1801 1212 502 127 ----
NM_003202chr551594 1331 367 336 262 ------
NM_003204chr1751485 625 75 69 63 ------
NM_003205chr154704 338 130 85 --11950 --
NM_003211chr1231552 508 213 1318 --11157
NM_003217chr1241734 1551 355 143 ------
NM_003220chr63628 551 442 ------
NM_003222chr204777 461 287 161 ------
NM_003234chr351888 1511 547 491 329 1569 22386 2094 --
NM_003242chr351696 693 371 97 82 12488 1792 --
NM_003253chr2171765 1622 769 714 386 271 138 --11403 --
NM_003262chr3125062 4627 4498 3746 3545 3246 3201 1770 1646 1365 500 23 34101 3448 925 ----
NM_003274chr2183000 2442 2275 1990 979 955 593 155 ------
NM_003286chr203864 241 145 ------
NM_003290chr1921024 914 ------
NM_003298chr3136108 6077 4465 4043 3784 1830 1670 1183 1121 1076 817 616 337 24662 2365 ----
NM_003299chr121163 ------
NM_003300chr141340 ------
NM_003304chr341598 1504 554 390 ------
NM_003305chr4174 ------
NM_003319chr22809 75 ----1663
NM_003320chr11123814 3659 3338 3085 3026 2976 2898 1704 1569 973 559 37 14471 23691 797 --
NM_003337chr53597 334 319 11080 ----
NM_003338chr103744 590 141 --11813 11884
NM_003339chr531534 1431 51 ------
NM_003340chr41517 ------
NM_003342chr1762859 1240 1174 1155 780 214 --12491 12117
NM_003349chr2021474 1060 --11195 --
NM_003352chr23939 370 131 11054 ----
NM_003360chr4145 ------
NM_003370chr191767 ------
NM_003374chr5------1840
NM_003375chr101348 ------
NM_003380chr10--1245 ----
NM_003385chr21731 ------
NM_003387chr282424 2227 2200 2153 1172 772 670 359 21788 445 ----
NM_003392chr374210 3820 3565 3398 2942 1357 838 13714 ----
NM_003403chr141636 ------
NM_003404chr2051798 1408 658 614 485 --1336 --
NM_003405chr222594 219 ------
NM_003410chrX73035 2375 2157 1199 371 179 41 1575 1857 --
NM_003411chrY51714 731 253 95 38 --1169 --
NM_003412chr32546 398 12510 1751 --
NM_003413chrX21527 446 11883 ----
NM_003418chr32316 58 ------
NM_003421chr1073555 3378 2842 1513 1378 362 83 34134 3784 1014 23085 1570 --
NM_003432chr5--1420 ----
NM_003442chr112795 611 1891 ----
NM_003463chr642807 2542 899 754 --23176 2402 --
NM_003468chr294074 4030 3573 3554 1316 1251 1182 1136 850 13396 33635 1170 816 1732
NM_003471chr341684 1612 172 86 12004 1130 --
NM_003472chr631374 1266 509 1424 11210 --
NM_003473chr101366 --1975 --
NM_003478chr1183216 2731 2719 1303 1079 1035 906 581 22533 1256 12770 12898
NM_003483chr1222851 1873 11951 --11101
NM_003488chr171921 ------
NM_003489chr2142423 1044 937 796 23460 806 ----
NM_003498chr16122742 2505 2494 2291 2132 2078 1704 906 758 453 441 350 --1268 --
NM_003503chr111282 --11292 --
NM_003505chr781941 1916 1769 1492 1253 752 745 170 ------
NM_003506chr82504 196 11302 ----
NM_003557chr171280 542 453 295 157 84 24 ------
NM_003565chr1251673 1421 1300 505 327 --21552 1285 --
NM_003566chr1263445 3194 3188 2117 1190 225 --23015 943 --
NM_003574chr18125742 5454 4720 4217 1866 1511 1472 1404 1378 672 539 378 12176 13587 14330
NM_003576chr1372512 1183 1153 1032 982 593 314 11806 ----
NM_003581chr21690 ------
NM_003583chr1233730 2829 30 11346 ----
NM_003589chr132422 401 11439 ----
NM_003590chr263824 2493 1461 906 692 462 13212 ----
NM_003595chr223389 176 156 1485 ----
NM_003597chr252305 2212 2044 309 258 11480 ----
NM_003601chr41205 ------
NM_003603chr452038 1330 855 633 63 --11359 12074
NM_003607chr1114002 3805 3402 2966 1418 1389 1047 1018 563 424 95 --11663 --
NM_003615chr383755 3103 2657 2639 1383 774 705 377 12531 ----
NM_003617chr174509 4316 3795 1686 1437 636 463 34971 4725 1665 ----
NM_003618chr2172 ------
NM_003620chr1731078 937 397 1250 ----
NM_003622chr1231659 629 165 21976 1649 ----
NM_003628chr21514 ------
NM_003629chr192407 1259 1116 874 740 715 633 345 176 --12313 12800
NM_003630chr6--1744 ----
NM_003633chr552176 2031 1599 566 426 --12082 12409
NM_003642chr21217 1130 ----
NM_003644chr17195960 5598 5481 5445 5338 5326 5268 4654 4422 3975 1709 1622 1460 1296 1280 673 617 336 263 --14820 --
NM_003659chr21945 11082 --11218
NM_003663chr372868 2794 2652 2284 2204 277 236 --1760 --
NM_003664chr51489 ------
NM_003671chr983471 3452 3110 2903 2511 2447 1014 220 1158 ----
NM_003672chr141385 614 249 159 1776 ----
NM_003675chr103509 450 115 ------
NM_003677chr1252233 1475 850 828 33 --21669 731 --
NM_003690chr21484 ------
NM_003701chr1331053 397 378 --135 1777
NM_003705chr2138 1585 ----
NM_003718chr7------187
NM_003719chr51826 1205 1135 --
NM_003725chr122396 45 ------
NM_003728chr4----1226 --
NM_003749chr1341789 1693 1667 1648 22243 1870 1918 --
NM_003756chr8143 ------
NM_003758chr1531551 377 50 ------
NM_003758chr1531551 377 50 ------
NM_003759chr493723 3675 3554 3412 2742 2701 1380 94 88 ------
NM_003766chr173621 517 483 ------
NM_003772chr113339 128 82 1210 ----
NM_003774chr1283295 3231 2319 2106 1241 1211 1113 884 ----12167
NM_003778chr32242 119 ------
NM_003783chr121117 142 ------
NM_003794chr341077 377 288 275 1691 ----
NM_003800chr632112 255 120 --11504 --
NM_003803chr181279 ------
NM_003816chr861503 1295 1212 364 157 77 1234 ----
NM_003821chr81182 ------
NM_003822chr142515 1142 140 93 --13045 --
NM_003825chr1531503 1445 53 ------
NM_003831chr1841152 649 95 80 ----1424
NM_003862chr51350 --1298 --
NM_003873chr1062559 1627 912 663 457 406 22482 228 ----
NM_003878chr81221 135 ----
NM_003887chr24890 796 439 226 --2806 707 --
NM_003893chr101407 ------
NM_003899chr1352038 1666 361 308 216 2740 314 12431 --
NM_003901chr1032210 1967 706 ----11859
NM_003909chr832972 2779 599 12300 22042 808 --
NM_003913chr6124291 4248 4203 3878 3431 3169 2833 2744 1383 1060 894 128 24347 3416 --13193
NM_003924chr431602 1289 311 ------
NM_003931chr65537 468 211 66 34 --1490 --
NM_003932chr2271941 1856 1614 1194 1180 375 329 ------
NM_003941chr722296 769 1460 ----
NM_003947chr331189 1066 406 --21361 1276 --
NM_003958chr693786 3500 3394 2429 761 455 390 95 51 23012 1277 12562 --
NM_003966chr5147673 7649 7368 7303 7085 5966 3121 1955 1405 914 828 794 393 214 32861 1465 508 12627 --
NM_003968chr33219 155 66 1538 ----
NM_003980chr621273 400 1164 ----
NM_003983chr1673956 2771 1120 608 436 344 29 --53640 1348 976 825 88 --
NM_003994chr1294363 4137 3890 3788 3560 3230 922 694 202 --11405 13380
NM_003996chr62226 37 ------
NM_004028chr1823629 409 21246 389 14106 --
NM_004035chr17115019 4823 4524 4427 4118 3163 2055 1912 1771 1251 1079 25201 315 --13634
NM_004050chr1482265 2196 2173 2134 1780 1068 320 300 22363 150 1827 --
NM_004060chr53252 187 34 11247 11084 --
NM_004080chr751460 1083 571 222 31 ------
NM_004081chrY2458 172 1134 ----
NM_004087chr341760 1264 543 103 --11717 --
NM_004089chrX41261 938 865 204 ------
NM_004090chr17102852 2663 2555 2316 2130 2123 1122 654 599 250 --1886 --
NM_004093chr1393254 2934 2192 2186 2079 778 540 384 207 --13118 --
NM_004094chr1423050 71 1105 22031 1866 --
NM_004100chr692584 2085 1865 1699 430 396 388 157 50 1819 ----
NM_004109chr1172035 1757 1667 816 509 161 146 ------
NM_004114chrX158 ------
NM_004124chr1483417 2911 2496 2274 1135 1129 916 715 33207 2504 370 --23338 1144
NM_004136chr1542947 2612 1013 899 22893 1112 1337 --
NM_004157chr32206 150 ------
NM_004161chr231251 351 46 --175 --
NM_004170chr931711 1604 1580 ----1763
NM_004171chr11149443 9358 9252 9202 8915 7043 6589 6455 6345 2726 2709 2483 1262 237 29590 1459 49081 6952 3596 1514 35981 3549 29
NM_004180chr22139 127 1466 ----
NM_004186chr3--1147 ----
NM_004202chrY--1514 1215 1551
NM_004225chr84261 222 53 45 ------
NM_004227chr792710 2449 2274 1977 1913 1198 954 626 559 --12548 --
NM_004229chrX82154 2068 2015 1928 1727 647 451 57 22087 393 ----
NM_004232chr1883570 3385 2943 2883 1094 975 647 374 21023 442 ----
NM_004235chr93255 212 132 --1351 1247
NM_004236chr152399 103 ------
NM_004241chr10----156 --
NM_004242chr61304 ------
NM_004244chr123142 52 43 1391 ----
NM_004247chr172129 59 ------
NM_004267chr31218 ------
NM_004272chr541677 1641 761 217 31891 464 111 ----
NM_004273chr10194953 4645 4629 4174 4137 4054 3580 3391 1951 1859 1666 1654 1422 1262 1194 1072 420 311 238 --14264 --
NM_004274chr1483167 3099 3002 1065 672 510 444 198 ------
NM_004282chr61214 ------
NM_004287chr1752518 1869 893 562 111 12577 ----
NM_004293chr963831 3257 2977 2709 2337 650 --13477 --
NM_004296chr1474049 3625 3172 2954 1369 1105 953 23581 3551 ----
NM_004319chr142780 2570 711 297 23193 3068 22934 895 --
NM_004327chr22112511 2008 1721 797 389 341 233 165 87 41 22 --11528 2992 413
NM_004331chr861992 1824 1001 985 204 21 ----11879
NM_004337chr81888 --31860 333 80 --
NM_004338chr18116934 6284 6029 4865 4651 4627 4277 2278 2267 2165 687 25006 388 ----
NM_004342chr741903 1727 664 304 11514 ----
NM_004352chr162381 100 ------
NM_004369chr23518 230 32 ------
NM_004370chr642181 1683 1567 837 140 1180 --
NM_004374chr8133 ------
NM_004379chr241710 1186 123 61 1710 ----
NM_004380chr1672616 2532 2377 1980 1732 750 433 11961 2920 533 --
NM_004392chr1372684 1936 643 560 489 354 207 2658 303 1109 --
NM_004397chr1154266 3994 3847 1627 430 1773 --12674
NM_004412chr10155904 5807 5673 5568 5321 4914 4628 4488 3803 2000 1248 730 638 426 63 25656 4654 ----
NM_004423chr352653 807 758 637 96 --32577 2448 1901 --
NM_004432chr93705 330 170 1203 --1726
NM_004434chr1421419 489 1224 ----
NM_004436chr13580 197 29 ------
NM_004438chr2132891 2497 2333 2230 2076 984 684 590 297 211 201 101 31 23093 2350 ----
NM_004440chr62246 150 11638 ----
NM_004447chr123806 202 72 --1140 --
NM_004449chr2111444 --11275 --
NM_004454chr352211 1973 681 517 143 ------
NM_004456chr72257 30 1244 ----
NM_004457chr251692 1623 1301 258 61 ------
NM_004458chrX41658 928 726 486 ------
NM_004464chr453305 3101 922 332 72 13649 13824 --
NM_004474chr1--11051 ----
NM_004482chr21642 --1801 --
NM_004487chr381244 1030 909 811 797 371 215 209 1789 ----
NM_004500chr1431785 1386 408 ------
NM_004501chr1103866 3843 3575 3549 3462 2897 2508 1327 1243 745 --24073 964 --
NM_004504chr252609 2336 2039 1978 1001 12145 3939 709 491 --
NM_004505chr1761642 1296 637 430 277 149 ------
NM_004514chr1793074 2990 2717 2478 2265 2155 2127 1186 173 1876 ----
NM_004537chr1251547 1300 1159 1059 59 --1228 --
NM_004538chrX3537 97 68 ------
NM_004566chr10102482 2316 2232 1846 907 839 794 763 565 85 --11677 --
NM_004571chr2193192 2966 2600 2579 2548 2353 1185 712 467 --22720 286 --
NM_004575chr43637 586 496 ------
NM_004580chr1551738 1685 729 598 201 11333 ----
NM_004586chrX135398 4752 4478 4289 3901 2154 1921 1682 1546 1205 640 247 197 34550 3937 298 1584 12117
NM_004594chr162950 805 ------
NM_004598chr563234 2897 2703 1152 1007 777 1627 13171 13313
NM_004600chr11419 1288 ----
NM_004612chr984786 3080 1764 816 724 459 427 355 43747 1456 1205 906 ----
NM_004622chr222482 518 11977 --22317 413
NM_004627chr211672 1127 ----
NM_004654chrY41401 1285 1070 510 ----1484
NM_004655chr173352 313 217 ------
NM_004660chrY52234 2045 1985 1839 1606 --11832 1631
NM_004663chr1561282 1154 1028 482 314 230 ------
NM_004667chr153603 453 35 --1503 --
NM_004673chr131526 539 506 1486 ----
NM_004681chrY2173 109 1313 ----
NM_004686chr82586 288 21303 1254 ----
NM_004703chr1762427 1764 973 962 648 587 ------
NM_004705chr112782 558 1112 ----
NM_004707chr541640 1458 1165 63 1440 ----
NM_004709chrX61714 1498 1441 1430 520 353 --1644 --
NM_004713chr143725 555 264 ------
NM_004717chr76998 492 471 210 129 76 --11270 --
NM_004721chr3121 1252 ----
NM_004724chr11182 ----133
NM_004725chr1061455 1178 1079 500 149 124 11059 ----
NM_004726chrX185436 5225 5113 5025 4777 4555 4362 4219 3582 3545 3509 1649 1623 1593 1231 629 207 59 11067 11010 1447
NM_004730chr521508 278 11884 11571 --
NM_004731chr1251598 1464 1393 1251 320 ----21736 1476
NM_004734chr1332292 1314 439 22523 275 22611 220 --
NM_004736chr172213 2048 1933 1901 1449 902 854 11478 ----
NM_004744chr4123722 3210 3070 2765 2645 1417 1016 946 689 653 344 182 23283 118 ----
NM_004745chr8126556 5780 4728 4306 2158 1914 1887 718 667 515 461 423 24448 1766 ----
NM_004748chr1584193 4091 3484 3240 2751 1453 1085 365 34031 3822 637 ----
NM_004757chr43614 526 490 ------
NM_004760chr782473 2036 1842 1798 1644 971 669 250 ------
NM_004763chr28819 767 711 431 375 319 112 35 ------
NM_004774chr1782673 2299 2253 2195 2045 1979 1251 1173 12076 12214 --
NM_004775chr1841978 1841 1479 41 ------
NM_004779chr561123 929 875 485 312 197 ------
NM_004781chr11128 ------
NM_004781chr11128 ------
NM_004789chr92124 58 1445 ----
NM_004795chr132672 316 1181 1200 --
NM_004798chr20103509 3262 3141 3000 2235 976 839 695 643 109 22607 1195 33432 3034 2936 1486
NM_004805chr251232 1193 957 917 231 ------
NM_004815chr1134796 4704 4609 4581 4566 4559 4190 1472 842 787 418 304 162 14694 1940 --
NM_004822chr17113532 3356 3123 1554 1185 1075 837 680 593 579 245 ------
NM_004827chr42280 166 ------
NM_004836chr24894 235 148 86 --1184 --
NM_004840chrX51675 1660 1509 60 46 12191 ----
NM_004842chr651574 1536 1326 290 59 --11351 --
NM_004849chr631197 487 21 11627 ----
NM_004856chr152546 407 ------
NM_004857chr1454777 2936 1276 833 195 14532 ----
NM_004859chr1782297 2271 2225 1238 813 771 516 352 ------
NM_004865chr61424 1381 ----
NM_004866chr523368 1272 11116 11073 --
NM_004867chrX3644 260 238 --1487 --
NM_004869chr1841426 1154 670 516 --11636 --
NM_004870chr17--1633 ----
NM_004871chr1764242 4128 3847 3222 1635 1560 ------
NM_004873chr1443240 2380 1205 909 ------
NM_004888chr91391 ------
NM_004898chr472686 2325 2217 1011 653 133 72 11875 --1247
NM_004902chr203748 628 133 ------
NM_004904chr7126126 6084 4297 2335 2293 1833 1722 1701 1635 334 325 92 35800 4603 915 --25072 1454
NM_004906chr61230 ------
NM_004912chr731700 1627 153 1698 ----
NM_004929chr841526 1371 1092 968 1362 11335 --
NM_004937chr1761863 1667 866 625 511 358 ------
NM_004938chr931111 1005 243 ------
NM_004947chr382249 2123 1965 1951 1038 770 731 64 --1972 --
NM_004948chr1831199 963 165 --11393 11184
NM_004956chr751562 1147 698 635 71 21600 643 ----
NM_004962chr105613 276 268 236 208 ----1202
NM_004973chr61465 ------
NM_004976chr1184241 3949 3828 3681 1993 1759 1530 222 21186 522 33696 3453 1705 --
NM_004985chr1294257 3964 3845 3760 3523 3289 3083 3032 348 43908 3879 1774 242 13227 --
NM_004991chr32340 112 ------
NM_004992chrX138510 8468 8172 7663 6771 5473 3309 3041 1545 1439 1417 702 678 --58069 6387 1834 1101 1044 --
NM_004992chrX138510 8468 8172 7663 6771 5473 3309 3041 1545 1439 1417 702 678 --58069 6387 1834 1101 1044 --
NM_004993chr1431392 1385 1319 ------
NM_004999chr674028 2934 2889 1688 821 556 457 13659 ----
NM_005010chr732221 1923 1537 ------
NM_005028chr1062348 2327 1991 910 839 637 ------
NM_005030chr161252 ------
NM_005032chrX41055 942 223 205 1845 ----
NM_005044chrX94266 4202 3580 3237 3017 2925 795 533 50 ------
NM_005056chr1285307 5142 4885 4715 4256 3827 3804 2196 11289 14279 --
NM_005057chr161494 1477 1207 1171 545 419 --11752 --
NM_005063chr10103836 3643 3168 3012 2737 2491 1395 1321 1163 872 22806 77 13050 13551
NM_005065chr14185379 5300 5176 4292 4199 4174 4149 4105 4011 3537 3524 2096 1479 1317 497 451 200 129 24450 788 23517 975 --
NM_005066chr13837 724 273 ------
NM_005077chr9133 ------
NM_005086chr1221321 481 1124 ----
NM_005093chr20104875 4832 4566 4398 3327 2136 1076 1063 1007 223 14415 --2436 142
NM_005096chrX31259 478 99 ------
NM_005099chr121231 1135 --1525 --
NM_005105chr152147 1897 1682 1658 1547 ----11925
NM_005119chr131110 508 95 --11251 --
NM_005121chr1743755 3455 3280 992 23533 3136 11480 --
NM_005124chr65857 725 717 89 63 ------
NM_005126chr331546 390 264 12199 ----
NM_005134chr183686 648 282 --1293 --
NM_005155chr61536 1682 ----
NM_005156chr974746 4337 1909 1539 1107 590 113 34796 2159 1472 ----
NM_005159chr1562179 2121 1948 838 375 249 1423 ----
NM_005160chr22146677 6498 6360 5593 5370 5254 4546 4366 4311 4220 2608 2096 712 251 26825 5511 24804 2499 26490 2540
NM_005164chr1242681 2329 1623 307 12503 ----
NM_005180chr1031292 1231 427 ------
NM_005181chr84836 698 671 646 ------
NM_005192chr14136 --196 --
NM_005197chr14166218 5748 5215 4280 4119 3877 2479 2110 2079 795 746 635 628 469 333 268 --25487 5016 --
NM_005201chr321030 407 --140 --
NM_005222chr74923 785 363 35 ------
NM_005224chr194718 536 521 33 --1240 --
NM_005233chr342131 2095 1978 652 ------
NM_005235chr2146705 6479 5808 5035 2918 1920 1748 1138 1118 1042 933 515 449 163 12589 11373 --
NM_005238chr1161316 1002 942 262 77 69 --11128 --
NM_005249chr141618 ------
NM_005252chr143737 595 162 ------
NM_005254chr1571276 1139 956 497 200 146 57 ------
NM_005259chr221341 585 --1444 --
NM_005261chr83817 723 675 180 ----
NM_005270chr261295 1254 1221 1125 391 24 1410 2554 480 --
NM_005277chr43511 491 32 ----1138
NM_005279chr21586 1339 ----
NM_005311chr762533 2257 817 615 489 341 1510 ----
NM_005316chr1111059 ----1702
NM_005327chr45739 730 634 561 36 ------
NM_005328chr82267 120 1723 ----
NM_005329chr1641991 749 507 397 --2878 356 --
NM_005333chrX6890 823 385 304 293 75 --11109 --
NM_005338chr783642 3507 3399 2934 899 841 707 516 --32996 2885 1017 11173
NM_005339chr484356 4300 3493 2762 2748 1486 1379 247 1337 13716 --
NM_005358chr1331440 1404 235 11903 ----
NM_005359chr18175944 5830 5623 5300 5138 4567 4259 2612 2296 1762 1695 1639 1321 1301 218 162 74 1947 14658 --
