TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-5087
miRNA Sequence: GGGUUUGUAGCUUUGCUGGCAUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr55408 392 372 248 232 1509 --1525
NM_000081chr141843 1821 659 573 146 --1109
NM_000084chrX66934 6791 4567 4402 2754 1493 45122 1579 1005 457 15672 145
NM_000091chr2122907 2643 2246 2163 2109 2054 1873 1756 1151 841 500 431 22317 1815 11952 11108
NM_000092chr2134279 4075 3880 3502 3285 3178 2807 2778 1640 872 668 425 317 34358 3747 1832 --13356
NM_000109chrX52467 2090 1797 1637 461 ------
NM_000110chr131122 1032 103 1916 ----
NM_000125chr664212 4036 3866 3355 3222 1167 13192 13946 12908
NM_000138chr1582612 2566 2543 2350 2151 635 310 40 1439 ----
NM_000163chr531955 902 87 1390 1691 --
NM_000176chr573361 3216 2905 2805 736 641 61 23865 310 23601 2854 --
NM_000189chr282302 1770 1661 1653 1643 748 703 559 11544 190 --
NM_000192chr1251399 1008 986 231 24 1542 11404 --
NM_000208chr1973765 3297 3279 3127 2894 1432 332 2905 262 14419 --
NM_000210chr252166 1687 1568 798 223 12212 1313 1858
NM_000216chrX113661 3587 3451 2617 1314 1081 1041 361 335 217 200 34119 2883 653 ----
NM_000217chr12184944 4545 4501 4351 4280 4268 3619 2100 1977 1819 1440 1431 1425 847 438 322 283 207 24601 1630 11749 35124 4357 3772
NM_000237chr841195 639 584 410 ------
NM_000248chr3112911 2785 2715 2687 2433 2075 1201 257 220 198 170 1539 132 --
NM_000253chr441069 1038 1011 249 --11028 --
NM_000264chr922886 2543 1797 12910 --
NM_000267chr1753384 2199 736 573 543 31400 835 751 12421 12259
NM_000314chr1063268 2770 760 316 52 42 ------
NM_000315chr111278 ----1118
NM_000321chr1311483 ----11572
NM_000332chr6126952 6731 6537 6014 5831 4603 4591 2147 2094 1959 1906 930 12630 35567 2237 1930 --
NM_000335chr372204 2155 1734 1443 894 572 57 ----22242 81
NM_000337chr5175878 5692 5424 5413 5402 4492 4432 4094 4023 2505 2450 2187 1915 1720 1634 822 710 46414 4989 2133 338 21201 1074 11533
NM_000346chr1741934 1699 299 196 --31636 1491 1405 --
NM_000361chr2052005 1766 538 324 249 --22118 462 11856
NM_000368chr974864 4585 4507 3554 3169 1299 909 24348 3780 11849 13491
NM_000393chr232093 1834 1463 12030 --11491
NM_000408chr282387 2316 2276 2225 985 954 555 30 11163 13325 147
NM_000411chr2143244 3038 525 346 13005 22117 1144 1376
NM_000428chr1462453 2313 2037 1058 855 653 --1879 12421
NM_000430chr1743567 3517 3030 2740 1576 23524 1257 1864
NM_000441chr752262 2105 1505 656 158 12277 --11608
NM_000448chr1133076 2622 2028 12533 12257 12842
NM_000452chr1371680 1628 786 283 183 47 22 ------
NM_000461chr3104629 4447 3536 3361 2845 1449 1353 1132 828 475 23573 1276 13327 1425
NM_000489chrX43331 2111 958 653 13309 ----
NM_000503chr881734 1516 1288 490 360 339 304 282 11456 ----
NM_000554chr1983099 2912 2785 2682 1195 1186 1108 382 2324 112 ----
NM_000555chrX137616 7083 7076 5859 5592 5068 4849 2658 1838 1009 985 427 42 --26277 36 37603 7089 577
NM_000579chr322198 1455 1205 1272 11754
NM_000587chr551273 965 850 168 145 ----1501
NM_000599chr2114398 4350 3968 3609 3382 2823 2817 1325 1182 691 358 ------
NM_000610chr1142622 841 827 589 1728 22301 491 12000