NM_005385chr352721 2552 1931 1050 929 21677 1670 1245 --
NM_005397chr7143920 3602 3367 3048 1379 1299 1015 699 684 531 323 231 215 162 --13436 --
NM_005398chr1021190 390 ------
NM_005399chr194381 4120 3771 2966 2934 1364 964 918 77 1132 13861 --
NM_005402chr72399 283 1593 1242 --
NM_005406chr181524 ------
NM_005409chr43881 41 27 --1202 --
NM_005414chr3280 74 ------
NM_005433chr1842740 2672 2361 695 21820 1708 1958 --
NM_005436chr1074119 3861 3827 3740 2925 2798 1175 11111 22583 223 --
NM_005475chr1273009 2998 2102 1249 1182 892 764 --12830 13258
NM_005479chr1011617 21514 577 --11190
NM_005502chr932346 1081 984 2590 118 1234 --
NM_005504chr12206440 6270 6190 5949 5744 5506 5036 4598 4414 4142 1961 1928 1484 1237 1216 1089 897 565 482 75 24998 4181 1594 --
NM_005515chr73667 417 256 ------
NM_005520chr5--1287 ----
NM_005522chr741406 1064 989 395 ----11262
NM_005523chr761486 1223 1099 1038 998 328 --1635 1389
NM_005542chr771575 1543 1490 333 231 187 131 ------
NM_005570chr1821095 998 --1739 1294
NM_005575chr53749 562 170 1689 ----
NM_005578chr3115169 3640 3153 2050 1720 1116 1105 823 402 321 188 ----11768
NM_005584chr136767 741 709 676 606 256 2779 521 --1735
NM_005595chr11789 ------
NM_005596chr954211 2337 2285 2123 1497 ------
NM_005599chr121345 1089 ----1577
NM_005602chr351304 1217 1183 963 341 ------
NM_005603chr1871758 1666 1405 704 648 405 271 ------
NM_005607chr81122 ------
NM_005611chr1631178 1083 885 ------
NM_005613chr172118 2007 1960 1835 1473 279 58 --11565 --
NM_005626chr1----1367 --
NM_005627chr631007 366 236 ------
NM_005637chr1821422 1340 11479 --11743
NM_005638chrX31470 1362 1210 ----21675 1605
NM_005639chr1241834 1199 537 524 ------
NM_005647chrX52881 1126 994 324 117 --12248 13471
NM_005653chr12263 48 ------
NM_005655chr83953 886 297 1247 ----
NM_005657chr151152 ------
NM_005665chr184907 4641 4345 3759 3433 1864 345 321 21353 265 ----
NM_005667chr21176 ------
NM_005668chr584213 4125 4055 3502 3184 487 240 40 14487 ----
NM_005684chr1------1100
NM_005707chr152447 127 1354 1176 --
NM_005721chr281132 1094 1048 1022 978 216 106 74 1209 1339 --
NM_005722chr232217 705 186 12406 11975 11709
NM_005725chr152417 2360 1925 1834 1551 22272 628 12238 --
NM_005734chr112743 100 ------
NM_005737chr272213 1994 1117 964 773 453 261 1552 ----
NM_005738chr741647 1379 794 292 --1103 --
NM_005748chr1252384 2302 1300 1083 237 12792 33169 589 312 --
NM_005749chr171658 ------
NM_005751chr72457 319 ------
NM_005752chr1631153 942 360 --11249 --
NM_005756chrX11168 ------
NM_005759chr283826 3664 3031 839 829 220 167 59 24410 1542 11920 --
NM_005765chrX2694 338 1544 --1219
NM_005776chr144875 816 663 298 ----1549
NM_005779chr552556 2234 1072 593 238 --12354 --
NM_005786chr183432 78 70 11060 ----
NM_005789chr1742153 1873 1794 543 ----12070
NM_005795chr232182 672 105 21208 600 ----
NM_005797chr1141511 1419 569 58 11585 11609 --
NM_005801chr172245 190 ------
NM_005802chr91679 ------
NM_005808chr343473 2221 804 410 1964 22695 2393 --
NM_005813chr272491 2266 2073 1645 1610 846 768 2656 178 ----
NM_005819chr173397 3278 2886 2799 2774 496 103 11393 1887 --
NM_005822chr652347 2201 870 806 650 --21891 1618 --
NM_005828chr17165088 4947 4718 4665 4514 4241 4101 1871 1581 1545 1132 1007 790 697 595 219 --13800 --
NM_005840chrX227569 7395 7262 6709 6615 6581 6549 5645 5547 5407 4702 2518 2461 2420 2387 2101 2091 1887 1646 1260 1222 1099 1968 27625 6566 --
NM_005841chr42988 28 21113 902 ----
NM_005843chr261800 1541 1238 491 69 24 1639 ----
NM_005845chr1341271 1094 466 398 1130 ----
NM_005857chr141158 1060 419 184 11459 1395 --
NM_005868chr772509 2335 814 429 393 370 127 1175 ----
NM_005871chr101336 2826 223 1981 --
NM_005875chr3------134
NM_005880chr1651434 1386 615 374 226 11020 11443 --
NM_005882chr42235 182 ------
NM_005888chr12127 1304 ----
NM_005895chr1293748 3262 3100 3076 2787 2597 1615 1303 256 1522 11444 --
NM_005896chr24814 721 619 551 ----1668
NM_005898chr1173176 2375 2090 1289 1150 963 326 --12995 1174
NM_005900chr441068 901 398 53 --2944 757 --
NM_005901chr18157940 7882 7743 7519 7289 7097 7020 6655 6549 3202 2957 2875 2516 2132 267 38479 3380 170 17389 17408
NM_005903chr594478 4232 4209 3774 3473 3416 1494 1452 523 --14140 --
NM_005909chr594102 3573 3266 2625 1126 1112 847 583 32 33306 3091 1497 1958 12867
NM_005911chr221081 998 ----1920
NM_005920chr1103581 3090 2681 2665 2576 2361 1553 1478 972 521 ------
NM_005924chr7--21056 223 1830 --
NM_005935chr484739 4711 4418 3470 1324 1160 875 364 ------
NM_005941chr873969 3756 1433 1337 1275 949 358 12968 13092 --
NM_005944chr341054 177 99 22 --146 --
NM_005955chr1115150 4713 4013 3907 3514 3493 1498 1451 1215 1058 436 13375 ----
NM_005964chr1741535 1311 571 104 11163 11003 --
NM_005966chr232192 789 393 ------
NM_006007chr973959 3038 2833 1802 1380 827 215 44327 3591 853 814 12728 --
NM_006009chr12--1192 ----
NM_006011chr15104030 3971 3806 3478 2817 2800 1592 1087 996 251 --23371 1510 1177
NM_006022chr131855 2923 871 ----
NM_006024chr71647 1278 1624 --
NM_006033chr1882216 2180 1950 1678 805 565 305 120 ----1209
NM_006036chr21791 2505 454 ----
NM_006037chr274550 3825 3664 1653 1619 720 48 ----11566
NM_006038chr2082093 1866 1765 1585 1579 1354 608 425 --11394 --
NM_006040chr1641230 910 477 285 --156 165
NM_006043chr162627 611 ------
NM_006047chr2043098 2852 2481 1332 1484 --13540
NM_006048chr121161 154 --11101 --
NM_006054chr1121089 286 --11628 --
NM_006064chrX176 --1142 --
NM_006070chr31430 ------
NM_006073chr662210 1998 1858 1658 1533 772 21759 1668 1670 --
NM_006080chr742208 510 298 133 --11146 --
NM_006095chr474336 4274 4015 3903 3808 1314 477 ------
NM_006096chr83632 590 352 21609 1431 ----
NM_006106chr1133261 2647 2610 --22764 2102 --
NM_006108chr1161654 788 699 538 186 58 1162 1355 11477
NM_006113chr151419 1409 1400 830 627 ------
NM_006136chr721203 69 --11291 --
NM_006139chr232159 1017 176 21824 67 ----
NM_006141chr1641884 833 613 478 12414 1660 --
NM_006152chr122202 52 ------
NM_006154chr1541908 868 116 100 --12937 --
NM_006159chr124597 483 471 124 ------
NM_006162chr1851592 1398 448 252 164 1113 11443 --
NM_006164chr21176 ------
NM_006166chr1282576 2492 2231 1820 1780 775 422 332 1583 ----
NM_006178chr1751639 552 535 467 340 --11472 --
NM_006180chr971907 1743 1470 1391 1384 785 315 11329 ----
NM_006183chr123559 400 126 ------
NM_006190chr261098 1064 847 327 301 291 --2763 21 1979
NM_006194chr1471328 997 823 817 373 242 114 ------
NM_006197chr831410 337 169 ------
NM_006203chr5105301 5156 5150 5083 3611 2205 2096 1586 1305 1046 45541 4858 722 521 14221 --
NM_006206chr4102768 2512 2181 1175 1162 1086 953 455 418 47 1907 12365 --
NM_006212chr1185442 5211 5056 4855 4823 4763 4744 4170 4129 3747 2093 2046 2024 1953 1890 1873 1673 511 35014 1833 1113 ----
NM_006241chr352194 1850 1732 1625 354 1454 ----
NM_006242chr2071633 1622 1475 558 181 171 25 --1355 --
NM_006243chr12910 227 --1307 --
NM_006252chr1137077 5516 5321 5215 5060 4754 4711 2946 2424 2196 1587 1444 1053 15870 37465 1418 1030 1669
NM_006258chr1071568 1377 1179 1006 583 232 72 ------
NM_006264chr42383 145 ------
NM_006265chr831508 1420 500 ------
NM_006266chr93632 616 126 1743 --1840
NM_006267chr241853 1422 1386 743 1375 ----
NM_006275chr2032203 929 103 2508 395 ----
NM_006282chr20134568 3960 3842 3792 3547 3253 1612 1474 1378 1076 1023 526 56 14070 ----
NM_006283chr8104364 4100 3764 3549 3501 3235 558 486 271 172 21380 1233 13324 14985
NM_006287chr252451 1932 1636 842 237 22700 686 1414 --
NM_006301chr121667 ------
NM_006306chrX204880 4378 4108 3800 1642 1215 1172 1108 1049 1041 741 706 688 620 513 463 425 212 186 31 23998 63 13742 15493
NM_006310chr1761281 939 924 887 832 274 ------
NM_006313chr1231380 1323 158 --11137 --
NM_006315chr4113635 3196 1577 1387 1141 690 485 413 342 334 289 1109 11483 --
NM_006320chr421092 231 1155 1747 --
NM_006323chr41229 ------
NM_006335chr14847 793 769 266 --1206 --
NM_006352chr172009 1786 1641 776 494 485 97 --1455 --
NM_006359chrX52208 2200 2129 214 93 --12103 --
NM_006364chr1421273 341 1442 ----
NM_006366chr621312 442 --132 --
NM_006371chr3105008 4824 4599 3545 3479 3415 1973 1745 1336 1259 --34663 3714 3680 11801
NM_006379chr742350 2047 316 122 ------
NM_006380chr1731504 591 303 ------
NM_006386chr2282362 2051 1917 1557 694 686 417 385 ------
NM_006390chr1271646 1522 1448 1277 687 270 178 --11797 --
NM_006393chr1084481 4071 3953 3774 3672 3179 2807 1415 ------
NM_006415chr921178 82 ------
NM_006420chr20143092 3039 2982 2960 2203 2189 1227 1150 833 765 573 478 349 124 ----1900
NM_006421chr851254 475 110 96 79 1986 1888 --
NM_006434chr1073232 3079 2791 721 439 381 297 11081 22010 1261 --
NM_006457chr483500 3182 2720 1561 1335 724 326 118 13901 --12948
NM_006466chr202788 92 ------
NM_006467chr571890 1840 507 435 385 313 44 1261 1660 12395
NM_006472chr13397 284 59 ------
NM_006475chr132159 132 ------
NM_006476chr111728 183 1704 1510
NM_006478chr222242 206 ------
NM_006482chr1233730 2829 30 11346 ----
NM_006489chr1491719 1610 1588 1455 1434 1324 741 614 303 --11278 --
NM_006496chr151920 1799 1494 1312 479 11880 ----
NM_006516chr171547 1242 1187 1171 568 325 72 --41488 478 310 276 --
NM_006520chrX41588 1353 1283 638 1139 ----
NM_006526chr2031907 739 568 ----1274
NM_006527chr43491 233 130 ------
NM_006534chr2072877 2732 929 901 713 501 162 ------
NM_006540chr83972 317 202 --1504 --
NM_006544chr14105996 5854 5544 5428 5032 4893 1452 1381 1075 222 --22069 241 1934
NM_006546chr17116311 6283 5765 5261 4703 4460 4394 1476 1130 835 78 --14844 11790
NM_006547chr771738 1685 1630 1486 1367 521 187 ------
NM_006548chr361533 1480 1443 684 291 159 --11603 --
NM_006558chr82464 116 ------
NM_006559chr131069 375 223 --1814 --
NM_006560chr111137 ------
NM_006561chr1086045 5241 4546 4151 2229 1746 1264 365 11972 14742 --
NM_006571chr8154 1347 ----
NM_006572chr1793475 2876 2751 2664 2608 2394 591 318 126 12761 ----
NM_006575chr1411061 ------
NM_006577chr231231 1136 273 145 ----
NM_006595chr1151964 1876 1652 1536 1317 3698 677 58 11387 --
NM_006599chr16146277 3189 3004 2775 2767 2544 2009 1809 1715 1140 1063 1024 806 48 25298 1894 ----
NM_006603chrX61726 709 449 394 318 264 11885 --1171
NM_006609chr252776 2547 2038 1932 214 ------
NM_006614chr322888 1187 ------
NM_006618chr121508 1183 ------
NM_006620chr694591 3589 3140 1609 1418 1314 1050 301 291 131 ----
NM_006628chr15124631 3918 3238 2862 1863 1558 1517 1345 699 505 482 228 13101 1512 --
NM_006629chr1862752 2738 2021 609 445 62 ------
NM_006646chr1362976 2406 2343 2195 557 245 2579 473 1933 --
NM_006654chr1284708 4502 3450 3276 1600 1310 769 754 34737 3399 122 ----
NM_006662chr16181 ------
NM_006690chr2012036 ------
NM_006699chr172074 1876 832 563 324 301 92 --1226 12365
NM_006704chr131430 190 175 --
NM_006706chr57819 777 722 563 342 240 143 ------
NM_006708chr61323 ----1212
NM_006710chr24944 422 392 229 2860 185 ----
NM_006716chr771349 1087 980 834 389 240 50 2508 160 1437 --
NM_006717chr943023 2969 2429 933 1148 13250 --
NM_006720chr10114796 4580 4487 3955 3670 3541 1916 1778 1692 1656 570 14135 21234 498 --
NM_006729chrX195533 5492 5295 5015 4327 3670 3445 1924 1858 1706 1681 1639 1075 1016 970 940 837 190 130 15073 ----
NM_006731chr9155771 5210 4617 4369 4103 2222 2065 2040 1423 1292 1201 898 801 562 476 --34097 1524 1338 --
NM_006734chr611586 ------
NM_006738chr15134248 4220 3230 2884 1747 1405 1246 1229 1043 933 520 351 142 ------
NM_006745chr451103 1059 921 326 24 --2971 44 --
NM_006750chr16197625 7106 6991 6349 6203 6053 5934 5798 3241 2969 2392 2350 2285 2165 1849 1483 1094 698 465 37895 5026 900 45626 1435 573 538 12072
NM_006751chr22314 196 --1685 --
NM_006759chr21299 ------
NM_006766chr82647 214 --1709 --
NM_006773chr221330 493 1652 --127
NM_006775chr692547 2511 2440 2346 2044 716 702 437 23 22256 241 ----
NM_006777chrX92513 1864 1033 871 585 382 296 166 114 32500 2141 2090 --1277
NM_006805chr541726 699 464 196 11521 ----
NM_006811chr20--2879 152 1961 --
NM_006814chr2072383 1958 1059 975 775 475 46 ------
NM_006815chr122212 96 ------
NM_006817chr123403 344 143 ----1135
NM_006827chr142928 641 11077 --22609 2140
NM_006832chr142922 92 --1200 --
NM_006838chr1241511 527 401 345 1287 1336 --
NM_006852chr1792615 2080 1761 1156 945 454 375 315 266 ------
NM_006854chr731656 765 632 11377 ----
NM_006884chr331996 1376 772 ------
NM_006885chr1633924 3086 2762 24205 3019 13665 --
NM_006888chr14103209 3098 3035 2657 2543 2401 1043 740 130 50 12682 ----
NM_006895chr251613 1513 1465 312 262 ------
NM_006902chr1143035 2774 2635 2611 2465 2419 2296 2180 1002 954 862 748 663 101 ------
NM_006908chr71327 --11517 --
NM_006910chr162356 293 ------
NM_006915chrX32391 2283 559 22381 667 --11835
NM_006918chr1174916 4834 4654 4019 3684 3608 1809 25787 782 --25139 498
NM_006920chr211750 ----1826
NM_006924chr17123959 3543 3402 3264 3136 2994 1707 1451 1431 1251 375 117 23875 3243 ----
NM_006931chr1262174 2019 1674 766 196 96 11685 11401 --
NM_006936chr2161190 1160 1110 1015 891 48 --2354 316 --
NM_006940chr1211670 11342 ----
NM_006948chr2182193 2165 2124 1966 1520 990 436 281 --11867 --
NM_006951chr103676 560 143 1201 ----
NM_006955chr1073056 2132 1365 1181 1105 948 254 2905 209 191 --
NM_006956chr791915 1890 1604 1581 1526 792 386 141 64 --11612 --
NM_006965chr183416 306 166 1475 ----
NM_006981chr962355 2226 1987 856 832 445 12362 ----
NM_006988chr211158 ------
NM_006996chr151731 1698 1276 1198 1169 --157 --
NM_007005chr941209 1097 1010 166 ------
NM_007007chr1243957 3931 1599 727 23804 141 13059 --
NM_007011chr15216667 6648 6598 6308 6066 5852 5739 5580 5445 4658 2757 2583 2431 2161 2119 1748 1286 954 568 477 361 1324 32562 1653 97 21537 1459
NM_007013chr841040 955 352 191 1997 ----
NM_007018chr92377 116 ------
NM_007027chr35550 454 206 157 104 --158 --
NM_007030chr5115002 4945 4815 4455 1866 1691 1633 1534 746 390 363 13487 ----
NM_007034chr1----1648 --
NM_007038chr2185982 5714 5433 3948 3713 3687 2388 1831 11396 ----
NM_007040chr194901 804 759 194 11086 ----
NM_007042chr352090 1707 625 324 182 12674 11973 --
NM_007050chr20108107 7534 6454 6418 2026 1850 1248 1186 1082 316 16870 ----
NM_007052chrX2205 188 1446 ----
NM_007054chr5113178 2510 2435 1538 1366 1004 818 717 708 633 52 12952 --12637
NM_007064chr351647 1220 212 111 61 ------
NM_007068chr222862 83 11002 ----
NM_007073chr6103468 3403 3379 2980 1562 1275 1065 1058 54 43 14201 22725 658 --
NM_007106chr1362637 2567 711 585 244 122 1851 12502 --
NM_007107chr361693 1575 851 779 485 473 11483 22088 686 1817
NM_007114chr393034 2804 2671 2519 2205 1016 617 571 32 23332 2553 1971 1254
NM_007145chr1951318 1198 939 82 21 ------
NM_007159chr331622 653 341 1265 11320 --
NM_007172chr2273297 2470 2274 1214 1195 1036 225 --13257 12212
NM_007174chr1232110 1993 1875 1468 ----
NM_007191chr122626 69 --1111 --
NM_007195chr1883633 3464 2941 2631 1470 1150 591 24 2748 410 12854 11290
NM_007197chr122637 139 ------
NM_007200chr15134248 4220 3230 2884 1747 1405 1246 1229 1043 933 520 351 142 ------
NM_007204chr12615 113 ------
NM_007217chr33327 126 102 ------
NM_007218chr81118 ------
NM_007222chr841600 1205 737 292 11670 --21840 1319
NM_007236chr1542219 1692 270 51 ------
NM_007238chr20124854 4636 4541 4467 3903 3852 3614 3316 3168 1684 1549 307 12982 13605 --
NM_007245chr16----1657 --
NM_007246chr42899 217 11072 21060 306 1720
NM_007249chr13259358 8724 8715 8258 7630 7571 7379 7227 6898 6608 6542 6381 6362 6013 3487 2608 2170 1841 1301 636 619 162 121 70 37 58738 8521 6785 776 448 27395 2508 16942
NM_007257chr862739 2359 1147 804 630 620 --12968 --
NM_007271chr681611 1466 1249 677 516 169 129 74 11877 ----
NM_007279chr192410 78 ------
NM_007280chr152340 79 ----1478
NM_007282chr32998 647 ------
NM_007292chr17115019 4823 4524 4427 4118 3163 2055 1912 1771 1251 1079 25201 315 --13634
NM_007345chr1822172 37 --22209 1683 --
NM_007347chr1523183 885 22154 557 --12803
NM_007350chr12104339 3986 3833 3827 3583 3260 3226 3107 986 360 11224 --1755
NM_007353chr793033 3008 2849 548 515 449 434 202 116 ----12108
NM_007358chr121734 801 11705 ----
NM_007365chr191948 754 630 598 455 394 335 179 157 ------
NM_007373chr1071744 1544 709 558 502 421 206 ------
NM_007375chr152442 2409 1957 772 310 22080 2070 ----
NM_012062chr122683 257 ----164
NM_012071chr104256 201 122 87 ----1285
NM_012081chr553567 3455 3307 2568 1322 12993 ----
NM_012089chr141457 1354 1093 1006 1617 ----
NM_012090chr13898 74 39 ------
NM_012092chr271663 1629 1474 1339 1192 363 56 --11731 --
NM_012093chr111260 ------
NM_012095chr1043196 2941 2548 1030 12328 12380 --
NM_012096chr373242 2848 2622 2379 1162 1029 243 1428 --12906
NM_012097chr251448 1440 343 302 58 21919 867 ----
NM_012102chr162532 2210 1965 1025 241 187 ------
NM_012104chr11103086 2975 2762 2713 2336 1353 887 291 277 36 12772 21153 536 --
NM_012104chr11103086 2975 2762 2713 2336 1353 887 291 277 36 12772 21153 536 --
NM_012120chr662566 2429 2342 1842 795 254 1268 ----
NM_012124chr112249 105 ----1722
NM_012137chr172627 1139 1049 464 457 335 142 ------
NM_012141chr1353834 3739 3487 937 638 --22582 1106 --
NM_012153chr1172325 2026 1711 1642 521 459 66 --12280 --