NM_000612chr11122450 1499 1422 1298 1272 1154 1103 1086 1038 994 947 826 ------
NM_000615chr1192854 2283 2233 1904 806 739 260 104 78 1273 --1402
NM_000618chr1276330 6322 5513 4514 4173 4006 309 25967 4688 11916 --
NM_000618chr1276330 6322 5513 4514 4173 4006 309 25967 4688 11916 --
NM_000620chr12102120 1995 1926 1484 1327 1305 832 819 367 49 ------
NM_000633chr18104769 4612 4164 3873 3652 3211 1648 144 129 26 --11415 13797
NM_000702chr152039 1822 1809 1558 473 1374 1740 11831
NM_000719chr1296702 6342 6068 4799 4712 4293 1859 1739 341 26362 5392 15058 11335
NM_000726chr271484 1242 1212 1108 1009 550 491 ----2366 63
NM_000788chr431181 1161 975 --11267 --
NM_000793chr1475141 4525 4371 4005 1309 1200 701 --24329 4199 --
NM_000794chr56907 818 688 680 378 211 ------
NM_000806chr541895 1761 1225 760 ----1475
NM_000809chr4209309 8060 7995 7582 7491 7288 7161 6983 6646 5899 5688 3474 3432 3126 2863 932 833 511 320 74 37968 6669 3542 48527 7460 2962 2256 16254
NM_000813chr5115211 4380 4108 3840 3774 3743 3557 3451 1040 1019 438 45025 3618 3529 47 11930 11034
NM_000814chr15104109 3270 2923 2601 1562 1538 1342 240 99 91 ----13614
NM_000826chr462467 2203 839 576 422 356 --2581 430 --
NM_000827chr552308 1881 586 508 60 2916 537 ----
NM_000828chrX52132 1815 1632 1601 357 32093 1866 207 --11797
NM_000829chr115693 569 506 283 191 197 --1475
NM_000831chr1125880 4763 4220 4131 2527 2115 1755 1170 1100 933 659 275 26017 1795 26219 425 --
NM_000833chr1661393 1256 1231 1167 450 440 31299 1177 612 ----
NM_000868chrX62494 2326 753 486 411 35 --12375 12443
NM_000875chr1556218 5025 2086 220 26 36705 5315 4313 35092 1636 93 15426
NM_000880chr85887 711 308 176 32 ----1208
NM_000891chr1742729 1182 409 286 ----33650 3376 1363
NM_000899chr1243383 1607 647 87 23653 620 1395 1114
NM_000901chr452162 1765 1597 678 378 11714 ----
NM_000902chr383232 2940 2616 2331 2226 1967 1042 830 23127 2011 1926 --
NM_000926chr11139483 7443 7250 7033 6861 5788 3233 3103 2006 1687 1644 1069 1022 32254 913 574 26597 625 1328
NM_000933chr201462 --3201 56 42 --
NM_000944chr442417 2385 529 183 11732 --1476
NM_000949chr52868 334 --1886 1176
NM_000950chrX63667 3055 2941 1372 935 447 --22569 2425 --
NM_000963chr132452 1804 973 --1733 1230
NM_001001323chr1262950 2595 2119 510 370 333 21239 1216 ----
NM_001001331chr352190 1936 1760 892 426 --3810 262 158 --
NM_001001389chr1142622 841 827 589 1728 22301 491 12000
NM_001001390chr1142622 841 827 589 1728 22301 491 12000
NM_001001391chr1142622 841 827 589 1728 22301 491 12000
NM_001001392chr1142668 887 873 635 1774 22347 537 12046
NM_001001395chr1252350 2032 2018 484 321 --12230 --
NM_001001396chr1124362 4354 4179 4115 2722 1281 831 688 504 447 205 99 --24035 2991 11298
NM_001001419chr554697 4279 4177 1722 958 14592 15243 13309
NM_001001420chr554697 4279 4177 1722 958 14592 15243 13309
NM_001001433chr2032789 1167 127 42461 922 736 416 12407 1512
NM_001001484chr1052389 2320 2257 1792 1715 --11911 --
NM_001001486chr34422 393 367 172 ------
NM_001001487chr34422 393 367 172 ------