NM_012156chr20143248 3218 3166 2968 2601 2295 2126 2114 1089 1046 625 610 257 76 --22417 487 --
NM_012161chr44906 865 850 405 ------
NM_012164chr9186718 6158 5557 5333 4874 4734 4668 2885 2808 2657 2528 2424 2137 1938 1331 1128 775 577 26730 4630 47457 5949 1458 698 --
NM_012175chr111869 1332 1601 --
NM_012193chr11155232 5177 5127 5057 5021 4850 4327 4222 4049 3751 3712 3645 3520 2177 1318 12021 15304 --
NM_012199chr174614 4485 4298 4289 3793 1774 1532 23429 28 ----
NM_012214chr2156424 6235 6149 5806 5689 5461 4586 4331 4247 2487 2209 1722 737 500 86 34669 4534 2109 11981 --
NM_012218chr1992989 2938 2667 2144 2068 2052 1973 508 497 13000 12708 --
NM_012219chr3103180 2678 2662 2311 2149 1257 1132 1078 838 596 --23100 2857 --
NM_012224chr441134 1058 203 46 ------
NM_012232chr1762141 2131 2060 1864 815 443 --11698 --
NM_012234chr321389 83 23178 3043 2940 259 --
NM_012238chr1031497 1461 444 11699 ----
NM_012243chr14249 241 193 108 ------
NM_012247chr102262 219 --1414 --
NM_012249chr272858 2408 1200 830 513 194 109 ------
NM_012252chr7105004 4525 4180 3907 2083 1670 1638 1330 1031 255 1722 13565 --
NM_012257chr72269 135 ------
NM_012262chr1114357 4173 4161 3605 3230 2039 1294 715 427 79 29 11775 ----
NM_012279chr582075 1941 1838 1547 811 581 408 116 --2642 522 --
NM_012286chrX1429 ------
NM_012287chr354305 3554 2799 446 112 --21131 821 13836
NM_012290chr22503 33 11701 --1451
NM_012294chr783678 3320 3239 3182 2946 1191 1075 99 12562 ----
NM_012296chr1173643 3329 3178 2928 2559 885 150 --12425 --
NM_012297chr462601 1991 1845 1739 491 290 ------
NM_012300chr562349 2123 2023 556 94 42 12105 ----
NM_012301chr731815 1777 1365 ----11575
NM_012302chr12981 92 ------
NM_012307chr181881 ------
NM_012309chr1184863 4315 3479 1884 561 381 143 71 ------
NM_012316chr1155558 5133 4810 4477 4463 2122 1926 1723 1410 1299 985 894 758 158 121 15346 12042 --
NM_012319chr184820 412 345 331 1127 ----
NM_012325chr2071394 1217 666 548 348 284 231 ------
NM_012333chr12214 80 ----152
NM_012342chr104367 151 79 39 ------
NM_012345chr1351793 1358 1259 559 219 ----11499
NM_012382chr5124235 4003 3963 3702 1441 1178 866 574 563 293 50 26 34452 259 220 12889 2467 310
NM_012383chr91354 ------
NM_012388chr1593194 3051 2982 2081 1937 1180 974 500 471 --1243 --
NM_012399chr2261377 1350 720 640 613 371 11233 --11387
NM_012408chr204791 255 132 104 ------
NM_012416chr9------123
NM_012417chr17------1463
NM_012428chr153818 641 31 ------
NM_012430chr31301 --2544 291 --
NM_012432chr12346 30 ------
NM_012464chr471924 1855 1082 860 847 599 282 12612 ----
NM_012471chrX61812 1660 1632 1433 1415 321 11956 ----
NM_012479chr752578 2268 2082 922 504 --12132 --
NM_013229chr1242475 1817 1090 44 --12373 --
NM_013230chrY41221 692 593 325 11166 1287 --
NM_013231chr1464133 3306 3272 1106 899 828 1125 ----
NM_013233chr241037 1027 1010 331 --1517 --
NM_013236chr224980 955 406 173 --125 1231
NM_013237chr51376 ------
NM_013252chr792526 2071 1070 779 711 671 486 157 46 --11978 --
NM_013257chr842162 957 794 660 ------
NM_013261chr462609 2382 1493 709 665 271 --12787 --
NM_013264chr11--1199 ----
NM_013269chr1244022 1305 946 547 23536 228 --14152
NM_013281chr2041205 460 452 213 21409 309 ----
NM_013286chr383687 3644 3496 3270 2992 2877 1274 93 13085 12657 1555
NM_013302chr1694367 3312 3191 3151 2878 1310 1256 234 151 --1663 23739 2983
NM_013309chr1542061 729 623 391 --12426 12333
NM_013313chr22123402 2380 2305 1383 1305 835 828 721 558 423 203 28 --22653 1374 --
NM_013316chr72229 102 ------
NM_013322chr721126 309 ------
NM_013341chr272471 1957 1113 1095 470 353 73 ------
NM_013354chr821110 72 1276 ----
NM_013372chr1562956 2827 2619 2135 1136 722 --22936 2924 --
NM_013381chr1252161 1963 1680 1504 884 11570 ----
NM_013386chr161376 639 564 404 294 278 21787 535 1266 --
NM_013436chr23314 202 88 ------
NM_013437chr821305 1005 ------
NM_013447chr19113539 3448 2756 2554 2536 2321 813 422 391 259 49 ------
NM_013448chr142593 479 ------
NM_013449chr1272865 2732 1881 885 776 759 503 12665 ----
NM_013450chr231180 804 506 1312 ----
NM_013943chr163215 3030 2863 2548 2039 1221 ----1526
NM_013958chr82394 357 ------
NM_013959chr82394 357 ------
NM_013961chr82394 357 ------
NM_013962chr82394 357 ------
NM_013989chr14105099 4355 4160 4087 3463 1805 1435 1146 463 68 35149 1739 186 23439 3115 1347
NM_013995chrX52231 1959 1902 1806 241 2703 598 1268 --
NM_014011chr262558 2240 2146 2015 1032 975 ------
NM_014016chr351591 1226 1060 622 268 --1243 --
NM_014021chr183471 3092 2908 2403 2367 693 275 111 1841 1382 --
NM_014023chr10112634 2424 2106 1786 1158 1037 992 791 549 376 105 ------
NM_014026chr11--1122 ----
NM_014028chr683221 2960 2754 2558 2163 1326 944 697 --12567 --
NM_014034chr641387 1315 222 62 ------
NM_014048chr1695154 5130 4246 3418 3337 2043 2019 220 146 33854 2122 1164 13361 --
NM_014053chr11119 ------
NM_014055chr122404 166 ------
NM_014057chr931608 380 180 11614 ----
NM_014089chr1352030 1883 705 574 419 12106 ----
NM_014112chr834594 3795 1418 25329 1541 --25502 4204
NM_014117chr1672692 2451 2049 2021 1742 617 36 ------
NM_014141chr7104341 3664 3585 3412 1287 1095 844 833 720 203 11603 14586 --
NM_014149chr73871 724 598 ------
NM_014154chr341066 1016 462 264 139 ----
NM_014155chr11105915 5141 4872 4559 2684 2020 1569 1468 785 425 12845 --1675
NM_014171chr22656 631 --153 --
NM_014176chr11154 --169 --
NM_014181chr242676 1966 602 213 ----11036
NM_014187chr16--1149 ----
NM_014191chr121111 ----173
NM_014223chr11300 ------
NM_014240chr394199 3872 3846 2914 1478 698 493 373 270 ------
NM_014253chrX72488 2359 1997 1624 1607 1575 415 22076 394 ----
NM_014283chr141558 1427 549 495 11108 ----
NM_014290chr9----1200 --
NM_014305chr132525 209 ------
NM_014309chr22114515 4404 4196 4168 3797 1912 1360 1131 647 482 416 1167 24857 1763 --
NM_014319chr1251932 1853 1552 792 121 21249 179 ----
NM_014325chr1231788 659 306 ------
NM_014331chr4167813 7721 7010 6760 6006 5831 2701 2418 2276 2076 2012 1543 1409 980 428 74 36580 6316 592 15251 --
NM_014333chr1121070 762 ------
NM_014338chr2241067 1010 887 374 --1138 --
NM_014363chr1341233 236 226 176 --134 --
NM_014372chr12583 405 11484 1128 --
NM_014382chr341672 1539 1343 279 ----11111
NM_014388chr1125905 5775 5497 5396 5244 5032 5003 4370 2347 2195 825 167 --25681 1911 --
NM_014392chr441310 1186 1083 350 21485 297 1554 --
NM_014393chr872191 1876 1555 907 869 590 433 12282 ----
NM_014395chr442004 1666 1236 1227 ------
NM_014399chr741012 334 225 208 1910 ----
NM_014409chr151130 931 924 234 79 ------
NM_014415chr331709 1056 309 ------
NM_014423chr5104980 4902 2248 2217 1940 1824 1732 1015 936 828 24127 385 --13658
NM_014445chr332220 1990 49 12130 --11943
NM_014456chr1031630 720 48 ------
NM_014458chr11494 11236 ----
NM_014487chr4--1688 ----
NM_014491chr71251 1334 ----
NM_014494chr1641808 1786 1603 402 2703 154 1161 --
NM_014496chrX130 ----1104
NM_014517chr391862 1850 1794 1388 1315 612 419 402 67 ------
NM_014547chr152230 182 ------
NM_014547chr152230 182 ------
NM_014548chr1551618 1559 1531 1374 1221 --11384 --
NM_014554chr12102254 2209 2190 2131 1875 1828 1571 855 664 120 ------
NM_014572chr1341829 1505 1150 129 ------
NM_014574chr1431222 469 238 21562 1050 ----
NM_014575chr33539 485 120 ------
NM_014577chr221288 ------
NM_014583chr31462 ------
NM_014584chr1431242 487 447 21017 248 ----
NM_014586chr21134095 4064 4002 3817 3542 3411 1667 1569 1404 841 677 491 125 ----24454 4172
NM_014612chr931527 1516 313 ------
NM_014613chr552911 1126 923 496 422 32725 2619 2570 1997 13018
NM_014614chr271364 1172 1072 520 458 421 399 11373 ----
NM_014615chr16113587 3558 3395 3166 3136 2964 2749 2705 593 288 186 22650 2366 --165
NM_014616chr3113390 3020 2816 2793 2730 2546 2203 884 549 193 88 --23265 1331 --
NM_014630chr15113910 3595 3166 2580 1110 571 438 321 204 137 120 ------
NM_014633chr111443 1560 ----
NM_014636chr9103528 2959 2914 2898 1623 1511 1429 1085 1076 863 ----13472
NM_014637chr841445 1399 1224 535 1590 ----
NM_014649chr19146 ------
NM_014655chr182334 2263 1750 1717 1543 1482 330 322 --1184 --
NM_014659chr15242 21 ----1356
NM_014660chr721085 1051 21031 325 ----
NM_014666chr53366 338 26 1325 1391 --
NM_014671chr741435 1280 348 97 11339 ----
NM_014676chr12498 488 11496 ----
NM_014679chr1141403 1283 1222 391 ------
NM_014682chr822151 1729 ------
NM_014683chr1721531 1510 ------
NM_014686chr1962374 1638 374 316 207 185 1523 11823 --
NM_014689chr22153 43 1213 ----
NM_014690chr7112611 2416 2302 964 856 538 401 345 311 138 39 ------
NM_014701chr1553357 3311 3304 2379 1286 --1941 --
NM_014702chr682921 2396 2319 2193 896 886 108 66 1766 ----
NM_014705chr772128 2060 2025 1635 1346 553 205 1364 22036 753 --
NM_014707chr752213 2115 2094 2078 447 1339 ----
NM_014709chr2----1115 --
NM_014711chr1651734 1614 389 113 62 --1712 --
NM_014720chr1031564 1165 283 ------
NM_014721chr686922 6720 5985 5628 1645 644 90 63 26322 5065 55758 5326 5233 2797 972 --
NM_014729chr831977 1639 220 --21887 324 --
NM_014730chr1283449 1446 1405 572 424 391 320 269 --44813 1438 932 885 13461
NM_014730chr1283449 1446 1405 572 424 391 320 269 --44813 1438 932 885 13461
NM_014733chr592221 1935 1794 1741 1481 1409 905 872 729 1488 ----
NM_014737chr20124112 4017 3513 2806 2632 1164 1047 1004 402 181 148 141 12851 ----
NM_014739chr654162 3970 2811 391 360 13156 ----
NM_014743chr442888 874 854 472 13104 12655 --
NM_014746chr274254 3392 1756 1585 1343 639 558 1511 ----
NM_014747chr1164696 4464 4343 4270 2291 2023 1950 1691 1642 1427 1390 1016 913 905 600 331 14072 --15245
NM_014752chr1151882 1590 407 127 43 11777 133 --
NM_014755chr2134136 3926 3915 3849 3776 3514 3372 3116 3026 1409 1403 1135 272 --11456 --
NM_014764chr1221111 88 11306 ----
NM_014766chr772658 1385 879 758 613 334 121 --21259 158 --
NM_014781chr831288 347 196 ------
NM_014782chrX2286 28 1132 1347 --
NM_014795chr221375 60 --11350 --
NM_014797chr6113168 3051 2768 1328 925 907 797 685 224 73 59 12552 12457 --
NM_014802chr122949 134 --1924 --
NM_014803chr1062646 924 758 576 532 105 ------
NM_014810chr1103035 2748 2328 1308 1095 774 337 305 198 28 --1917 13071
NM_014819chr562357 885 796 725 614 193 22000 228 ----
NM_014824chr1131419 769 99 22028 167 21767 564 --
NM_014826chr1114002 3805 3402 2966 1418 1389 1047 1018 563 424 95 --11663 --
NM_014827chr171454 1138 1045 687 618 132 79 --2398 153 --
NM_014829chr572327 2182 1981 1920 1662 622 463 ------
NM_014830chr12103393 2865 2846 2811 2692 2678 2609 2449 2435 2385 --1708 23702 1023
NM_014832chr1371753 1554 1353 799 710 425 91 --21915 1619 --
NM_014835chr2062261 1709 1519 437 394 110 ----1616
NM_014839chr111909 12359 1320 --
NM_014841chr661397 1266 846 298 204 78 132 ----
NM_014850chr384526 4407 4115 3661 3280 1800 1672 1660 24794 1515 11939 --
NM_014862chr1554232 3931 3771 2957 1147 22638 946 24132 1266 --
NM_014864chr184388 3901 3588 2832 1591 1505 959 206 --12970 1916
NM_014872chr972174 2062 1880 1857 209 172 47 1633 22243 2218 --
NM_014873chr183767 3730 3617 3365 1105 873 773 605 33872 3306 1958 14412 23558 3528
NM_014877chr17117371 7347 6642 6350 5765 5685 5438 3048 2968 1280 1238 12693 27026 2217 --
NM_014883chr452128 1854 1601 788 774 ----2966 363
NM_014887chr132683 41 1859 --1243
NM_014893chrY52146 2020 1853 1519 579 ------
NM_014899chr562930 2378 2320 1228 839 531 1607 13127 --
NM_014903chr1262364 2301 2056 1971 1656 154 ------
NM_014904chr1071571 1403 1365 1293 1097 962 841 12853 12977 --
NM_014906chr1753536 3193 3141 1533 427 --13098 --
NM_014912chr1042898 2534 1056 597 ------
NM_014918chr1531143 230 149 ------
NM_014920chr643739 2545 185 130 ----11522
NM_014923chr1362096 1824 1792 1508 769 544 ------
NM_014924chr1462696 2283 2143 2081 760 408 ------
NM_014932chr33320 217 203 21734 601 ----
NM_014934chr13153939 3784 3594 3378 3117 3100 3049 2943 2554 1399 1157 869 698 452 360 ------
NM_014939chr1831250 207 49 31526 1458 579 --11572
NM_014946chr263003 2572 2403 2356 1049 139 --11188 11932
NM_014947chr152342 2200 892 632 421 1157 11976 --
NM_014949chr1--1979 ----
NM_014950chr142678 86 ----11243
NM_014952chr1561880 1601 1553 1473 297 67 11633 ----
NM_014953chr1333630 544 57 23282 224 ----
NM_014961chr471858 1548 1479 454 259 126 67 1235 ----
NM_014962chr2042834 1764 800 312 --22769 335 --
NM_014969chr13863 77 56 ------
NM_014978chr1011479 ----11797
NM_014982chr14145365 5317 5306 4594 4515 4489 3812 3504 3354 2148 2111 2065 2058 1022 14280 24852 1159 --
NM_014988chr452475 992 564 127 114 ----1252
NM_014991chr453190 3154 3083 1149 1096 32760 2508 149 --12209
NM_014992chr145879 623 556 333 185 ------
NM_014997chr752811 2434 2400 2120 279 32025 533 336 12096 --
NM_014999chr1231377 1240 1039 --21478 1078 --
NM_015000chr1293095 2720 2504 2389 2224 2008 1103 852 95 22757 1128 ----
NM_015002chr1261873 1593 1531 573 476 219 --11673 --
NM_015008chr3113390 3249 3092 2772 2330 972 780 562 467 321 81 ------
NM_015017chr121213 873 21233 1134 ----
NM_015020chr1673084 3035 2425 1476 1327 1061 911 33278 3028 488 11453 --
NM_015024chr81486 11181 ----
NM_015025chr262691 2126 920 417 288 101 1185 11789 --
NM_015026chr1264029 3727 1642 1346 983 910 --33982 189 142 --
NM_015027chr1691940 1768 1691 1466 1405 1380 757 482 143 133 ----
NM_015032chr1371803 1050 902 852 781 646 294 22953 81 ----
NM_015035chr20186547 5465 5330 5131 5085 4952 4858 4752 4658 4624 4521 4424 4097 2575 1304 1180 940 763 15612 12673 15657
NM_015039chr1104201 4153 3478 3271 3070 1747 1168 1071 870 820 --13434 11684
NM_015040chr2103382 3219 2972 2489 2448 2263 2190 1134 471 416 12741 ----
NM_015042chr15104207 3919 3741 3612 3415 1692 1517 1254 651 428 14356 ----
NM_015044chr16143137 2895 2885 2565 2476 2459 2357 2205 2105 2012 1976 1148 685 626 23065 980 11252 --
NM_015045chr1042131 556 494 85 ----11597
NM_015051chr953302 2815 2233 2220 705 32336 440 106 ----
NM_015061chr93878 616 195 1578 ----
NM_015068chr793407 3202 1505 1442 1179 691 303 127 111 ------
NM_015071chr5216536 6464 5647 5636 5128 4763 4693 4685 4249 2514 1855 1646 1427 1387 1355 1253 834 815 507 426 360 14306 24501 1636 1283
NM_015074chr1124170 4040 3905 3830 3332 1559 1457 1443 1270 1252 651 535 ------
NM_015076chr684481 3862 1571 1463 1353 1229 1040 710 1735 12955 --
NM_015090chr1176214 6202 5655 5073 4833 4745 2169 2135 2013 2005 1955 1398 1360 1271 808 505 437 --12092 --
NM_015092chr1664587 4463 4245 3040 617 248 14567 --14024
NM_015093chr631319 528 339 ------
NM_015097chr321632 1450 --11734 --
NM_015115chr452733 2329 372 321 144 12515 21150 932 1682
NM_015120chr2--187 ----
NM_015122chr19--1217 ----
NM_015130chr451206 1130 1032 862 119 --11091 --
NM_015138chr1542489 2094 2076 717 11074 --12006
NM_015143chr451482 1362 1340 464 169 ------
NM_015144chr16103899 3502 3467 3388 2568 2521 2486 1288 1015 355 1134 12932 --
NM_015153chr61766 ----1640
NM_015156chr1433936 3298 1523 --13502 12820
NM_015170chr882111 1946 1888 1711 583 421 415 126 --1380 --
NM_015172chr151447 1354 1316 640 376 1497 1603 --
NM_015173chr431731 691 669 ------
NM_015176chr13480 386 130 11531 11264 --
NM_015191chr1132734 2639 516 ------
NM_015192chr2062778 2419 2092 1920 795 747 32197 953 828 ----
NM_015198chr741144 460 422 164 1232 ----
NM_015199chr3102826 2246 2096 2026 1988 1979 1104 806 609 195 --12675 --
NM_015200chr452523 2497 466 131 87 ------
NM_015206chr1583698 3680 3006 2624 1552 1308 915 133 33229 1106 282 12847 --
NM_015208chr1873200 3047 1534 1409 1213 979 967 --11521 --
NM_015215chr1103164 3133 3079 2997 2855 2790 2423 1140 920 475 22554 2341 ----
NM_015216chr541463 1216 1124 568 ------
NM_015226chr1643226 1112 776 698 22854 1150 2174 146 --
NM_015230chr461811 1767 1756 1200 201 174 ------
NM_015236chr441213 389 302 59 --1491 --
NM_015239chr92513 221 ------
NM_015245chr682770 2624 2435 2176 1891 964 640 94 11995 12566 --
NM_015247chr16185130 4652 4645 4352 3729 3678 3270 3264 2095 2046 1874 1712 1657 1165 678 485 256 170 13359 11197 14059
NM_015260chr1961569 1247 457 380 196 84 11618 ----
NM_015263chr1541133 456 410 296 2137 121 ----
NM_015268chr33675 558 510 ------
NM_015269chr1----1589 --
NM_015270chr1221768 314 --42189 1758 1699 1558 22053 1495
NM_015271chr4104270 3401 1225 1193 1047 875 730 713 214 136 ------
NM_015277chr1861819 1783 1515 1295 755 118 1657 21345 1200 --
NM_015291chr193365 3314 2173 1345 1243 877 461 238 189 --12584 --
NM_015293chr62648 237 ------
NM_015299chr14123819 3803 3786 3502 3253 3128 2756 2439 1599 1483 1312 391 11617 33902 1303 109 --
NM_015310chr8217725 7447 7345 7297 7095 7089 6941 6232 5682 5620 5598 3073 2941 2742 2504 2495 2198 1952 1433 1103 650 12322 47398 3210 2125 2116 --
NM_015313chr11104356 3212 3192 1586 1135 1068 1057 772 694 465 --11181 --
NM_015315chr5153500 3083 2993 2844 2636 2523 2350 2158 2151 1068 1001 940 755 324 106 1135 43345 3144 3104 2534 --
NM_015317chr232643 2358 1774 11892 1212 --
NM_015323chr61314 21175 1084 ----
NM_015335chr1282683 2424 2207 2198 1869 827 434 208 --12224 --
NM_015338chr2061720 1674 1334 367 317 233 ----1646
NM_015347chr1252190 936 755 467 207 1788 ----
NM_015349chr662899 2763 2708 2152 977 722 ------
NM_015355chr1731925 761 287 11574 ----