NM_001001549chr7122865 2826 2698 2663 2528 2273 2181 1929 1734 805 505 263 11820 1592 --
NM_001001550chr7122865 2826 2698 2663 2528 2273 2181 1929 1734 805 505 263 11820 1592 --
NM_001001555chr7122865 2826 2698 2663 2528 2273 2181 1929 1734 805 505 263 11820 1592 --
NM_001001664chr263723 3658 2815 1564 1303 1292 --23644 643 176
NM_001001665chr272532 2448 2436 2241 1076 560 352 22646 36 12453 12971
NM_001001890chr2174310 4003 3837 3130 3057 2843 300 33073 3051 1305 181 --
NM_001001928chr22138360 7188 6782 6770 5559 5517 3028 2491 1909 1178 1075 875 90 16594 17735 26441 6433
NM_001001995chrX3675 190 109 2540 93 --149
NM_001002257chr2113126 3029 2758 2205 1373 1136 1029 965 485 320 56 ------
NM_001002843chr1531163 342 220 1885 --1162
NM_001002860chr1464554 3841 1631 1623 280 249 22903 1466 --176
NM_001002909chr1742190 1888 821 292 --12178 12273
NM_001003652chr18108288 6856 2284 2128 1889 1748 1082 731 568 412 11998 12122 27909 5348
NM_001003674chr18156850 6229 5853 5708 5239 4888 4456 4331 1912 1820 1593 1424 211 124 102 37062 2729 170 25642 189 --
NM_001003675chr18156850 6229 5853 5708 5239 4888 4456 4331 1912 1820 1593 1424 211 124 102 37062 2729 170 25642 189 --
NM_001003679chr13486 414 100 1237 ----
NM_001003688chr431080 1017 305 1296 11214 --
NM_001003760chr643205 3076 2786 1439 ----13617
NM_001003800chr993687 2995 2945 2843 2511 1493 792 638 580 23202 543 13581 --
NM_001004065chr973740 3633 3624 3249 645 294 102 1300 21233 107 1697
NM_001004317chr683861 3254 2786 1376 1218 1061 139 82 11694 11198 1145
NM_001004330chr1281731 1678 1622 1542 1186 562 211 183 ------
NM_001004342chr186002 5978 4770 4722 4040 2424 551 254 35418 4988 106 ----
NM_001004419chr1234261 3849 3127 43951 3390 1171 58 12836 24243 218
NM_001004441chr531689 624 517 1432 ----
NM_001005404chr1774028 3828 3783 3386 2981 2967 2896 --14326 13528
NM_001005463chr1072250 2136 2125 2041 1800 666 180 11923 11821 --
NM_001005473chr5136344 5864 5826 5572 5276 5015 4783 4699 4530 2662 2062 2032 1816 24897 557 ----
NM_001005502chr1295158 3925 3859 3254 3184 1983 1783 821 704 23410 3397 ----
NM_001005505chr391731 1578 1530 1158 662 542 398 392 237 1201 ----
NM_001005609chrX83791 3771 2391 1510 1411 1088 958 928 --23363 692 --
NM_001005746chr271484 1242 1212 1108 1009 550 491 ----2366 63
NM_001005747chr271484 1242 1212 1108 1009 550 491 ----2366 63
NM_001006610chr16--3967 844 203 --2882 395
NM_001006636chr25956 911 760 751 732 --2158 23 --
NM_001007023chr1475141 4525 4371 4005 1309 1200 701 --24329 4199 --
NM_001007024chr1733361 3333 1696 1273 --23452 330
NM_001007025chr1733361 3333 1696 1273 --23452 330
NM_001007094chr10114441 3985 3958 3687 3653 3571 3450 2891 1771 1308 927 54078 3876 1396 1372 846 1534 --
NM_001007097chr994864 4825 4176 3416 3151 1507 1441 770 721 24373 1590 13462 35105 4428 1612
NM_001007246chr2171965 1845 1625 1251 439 430 328 --11915 --
NM_001007278chr1355288 5197 3993 3570 1500 11348 ----
NM_001007466chr6114876 3752 3738 3472 3203 1848 1706 1518 1359 1300 1217 34844 3516 1381 --14006
NM_001008239chr1873402 3292 3010 1461 1396 894 124 ----13626
NM_001008401chr1961485 1402 1058 582 201 30 1115 11258 --
NM_001008529chr1771339 921 500 367 336 41 28 1471 ----
NM_001008536chr14667 611 174 123 --2700 641 --
NM_001008541chr102207 59 --12216 12326
NM_001008541chr102207 59 --12216 12326
NM_001008738chr552637 2537 2174 1155 215 ------
NM_001008777chr172598 221 2679 260 --1466
NM_001008801chr1982165 2085 711 526 442 211 171 87 --21937 560 --
NM_001009554chr454077 3731 1902 1697 1490 34044 3793 1358 --14215
NM_001009554chr454077 3731 1902 1697 1490 34044 3793 1358 --14215
NM_001009571chr751633 1603 1473 593 460 ------
NM_001009881chr12584 202 ----1136
NM_001009882chr12584 202 ----1136
NM_001009899chr3106538 6398 6119 5622 5579 2572 2398 1742 70 44 25868 4569 15525 14910
NM_001009909chr1153798 3010 1019 806 66 43879 1206 1176 159 1879 1924
NM_001009959chr231718 680 670 22596 186 12329 --
NM_001010000chr1883281 2799 2496 2373 2323 1387 1161 1111 --32863 2761 2378 13419
NM_001010861chr162651 2457 2174 1875 1704 1055 11127 ----
NM_001010888chrX84661 4191 3966 3103 1433 1357 632 31 ------
NM_001010891chr5126951 6845 6700 6682 6003 5847 5778 4991 4518 4411 1788 1260 1114 ----
NM_001010895chr942104 331 215 198 1798 ----
NM_001010986chrX42533 1733 739 647 2792 72 ----
NM_001011537chr342366 2103 1985 387 ------
NM_001011666chr7126566 5888 5314 5284 4745 4151 2262 1769 738 477 266 88 35058 1561 346 --11730
NM_001011708chr272752 2575 1041 307 120 89 24 12898 ----
NM_001012393chr11124641 4312 4207 3349 1941 1878 1784 1772 1671 762 378 50 178 --13992
NM_001012418chr654274 963 846 518 217 12725 23076 2947 --
NM_001012426chr693385 3011 2495 1367 636 383 253 241 116 11137 --13004
NM_001012427chr693385 3011 2495 1367 636 383 253 241 116 11137 --13004
NM_001012751chr1051544 1417 1203 661 590 11497 --21771 1663
NM_001012755chrX105070 4397 4085 3733 3680 3289 3261 1957 306 115 1376 23777 950 14139
NM_001012968chrX42308 2290 2006 303 1449 1136 --
NM_001013031chr1093354 2933 2808 2762 1161 824 125 77 58 --12664 --
NM_001013406chr741636 1597 1306 287 21300 26 ----
NM_001013620chr12178168 7609 7481 6386 6234 5863 5839 5427 5212 2979 2393 2328 1895 1630 771 688 471 57388 7065 6775 6515 5772 36822 6571 782 --
NM_001014380chr1365607 4757 3648 3582 1080 489 43834 2346 1755 251 15566 15479
NM_001014797chr1077289 6724 5785 3215 2385 2028 88 42948 1707 1002 35 37798 5673 172 --
NM_001015508chr83775 237 149 1253 --1507
NM_001017368chr1782853 2787 1886 1856 1820 718 605 539 12653 12229 --
NM_001017395chr373121 2570 2498 2323 798 382 251 1374 ----
NM_001017440chr766426 6397 5636 3089 2855 2537 46593 6045 2170 1893 27436 6601 27514 5690
NM_001017923chr1421495 1359 --1637 --
NM_001017970chr1482360 2316 2163 1866 919 483 315 224 --1614 --
NM_001017999chr181970 1916 1878 812 707 574 484 224 ------
NM_001017999chr181970 1916 1878 812 707 574 484 224 ------
NM_001018000chr181970 1916 1878 812 707 574 484 224 ------
NM_001018000chr181970 1916 1878 812 707 574 484 224 ------
NM_001018001chr181970 1916 1878 812 707 574 484 224 ------
NM_001018037chr951384 1344 1315 418 137 ------
NM_001018038chr9--2495 256 --166
NM_001018050chr2262867 2482 961 465 284 275 1921 23336 3084 --