NM_015358chr2131168 536 238 ------
NM_015365chrX54087 4016 3947 2929 553 11625 21251 494 --
NM_015367chr2221566 609 --21269 1195 --
NM_015375chr1164527 4315 4180 4153 4125 4089 3886 3441 3355 1933 1550 1354 890 664 175 159 ------
NM_015385chr1073232 3079 2791 721 439 381 297 11081 22010 1261 --
NM_015393chr483456 3401 3267 2718 2652 2334 796 602 1882 ----
NM_015396chr341083 574 516 500 ------
NM_015409chr122837 308 12044 12200 12721
NM_015416chr121975 ------
NM_015423chr1121615 211 ------
NM_015431chr1133618 3119 2888 2702 2557 2461 2325 1225 1021 1014 679 559 46 ------
NM_015435chr81272 ------
NM_015436chr442749 1246 478 195 23187 1258 ----
NM_015446chr11508 ----11689
NM_015455chr563860 2804 812 438 292 55 33605 2703 1097 11135 --
NM_015458chr8115200 4884 4641 4462 4414 4384 3586 3438 2046 1006 96 25335 4400 --14296
NM_015461chr182738 732 1511 1679 1617
NM_015463chr21785 ------
NM_015465chr51145 1518 ----
NM_015475chr23965 767 82 --164 1321
NM_015503chr161194 ------
NM_015520chr372745 763 708 613 556 445 156 22470 2354 ----
NM_015525chr64953 886 789 289 1258 ----
NM_015526chr1971372 1284 1266 1138 514 405 78 --3359 344 69 1219
NM_015532chr1532182 928 175 21882 193 ----
NM_015535chr274056 3341 2804 1500 1466 543 442 --13482 --
NM_015542chr102419 73 ------
NM_015548chr62886 392 ----11011
NM_015553chr654802 4572 4503 1988 884 11684 24656 1648 --
NM_015554chr1562769 2505 2249 2051 592 352 ----1463
NM_015555chr631194 267 37 ------
NM_015557chr1153365 3326 3289 3143 2642 1405 1391 1147 1108 1079 1054 961 768 759 348 12529 ----
NM_015564chr5103554 3455 3358 3073 2319 2294 2173 1309 900 636 ------
NM_015565chr214697 559 68 29 ------
NM_015568chr20104276 3658 2939 2869 2802 1667 1519 909 761 46 23445 2669 --12910
NM_015569chr194848 4804 3646 3531 3513 3359 1936 1065 975 23750 1374 14398 --
NM_015571chr632571 1714 1022 --1739 --
NM_015575chr281410 1376 1298 1067 966 656 642 531 --22394 581 --
NM_015576chr393005 2843 2686 2068 2026 2005 340 321 137 22020 58 ----
NM_015601chr10----1843 --
NM_015605chr1051353 1339 1024 182 59 21363 529 11305 --
NM_015608chr103614 540 186 1647 ----
NM_015609chr162847 2404 1195 1103 773 159 --12950 --
NM_015626chr175449 423 390 274 187 --1821 --
NM_015627chr191570 1538 1453 1417 643 553 425 318 124 ----1210
NM_015630chr23788 275 61 --1263 1229
NM_015640chr194952 4611 4237 4165 3257 2012 638 312 137 15123 13834 14088
NM_015646chr12137 --11290 --
NM_015660chr72118 81 1300 ----
NM_015678chr1331488 1450 627 ------
NM_015691chrX72804 2489 706 476 370 217 71 ------
NM_015713chr863072 2266 2231 1402 1159 636 ----11186
NM_015833chr214937 614 258 73 1316 --1370
NM_015878chr862235 2061 2016 1870 903 29 12185 ----
NM_015879chr18148613 7518 7431 7145 6964 6684 5873 3456 2998 2469 2025 1548 565 416 21209 60 ----
NM_015885chr111652 ------
NM_015888chr163282 2953 2565 1102 634 523 22302 215 ----
NM_015891chr661991 1830 1592 1291 727 692 11474 11398 --
NM_015906chr154331 1701 1306 521 125 --23727 1329 23972 3628
NM_015907chr4--168 ----
NM_015915chr141121 --1287 --
NM_015995chr15114880 4619 4448 4382 4301 3710 3528 3406 1503 1290 1247 --25384 3511 --
NM_016009chr1154236 4095 4049 3956 3850 3716 3554 3140 3132 1680 1141 642 606 479 297 ------
NM_016018chr872581 2334 2059 1147 1107 1032 848 ----1887
NM_016019chr73671 217 144 ------
NM_016021chr6102998 2478 2352 2142 2130 1933 798 789 611 601 ------
NM_016023chr872050 1587 1542 1483 861 388 283 151 ----
NM_016025chr1671962 1910 1834 1824 1349 681 524 1615 ----
NM_016040chr142704 2659 432 233 1456 ----
NM_016047chr21121 ------
NM_016070chr172252 52 ------
NM_016072chr1252347 1972 595 562 262 22402 820 ----
NM_016075chr1373123 3091 2972 2788 2352 1113 1106 ------
NM_016076chr173109 3086 2206 945 558 535 234 1610 12628 --
NM_016078chr171839 11073 ----
NM_016083chr663953 3594 3409 1580 1048 880 --13157 1949
NM_016087chr731392 1225 131 ----21353 354
NM_016094chr32640 31 ------
NM_016101chr1641210 240 161 87 --1534 --
NM_016103chr51149 --178 --
NM_016120chrX21043 131 1474 1112 11126
NM_016121chr15934 923 878 373 61 ------
NM_016144chr5186 ----1687
NM_016173chr3123884 3878 3865 3783 3302 3019 2919 1774 1273 1224 1156 1087 24075 3089 24056 154 --
NM_016201chr342026 913 887 739 --1531 --
NM_016203chr76973 737 264 220 175 38 --1429 --
NM_016205chr471439 1423 1166 978 578 448 144 ------
NM_016206chr3158443 8248 6898 6820 6393 5446 2940 2665 2608 2085 2064 1047 728 711 667 --27151 2331 --
NM_016218chr521211 1155 1301 ----
NM_016220chr711981 21868 1848 22186 809 --
NM_016227chr141558 1427 549 495 11108 ----
NM_016231chr1761552 1499 1417 1206 1127 1074 --21588 1214 --
NM_016248chr1353672 3501 2636 1502 1414 23640 83 ----
NM_016252chr24806 724 706 309 ------
NM_016255chr642457 636 568 135 23092 2598 2812 155 23205 2561
NM_016260chr2137515 6636 6521 6484 6260 5498 5352 4673 2684 1691 1210 538 435 --11197 14906
NM_016264chr19154 ----1479
NM_016271chr1832218 449 290 1728 ----
NM_016272chr2272599 2491 1114 891 801 626 443 12256 --1546
NM_016282chr951787 1588 1107 487 243 ------
NM_016289chr262044 1776 868 468 369 256 ----1664
NM_016308chr12790 25 ----139
NM_016315chr241895 393 311 289 1108 ----
NM_016316chr22584 558 ------
NM_016322chr943083 2294 2127 1141 ------
NM_016373chr163688 339 292 ----1868
NM_016374chr121601 602 ------
NM_016374chr121601 602 ------
NM_016376chr1794319 4226 4009 3426 3291 3180 2838 1209 509 11532 12966 --
NM_016377chr651574 1536 1326 290 59 --11351 --
NM_016396chr1532105 1981 593 ------
NM_016422chr1183177 2902 2348 2312 2103 1140 888 548 --1267 --
NM_016424chr172748 156 ------
NM_016426chr2272166 1824 1739 1503 570 273 25 ------
NM_016436chr2082212 1870 1777 1688 936 286 253 92 ------
NM_016441chr232301 1886 419 --32232 1534 454 --
NM_016448chr151725 1304 1174 352 260 11509 --11887
NM_016451chr113199 101 22 1113 ----
NM_016467chr241241 1089 205 40 11026 ----
NM_016470chr20--1535 ----
NM_016472chr1411305 21509 154 ----
NM_016494chr2----152 --
NM_016507chr1792509 2100 2038 1257 1212 612 425 63 23 1539 1201 --
NM_016513chr643739 2545 185 130 ----11522
NM_016525chr93786 724 163 --1923 --
NM_016530chr1553698 3610 3191 643 57 11549 ----
NM_016531chr4104062 3973 3531 3183 3132 2659 1631 567 127 119 --31534 1222 550 --
NM_016546chr1231179 426 63 --1299 --
NM_016575chr12145505 5480 4091 3937 3568 1677 912 806 623 580 368 333 264 77 14835 1820 --
NM_016577chr3164151 2889 2832 1610 1414 1337 1318 1301 1223 1068 1002 963 869 723 713 570 --1978 --
NM_016584chr121268 ------
NM_016589chr33502 430 317 ------
NM_016591chr5--162 ----
NM_016603chr562257 1740 790 706 400 49 --1751 --
NM_016607chrX51486 1435 457 195 146 1103 1576 --
NM_016612chr82570 478 --1668 --
NM_016620chr121244 33 1149 ----
NM_016621chr1194298 4221 4107 3889 3078 1504 957 872 698 ------
NM_016626chr1841801 1265 283 207 ------
NM_016628chr102593 187 ------
NM_016630chr151213 ------
NM_016631chr211774 ------
NM_016641chr1681711 1443 1338 587 302 226 212 144 --11739 1617
NM_016654chr1571276 1139 956 497 200 146 57 ------
NM_016656chrX176 --1142 --
NM_016824chr1041549 572 280 200 ------
NM_016831chr1102338 2321 1612 1459 963 645 397 231 102 71 11842 ----
NM_016836chr21120 ------
NM_016839chr21120 ------
NM_016946chr193593 2939 2695 1341 1143 758 653 216 208 1370 --22217 571
NM_016952chr11114063 3667 3616 3580 3507 3300 2937 1364 1101 743 258 12546 12668 1562
NM_016953chr2145553 5269 1965 1671 1569 1504 1475 1440 1345 1194 1185 776 146 42 --1432 16126
NM_016954chrX1601 ------
NM_017409chr121555 ----194
NM_017415chr5164323 3891 3823 3559 3526 3235 3049 493 468 447 385 294 215 193 81 58 --13266 --
NM_017420chr14103811 3783 3745 2843 2810 1523 1461 1322 1104 619 12647 ----
NM_017423chr461649 697 372 338 116 69 ------
NM_017437chr1421847 1764 1503 --1297
NM_017443chr971202 1171 569 247 215 114 42 1184 --11213
NM_017450chr1731464 439 32 11497 ----
NM_017455chr153818 641 31 ------
NM_017489chr81844 11195 11034 2862 488
NM_017540chr592965 2604 2399 2151 2061 1292 803 620 303 --1177 --
NM_017544chrX5891 698 683 285 49 ----1991
NM_017548chr372145 2007 1803 840 594 442 86 1387 ----
NM_017577chr341487 554 261 55 11673 1297 --
NM_017588chr961913 1541 1461 1417 1216 135 --11470 11888
NM_017594chr963155 3142 2859 2647 1092 583 ------
NM_017596chr1134456 4388 4344 3561 3363 3342 2865 2846 1274 1262 623 326 262 --34699 3734 3331 13441
NM_017599chr1231932 1332 153 3480 221 142 ----
NM_017610chr151532 22033 673 ----
NM_017628chr494385 3676 3375 1478 1264 1054 234 180 45 24941 4469 15103 --
NM_017629chr181936 1725 1683 1599 1351 271 236 136 ------
NM_017633chr643875 2892 2457 837 13529 ----
NM_017634chr851747 1344 706 405 250 ------
NM_017637chr9139231 8995 8080 7672 6963 6060 3078 2443 1704 1611 1513 1348 196 --23306 1492 17875
NM_017640chr6----1316 --
NM_017641chr1271135 1010 343 299 257 124 30 ------
NM_017644chr333579 1232 1142 33520 3395 3258 14471 --
NM_017650chr7135863 5118 4942 4892 4569 4469 4394 4262 2295 1643 1635 1111 393 1143 12088 --
NM_017658chr1484514 4407 4326 4020 417 246 111 76 44010 1780 1275 558 --21718 1130
NM_017664chr132125 79 11080 ----
NM_017672chr151114 11075 ----
NM_017684chr1551731 1480 811 781 239 ----1527
NM_017693chr1341566 1548 1389 611 --11471 --
NM_017705chr15103776 3678 2969 2772 2630 1510 1132 784 484 125 23116 1262 23538 2496 13444
NM_017709chr182633 2621 1145 929 890 718 706 658 --13252 --
NM_017715chr71168 ------
NM_017736chr1652846 2015 2001 1986 607 1642 12142 --
NM_017737chr171869 1717 1605 1577 1514 1445 667 ------
NM_017742chr1831495 740 317 1291 11974 --
NM_017753chr91397 ------
NM_017754chr6145048 4835 3866 3265 2010 1725 1206 1156 877 846 742 561 466 450 2976 90 14622 --
NM_017769chr1423095 944 --23054 1059 --
NM_017770chr662629 2185 2096 945 173 68 ------
NM_017778chr851422 1251 1118 209 160 ------
NM_017786chr8------1469
NM_017791chr1431385 1027 388 ------
NM_017798chr2071219 1192 1137 1108 998 908 424 --21208 1052 --
NM_017799chr1481817 1735 1579 1545 1416 426 283 51 ------
NM_017811chr962971 2454 1154 728 344 211 ------
NM_017813chr885832 4526 4112 3782 1692 1548 285 52 45842 5594 5245 523 ----
NM_017816chr4125 ------
NM_017831chr18144611 4204 4045 4031 3946 3375 3188 1884 1876 1563 1153 738 60 35 --24188 4132 --
NM_017832chr941169 1084 989 871 ------
NM_017848chrX94533 3039 3004 2981 1642 1534 1324 1190 444 --1524 13885
NM_017896chr2052897 2744 2606 1410 859 --11327 --
NM_017902chr1055569 2067 1678 1470 441 11216 24078 1740 --
NM_017907chr113434 418 160 --1428 --
NM_017910chr2129 ------
NM_017911chr2241473 1213 1153 29 ------
NM_017919chr9165815 5787 5393 5199 4778 4667 4651 3863 3835 2169 2028 1809 1524 607 267 44 25126 1734 35527 1874 359 15827
NM_017925chr961393 611 344 225 184 164 11940 ----
NM_017926chr141328 ------
NM_017929chr2221206 258 11253 ----
NM_017933chr231555 1196 1168 ------
NM_017935chr43749 729 546 --168 --
NM_017938chrX62132 1924 1871 1644 1563 517 ------
NM_017945chr3132 --1435 --
NM_017954chr721312 551 --1140 --
NM_017964chr22964 671 --1891 1786
NM_017972chr141328 ------
NM_017988chr121275 ----1286
NM_017994chr763025 2896 2477 2456 2310 2085 --32764 299 77 --
NM_017998chr941036 459 116 96 ------
NM_018000chr241766 1713 338 124 ------
NM_018003chr1552268 1732 1597 297 184 11853 1243 --
NM_018004chr31150 ------
NM_018017chr1062864 1953 1782 1061 660 238 22535 2488 ----
NM_018018chr1221689 68 ------
NM_018024chr84487 448 439 141 ------
NM_018027chr1093160 3124 2613 2430 2407 886 785 582 254 --130 --
NM_018030chr1811067 1369 1392 --
NM_018043chr1141241 1168 577 362 11519 ----
NM_018045chr192960 2718 2680 2281 2015 538 437 344 136 ----1372
NM_018046chr521951 499 21782 669 ----
NM_018054chr166713 582 268 201 186 166 ------
NM_018061chr141488 1154 273 31 ------
NM_018078chr44848 714 83 49 ------
NM_018084chr2103167 2861 2142 2122 1310 1242 745 626 213 83 22129 281 22887 195 --
NM_018098chr34848 438 236 151 ------
NM_018112chr93671 369 166 3995 888 245 ----
NM_018117chr105636 511 318 275 33 ------
NM_018120chr841231 1048 372 167 1416 ----
NM_018121chr1072906 2345 1165 972 728 491 170 --21226 905 1129
NM_018124chr1662137 1631 533 416 390 21 ------
NM_018131chr102819 72 --1673 --
NM_018155chr363091 2582 2407 1364 863 463 --23449 797 --
NM_018157chr1283132 2718 2700 2659 2547 695 376 294 ----1825
NM_018169chr121545 ------
NM_018171chr123925 868 803 ------
NM_018176chr441493 1311 505 101 --1528 --
NM_018178chr142006 1935 384 66 21782 475 2601 113 --
NM_018181chr1841700 1288 531 384 --1349 --
NM_018182chr1751950 1845 1743 1464 463 174 32169 2060 304 --
NM_018195chr11112149 2140 1691 1681 1610 809 620 337 299 220 96 ------
NM_018201chr992368 2143 1898 930 827 784 748 452 95 1975 32398 2159 1653 12528
NM_018202chr11310 1860 ----
NM_018214chr641321 1123 520 355 1845 ----
NM_018221chr21344 ------
NM_018243chr493179 2771 2643 1524 635 583 448 261 152 --12542 1388
NM_018247chr642718 2233 747 687 11238 12608 --
NM_018254chr142201 1690 981 821 --11717 --
NM_018257chr2052225 525 478 88 45 1516 --12469
NM_018263chr23738 618 314 ----12566
NM_018264chr72961 61 ------
NM_018268chr53622 63 37 ------
NM_018287chr103338 253 37 21020 304 1232 --
NM_018293chr342865 2489 1105 835 ------
NM_018299chr883068 2954 2491 2143 1241 1012 733 605 --12406 --
NM_018307chr174771 681 290 55 ------
NM_018312chr1142137 1646 1388 719 1534 11731 --
NM_018313chr391900 1763 1672 1642 1636 935 799 736 696 --22542 1817 1517
NM_018318chr123922 683 68 ------
NM_018319chr1461610 1357 569 325 281 74 ------
NM_018320chr112975 869 11252 --11134
NM_018323chr441811 1399 394 134 1498 ----
NM_018334chr7----1408 --
NM_018340chr16135031 4733 4064 3978 3841 3763 3605 1965 1594 933 677 302 215 1262 1163 --
NM_018342chr431708 1648 1276 11741 ----
NM_018351chr12124606 4310 3568 3546 3280 1719 1697 1472 1337 656 478 245 ------
NM_018361chr853731 3505 3369 1466 794 22885 2737 183 --
NM_018362chr1142751 1561 1548 1190 ----13735
NM_018364chr123605 1456 --11316 11096
NM_018367chr1132331 1030 706 ------
NM_018370chr1232235 1977 1759 --1128 --
NM_018372chr12729 84 2279 98 ----
NM_018373chr1486487 6069 4331 1823 1414 1207 1166 771 --26235 5635 24685 4611
NM_018374chr774959 3848 3594 1581 1442 1068 371 13372 1209 --
NM_018381chr192822 328 1591 ----
NM_018383chr292016 1910 832 759 699 677 599 104 23 --1125 --
NM_018386chr132237 117 ------
NM_018387chr91176 ------
NM_018388chrX21418 238 11183 --11300
NM_018398chr31292 ------
NM_018400chr11124606 4181 3668 3497 1478 1311 1216 578 488 306 40 32 34066 3376 903 33541 3126 815 --
NM_018403chr373929 2947 2694 1555 1216 787 100 1662 ----
NM_018424chr981882 1610 1437 710 677 457 415 118 11761 ----
NM_018425chr1082684 2527 2480 2132 1646 636 511 306 --22081 874 --
NM_018427chr1631347 160 148 ------
NM_018429chr552826 2680 2287 1848 1796 22250 123 11778 --
NM_018434chr5139 ------
NM_018440chr8188501 8077 7700 7399 7349 7135 6804 6339 6086 5449 3195 2161 2128 1621 718 649 449 113 28558 2700 47186 5988 2804 196 13348
NM_018441chr22568 150 ------
NM_018444chr872038 1821 1534 543 279 253 221 11813 --1315
NM_018448chr1241294 1019 996 51 1861 ----
NM_018452chr6_random93252 2897 2481 2372 1467 1408 724 717 588 21485 134 --22384 819
NM_018460chr2--2165 23 ----
NM_018462chr32891 543 ------
NM_018475chr4--1675 ----
NM_018490chr1131884 595 246 11329 ----
NM_018557chr241584 442 258 137 ------
NM_018566chr1155023 4893 4730 4718 4123 4092 1921 1209 907 794 782 532 514 275 107 13943 ----
NM_018569chr43607 329 161 ------
NM_018571chr23668 542 97 ------
NM_018590chr1071357 1303 1093 1081 590 518 471 --1445 --
NM_018593chr64738 646 228 41 ------
NM_018638chr12115145 4879 4362 4222 4189 4141 1820 1439 592 484 165 12033 14252 14135
NM_018640chr1272791 2730 2502 2247 2112 228 187 21790 98 22542 2368 --
NM_018650chr131728 1389 61 --1321 --
NM_018652chr151172 ------
NM_018662chr194225 4070 3488 3473 3158 693 665 650 214 11384 23111 91 --
NM_018695chr552434 2155 497 434 197 12471 ----
NM_018703chr162356 293 ------
NM_018704chr181731 721 642 547 483 393 332 71 1168 --1811
NM_018710chr81448 21209 207 ----
NM_018712chr1151284 1051 357 88 32 11419 ----
NM_018717chr4122784 2765 2566 1990 1915 1876 1100 1085 1036 881 688 551 ------
NM_018834chr51405 --1723 --
NM_018840chr204394 309 173 120 ----1485
NM_018841chr193323 3127 1590 889 869 796 683 138 62 11285 23351 3338 --
NM_018844chr751797 1712 759 730 353 11411 ----
NM_018846chr71226 --1265 --
NM_018847chr971629 1527 1462 1445 1429 775 169 21850 1804 ----
NM_018890chr71327 --11517 --
NM_018896chr171315 ------
NM_018898chr532354 1859 1527 ------
NM_018899chr532354 1859 1527 ------
NM_018900chr532354 1859 1527 ------
NM_018901chr532354 1859 1527 ------
NM_018902chr532354 1859 1527 ------
NM_018903chr532354 1859 1527 ------
NM_018904chr532354 1859 1527 ------
NM_018905chr532354 1859 1527 ------
NM_018906chr532354 1859 1527 ------
NM_018907chr532354 1859 1527 ------
NM_018908chr532354 1859 1527 ------
NM_018909chr532354 1859 1527 ------
NM_018910chr532354 1859 1527 ------
NM_018911chr532354 1859 1527 ------
NM_018945chr693496 2972 2597 2517 2487 1465 991 597 101 11088 11207 --