NM_001018052chr2262867 2482 961 465 284 275 1921 23336 3084 --
NM_001018065chr944800 2389 587 485 33778 1891 527 1389 --
NM_001018066chr944800 2389 587 485 33778 1891 527 1389 --
NM_001018067chr174265 4119 1652 1385 643 308 186 --21881 403 11160
NM_001018068chr174265 4119 1652 1385 643 308 186 --21881 403 11160
NM_001018069chr174265 4119 1652 1385 643 308 186 --21881 403 11160
NM_001018074chr573361 3216 2905 2805 736 641 61 23865 310 23601 2854 --
NM_001018075chr573361 3216 2905 2805 736 641 61 23865 310 23601 2854 --
NM_001018076chr573361 3216 2905 2805 736 641 61 23865 310 23601 2854 --
NM_001018077chr573361 3216 2905 2805 736 641 61 23865 310 23601 2854 --
NM_001018089chr1593948 3585 2712 2663 1327 1206 1006 427 273 --11313 --
NM_001018111chr753804 3571 3444 2940 1346 22878 46 13157 1169
NM_001020658chr14520 469 150 58 --11601 --
NM_001020658chr14520 469 150 58 --11601 --
NM_001020825chr52380 280 11340 21076 329 --
NM_001024094chr573361 3216 2905 2805 736 641 61 23865 310 23601 2854 --
NM_001024647chr1297381 7247 5804 5437 5335 2524 1441 1069 1036 37470 5812 357 22363 1670 22438 1625
NM_001024660chr331330 329 134 11501 11608 --
NM_001024934chr6--1173 --1236
NM_001024935chr6--1173 --1236
NM_001024936chr6--1173 --1236
NM_001024948chr143058 881 702 281 22360 716 ----
NM_001024956chr11115886 5384 5341 4712 4163 3907 3643 2177 1044 1012 654 23653 3627 24112 883 --
NM_001025076chr10135485 5380 4942 4537 4360 4322 3873 2356 2200 2144 454 360 294 25944 3936 22169 1741 --
NM_001025077chr10126843 6738 6300 5895 5718 5680 5231 1812 1718 1652 364 333 27302 5294 ----
NM_001025079chr353299 1654 1091 642 425 14027 ----
NM_001025100chr1843668 1404 1114 501 11418 1473 14020
NM_001025108chr2104153 4015 3549 2944 2803 1609 783 685 377 345 --1855 --
NM_001025201chr21500 --1296 1475
NM_001025580chrX93828 3728 3617 3139 2855 2690 1673 984 41 23431 767 23833 2667 1795
NM_001029858chr673127 2991 2689 457 379 155 128 32899 2137 2094 23321 400 13289
NM_001029863chr673255 2659 2462 2398 2255 2004 579 --11046 1325
NM_001030006chr1782698 2530 2474 1816 894 628 609 362 12066 1791 --
NM_001030007chr1684011 3561 1609 1408 1056 901 648 610 ------
NM_001030055chr1483878 1826 1096 1071 916 587 213 46 33831 1890 948 1166 --
NM_001031685chr12753 698 1376 2861 825 --
NM_001031695chr2295389 4890 4779 4338 3510 979 728 441 110 25241 2055 --14102
NM_001031700chr4183 1337 12426 2363 197
NM_001031804chr16114049 3912 3810 3752 3590 3233 3211 2818 1268 841 788 12959 23685 157 12829
NM_001031812chr521903 1845 --12191 11645
NM_001032280chr631607 558 546 11156 --1351
NM_001032296chr1342829 2027 995 695 --2496 309 12158
NM_001033044chr121543 577 --31766 1466 1319 --
NM_001033045chr294038 4009 3390 3026 2805 2703 1673 1509 1165 ------
NM_001033056chr121543 577 --31766 1466 1319 --
NM_001033057chr382053 1666 1360 827 730 686 551 128 --161 --
NM_001033087chr2053293 3182 3145 2537 2349 ------
NM_001033117chr3104390 3814 3448 3288 3075 3039 1533 660 650 211 11067 --14727
NM_001033507chr142011 1231 563 460 31849 1832 285 ----