NM_018947chr7144934 4487 4328 4194 3519 3166 1981 1689 1645 1509 1478 1392 1172 187 --23793 669 --
NM_018948chr121197 1071 21442 1297 ----
NM_018963chr2161251 611 500 347 288 31 11226 --1946
NM_018976chr1232204 1944 133 22544 411 1347 --
NM_018979chr1222443 1793 22158 22 1388 1867
NM_018981chr25973 899 492 411 343 ------
NM_018983chr43277 99 88 ------
NM_018999chr10144931 4165 4023 4011 3621 3436 1950 1698 1677 1577 1505 510 394 154 23963 3466 14572 --
NM_019004chr722131 1554 2204 127 1146 --
NM_019006chr153691 525 156 ------
NM_019008chr22143701 3559 3360 3185 2821 1346 975 920 710 687 587 463 424 279 --144 --
NM_019022chr1863173 3091 3080 2684 196 62 2683 282 ----
NM_019027chr482424 2097 1807 1710 675 631 132 101 ------
NM_019030chr52199 65 ------
NM_019035chr441792 1406 593 74 22070 132 --11605
NM_019044chr2134721 3969 3934 3269 3107 2957 2877 1599 1510 1461 1160 947 82 21811 324 24661 128 --
NM_019045chrX2928 828 ------
NM_019050chr4159 2371 298 11645 --
NM_019071chr71146 --1153 --
NM_019072chr514090 24255 2866 11417 11617
NM_019083chr121069 282 --1217 --
NM_019084chr1042180 2025 1950 1805 1141 11880 --
NM_019087chr541679 636 591 38 ----11654
NM_019094chr1282964 2809 2405 1160 1083 904 592 101 22578 2478 ----
NM_019114chr962466 1793 1668 833 568 22 ------
NM_019116chr16103716 3587 3461 3187 2942 2825 2736 1288 1132 263 --178 23743 3049
NM_019117chrX43149 3011 2665 1375 21112 55 ----
NM_019555chr36690 586 551 530 280 233 ------
NM_019556chrX71216 1124 1099 206 105 41 25 ------
NM_019558chr21364 ------
NM_019592chr93629 333 162 --1901 --
NM_019593chr2093018 2895 2817 2485 2443 2190 2083 587 361 --11014 --
NM_019597chrX--164 ----
NM_019845chr23620 211 167 ----1568
NM_019854chr123734 126 99 1619 ----
NM_019857chrX4654 430 82 49 51791 1525 1186 614 512 ----
NM_019859chr1061586 1501 1451 354 262 71 1460 ----
NM_019860chr1071634 1549 1499 1042 402 310 119 1508 ----
NM_019903chr1041549 572 280 200 ------
NM_020116chr451674 1583 1540 472 25 ------
NM_020122chr2145840 5502 4894 4445 4131 4023 3689 2344 2324 2293 1593 1571 1487 1103 46047 4182 2357 517 45729 1847 881 531 15048
NM_020123chr1021476 508 ------
NM_020133chr6156080 5465 4930 4214 4065 2527 2360 2233 1901 1884 1560 795 780 760 363 --44377 4128 1845 1634 15027
NM_020140chr12----164 --
NM_020144chr751851 673 530 334 226 --12012 --
NM_020159chr451365 1057 256 219 161 31466 367 230 1545 --
NM_020177chr543091 3037 2247 2142 --12714 --
NM_020179chr112491 339 1518 ----
NM_020182chr2083615 3562 3314 2831 2523 495 247 165 ------
NM_020199chr531290 1256 186 21313 826 1895 --
NM_020204chr1--1275 ----
NM_020205chr162911 2523 2176 528 488 185 12182 12463 --
NM_020228chr1151843 719 547 447 58 1501 22116 21 --
NM_020235chr31142 ------
NM_020239chr182045 1609 367 304 264 193 90 32 --22088 325 --
NM_020240chr571851 1032 913 804 769 174 84 ----12693
NM_020245chr674668 4174 4042 3754 3469 3457 3293 13905 14127 --
NM_020248chr1152349 2177 2110 1997 1815 1484 853 833 800 737 725 548 503 335 73 --21776 27 --
NM_020307chr31112 ------
NM_020336chr2093847 3608 3558 3199 2835 1349 1009 663 646 --13286 --
NM_020337chr4133140 3061 2935 2672 2633 2204 2063 2034 1234 1072 811 650 60 ----1910
NM_020341chr201610 1604 11271 --
NM_020342chr252523 2190 1863 1744 935 --21655 576 --
NM_020357chr321276 1061 1609 ----
NM_020382chr1251597 642 443 192 74 ------
NM_020390chr3134132 4095 4051 3961 3679 3544 3333 3267 1488 1138 941 197 37 1871 ----
NM_020409chr31320 1327 --143
NM_020420chrY2458 172 1134 ----
NM_020432chr732064 1644 64 11957 1468 --
NM_020443chr1186781 6382 6227 6059 5498 4931 4641 4577 4458 2379 2071 1873 1816 1495 1313 709 671 387 25239 1541 24509 2034 25859 5677
NM_020455chr632516 567 400 32751 2017 513 ----
NM_020456chr1342237 1444 363 153 --21585 902 --
NM_020466chr6144899 4764 4635 1971 1777 1757 1683 1617 1386 1225 1193 864 602 497 11840 --11069
NM_020474chr1811750 1725 11369 11814
NM_020630chr10288 66 1269 ----
NM_020640chr352273 1882 870 636 494 12157 ----
NM_020651chr251476 288 219 211 194 ------
NM_020665chrX3136 127 67 1549 ----
NM_020673chr20137180 7128 6304 5777 5477 2206 1725 1563 1195 975 738 485 47 --11528 57703 6088 5759 5161 1476
NM_020698chr1282171 2164 1203 1110 999 809 607 317 13125 33025 2574 1237 --
NM_020699chr1115041 4927 4791 4210 3830 3569 1658 1647 1408 1171 574 34999 4430 2170 134 15146
NM_020708chr2052453 2178 1872 649 134 21792 1645 1836 11909
NM_020714chr1954480 4316 3453 1139 293 14629 --24091 3780
NM_020715chr1462126 1973 1592 1437 657 45 12214 --11813
NM_020718chr16176547 6258 6181 5819 5552 5355 5142 4904 4859 4532 2184 2176 2113 2070 1518 896 827 11425 ----
NM_020727chr2153297 2984 2681 877 125 13812 152 --
NM_020734chr1252996 2733 2167 906 462 22308 591 12552 --
NM_020739chr1584193 4091 3484 3240 2751 1453 1085 365 34031 3822 637 ----
NM_020742chrX42215 1920 593 362 12378 ----
NM_020747chr52914 35 --1723 1783
NM_020748chr172759 82 12154 11951 1691
NM_020752chr1042851 2186 773 682 ------
NM_020760chr241884 439 350 337 ------
NM_020766chrX124415 4196 3399 3249 3117 1745 1294 1036 974 955 506 292 --11768 --
NM_020768chr582981 2768 2730 2096 2077 932 926 368 ----11066
NM_020771chr611408 ----1966
NM_020772chr17138300 7623 7411 7028 6499 6268 6130 5418 2395 2327 1709 1522 552 38683 541 261 12450 15614
NM_020774chr1876103 6030 4765 4390 2306 2168 562 35811 4536 1648 1655 24020 1320
NM_020776chr1832049 718 507 33041 2336 139 ----
NM_020782chr12113747 3677 1840 1772 1441 1307 1261 1085 888 163 150 24781 664 ----
NM_020783chr1862138 1826 805 772 633 136 --12187 --
NM_020794chr131492 1353 552 --11192 --
NM_020795chr1781854 1363 754 716 459 450 350 193 --11380 11654
NM_020796chr532458 2439 2431 1860 12479 12279
NM_020800chr331157 1024 1017 ------
NM_020801chr542263 2030 523 199 12565 ----
NM_020805chr1841353 1289 703 165 ------
NM_020806chr141126 ------
NM_020810chr14103603 3408 3052 3045 2574 2513 1426 1044 837 800 23647 1311 12280 --
NM_020819chr61773 11042 ----
NM_020821chr1551731 1480 811 781 239 ----1527
NM_020830chr243015 2027 861 218 12307 --12430
NM_020841chr1263788 3250 3102 1326 1259 1093 13004 ----
NM_020843chr152406 379 --1167 --
NM_020844chr8197601 6759 6457 6449 6038 5494 5177 4949 2502 2445 2418 1805 1641 1511 1413 1190 734 537 234 57133 6935 5140 5117 162 174 16661
NM_020854chr1861513 1486 1433 1028 583 67 ------
NM_020858chr1552043 1944 1759 329 198 --1962 --
NM_020859chr441052 922 466 59 34007 3382 704 13027 --
NM_020861chr621151 181 21386 1315 165 --
NM_020868chr251972 1953 1749 1534 1267 1155 11681 --
NM_020870chr461772 774 683 417 333 199 12224 ----
NM_020871chrX42467 2225 192 162 32477 2279 365 ----
NM_020899chr1781981 1762 632 472 407 332 130 46 12278 31743 1666 303 --
NM_020909chr294146 3789 3770 2655 1380 1166 650 219 178 23982 933 12935 --
NM_020918chr1083476 3385 3267 2816 2528 1399 368 128 13076 12709 --
NM_020919chr25815 455 389 159 26 11081 2486 406 --
NM_020925chr11212 11344 --1467
NM_020926chrX--1114 ----
NM_020935chr2123900 3853 3595 3482 3244 2884 1809 1721 1628 1571 1241 431 24087 3735 ----
NM_020948chr1113040 2839 976 797 521 446 438 301 224 113 94 33525 2738 260 ----
NM_020952chr9--1886 183 --
NM_020956chr19144592 3793 3585 3470 3338 1552 1528 1432 1354 1272 1261 269 260 196 --33202 1186 238 --
NM_020977chr461587 1359 806 379 153 69 22150 1483 --12079
NM_020980chr1551486 1124 513 230 87 21312 408 --11740
NM_020983chr1221768 314 --42189 1758 1699 1558 22053 1495
NM_021005chr151849 1824 1872 --
NM_021007chr222303 1784 1543 21877 965 --
NM_021033chr1342741 1177 438 295 21087 163 124 --
NM_021045chr1052354 1940 1925 330 313 1112 ----
NM_021061chr8104511 4374 3695 3502 3409 3128 2818 1821 1749 210 --14015 --
NM_021069chr452038 1330 855 633 63 --11359 12074
NM_021090chr22105058 4468 4348 4278 3397 3315 1137 1036 861 147 24684 4423 14727 --
NM_021101chr352480 2283 2094 904 104 --21629 669 --
NM_021111chr931229 1120 51 31112 1077 86 ----
NM_021116chr7239057 8447 8336 8167 7528 7156 6970 6442 6116 5539 3167 3021 2995 2850 2270 2259 1711 1529 1475 1397 819 593 244 48968 7961 5764 949 ----
NM_021120chrX103073 2885 2820 2720 2704 1106 853 834 780 453 ------
NM_021148chr732250 1937 375 1638 --11945
NM_021156chr2041074 986 734 373 1946 194 --
NM_021183chrX61853 1788 1747 950 766 660 21690 1002 12166 --
NM_021190chr11459 ------
NM_021191chr1272408 2380 2181 1818 520 460 420 11943 ----
NM_021202chr20122829 2718 2599 2284 1962 879 872 822 626 490 341 176 ----22376 1183
NM_021205chr1112880 2305 2287 2208 2157 2036 1906 1886 924 866 308 11953 ----
NM_021224chr9136 ------
NM_021229chr1241193 965 239 123 ----11131
NM_021238chr1271475 1426 1409 471 396 363 45 22103 452 11834 --
NM_021239chr1451418 1392 1261 187 64 11324 ----
NM_021249chr1471567 1471 1315 1305 558 407 351 1502 ----
NM_021252chr1021376 362 22111 1678 --21757 1697
NM_021255chr1443469 3137 2916 867 22776 1528 11459 --
NM_021574chr22112511 2008 1721 797 389 341 233 165 87 41 22 --11528 2992 413
NM_021622chr1032231 1597 237 12252 21541 542 --
NM_021629chr3134866 4773 4133 4106 3744 3617 3380 1914 1034 882 633 487 453 24010 3560 1469 --
NM_021637chrX1417 ------
NM_021638chr494970 4949 3988 3945 3308 1754 1704 1343 336 --21711 380 11106
NM_021643chr231755 1320 646 193 11547 --
NM_021648chr672736 2521 2115 1976 1959 1008 540 22544 2018 12198 --
NM_021809chr2092441 2415 2331 2110 1940 1910 1792 1001 474 ----21831 1740
NM_021813chr6155819 5801 4475 3656 3584 2298 1905 1597 1438 1427 1362 1312 1143 866 361 ----11064
NM_021814chr62611 298 11312 --11672
NM_021818chr141163 11472 ----
NM_021825chr112391 307 1351 ----
NM_021911chr545619 1951 1706 450 12045 25551 250 --
NM_021912chr15113874 3647 3603 3590 3385 2874 2855 2787 683 653 43 --13259 --
NM_021914chr1451879 1694 347 339 25 3738 680 188 ----
NM_021922chr6294 50 1741 --1720
NM_021940chr621629 1420 --11249 --
NM_021949chrX102859 2643 2202 2061 1936 1833 1063 832 621 21 ------
NM_021954chr13113180 3035 2610 2327 1069 1059 789 697 479 222 93 33531 3163 1475 23668 2974 --
NM_021956chr661520 1116 564 509 445 246 ------
NM_021961chr1196717 6630 5910 2998 2671 1338 960 706 295 ----16763
NM_021964chr3146672 6209 6014 5996 5894 4916 4819 4809 4740 4695 4685 4041 1870 1427 36196 1789 413 16571 --
NM_021967chr531367 1236 1147 ----1479
NM_021977chr693881 3841 3505 2927 2414 1464 1165 505 454 23005 1327 ----
NM_021988chr2021474 1060 --11195 --
NM_022041chr1632622 973 338 --1869 --
NM_022048chr1575505 5163 4729 4425 1997 1561 958 14647 1992 25467 4847
NM_022068chr182213 41 ------
NM_022073chr1421288 456 21648 662 2616 51 --
NM_022079chr10----1843 --
NM_022093chr12280 188 1709 ----
NM_022114chr164512 3585 3472 3366 1162 1028 14474 --13544
NM_022123chr14190 ------
NM_022124chr101621 ------
NM_022130chr541486 1461 1419 1011 ------
NM_022160chr92215 172 ------
NM_022166chr16136071 6038 5541 5430 5367 4699 4526 1939 1286 986 899 625 71 --11360 --
NM_022334chr28819 767 711 431 375 319 112 35 ------
NM_022351chr843412 3009 2946 847 13561 12406 --
NM_022368chrX275 46 ------
NM_022373chr72715 181 2841 684 ----
NM_022374chr2131 1174 ----
NM_022442chr2021474 1060 --11195 --
NM_022454chr85702 303 271 166 57 ------
NM_022456chr12217590 6935 6321 6017 5991 5414 5316 5199 4961 2854 1550 1517 1427 1352 1227 1195 756 402 280 258 25 155 46856 6399 6297 638 --
NM_022457chr1--1283 ----
NM_022458chr773032 2327 2245 2111 1967 636 410 22393 1122 --11951
NM_022459chr13166202 5894 5481 4329 4145 3866 2349 2198 1849 1731 1607 820 556 232 123 51 35374 4763 2287 26159 5362 --
NM_022461chr321196 217 11234 11135 --
NM_022465chr1232118 783 247 --1601 --
NM_022474chr1442676 2621 2312 1776 --3736 572 141 --
NM_022476chr164986 952 443 84 1273 ----
NM_022482chr2082271 2248 2204 2154 2015 828 504 131 --11752 --
NM_022484chr721324 898 11423 ----
NM_022491chr1283581 3016 2667 1388 1001 614 420 321 12684 ----
NM_022494chr102190 47 ------
NM_022496chr12----1107 --
NM_022497chr382857 2769 2724 2481 370 298 174 100 ------
NM_022566chr151457 ------
NM_022648chr2154565 3848 3840 3491 3360 2939 2902 1811 1787 1257 1092 1039 898 515 80 --23691 2875 --
NM_022658chr1241177 895 294 42 --21200 305 --
NM_022716chr1142879 2618 2479 2455 2309 2263 2140 2024 1257 846 798 706 592 507 ------
NM_022719chr22113685 3556 2516 1458 1397 1106 1051 942 450 349 232 13589 ----
NM_022730chr221002 996 ------
NM_022733chr111113 ------
NM_022735chr131894 1444 701 --11609 --
NM_022739chr173487 439 251 1427 ----
NM_022745chr182981 2562 1868 1162 1092 896 394 188 13012 12061 --
NM_022753chr152683 2207 1865 491 286 1501 21097 168 --
NM_022755chr951835 453 176 50 31 32627 2337 270 1383 --
NM_022758chr6143168 3139 2945 2912 2819 2689 2109 2066 2050 1008 782 704 195 80 ------
NM_022763chr382952 2942 2861 2362 1230 1009 386 191 12274 11202 --
NM_022766chr2272687 2616 1967 933 884 851 373 --12193 12587
NM_022771chr1221103 61 1680 ----
NM_022776chr33499 297 82 --2247 127 --
NM_022780chr231884 467 40 --11499 --
NM_022781chr963110 2945 2894 1224 1024 925 1664 12404 --
NM_022783chr82760 157 ----1752
NM_022784chr151146 ----1826
NM_022787chr182751 2565 2513 2506 1097 876 575 46 11811 22662 2598 --
NM_022802chr1051540 1509 1196 564 322 ------
NM_022828chr531520 305 54 1631 11742 1364
NM_022831chr161688 663 529 507 303 21 --11410 --
NM_022836chr141537 1368 522 375 11455 ----
NM_022841chr1551952 1797 1094 483 441 22714 2403 --11000
NM_022842chr3122738 2707 2691 2672 2468 2354 2286 1227 1029 380 127 29 1203 4991 731 313 281 --
NM_022893chr252927 2254 1059 1036 259 --1665 --
NM_022894chr23498 341 134 --21597 1356 --
NM_022898chr14104318 3449 2974 1913 1843 1606 1364 545 364 296 ------
NM_022912chr252918 2545 1135 865 851 --1844 13080
NM_022918chr1141689 457 221 44 ----1783
NM_022977chrX41658 928 726 486 ------
NM_022978chr531367 1236 1147 ----1479
NM_023012chr121511 ------
NM_023016chr272718 2454 2121 1879 935 854 238 153 1332 12787
NM_023035chr193867 717 303 ------
NM_023071chr1251062 1044 893 440 223 11142 ----
NM_023076chr1662866 1150 868 699 555 280 --13031 --
NM_023923chr1143477 3457 3234 3149 2894 2578 2440 1368 901 790 691 589 273 141 13305 22563 1231 --
NM_023929chr832150 2143 75 1104 --12458
NM_023948chr7--1172 ----
NM_024007chr582946 2938 2716 2619 2563 2538 810 677 13049 ----
NM_024019chr441085 944 778 102 ------
NM_024045chr10--1188 ----
NM_024052chr1782993 2466 2438 2393 2061 2043 1141 1126 --33023 2867 2359 --
NM_024061chr7--1551 ----
NM_024077chr93720 110 49 ------
NM_024081chr112952 815 1702 ----
NM_024104chr1961074 1024 897 760 385 211 11066 1983 --
NM_024293chr21839 ------
NM_024294chr6143168 3139 2945 2912 2819 2689 2109 2066 2050 1008 782 704 195 80 ------
NM_024295chr861917 1597 1341 732 667 109 21536 286 ----
NM_024296chr11115 ------
NM_024345chr9116153 5890 5177 4918 4633 4297 3985 1739 1391 1003 917 21204 435 12042 --
NM_024408chr173355 2971 2875 2579 2283 717 406 12313 22517 419 --
NM_024416chr931608 380 180 11614 ----
NM_024422chr183598 437 23 --11716 11957
NM_024423chr1894211 3751 2592 1666 1471 953 866 647 329 24045 505 24109 1486 --
NM_024429chr76973 737 264 220 175 38 --1429 --
NM_024501chr21614 --2647 546 --
NM_024511chr443077 2872 940 844 --12492 --
NM_024524chr362636 2255 2212 1117 1027 1021 12118 --12579
NM_024525chr13581 158 135 1129 ----
NM_024529chr141116 961 858 455 ------
NM_024532chr2146 ------
NM_024539chrX31172 480 25 ------
NM_024541chr1091876 1814 1641 1505 1343 1254 465 392 365 ------
NM_024548chr351754 1667 1319 257 166 11146 ----
NM_024558chr141367 1847 1209 --
NM_024570chr131235 ------
NM_024574chr41168 ------
NM_024576chr6--1171 ----
NM_024582chr41198 11012 ----
NM_024590chr471788 1651 1599 1579 1410 482 314 --1270 --
NM_024594chr531518 1282 122 1356 11427 --
NM_024607chr8113923 3540 3503 3102 2943 2762 1779 1719 1645 1500 1255 --24001 3059 --
NM_024624chr251512 1448 1429 158 102 21267 584 ----
NM_024629chr43975 436 61 --1336 --
NM_024631chr111186 ----1438
NM_024635chr91223 ------
NM_024639chr692954 2803 2728 2292 2103 1972 982 624 298 ------
NM_024646chr172931 2714 2485 2429 1550 1521 26 --33137 1484 531 --
NM_024659chr25988 375 351 339 46 --1391 --
NM_024665chr3104712 4702 4551 4385 3911 3154 1590 362 168 92 11048 23850 2934 14273
NM_024669chr52460 343 1383 ----
NM_024670chr1041184 637 491 160 --31771 1715 1093 --
NM_024674chr143070 2629 975 958 --12999 22212 306
NM_024686chr13414 361 59 ------
NM_024692chr221725 1494 ------
NM_024713chr1561603 1426 1308 1211 305 48 --11339 --
NM_024715chr541786 1522 142 100 ----11232
NM_024721chr882418 2264 1938 1063 884 778 313 200 --12023 12336
NM_024740chr1184005 3792 3607 3327 1331 738 591 357 23352 1618 --13051
NM_024744chr24964 428 283 258 --1702 --
NM_024749chr172205 1901 1597 847 354 141 127 ------
NM_024761chr9104922 4238 3314 1904 1604 561 453 181 139 55 25061 1964 14092 14650
NM_024770chr2146540 6410 5396 5153 4740 4701 4235 2601 2553 2113 1806 732 543 226 16690 --44749 1540 1302 1009
NM_024780chr1631016 740 453 1788 1191 1415
NM_024785chr261075 956 947 425 203 50 11545 21103 327 --
NM_024811chr1111490 --11214 --
NM_024817chr15165394 5333 5251 5106 4837 4614 4608 3844 1591 1493 1457 1191 1022 858 733 402 13688 11620 --
NM_024818chr341469 1370 251 52 --1118 --
NM_024824chr1441545 1440 567 143 ------
NM_024828chr931284 521 21 ----1235
NM_024837chr1551292 568 496 341 288 ------
NM_024854chr1241317 567 504 479 --11534 --
NM_024884chr1474475 4467 3965 3406 2989 1659 572 23444 1531 11224 11047
NM_024899chr182552 211 --1110 --
NM_024913chr73256 206 22 ------
NM_024920chr431539 1165 126 31460 1265 113 11432 --
NM_024942chr1031360 1078 183 11502 11392 --
NM_024944chr2151329 891 517 85 40 ------
NM_024945chr931176 1011 868 ------
NM_024947chr3139534 9225 8627 7874 7030 3518 3124 2663 2180 1820 1488 1471 1351 36757 3435 1002 17844 --
NM_024949chr4134983 4740 4652 4503 4252 4056 3802 3479 3371 3284 1515 1441 123 11705 34262 3227 797 --
NM_024953chr1242804 2647 1805 919 21823 370 11113 --
NM_024960chr204534 363 100 26 ------
NM_024971chr9--1886 183 --
NM_024989chr2178200 7176 7071 7034 6977 6783 6745 6662 5437 5180 5042 4971 1995 1456 848 580 409 48226 6722 6429 5546 25731 3191 11052
NM_024991chr1073232 3079 2791 721 439 381 297 11081 22010 1261 --
NM_024993chr241466 1167 322 200 ------
NM_025040chr1931601 1571 309 21758 255 ----
NM_025054chr8114026 2901 2794 1474 1221 1215 1165 1118 451 342 196 13143 1441 --
NM_025057chr143957 355 155 ----169
NM_025073chr154199 3535 1817 303 199 --14250 13492
NM_025074chr442499 2388 1983 617 32996 2280 989 1430 --
NM_025076chr22205 130 ------
NM_025125chr1051593 1360 1217 616 564 ----21613 181
NM_025133chr241043 312 282 228 ------
NM_025134chr1642476 1699 597 188 1354 ----
NM_025141chr152531 189 ------
NM_025146chr362743 2545 2078 1967 915 192 --12149 --
NM_025154chr7--11414 ----
NM_025160chr1134122 4073 3970 3903 3465 3410 3203 1449 923 899 426 225 133 11425 13816 --
NM_025164chr1142122 1740 801 622 --11635 11555
NM_025179chr1104974 4448 4320 4222 1255 1187 1034 668 570 114 --11483 --
NM_025182chr92999 263 --1101 --
NM_025184chrX--1226 ----
NM_025191chr151175 1123 1046 824 741 1317 11418 --
NM_025208chr1182332 2164 1989 1539 814 459 134 32 12352 ----
NM_025211chr91106 ------
NM_025214chr1872639 1993 901 614 552 279 58 12755 22606 2259 --
NM_025221chr43446 381 203 --121 --
NM_025222chr352451 1909 907 687 316 --12605 --
NM_025230chr1481680 1656 1519 441 353 341 308 151 ------
NM_025235chr1021680 274 1381 --11592
NM_025238chr1531604 1303 1109 ------
NM_025248chr17132987 2978 2748 1170 1160 1064 910 631 470 413 351 123 109 --12170 --
NM_030579chr1683373 3129 2804 2669 2633 2342 755 616 --12543 --
NM_030621chr1473542 3371 2726 2691 1618 1565 1428 33639 1667 463 ----
NM_030625chr1052308 2178 2111 649 440 11787 ----
NM_030627chr564152 3882 3330 2916 1450 893 --13361 --
NM_030637chr143487 174 129 --1251 --
NM_030647chr7146336 6320 6008 5419 5326 4958 4460 4279 3817 2447 1824 237 86 62 --32035 1657 267 12424
NM_030648chr4135529 5231 4403 4188 4134 2140 2124 1783 1317 1306 1006 980 31 11860 11456 14982
NM_030660chr1431392 1385 1319 ------
NM_030674chr12125675 5415 5151 4370 4233 3648 1571 1514 799 553 526 367 22363 1235 25614 434 15470
NM_030762chr122648 552 ------
NM_030763chrX2924 280 ------
NM_030773chr2051865 1614 718 383 207 ------
NM_030782chr5----139 --
NM_030786chr171932 1837 1672 617 594 307 210 --11718 11738
NM_030791chr1451726 727 700 674 494 ------
NM_030806chr1178859 8851 8550 7883 7604 7207 6751 5924 3712 2861 2560 2510 2254 1199 969 716 597 12302 37440 6691 6246 19298
NM_030809chr1272448 2083 1789 1621 1599 768 738 --22253 646 --
NM_030816chr152910 2829 525 376 116 --1715 --
NM_030817chr1273399 2575 1418 1386 948 496 347 13039 21057 617 12481
NM_030820chr62893 89 1264 ----
NM_030881chr2282362 2051 1917 1557 694 686 417 385 ------
NM_030918chr1145026 4730 4503 4348 3590 3493 1774 1768 1601 1416 1039 973 247 60 1366 34757 3735 1908 11948
NM_030922chr153721 333 71 152 ----
NM_030925chr1362095 2089 1987 1463 343 153 1750 ----
NM_030934chr131812 712 587 11557 --1439
NM_030964chr5103723 3247 3034 2762 2335 908 763 222 97 34 1451 1337 --
NM_031157chr121524 1617 ----
NM_031226chr1541291 1161 1133 1092 ------
NM_031243chr731982 1688 1564 ------
NM_031267chr7------187
NM_031268chr1695159 4268 4261 3736 3492 3368 1437 936 455 23538 2124 35212 4664 4481 --
NM_031275chr11----1134 --
NM_031291chr41672 ------
NM_031314chr1431785 1386 408 ------
NM_031362chr272328 618 417 396 347 267 234 22731 922 ----
NM_031365chr272464 754 553 532 483 403 370 22867 1058 ----
NM_031366chr272464 754 553 532 483 403 370 22867 1058 ----
NM_031371chr121601 602 ------
NM_031371chr121601 602 ------
NM_031411chr532354 1859 1527 ------
NM_031427chr14175953 5833 5695 5331 5195 5123 4502 4332 4084 2325 2181 2136 2098 2057 1237 825 407 ----14466
NM_031435chr1282776 2690 2629 2546 1341 602 120 105 13505 12758 --
NM_031442chrX21084 476 12771 --12126
NM_031453chr1072442 2286 1905 1777 1616 1010 84 11654 ----
NM_031461chr831890 347 55 ------
NM_031468chr7177624 7250 6662 6622 6256 6242 6196 6190 5912 3143 3078 2714 2529 2132 1869 1716 1297 17032 ----
NM_031469chr6124016 3852 3434 3343 3008 1558 1533 807 742 732 433 245 --1389 23307 1348
NM_031483chr2073420 2587 1275 930 600 550 114 12438 ----
NM_031844chr1103866 3843 3575 3549 3462 2897 2508 1327 1243 745 --24073 964 --
NM_031845chr252931 2918 379 331 310 --13176 2831 544
NM_031847chr252931 2918 379 331 310 --13176 2831 544
NM_031849chr532354 1859 1527 ------
NM_031857chr532354 1859 1527 ------
NM_031860chr532354 1859 1527 ------
NM_031890chr2283071 2989 2758 2712 2108 1906 660 402 --21048 597 12473
NM_031904chr1182115 1542 855 639 436 403 347 62 12003 1586 11758
NM_031905chr741150 1101 1046 839 2370 38 ----
NM_031911chr482711 2336 2105 957 709 568 219 39 12163 1288 --
NM_031914chr143895 342 330 2932 701 ----
NM_031935chr15324 261 188 107 83 ------
NM_031940chr862291 2043 1934 496 419 52 --1398 --
NM_031942chr22400 280 --21162 81 --
NM_031966chr51136 ------
NM_032021chr1111061 ------
NM_032028chr52138 57 ------
NM_032042chr582433 2205 2121 1062 981 672 478 304 11934 32810 2065 564 --
NM_032047chr341987 1533 862 38 --22376 49 12260
NM_032102chr1183078 2800 2575 2214 2080 841 703 85 ------
NM_032105chr1177955 7857 7748 7532 7075 5858 5729 5660 5583 5310 5229 3033 2733 2128 1874 993 611 45084 3233 2745 1093 --17292
NM_032121chrX52678 2378 2081 859 530 ------
NM_032124chr1841127 374 157 29 ------
NM_032144chr231838 1493 1305 21690 543 1489 --
NM_032145chr651758 1410 1328 1258 427 11565 ----
NM_032148chr121448 ------
NM_032153chr352649 2614 1122 186 172 12299 1390 --
NM_032154chr1041000 958 757 240 ------
NM_032160chr18104122 3475 3058 2810 2646 1177 1034 761 640 220 --11603 13735
NM_032169chr32692 74 ------
NM_032174chr171278 1054 944 917 481 283 43 11493 --11255
NM_032175chr53593 197 33 ----11788
NM_032182chr1031279 1104 388 ------
NM_032186chr121244 33 1149 ----
NM_032199chr1073533 2874 2765 2678 2641 1382 319 ------
NM_032208chr293645 3568 3325 3173 3028 1258 1209 412 327 ------
NM_032221chr2022009 1302 ------
NM_032228chr11113402 3384 3322 3230 3039 2948 2868 2753 2539 1148 1044 ------
NM_032246chr153512 259 251 ------
NM_032268chr16123112 2916 2818 2718 2498 2285 2279 2253 2016 1270 720 163 ------
NM_032288chr362346 906 567 177 55 47 ------
NM_032291chr131360 355 303 11955 ----
NM_032293chr9--1264 ----
NM_032303chr941816 1689 1497 151 ------
NM_032307chr92341 127 ------
NM_032321chr293290 2934 2550 2171 2156 684 257 215 99 23137 47 12112 --
NM_032329chr2133804 3735 3630 3087 2923 2814 2770 1645 1507 1459 1211 565 133 --13094 --
NM_032373chr10105117 4718 4568 4549 4089 1827 1527 1396 688 440 1292 ----
NM_032379chr112248 60 170 ----
NM_032438chr641404 604 502 352 1578 ----
NM_032439chr1021601 441 ------
NM_032440chr1042955 2698 2691 159 22799 936 ----
NM_032441chrX41095 441 156 30 ------
NM_032445chr1562067 405 313 128 76 53 21699 40 2807 227 --
NM_032446chr583706 3491 2660 2442 2424 1296 862 337 2574 354 ----
NM_032457chr443212 2781 1317 822 --13261 --
NM_032458chrX53159 3140 2760 2436 511 12513 ----
NM_032466chr851620 1606 1543 1351 139 --1302 --
NM_032468chr851620 1606 1543 1351 139 --1302 --
NM_032490chr145766 560 504 270 217 --1527 --
NM_032499chr1531543 1441 97 21233 1147 --11584
NM_032505chr322208 1993 11937 ----
NM_032509chr842321 2270 946 653 21906 988 22239 266 --
NM_032510chr181686 11931 22238 226 11714
NM_032547chr42934 268 1103 ----
NM_032578chr1021502 1245 1138 ----
NM_032582chr1741315 652 441 122 ------
NM_032590chr1241117 1080 948 200 ------
NM_032601chr22208 36 ------
NM_032626chr16--196 ----
NM_032632chr1451905 1523 1377 443 292 11290 ----
NM_032663chr1261741 1571 1490 765 292 179 ------
NM_032679chr1961094 1060 986 475 382 198 ------
NM_032682chr372594 1409 1358 1312 1284 742 137 ------
NM_032689chr1931167 380 77 ------
NM_032727chr1031575 196 75 1139 ----
NM_032778chr3123363 2958 2500 2481 2390 2346 2250 2101 2087 574 291 66 --12820 --
NM_032802chr15287 75 ------
NM_032804chr104920 895 456 265 12312 ----
NM_032810chr1071400 1333 1247 479 216 206 129 21482 449 ----
NM_032830chr16130 ------
NM_032832chr641460 663 420 251 172 ----
NM_032833chr172515 2480 1996 1815 1039 396 47 ------
NM_032836chr199860 682 411 266 257 251 122 54 43 ------
NM_032857chr151235 ------
NM_032858chr1126 1337 ----
NM_032859chr1383879 2878 2764 1309 1024 716 615 95 11446 1470 --
NM_032869chr861905 1805 1415 441 213 54 1434 ----
NM_032870chr6149 --1533 --
NM_032873chr1163941 3658 3061 2788 1661 498 ------
NM_032875chr172802 614 133 ----
NM_032876chr14102218 2184 2177 2098 1690 830 726 619 355 273 --1477 --
NM_032892chr151289 ------
NM_032900chr1093921 3787 3374 2820 2471 1065 880 169 112 11494 13618 13097
NM_032918chr1231070 484 255 11038 --1207
NM_032943chr112248 60 170 ----
NM_032961chr451193 952 503 178 24 1115 ----
NM_032968chrX44112 3681 3414 2906 22748 1697 ----
NM_032969chrX44112 3681 3414 2906 22748 1697 ----
NM_032973chrY44104 3673 3410 2901 22743 1691 ----
NM_032975chr1863066 2300 1138 694 589 490 --23013 606 --
NM_032980chr1863066 2300 1138 694 589 490 --23013 606 --
NM_032993chr43277 99 88 ------
NM_033012chr1331053 397 378 --135 1777
NM_033014chr931608 380 180 11614 ----
NM_033020chr154331 1701 1306 521 125 --23727 1329 23972 3628
NM_033044chr13898 74 39 ------
NM_033055chr12794 65 ----1754
NM_033058chr84784 679 654 219 ------
NM_033071chr62648 237 ------
NM_033083chr363195 3007 2831 2744 2363 1312 --2803 696 1524
NM_033087chr91311 --2484 127 --
NM_033089chr2061095 975 601 586 445 172 21497 1020 1352 --
NM_033121chr121728 ------
NM_033132chr1351626 1582 895 83 66 --11752 11965
NM_033135chr1182332 2164 1989 1539 814 459 134 32 12352 ----
NM_033136chr541719 1381 1164 458 1550 1300 --
NM_033137chr541719 1381 1164 458 1550 1300 --
NM_033138chr741903 1727 664 304 11514 ----
NM_033139chr741903 1727 664 304 11514 ----
NM_033140chr741903 1727 664 304 11514 ----
NM_033143chr463636 3432 1253 663 403 229 13980 14155 1104
NM_033157chr741903 1727 664 304 11514 ----
NM_033181chr663953 3594 3409 1580 1048 880 --13157 1949
NM_033211chr551288 820 465 454 123 1154 1395 --
NM_033219chr9----136 --
NM_033222chr9--11125 ----
NM_033224chr7197784 7316 7016 6900 6586 6462 6328 5607 5163 3224 2512 1591 1405 1383 1092 1053 1033 676 315 37047 4938 2604 15840 15499
NM_033225chr882614 2589 2338 2275 1973 1214 897 462 ------
NM_033227chr52452 129 ------
NM_033228chr52492 169 ------
NM_033284chrY1138 --155 --
NM_033285chr8124461 4209 3936 3902 3794 3673 3283 3127 1497 1288 1017 146 ------
NM_033290chrX73701 3591 2779 2641 1188 769 675 1962 --12950
NM_033305chr93563 238 117 11201 1426 --
NM_033326chr1161869 865 585 557 426 260 ------
NM_033331chr983471 3452 3110 2903 2511 2447 1014 220 1158 ----
NM_033334chr91200 ------
NM_033338chr1041269 450 166 75 ------
NM_033339chr1041269 450 166 75 ------
NM_033340chr1041385 566 282 191 ------
NM_033360chr1294378 4085 3966 3881 3644 3410 3204 3153 469 34029 4000 363 13348 --
NM_033364chr371573 1437 1360 1304 1270 806 291 ------
NM_033389chr17134692 4446 4323 4206 3508 3359 1142 1086 1058 964 524 444 196 34881 3668 1806 --1944
NM_033393chr452880 2241 2124 1171 565 --1623 12198
NM_033396chr111428 ------
NM_033397chr1041878 891 353 261 --22062 309 1378
NM_033425chr1153281 2664 2627 807 563 ------
NM_033426chr1472964 2599 2292 2141 1899 981 585 --11992 --
NM_033429chr15112996 2987 2887 2519 2459 2244 2051 1099 965 356 35 11992 ----
NM_033430chr493484 3363 1595 1441 894 664 544 478 358 12912 11138 11057
NM_033437chr493484 3363 1595 1441 894 664 544 478 358 12912 11138 11057
NM_033484chr51647 1489 ----
NM_033505chr2136653 6625 6189 5814 5211 5099 4926 2263 1264 1032 742 525 145 45708 4900 1767 1064 21426 1281 12698
NM_033515chr631032 537 56 ----1938
NM_033516chr981606 1356 1245 1229 1111 616 521 406 --11488 --
NM_033535chr44906 865 850 405 ------
NM_033551chr5153500 3083 2993 2844 2636 2523 2350 2158 2151 1068 1001 940 755 324 106 1135 43345 3144 3104 2534 --
NM_033624chr1261873 1593 1531 573 476 219 --11673 --
NM_033631chr1113550 2782 2728 2520 2512 2413 1365 754 723 627 359 23446 2821 12378 --
NM_033642chrX158 ------
NM_033644chr562349 2123 2023 556 94 42 12105 ----
NM_033645chr562349 2123 2023 556 94 42 12105 ----
NM_033656chr2195955 5633 5280 4343 3937 3780 1591 1290 353 12368 25212 658 --
NM_052821chr961913 1541 1461 1417 1216 135 --11470 11888
NM_052827chr123722 326 101 ------
NM_052828chr671206 481 392 360 239 203 42 ------
NM_052832chr872600 2298 2162 1853 598 472 46 ------
NM_052845chr1292826 2776 2652 1100 734 703 663 446 88 13272 22583 2041 --
NM_052867chr133527 468 99 ------
NM_052879chr1263639 3053 2752 595 458 50 12926 --13123
NM_052886chr862026 1365 688 342 334 258 ----1849
NM_052898chr841562 1305 1258 208 ------
NM_052905chr221454 90 ------
NM_052906chr22115025 4927 4875 4360 3861 3618 3378 3295 1755 1527 1035 11942 13754 --
NM_052907chr12104113 3728 3331 3162 3003 2794 1596 909 435 49 --22946 408 --
NM_052910chr1321679 188 --1113 --
NM_052913chr621039 779 1447 ----
NM_052917chr252632 2169 549 482 85 13369 13187 --
NM_052918chr1093152 2927 2786 2764 1473 1311 1007 642 201 --23694 2716 --
NM_052927chr541496 820 382 66 --22172 276 1641
NM_052937chr862454 1883 1810 605 374 48 2982 539 11846 --
NM_052954chr2172204 1615 1604 1430 780 335 47 11851 ----
NM_052966chr153388 3114 2744 2553 32 1118 ----
NM_052978chr1431573 415 49 11833 2743 242 --
NM_052996chr1611453 11337 --165
NM_053002chr351016 846 793 299 200 ------
NM_053016chr9177894 7855 7399 7069 7038 6988 5910 5871 5124 3189 3049 2361 2197 1772 1706 167 125 32635 1930 875 --27007 2059
NM_053023chr1152944 2742 1010 842 353 --12722 13197
NM_053024chr331032 544 306 ------
NM_053025chr32621 478 --1332 --
NM_053026chr32621 478 --1332 --
NM_053027chr32621 478 --1332 --
NM_053028chr32621 478 --1332 --
NM_053031chr32621 478 --1332 --
NM_053032chr32621 478 --1332 --
NM_053042chr452295 1029 198 158 152 2449 311 22322 626 --
NM_054016chr131439 685 262 --11804 --
NM_054016chr131439 685 262 --11804 --
NM_054016chr131439 685 262 --11804 --
NM_054022chr171665 1724 ----
NM_057164chr23518 230 32 ------
NM_057165chr23518 230 32 ------
NM_057166chr23518 230 32 ------
NM_057167chr23518 230 32 ------
NM_057168chr731392 1225 131 ----21353 354
NM_057175chr462335 2292 1029 870 713 410 22322 2196 ----
NM_057178chr1782484 1952 1776 1088 1078 1029 314 148 --11938 --
NM_057182chr192175 100 ------
NM_057749chr831288 460 402 2358 251 1554 --
NM_058172chr431812 1772 300 ------
NM_058241chr272280 2192 1908 791 783 362 147 1329 11429 --
NM_058241chr272280 2192 1908 791 783 362 147 1329 11429 --
NM_058243chr191776 ------
NM_078467chr661366 1285 557 424 202 29 11494 1439 --
NM_078473chr862291 2043 1934 496 419 52 --1398 --
NM_078474chr152531 189 ------
NM_080491chr1173643 3329 3178 2928 2559 885 150 --12425 --
NM_080597chr1811067 1369 1392 --
NM_080599chr102419 73 ------
NM_080629chr141324 1287 1254 268 185 21034 445 --
NM_080630chr141324 1287 1254 268 185 21034 445 --
NM_080645chr642181 1683 1567 837 140 1180 --
NM_080651chr8--1240 ----
NM_080664chr1441492 1263 229 185 --1387 185
NM_080669chr17134962 3753 1901 1863 1715 1495 1300 1241 1153 1004 845 729 319 11427 14590 --
NM_080671chr262128 2074 2057 664 548 322 --12068 11644
NM_080683chr42383 145 ------
NM_080684chr42383 145 ------
NM_080685chr42383 145 ------
NM_080743chr662505 1996 1690 1621 679 672 ------
NM_080759chr1372684 1936 643 560 489 354 207 2658 303 1109 --
NM_080760chr1372684 1936 643 560 489 354 207 2658 303 1109 --
NM_080764chr2272254 1006 829 818 631 376 166 13173 12321 --
NM_080836chr20134698 4266 3352 3252 3152 2989 1719 1173 1062 1014 638 569 138 --23640 959 --
NM_080867chr1475039 4652 4458 3997 3495 1027 502 35080 1034 349 13244 1734
NM_080872chr8114042 3990 3859 3834 3437 2829 2754 1165 1009 818 661 11127 --11221
NM_080874chr451695 670 506 466 29 ------
NM_080921chr131017 464 402 ------
NM_080927chr383000 2994 2170 2119 2054 475 405 388 --12432 --
NM_100264chr102593 187 ------
NM_100486chr102593 187 ------
NM_130385chr1183124 2944 2922 2843 2609 616 599 453 22418 750 23212 2898 --
NM_130391chr963067 2533 327 237 199 22 ------
NM_130392chr963067 2533 327 237 199 22 ------