NM_001033518chr772861 2820 2615 2532 2492 2327 1038 32134 1148 312 ----
NM_001033519chr772861 2820 2615 2532 2492 2327 1038 32134 1148 312 ----
NM_001033520chr772861 2820 2615 2532 2492 2327 1038 32134 1148 312 ----
NM_001033578chr832362 2023 1568 --32408 1685 700 --
NM_001033723chr852619 1000 878 642 409 12668 12595 11083
NM_001034841chr1685289 4749 3396 1527 1304 1058 825 131 34252 3764 217 ----
NM_001034954chr1083265 2648 2641 1270 1052 535 392 154 12224 ----
NM_001034955chr1083265 2648 2641 1270 1052 535 392 154 12224 ----
NM_001034956chr1083265 2648 2641 1270 1052 535 392 154 12224 ----
NM_001034957chr1083265 2648 2641 1270 1052 535 392 154 12224 ----
NM_001037131chr231151 911 227 2522 239 ----
NM_001037132chr731592 1381 719 ----1779
NM_001037133chr731592 1381 719 ----1779
NM_001037164chr751996 1822 1609 1309 59 --22065 215 --
NM_001037165chr785556 2316 730 627 565 391 196 86 38085 6261 881 25642 2372 --
NM_001037174chr271858 1833 1784 1462 641 529 98 ----1383
NM_001037317chr162651 2457 2174 1875 1704 1055 11127 ----
NM_001037332chr542552 2011 1574 117 12585 --21630 828
NM_001037333chr542552 2011 1574 117 12585 --21630 828
NM_001037535chrX41267 620 585 268 ------
NM_001037536chrX41267 620 585 268 ------
NM_001037540chrX41267 620 585 268 ------
NM_001037553chr2154486 3602 1539 1509 546 23592 1725 13869 24316 3319
NM_001037954chr1133544 761 435 22577 483 1271 33521 1370 913
NM_001039199chr2074888 4566 3666 3120 1208 686 425 14051 ----
NM_001039538chr253434 3246 2418 2357 123 33229 2395 429 13553 196
NM_001039547chr376320 6266 5856 2833 2205 1613 1536 25883 188 ----
NM_001039570chr22104648 4448 4250 4177 3914 2886 1057 655 144 87 ----1424
NM_001039571chr22104648 4448 4250 4177 3914 2886 1057 655 144 87 ----1424
NM_001039580chr4104803 4603 4553 4290 3804 3726 1930 1383 1126 186 --13308 21212 1004
NM_001039585chr1104068 3623 3543 2683 1253 1087 870 660 421 71 13748 11092 --
NM_001039590chrX63987 3255 1448 1372 1259 918 13100 12604 23981 320
NM_001039591chrX63987 3255 1448 1372 1259 918 13100 12604 23981 320
NM_001039618chr11115797 5355 5278 4468 3706 1775 1733 1726 738 445 63 ----11855
NM_001039690chr164945 627 387 243 11523 31503 903 660 --
NM_001039840chrX115704 5422 4500 4228 3738 2366 1908 1715 1658 1540 1481 15864 1402 --
NM_001039937chr1393794 3381 1593 1305 989 816 463 251 127 1310 11513 1233
NM_001040020chr741371 1239 1201 1176 21302 199 ----
NM_001040092chr81120 ----1402
NM_001040100chr341219 984 965 846 --2330 257 1238
NM_001040101chr471248 1241 1146 1041 1029 423 371 --11368 --
NM_001040142chr272311 2078 1780 733 169 117 101 22193 2177 11773 --
NM_001040143chr272311 2078 1780 733 169 117 101 22193 2177 11773 --
NM_001040144chr164945 627 387 243 11523 31503 903 660 --
NM_001040146chr164945 627 387 243 11523 31503 903 660 --
NM_001040152chr7104790 4397 4377 4243 4106 4012 1984 1740 1544 679 23992 1906 ----
NM_001040214chr682269 1798 1788 1706 661 478 224 126 22074 613 12030 --
NM_001040284chr1655356 4951 4321 1230 1044 11672 13779 --
NM_001040402chr473179 2763 1207 985 751 701 446 --12338 1618
NM_001040409chr22379 25 1403 1830 --