NM_130393chr963067 2533 327 237 199 22 ------
NM_130436chr2172821 2005 1838 808 651 623 150 12636 186 --
NM_130438chr21103398 2582 2415 2278 2204 2141 2123 1228 1200 727 13213 1663 --
NM_130466chr1271783 1774 1636 1538 620 442 330 ------
NM_130798chr1531503 1445 53 ------
NM_130830chr3113996 3683 2831 2637 1384 1266 1256 1224 1093 655 527 ------
NM_130838chr152540 532 1309 ----
NM_130839chr152540 532 1309 ----
NM_130846chr126969 864 794 352 213 109 1849 ----
NM_133170chr20108107 7534 6454 6418 2026 1850 1248 1186 1082 316 16870 ----
NM_133263chr51133 ------
NM_133264chr17103728 3535 3517 3414 3172 1002 966 820 177 77 ------
NM_133265chrX51007 998 754 660 246 12431 ----
NM_133329chr241591 1314 748 448 1738 21528 262 11388
NM_133330chr4113146 2703 2509 2398 2339 2255 926 766 664 348 224 --2475 264 --
NM_133331chr4113146 2703 2509 2398 2339 2255 926 766 664 348 224 --2475 264 --
NM_133334chr4116392 5670 5626 5553 5486 4378 4092 2028 1866 1426 1151 25722 1633 24875 2295 --
NM_133335chr4113146 2703 2509 2398 2339 2255 926 766 664 348 224 --2475 264 --
NM_133338chr52505 166 ------
NM_133339chr52505 166 ------
NM_133340chr52505 166 ------
NM_133341chr52505 166 ------
NM_133342chr52505 166 ------
NM_133343chr52505 166 ------
NM_133344chr52505 166 ------
NM_133370chr462237 1404 1320 1271 1249 213 12927 13140 --
NM_133371chr592278 2012 1953 1729 1661 1510 533 478 343 --22215 244 --
NM_133372chr532028 2020 108 1971 22368 2329 --
NM_133378chr22809 75 ----1663
NM_133432chr22809 75 ----1663
NM_133433chr52633 59 1768 ----
NM_133437chr22809 75 ----1663
NM_133478chr231613 926 791 ------
NM_133493chr684575 4298 4148 3498 2835 1144 1090 582 23919 3507 ----
NM_133494chr11116 ------
NM_133496chr184113 3380 2758 1586 1512 1268 334 200 1800 --13026
NM_133507chr123878 627 46 ------
NM_133646chr284789 4176 3985 3497 1830 1284 827 484 15309 24237 4042 --
NM_133650chr62648 237 ------
NM_134265chr175449 423 390 274 187 --1821 --
NM_134442chr241710 1186 123 61 1710 ----
NM_138270chrX42789 1059 511 408 23030 221 11325 --
NM_138285chr21402 ------
NM_138319chr1541264 1251 829 313 ----11121
NM_138333chr952207 2116 2081 1944 131 11672 22011 184 --
NM_138335chr4--1156 129 --
NM_138370chr2--1737 ----
NM_138391chr14394 335 154 81 1982 ----
NM_138423chr151652 --12275 --
NM_138444chr13144597 4543 4188 4107 4028 3867 3453 1440 1432 569 550 415 365 217 24464 3942 ----
NM_138448chr22370 111 1388 ----
NM_138458chr241011 724 412 338 ------
NM_138459chr6123208 3060 2839 2734 2600 2586 2378 1445 1079 736 646 479 13672 ----
NM_138468chr2105873 5098 3918 2384 2116 1898 923 900 848 667 1163 15785 --
NM_138473chr1274711 4587 3601 1207 1195 859 840 --1777 --
NM_138494chr752148 1874 881 255 165 ----12845
NM_138555chr152546 407 ------
NM_138576chr14104318 3449 2974 1913 1843 1606 1364 545 364 296 ------
NM_138633chr651574 1536 1326 290 59 --11351 --
NM_138638chr1451879 1694 347 339 25 3738 680 188 ----
NM_138694chr693332 2402 1281 1190 1181 1091 346 122 29 158 11303 --
NM_138713chr16146277 3189 3004 2775 2767 2544 2009 1809 1715 1140 1063 1024 806 48 25298 1894 ----
NM_138714chr16146277 3189 3004 2775 2767 2544 2009 1809 1715 1140 1063 1024 806 48 25298 1894 ----
NM_138717chr61536 1682 ----
NM_138730chr61329 ------
NM_138731chr1454005 1127 779 740 363 23294 730 ----
NM_138771chr731031 633 136 ------
NM_138785chr6------162
NM_138927chr211825 ------
NM_138971chr11103086 2975 2762 2713 2336 1353 887 291 277 36 12772 21153 536 --
NM_138971chr11103086 2975 2762 2713 2336 1353 887 291 277 36 12772 21153 536 --
NM_138972chr11103086 2975 2762 2713 2336 1353 887 291 277 36 12772 21153 536 --
NM_138972chr11103086 2975 2762 2713 2336 1353 887 291 277 36 12772 21153 536 --
NM_138973chr11103086 2975 2762 2713 2336 1353 887 291 277 36 12772 21153 536 --
NM_138973chr11103086 2975 2762 2713 2336 1353 887 291 277 36 12772 21153 536 --
NM_138980chr42725 703 ------
NM_138982chr42725 703 ------
NM_139012chr632182 2110 1649 12040 11830 1850
NM_139014chr642262 2190 1729 81 12120 11910 1930
NM_139045chr94809 577 561 34 1664 ----
NM_139057chr1552449 980 415 344 44 22938 2700 ----
NM_139068chr53550 190 119 ------
NM_139069chr53550 190 119 ------
NM_139136chr123398 368 134 1990 ----
NM_139168chr531414 443 384 21567 682 ----
NM_139169chr102282 43 12026 ----
NM_139182chr461811 1767 1756 1200 201 174 ------
NM_139201chr122713 84 ------
NM_139207chr1282221 1974 1833 1733 1380 733 344 197 1378 1654 --
NM_139242chr1541496 1405 1027 383 --1511 1211
NM_139246chr962255 2128 1628 455 269 186 1800 --1551
NM_139276chr1761888 1828 1712 794 788 92 ------
NM_139279chr263367 3354 2792 2560 1405 1306 23561 2498 12961 --
NM_139283chr1242590 1755 924 893 12095 1867 --
NM_139286chr91192 ------
NM_139321chr20144249 3874 3684 3624 3210 3183 3092 2995 2880 1293 1204 629 446 402 12591 11168 --
NM_139323chr2051798 1408 658 614 485 --1336 --
NM_144498chr2062261 1709 1519 437 394 110 ----1616
NM_144567chr162579 2276 1937 661 575 110 ------
NM_144570chr1673025 2948 2404 1159 647 624 521 ------
NM_144571chr4166701 6602 5907 5735 5674 5476 4935 4709 4431 2049 1811 1411 1169 782 415 344 25102 940 1446 16341
NM_144574chr141159 ----127
NM_144578chr1475031 4884 4604 4171 3910 1456 888 23804 268 33866 1881 1156 14495
NM_144583chr261302 1115 563 324 219 187 ------
NM_144586chr23458 212 194 1176 2500 72 --
NM_144590chr10122630 2342 1994 1885 1143 1123 1021 454 443 428 327 48 --22171 95 --
NM_144594chr12----1155 --
NM_144595chr133625 184 22 ----1270
NM_144599chr15115278 5026 4980 4665 4250 3858 2180 1617 509 407 264 31812 982 113 1676 --
NM_144618chr131586 1403 395 ----1658
NM_144629chr23878 846 103 1331 ----
NM_144632chr242135 1511 715 388 12016 --11932
NM_144642chr321380 107 ------
NM_144664chr111925 12050 12271 --
NM_144710chr261392 1350 1080 457 247 224 11129 --11273
NM_144718chr382492 2328 2306 1937 1914 1773 368 22 --1763 1919
NM_144721chr462102 1816 1760 789 738 399 11043 ----
NM_144732chr194901 804 759 194 11086 ----
NM_144767chr15134248 4220 3230 2884 1747 1405 1246 1229 1043 933 520 351 142 ------
NM_144778chr136744 658 643 585 488 234 ------
NM_144949chr262558 2240 2146 2015 1032 975 ------
NM_144969chrX3698 581 520 ------
NM_144973chr12135229 5212 5158 5108 4729 4490 4045 3748 3239 1980 1502 561 178 1283 24976 4720 --
NM_144979chr42541 278 --1711 --
NM_144982chr122620 55 --1553 --
NM_145000chr52424 101 ------
NM_145020chr18--1146 ----
NM_145052chrX61032 990 807 776 706 310 ------
NM_145055chr1832940 755 350 13440 ----
NM_145062chr61150 ------
NM_145119chrX275 46 ------
NM_145165chr1482758 2500 2369 2039 1899 1010 579 473 11108 ----
NM_145176chr682744 2389 2200 1296 1267 1186 442 130 22945 300 ----
NM_145206chr1052805 2744 2361 2265 1343 148 21115 521 --
NM_145251chr141317 ------
NM_145259chr2207045 6524 6516 5931 5629 5601 4796 2499 2386 2102 1805 1785 1707 1590 1008 966 694 674 624 327 12574 14465 1786
NM_145268chr751110 1068 975 416 28 1740 ----
NM_145274chr174941 767 320 229 1248 ----
NM_145276chr19----11014 --
NM_145304chr72133 126 ----1308
NM_145307chr1073635 3393 3278 2953 1726 1489 636 24498 3437 23126 271 --
NM_145331chr61110 --1223 --
NM_145341chr1031630 720 48 ------
NM_145349chr1762224 2158 1699 1643 785 605 --21405 486 --
NM_145350chr1751576 1510 1051 995 137 --1464 --
NM_145649chr682683 2535 2511 2336 1886 1758 791 526 1908 1502 --
NM_145655chr682683 2535 2511 2336 1886 1758 791 526 1908 1502 --
NM_145698chr1071814 1634 628 268 262 61 41 ----1209
NM_145714chr16----1122 --
NM_145719chr113367 337 248 ------
NM_145725chr141340 ------
NM_145726chr141340 ------
NM_145735chr1352740 2643 2480 2319 2261 1317 1735 --
NM_145802chrX----1709 --
NM_145805chr151499 ------
NM_145808chr742754 2302 907 608 --23157 1967 12614
NM_145810chr22400 280 --21162 81 --
NM_145859chr33327 126 102 ------
NM_145860chr33327 126 102 ------
NM_145888chr1962052 1743 1400 1339 1279 363 11431 21955 757 --
NM_145891chr162627 207 1340 --21512 61
NM_145892chr162627 207 1340 --21512 61
NM_145893chr161329 1462 --21634 183
NM_145912chr22134655 4567 4516 4304 3423 3410 3009 1732 1726 1154 782 770 80 --33528 1317 297 --
NM_147147chr6103468 3403 3379 2980 1562 1275 1065 1058 54 43 14201 22725 658 --
NM_147156chr1021094 475 --1459 --
NM_147164chr91572 ------
NM_147166chr73709 617 47 1121 ----
NM_147171chr72457 319 ------
NM_147175chrX51951 1797 1760 1751 836 ------
NM_147181chr43446 381 203 --121 --
NM_147182chr43446 381 203 --121 --
NM_147183chr43446 381 203 --121 --
NM_147185chr72457 319 ------
NM_147189chr862246 2205 1529 945 790 73 --12257 --
NM_147223chr252488 1992 1533 497 86 22363 182 ----
NM_147780chr882392 2257 2080 1815 899 807 112 103 ------
NM_147781chr882392 2257 2080 1815 899 807 112 103 ------
NM_147782chr882392 2257 2080 1815 899 807 112 103 ------
NM_147783chr882392 2257 2080 1815 899 807 112 103 ------
NM_148174chr862235 2061 2016 1870 903 29 12185 ----
NM_148416chr16----1122 --
NM_148898chr71251 1334 ----
NM_148899chr71251 1334 ----
NM_148923chr18198 ------
NM_148955chr15126473 6214 6093 5848 5334 5261 4731 4631 1846 1344 977 799 26331 1770 15581 --
NM_148957chr1352352 2133 843 603 120 ------
NM_152233chr1471567 1471 1315 1305 558 407 351 1502 ----
NM_152236chr222242 206 ------
NM_152261chr1252378 1998 1711 310 53 1265 22453 388 1634
NM_152265chr141133 1024 544 470 ------
NM_152271chr82473 212 11172 1135 --
NM_152277chr541711 1579 1416 1347 22025 362 ----
NM_152280chr153195 2578 2233 722 701 ------
NM_152282chr351290 1136 536 410 283 11395 ----
NM_152291chr43950 891 374 --1322 --
NM_152292chr441981 688 602 487 11528 ----
NM_152305chr342244 1526 1466 514 ----196
NM_152317chr122254 22 ------
NM_152332chr1442721 2640 2256 1966 ------
NM_152344chr1761359 1221 1037 379 198 147 --1550 --
NM_152347chr17171 --1481 --
NM_152387chr22229 129 1719 1867 --
NM_152388chr293984 3256 2703 2643 1490 1243 797 507 454 1424 23077 1066 23936 3777
NM_152391chr231039 1029 140 ------
NM_152400chr422119 1438 2198 185 ----
NM_152407chr553032 2567 952 274 21 --13288 --
NM_152409chr543044 2747 1336 616 ------
NM_152410chr62502 24 ------
NM_152414chr85636 534 497 372 360 ------
NM_152415chr81351 ------
NM_152417chr871290 1216 1208 1174 1060 348 74 --21142 985 1316
NM_152422chr961828 1821 1569 1417 247 113 11889 ----
NM_152424chrX104722 4614 4592 2987 2882 1899 1713 953 102 37 14675 1936 --
NM_152437chr1272343 1936 1793 1682 764 658 185 1523 32053 744 319 --
NM_152440chr1231014 965 171 1286 ----
NM_152447chr14129 159 --1332
NM_152450chr152718 163 --1249 --
NM_152520chr21387 11064 ----
NM_152522chr21769 2216 183 --1331
NM_152529chr283520 3468 1699 1105 882 604 411 295 13911 33978 3726 549 --
NM_152546chr511402 21073 248 ----
NM_152556chr752518 2139 1976 742 350 ------
NM_152558chr774097 3982 3886 3389 2884 1352 625 ------
NM_152584chrY249 30 ------
NM_152588chr124653 515 322 208 11631 ----
NM_152594chr1571945 1914 1747 1715 1494 573 346 2861 624 ----
NM_152622chr5113100 2915 2906 2485 2466 1109 1075 1045 885 393 387 ------
NM_152624chr5136636 5641 5402 5020 4945 2813 2788 2448 2361 1628 629 121 48 34771 2960 2424 24632 984 15129
NM_152629chr993202 1468 1264 1245 984 797 360 213 152 13572 34065 4012 854 1272
NM_152638chr1231077 914 55 1253 11232 --
NM_152641chr1252880 2347 1948 1915 161 2606 443 11843 --
NM_152653chr31237 ------
NM_152660chr12682 151 ------
NM_152665chr12230 134 1922 ----
NM_152678chr342031 1018 974 510 --11849 --
NM_152682chr451788 1677 1516 1286 1190 --11359 --
NM_152685chr53396 363 80 ------
NM_152695chrX42126 1924 1559 590 12049 ----
NM_152699chr393523 3288 2315 1459 1311 1178 942 760 80 33295 1362 351 33310 769 60 --
NM_152727chr161251 ------
NM_152733chr6146150 6091 6061 5734 5125 2534 2482 2421 2144 1977 1554 752 391 67 --46477 6190 5691 5209 --
NM_152734chr6115380 4863 4720 4648 4533 3885 1618 1426 1324 728 546 --35326 2158 1505 --
NM_152737chr622064 1349 1583 ----
NM_152739chr71452 ----1843
NM_152740chr71748 1286 ----
NM_152754chr773764 3230 3167 2765 1370 1050 521 31522 1286 131 13108 --
NM_152756chr564329 3043 1272 909 845 375 1278 --1724
NM_152758chr8132950 2585 2391 2316 2276 1890 1878 1173 576 476 324 295 231 32689 1929 1101 12114 12462
NM_152774chr732407 408 107 1994 12019 --
NM_152780chrX6992 929 274 191 112 84 1305 1313 --
NM_152787chrX103723 3353 3318 3051 2914 2668 1515 353 322 229 --13387 --
NM_152788chr12----164 --
NM_152789chr741300 324 186 123 21468 331 ----
NM_152793chr7135151 4802 4496 4347 4237 3953 3750 1611 1377 1242 599 339 254 24564 3508 1193 --
NM_152826chr15126473 6214 6093 5848 5334 5261 4731 4631 1846 1344 977 799 26331 1770 15581 --
NM_152835chr121825 750 1888 --12354
NM_152838chr2043098 2852 2481 1332 1484 --13540
NM_152857chr621045 739 ------
NM_152858chr621045 739 ------
NM_152888chr85983 936 80 47 40 ------
NM_152896chr91108 1327 ----
NM_152903chr1362775 2114 2047 872 591 337 --22753 780 --
NM_152919chr19113539 3448 2756 2554 2536 2321 813 422 391 259 49 ------
NM_152924chr15216667 6648 6598 6308 6066 5852 5739 5580 5445 4658 2757 2583 2431 2161 2119 1748 1286 954 568 477 361 1324 32562 1653 97 21537 1459
NM_152989chr1211670 11342 ----
NM_152994chr21151 ------
NM_152996chr12433 410 ------
NM_152998chr72257 30 1244 ----
NM_152999chr7124698 4401 4253 4116 4089 3205 1776 1734 1468 1341 602 390 ------
NM_153013chr522208 426 ------
NM_153020chr651607 1546 1470 370 25 11512 1415 1235
NM_153035chr183192 3057 2286 1269 1004 708 558 539 1651 21157 423 --
NM_153050chr22105058 4468 4348 4278 3397 3315 1137 1036 861 147 24684 4423 14727 --
NM_153051chr22105058 4468 4348 4278 3397 3315 1137 1036 861 147 24684 4423 14727 --
NM_153182chr3123363 2958 2500 2481 2390 2346 2250 2101 2087 574 291 66 --12820 --
NM_153184chr331440 40 22 ----1256
NM_153188chr5135559 5489 5342 4794 4295 4175 3974 3734 3658 2215 2015 1770 1103 11956 ----
NM_153207chr12103827 3685 3472 2973 2955 2920 2727 2502 948 921 1794 13951 --
NM_153208chr161881 ------
NM_153223chr551330 1310 1046 603 401 11008 11401 --
NM_153226chr101858 1138 1907 --
NM_153260chr1551526 1387 1321 1116 67 ------
NM_153262chr162985 2873 2735 1984 1230 1081 22511 957 12778 --
NM_153321chr171397 ----1781
NM_153322chr171397 ----1781
NM_153332chr882992 2598 2452 1075 324 249 179 70 --12534 --
NM_153343chr452301 2266 1922 1824 673 22367 1833 ----
NM_153347chr11112534 2342 2029 1982 1975 1952 552 503 283 119 74 ------
NM_153354chr51888 --1937 --
NM_153365chr452259 2129 2028 373 335 --11848 --
NM_153367chr1083948 3674 3550 2632 1550 1276 1158 1043 --33608 3093 479 --
NM_153456chr13116112 5702 5544 5490 5480 5170 5066 970 718 529 517 ----11167
NM_153498chr102767 167 ------
NM_153607chr532503 740 340 ------
NM_153613chr15186 ------
NM_153616chr1552043 1944 1759 329 198 --1962 --
NM_153617chr1552043 1944 1759 329 198 --1962 --
NM_153618chr1552043 1944 1759 329 198 --1962 --
NM_153619chr15103281 3182 2997 2603 1436 872 746 676 667 170 --22517 342 --
NM_153634chr1261223 576 506 451 218 47 ------
NM_153640chr204534 363 100 26 ------
NM_153645chr2273297 2470 2274 1214 1195 1036 225 --13257 12212
NM_153646chr1472396 2309 1647 719 579 256 217 --11610 --
NM_153647chr1472396 2309 1647 719 579 256 217 --11610 --
NM_153648chr1472396 2309 1647 719 579 256 217 --11610 --
NM_153686chr43683 81 53 1839 ----
NM_153687chr1261602 1534 1391 598 553 421 --11086 --
NM_153689chr232082 1910 1902 1345 1859 --
NM_153707chr9------1142
NM_153712chr273583 2827 1437 1274 1159 662 70 21247 731 11056 12314
NM_153748chr123398 368 134 1990 ----
NM_153757chr441204 979 820 237 ------
NM_153810chr10115064 4349 4302 4160 1856 1831 1698 1659 1193 654 31 --21639 1275 --
NM_153825chr471822 1231 1211 1108 538 140 92 ------
NM_153831chr81122 ------
NM_170606chr741814 1609 1172 200 1672 --11706
NM_170665chr1294377 4332 3716 3701 3693 3175 2867 1183 83 ------
NM_170679chr551237 941 917 456 441 1229 ----
NM_170706chr1104201 4153 3478 3271 3070 1747 1168 1071 870 820 --13434 11684
NM_170709chr842162 957 794 660 ------
NM_170710chr4103206 2313 1979 1213 1051 916 661 617 418 402 32969 411 264 ----
NM_170731chr1142021 1946 1787 924 12216 ----
NM_170732chr1142021 1946 1787 924 12216 ----
NM_170733chr1142021 1946 1787 924 12216 ----
NM_170734chr1142021 1946 1787 924 12216 ----
NM_170735chr1142021 1946 1787 924 12216 ----
NM_170739chr111235 ----1282
NM_170774chr20124112 4017 3513 2806 2632 1164 1047 1004 402 181 148 141 12851 ----
NM_171998chrX82064 2025 2005 1734 864 852 193 39 --1172 --
NM_172037chr81556 --21303 919 --
NM_172058chr851728 1702 1636 1339 640 ----1399
NM_172059chr851728 1702 1636 1339 640 ----1399
NM_172060chr851728 1702 1636 1339 640 ----1399
NM_172070chr21591 ----21992 1764
NM_172071chr1137020 6855 5991 5513 5490 5471 5208 4849 4738 2686 1888 1662 531 --24964 2791 12319
NM_172103chr692584 2085 1865 1699 430 396 388 157 50 1819 ----
NM_172105chr692584 2085 1865 1699 430 396 388 157 50 1819 ----
NM_172127chr451479 738 690 385 139 --21342 92 --
NM_172128chr451435 694 646 341 95 --21298 48 --
NM_172159chr341684 1612 172 86 12004 1130 --
NM_172160chr341684 1612 172 86 12004 1130 --
NM_172169chr1061982 1939 1724 1495 470 372 --176 --
NM_172170chr1061982 1939 1724 1495 470 372 --176 --
NM_172171chr1061982 1939 1724 1495 470 372 --176 --
NM_172173chr1061982 1939 1724 1495 470 372 --176 --
NM_172193chr1441217 1129 1050 232 ----1455
NM_172344chr241591 1314 748 448 1738 21528 262 11388
NM_172354chr141998 1586 1283 463 2117 65 1242 --
NM_172387chr1851545 1351 401 205 117 166 11396 --
NM_172388chr1851592 1398 448 252 164 1113 11443 --
NM_172389chr1851592 1398 448 252 164 1113 11443 --
NM_173198chr962355 2226 1987 856 832 445 12362 ----
NM_173199chr91113 ------
NM_173200chr962355 2226 1987 856 832 445 12362 ----
NM_173214chr16146277 3189 3004 2775 2767 2544 2009 1809 1715 1140 1063 1024 806 48 25298 1894 ----
NM_173362chr57793 714 662 579 228 212 41 ------
NM_173454chr153823 59 26 11017 --11119
NM_173468chr4125671 5341 5093 4773 4319 4140 1916 1575 1268 976 441 87 23910 988 ----
NM_173469chr1531435 568 270 --11031 11424
NM_173470chrX1288 22832 2157 ----
NM_173475chr1651631 1494 1114 396 132 1537 ----
NM_173491chr54473 266 146 87 1528 11112 1394
NM_173495chrX32568 2288 1640 ------
NM_173508chr131193 340 321 ------
NM_173510chr2232730 2612 86 --1349 --
NM_173511chr2103929 3733 3650 3198 2792 1183 1018 804 454 59 ------
NM_173519chr852031 1958 496 459 126 ------
NM_173526chr14178 ------
NM_173531chr1963474 3105 3095 2541 2506 632 23643 892 ----
NM_173546chr32601 129 ------
NM_173550chr9158 ------
NM_173552chr342369 1523 393 75 12437 ----
NM_173576chr1042193 1914 731 406 12158 ----
NM_173582chr1185477 5293 4028 1557 1434 1004 978 959 16091 11706 --
NM_173595chr12164935 4337 4015 4007 3503 3469 3363 2121 1608 1565 1411 1354 1094 838 619 561 --11689 24369 1494
NM_173602chr1283778 2955 2945 2819 1309 1059 363 35 11363 --13350
NM_173611chr15----1132 179
NM_173630chr18289 25 ------
NM_173642chr1258289 8155 7815 7775 7683 6984 6754 6489 6264 6218 5812 5642 3697 3245 3144 3125 3085 3028 2883 2513 2344 2215 1468 1018 669 --25928 3263 --
NM_173645chr22580 388 ------
NM_173667chr51246 ----2814 304
NM_173694chrX52115 745 706 629 515 22214 890 ----
NM_173698chrX21958 826 2719 528 ----
NM_173797chr531161 463 336 ------
NM_173803chr1641337 423 270 237 ------
NM_173808chr184156 3338 3329 1560 1151 238 56 39 24332 3582 ----
NM_173809chr1061405 1159 1022 554 172 73 --2234 67 11317
NM_173825chr353088 2879 2845 1930 850 --22151 447 11105
NM_173826chr381718 1414 1372 1347 1292 1204 564 297 ------
NM_173829chr5156227 5821 5596 5506 5375 5077 4824 4478 4374 2427 2378 2077 1899 746 372 25873 2240 --16123
NM_173830chr6197 --151 --
NM_173832chr8123428 3412 2857 2524 2401 1362 1337 1312 1262 1237 1137 634 --1722 --
NM_173833chr84634 284 261 174 ------
NM_173851chr883584 3250 2828 2822 2806 1278 1040 524 23805 2596 1250 --
NM_174858chr111260 ------
NM_174890chr101677 ------
NM_174909chr53734 671 109 ------
NM_174911chr843116 2850 1235 539 ----11049
NM_174921chr411120 ------
NM_174938chr9176 1398 ----
NM_174941chr122176 125 ------
NM_175056chr332074 490 77 21909 1562 --11454
NM_175061chr752107 1863 1665 827 310 ----11686
NM_175085chr211142 ------
NM_175571chr761582 1534 1528 635 498 115 ------
NM_175623chr12217590 6935 6321 6017 5991 5414 5316 5199 4961 2854 1550 1517 1427 1352 1227 1195 756 402 280 258 25 155 46856 6399 6297 638 --
NM_175736chr12156531 6212 6114 5436 5051 4974 3111 2486 1456 1334 778 475 232 136 65 15529 ----
NM_175768chr651724 1320 649 450 86 ------
NM_175854chr1332551 1694 155 1664 22093 1049 1455
NM_175859chrX4654 430 82 49 51791 1525 1186 614 512 ----
NM_175861chr12165586 5570 5489 5330 5153 4330 4077 4005 3980 3691 2091 1757 625 364 314 46 34867 4767 2071 15483 --
NM_175873chr56940 310 264 246 168 91 ------
NM_175876chr192773 2528 2399 2065 2044 878 779 252 108 22817 1898 12107 --
NM_175907chr1832550 2289 679 ------
NM_175920chr53749 562 170 1689 ----
NM_176081chr10155904 5807 5673 5568 5321 4914 4628 4488 3803 2000 1248 730 638 426 63 25656 4654 ----
NM_176083chr10155904 5807 5673 5568 5321 4914 4628 4488 3803 2000 1248 730 638 426 63 25656 4654 ----
NM_176812chr202310 240 ------
NM_176814chr731392 437 350 ------
NM_176824chr411174 11276 ----
NM_176863chr1742153 1873 1794 543 ----12070
NM_177398chr141722 1357 1348 738 1173 ----
NM_177399chr141722 1357 1348 738 1173 ----
NM_177424chr131612 1587 470 --12040 11288
NM_177438chr1473542 3371 2726 2691 1618 1565 1428 33639 1667 463 ----
NM_177452chr1442281 2060 803 320 22458 2071 12269 --
NM_177524chr741052 920 489 346 11079 ----
NM_177525chr741052 920 489 346 11079 ----
NM_177538chr2186708 6359 6319 6007 5761 5712 2887 2753 2373 2048 1714 1376 856 720 583 447 314 72 1359 12497 16222
NM_177947chrX51486 1435 457 195 146 1103 1576 --
NM_177948chrX51486 1435 457 195 146 1103 1576 --
NM_177949chrX2286 28 1132 1347 --
NM_177951chr14--1349 ----
NM_177966chr391861 1728 1354 1247 689 544 291 248 29 ------
NM_177968chr262241 2095 1793 338 305 35 ------
NM_177969chr2193 ------
NM_177972chr11123814 3659 3338 3085 3026 2976 2898 1704 1569 973 559 37 14471 23691 797 --
NM_177974chr151652 --12275 --
NM_177985chr251448 1440 343 302 58 21919 867 ----
NM_177988chr31320 1327 --143
NM_177990chr201610 1604 11271 --
NM_177995chr961828 1821 1569 1417 247 113 11889 ----
NM_177996chr20143248 3218 3166 2968 2601 2295 2126 2114 1089 1046 625 610 257 76 --22417 487 --
NM_178010chr1211670 11342 ----
NM_178011chr1073248 3059 2656 2581 2391 1183 239 --1723 --
NM_178012chr62331 316 --1439 --
NM_178014chr61182 ------
NM_178123chr241040 883 852 305 ------
NM_178140chr552576 2386 1761 936 522 --1865 --
NM_178151chrX167507 6945 6656 6606 6331 6127 5469 5431 5303 5139 4929 2973 1600 854 475 450 37242 6377 2300 ----
NM_178152chrX167507 6945 6656 6606 6331 6127 5469 5431 5303 5139 4929 2973 1600 854 475 450 37242 6377 2300 ----
NM_178153chrX167507 6945 6656 6606 6331 6127 5469 5431 5303 5139 4929 2973 1600 854 475 450 37242 6377 2300 ----
NM_178313chr211923 11951 1652 --
NM_178335chr3122 ------
NM_178423chr741205 382 174 140 ------
NM_178425chr741205 382 174 140 ------
NM_178426chr192388 2359 2337 1615 1586 1527 482 376 323 12245 ----
NM_178427chr192288 2259 2237 1515 1486 1427 382 276 223 12145 ----
NM_178539chr1261668 729 154 104 85 74 1627 1397 --
NM_178554chr3123377 3283 2851 2824 2810 2637 2217 1455 851 172 96 85 --1441 1962
NM_178565chr821613 182 ------
NM_178566chr941889 1573 1394 243 ------
NM_178578chr2072383 1958 1059 975 775 475 46 ------
NM_178582chr2031090 1058 39 ------
NM_178584chr261392 1350 1080 457 247 224 11129 --11273
NM_178585chr453190 3154 3083 1149 1096 32760 2508 149 --12209
NM_178812chr841096 1020 415 48 ------
NM_178815chr1031939 1082 310 --31877 1051 129 1747
NM_178818chr1671967 1766 805 685 384 305 26 ------
NM_178831chr7112968 2925 2535 2272 2118 1879 747 683 514 459 112 --1419 --
NM_178858chr104955 869 247 103 21393 1163 ----
NM_178864chr11----1255 --
NM_180989chr1362028 1602 1572 985 826 102 12349 ----
NM_181077chr1522092 96 ------
NM_181265chr4103206 2313 1979 1213 1051 916 661 617 418 402 32969 411 264 ----
NM_181291chr142532 80 ----1788
NM_181302chr141159 ----127
NM_181308chr141159 ----127
NM_181332chrX42215 1920 593 362 12378 ----
NM_181356chr611037 ------
NM_181357chr1481680 1656 1519 441 353 341 308 151 ------
NM_181358chr1103888 3817 3162 1503 1203 1129 1052 320 307 96 --11354 --
NM_181443chr2042834 1764 800 312 --22769 335 --
NM_181481chr18116934 6284 6029 4865 4651 4627 4277 2278 2267 2165 687 25006 388 ----
NM_181482chr18116934 6284 6029 4865 4651 4627 4277 2278 2267 2165 687 25006 388 ----
NM_181483chr18116934 6284 6029 4865 4651 4627 4277 2278 2267 2165 687 25006 388 ----
NM_181504chr592776 1647 1530 1183 894 422 354 45 29 12786 21262 453 --
NM_181521chr16206748 6547 5586 5466 5165 5086 4807 4763 4757 4596 2708 2668 2121 2088 1905 1637 743 647 260 99 --11010 --
NM_181523chr592776 1647 1530 1183 894 422 354 45 29 12786 21262 453 --
NM_181524chr592776 1647 1530 1183 894 422 354 45 29 12786 21262 453 --
NM_181598chr141121 --1287 --
NM_181659chr2072877 2732 929 901 713 501 162 ------
NM_181659chr2072877 2732 929 901 713 501 162 ------
NM_181671chr171242 1310 1260 1774
NM_181672chrX51601 1273 490 353 37 --21540 1499 --
NM_181673chrX51601 1273 490 353 37 --21540 1499 --
NM_181702chr83817 723 675 180 ----
NM_181706chr11--22005 1965 ----
NM_181712chr161994 1586 1450 656 198 67 --1288 --
NM_181713chr23783 596 377 ------
NM_181714chr661390 1366 561 385 232 204 ------
NM_181723chr842347 2039 1655 153 --11997 --
NM_181780chr33765 386 33 1790 --1214
NM_181782chr65872 638 566 523 293 --11508 --
NM_181783chr1241852 1790 1265 122 --21329 324 --
NM_181838chr531534 1431 51 ------
NM_181861chr1242475 1817 1090 44 --12373 --
NM_181868chr1242475 1817 1090 44 --12373 --
NM_181869chr1242560 1902 1175 129 --12458 --
NM_181886chr41517 ------
NM_181887chr41517 ------
NM_181888chr41517 ------
NM_181889chr41517 ------
NM_181890chr41517 ------
NM_181891chr41517 ------
NM_181892chr41564 ------
NM_181893chr41517 ------
NM_181897chr342334 836 772 429 1157 2352 264 --
NM_182481chr2141274 1074 476 304 --199 154
NM_182482chr2141274 1074 476 304 --199 154
NM_182485chr453335 1374 1244 1009 64 --1829 12891
NM_182488chr132824 324 ------
NM_182501chr263189 3157 2600 2095 757 151 1321 22144 87 1243
NM_182511chr1841225 1096 401 71 --2979 969 --
NM_182515chr19146364 5586 5427 4960 4799 4743 4379 4198 4071 1618 1567 1209 991 510 11463 --11839
NM_182551chr282992 2704 2653 2608 2296 688 641 184 ------
NM_182606chr44915 887 218 106 ------
NM_182646chr453335 1374 1244 1009 64 --1829 12891
NM_182648chr142593 479 ------
NM_182649chr201299 --1319 --
NM_182664chr162253 1772 1544 893 609 27 ------
NM_182691chr721276 295 1365 ----
NM_182692chr721276 295 1365 ----
NM_182717chr1051296 1016 374 366 135 --1938 --
NM_182720chr1051296 1016 374 366 135 --1938 --
NM_182721chr1051296 1016 374 366 135 --1938 --
NM_182722chr1051296 1016 374 366 135 --1938 --
NM_182723chr1051296 1016 374 366 135 --1938 --
NM_182757chr663485 3433 2995 2701 2437 2321 11307 13133 --
NM_182758chr1553792 2809 2800 1497 27 11400 1353 --
NM_182762chr775848 4823 4411 4389 2001 786 647 65708 4954 4604 4551 1677 391 13790 11854
NM_182765chr1052342 1699 1478 912 570 ------
NM_182797chr2031408 134 68 ------
NM_182830chr1452196 2141 2067 744 541 12114 --2843 224
NM_182853chr1051296 1016 374 366 135 --1938 --
NM_182898chr7126126 6084 4297 2335 2293 1833 1722 1701 1635 334 325 92 35800 4603 915 --25072 1454
NM_182899chr7126126 6084 4297 2335 2293 1833 1722 1701 1635 334 325 92 35800 4603 915 --25072 1454
NM_182907chr6--1280 ----
NM_182918chr2111444 --11275 --
NM_182935chr372348 1683 831 695 183 43 23 1571 175 --
NM_182943chr361194 1050 487 460 441 21 --1913 --
NM_182944chr141279 ------
NM_182948chr172945 2924 2830 2598 2528 430 120 22819 2764 --12391
NM_182961chr62648 237 ------
NM_182972chr13601 570 532 32390 1056 145 22789 54 --
NM_183004chr1473926 3719 3373 2726 2627 2468 324 11202 11239 --
NM_183011chr1051296 1016 374 366 135 --1938 --
NM_183012chr1051296 1016 374 366 135 --1938 --
NM_183013chr1051296 1016 374 366 135 --1938 --
NM_183047chr204791 255 132 104 ------
NM_183048chr204791 255 132 104 ------
NM_183078chr663692 3406 3300 667 361 296 22918 1183 12468 --
NM_183079chr2051441 1349 1072 331 175 11385 11191 1348
NM_183234chr1551738 1685 729 598 201 11333 ----
NM_183235chr1551738 1685 729 598 201 11333 ----
NM_183236chr1551738 1685 729 598 201 11333 ----
NM_183353chrX21043 131 1474 1112 11126
NM_183380chr62886 392 ----11011
NM_183381chr32998 647 ------
NM_183383chr32998 647 ------
NM_183384chr32998 647 ------
NM_183397chr20155078 4860 4765 4691 4127 4076 3838 3540 3392 3153 1908 1773 531 236 35 13206 13829 --
NM_183415chr1271783 1774 1636 1538 620 442 330 ------
NM_183416chr161959 1674 658 238 202 23 ------
NM_183419chr81272 ------
NM_183422chr131855 2923 871 ----
NM_184085chr84672 567 542 107 ------
NM_184086chr84672 567 542 107 ------
NM_184087chr84672 567 542 107 ------
NM_184234chr203748 628 133 ------
NM_194071chr7105205 5050 4297 4003 3356 1821 1779 606 530 92 13587 ----
NM_194247chr294111 3972 3587 1548 1313 1188 918 807 266 23828 1623 11292 11507
NM_194250chr21407 ------
NM_194282chr462968 2795 2490 2467 214 122 ------
NM_194283chr583389 1390 1048 969 659 347 207 188 --21440 218 --
NM_194285chr1133216 501 439 13189 1955 --
NM_194291chr862746 2733 2256 2147 2023 1013 21030 730 ----
NM_194292chr171552 1346 1250 1204 1142 556 435 1126 ----
NM_194314chr165123 4304 3901 1691 1319 500 ------
NM_194317chr262485 656 508 501 471 334 12317 1790 --
NM_194328chr963110 2945 2894 1224 1024 925 1664 12404 --
NM_194329chr963110 2945 2894 1224 1024 925 1664 12404 --
NM_194330chr963110 2945 2894 1224 1024 925 1664 12404 --
NM_194332chr963110 2945 2894 1224 1024 925 1664 12404 --
NM_194434chr18125742 5454 4720 4217 1866 1511 1472 1404 1378 672 539 378 12176 13587 14330
NM_194439chr471532 1264 1120 961 312 175 72 1943 --1596
NM_194452chr112975 869 11252 --11134
NM_194453chr112975 869 11252 --11134
NM_194454chr731700 1627 153 1698 ----
NM_194455chr731700 1627 153 1698 ----
NM_194456chr731700 1627 153 1698 ----
NM_194463chrX31172 480 25 ------
NM_197941chr562797 2247 2045 1902 622 363 --12454 12467
NM_198047chr21581 169 ----
NM_198057chrX41261 938 865 204 ------
NM_198066chr1442826 2632 1217 809 22835 372 1249 --
NM_198081chr662895 2433 667 579 476 309 --22448 515 --
NM_198086chr14102218 2184 2177 2098 1690 830 726 619 355 273 --1477 --
NM_198128chr1832218 449 290 1728 ----
NM_198181chr1572758 2221 1925 1914 1056 825 81 12212 ----
NM_198189chr24944 422 392 229 2860 185 ----
NM_198195chr33219 155 66 1538 ----
NM_198212chr732193 1435 434 22076 1694 ----
NM_198240chr1241172 1152 1130 1085 ------
NM_198256chr282020 1875 1367 829 594 491 256 30 21265 172 ----
NM_198261chr121511 ------
NM_198262chr121511 ------
NM_198268chr1103888 3817 3162 1503 1203 1129 1052 320 307 96 --11354 --
NM_198269chr1103888 3817 3162 1503 1203 1129 1052 320 307 96 --11354 --
NM_198270chrX52872 1322 888 637 385 12180 12572 12474
NM_198273chr573008 2723 2695 2367 2178 2123 1229 12133 ----
NM_198279chrX41222 500 376 249 ------
NM_198281chr4103383 3321 3197 3183 2951 2434 2329 828 821 159 23443 3329 23157 1360 --
NM_198320chr12165207 5067 4255 4146 3784 3265 3213 1750 1484 1045 887 602 475 257 122 37 --33918 1090 986 --
NM_198321chr592965 2604 2399 2151 2061 1292 803 620 303 --1177 --
NM_198329chr341469 1370 251 52 --1118 --
NM_198336chr771487 1455 1402 245 143 99 43 ------
NM_198376chr171315 ------
NM_198377chr171315 ------
NM_198378chr171315 ------
NM_198379chr171315 ------
NM_198380chr171315 ------
NM_198382chr171315 ------
NM_198383chr171315 ------
NM_198384chr171315 ------
NM_198385chr171315 ------
NM_198386chr171315 ------
NM_198387chr171315 ------
NM_198388chr171315 ------
NM_198391chr2041205 460 452 213 21409 309 ----
NM_198396chr171315 ------
NM_198399chr341503 683 593 75 --11738 --
NM_198400chr1541908 868 116 100 --12937 --
NM_198401chr821292 473 ----11453
NM_198465chrX32990 2959 2367 --12034 1752
NM_198468chr664204 3287 3107 3035 1610 575 ------
NM_198484chr395885 5661 5283 4560 4298 4182 1485 991 525 25092 1148 35345 5056 1319 --
NM_198485chr352519 1838 1747 701 594 ------
NM_198503chr152033 972 871 838 46 1831 ----
NM_198504chr35744 682 651 627 240 ------
NM_198527chr152418 58 ------
NM_198568chr65808 347 176 99 26 ------
NM_198569chr632383 434 267 32618 1884 380 ----
NM_198581chr2117547 6659 5356 5056 3008 2937 2751 2666 1294 1205 578 35590 2308 1643 11350 25261 286
NM_198595chr494970 4949 3988 3945 3308 1754 1704 1343 336 --21711 380 11106
NM_198700chr111137 ------
NM_198715chr186195 5355 4846 4755 4688 2184 1758 1436 75792 5348 807 686 613 332 243 25774 2497 --
NM_198719chr12730 71 3866 225 193 148 --
NM_198793chr344039 2921 1215 716 13884 11048 --
NM_198794chr1411061 ------
NM_198829chr71327 --11517 --
NM_198844chr171209 1981 ----
NM_198859chr355086 1332 1209 1145 951 55177 4583 4101 531 189 1986 --
NM_198896chr1151982 1637 1611 1448 89 21834 691 1637 --
NM_198900chr12156531 6212 6114 5436 5051 4974 3111 2486 1456 1334 778 475 232 136 65 15529 ----
NM_198904chr561964 1885 1784 1774 107 41 1805 21600 669 --
NM_198935chr2062960 2828 2347 2312 1016 481 --12374 --
NM_198968chr13153939 3784 3594 3378 3117 3100 3049 2943 2554 1399 1157 869 698 452 360 ------
NM_198989chr133464 386 70 ------
NM_198992chr1231328 901 55 ----1189
NM_199000chr742082 797 509 100 --12298 --
NM_199040chr1282964 2809 2405 1160 1083 904 592 101 22578 2478 ----
NM_199051chr1133 ------
NM_199072chr792933 2900 2353 2082 1975 864 619 484 138 12149 --12785
NM_199144chr2021474 1060 --11195 --
NM_199168chr1051538 1091 988 383 155 ------
NM_199169chr2083615 3562 3314 2831 2523 495 247 165 ------
NM_199170chr2083615 3562 3314 2831 2523 495 247 165 ------
NM_199171chr2083615 3562 3314 2831 2523 495 247 165 ------
NM_199188chr1263639 3053 2752 595 458 50 12926 --13123
NM_199189chr51405 --1723 --
NM_199190chr1263639 3053 2752 595 458 50 12926 --13123
NM_199203chr2021474 1060 --11195 --
NM_199245chr1282606 2185 1941 1748 1681 897 886 37 --1303 --
NM_199246chr53252 187 34 11247 11084 --