NM_001040429chr1363198 2995 2905 2614 581 209 --1412 --
NM_001040441chr1104811 4183 3910 1526 1321 1193 485 370 325 92 34114 3408 3377 23951 1590 24826 1078
NM_001040446chr542769 2667 2609 767 2591 506 3860 611 123 --
NM_001040450chr1532897 2604 2108 1271 --12177
NM_001040453chr1532897 2604 2108 1271 --12177
NM_001040458chr551576 1421 458 338 223 41674 1561 1233 69 ----
NM_001040665chr7114961 3896 3873 1636 1515 1401 1276 598 592 579 169 1338 ----
NM_001040712chr9103598 3426 2772 2614 2438 1178 1118 637 153 142 1699 ----
NM_001040876chr431492 461 253 --11208 --
NM_001042355chr16105099 4913 4590 4446 3700 2054 1849 900 827 152 --24233 1302 --
NM_001042383chr353301 2483 2458 2428 39 --12673 1222
NM_001042404chr161883 1687 1670 517 334 206 3428 340 180 ----
NM_001042412chr16105099 4913 4590 4446 3700 2054 1849 900 827 152 --24233 1302 --
NM_001042413chr983512 3428 1611 1498 1299 1015 979 76 ------
NM_001042424chr472863 2809 2611 2270 873 229 117 --13040 1887
NM_001042425chr631607 558 546 11156 --1351
NM_001042473chr1051967 1667 1434 638 170 1430 ----
NM_001042479chrX61831 1691 1389 592 444 361 1519 --11909
NM_001042480chrX61831 1691 1389 592 444 361 1519 --11909
NM_001042492chr1753384 2199 736 573 543 31400 835 751 12421 12259
NM_001042494chr1562924 2646 974 848 493 279 31322 483 242 ----
NM_001042495chr1562924 2646 974 848 493 279 31322 483 242 ----
NM_001042496chr1562924 2646 974 848 493 279 31322 483 242 ----
NM_001042497chr1562924 2646 974 848 493 279 31322 483 242 ----
NM_001042510chr82785 53 --190 11681
NM_001042511chr82785 53 --190 11681
NM_001042537chrX42521 1990 1884 1562 1685 12074 1173
NM_001042555chr1264575 3956 3637 1462 1438 1134 13497 13717 --
NM_001042599chr2137895 7170 6639 6228 6071 5315 4897 2466 2251 2217 1952 1670 1463 66362 6281 5697 2318 1228 301 27055 2759 --
NM_001042601chr342875 2088 934 25 12014 1418 12560
NM_001042603chr1245297 4809 4063 624 ----14739
NM_001042604chr3114120 4021 3915 3829 3685 3317 1914 1634 833 781 257 13179 11761 --
NM_001042749chrX41698 1607 1569 174 --11895 --
NM_001042750chrX41698 1607 1569 174 --11895 --
NM_001042751chrX41698 1607 1569 174 --11895 --
NM_001043318chr1484151 3655 3585 3229 928 858 605 588 23341 2965 11254 --
NM_001044305chr651644 1238 1177 1119 556 --21308 361 --
NM_001044385chr264008 3780 3447 3268 1343 1094 --12919 --
NM_001044722chr521903 1845 --12191 11645
NM_001044723chr521903 1845 --12191 11645
NM_001046chr553044 2959 856 396 379 ------
NM_001049chr1472481 2436 2286 1794 763 365 216 --1798 12400
NM_001068chr3133 --1281 1275
NM_001071775chr1351641 1429 1390 667 407 ------
NM_001083620chr462465 2201 838 575 421 355 --2580 429 --
NM_001083621chr184487 3743 3654 3614 3484 2987 1697 475 ----14240
NM_001099678chr351935 1430 1336 1279 470 --25794 558 21114 572
NM_001100108chr187859 7358 7210 7117 6724 5894 2732 365 76928 5770 5252 1700 775 542 180 27914 2786 --
NM_001106chr3119073 7366 6930 2778 2633 2578 2567 1201 412 228 96 48034 7946 7023 1451 29686 8553 --
NM_001113490chrX43145 2351 2216 1266 13123 33139 3105 2843 --
NM_001117chr1851696 1654 990 479 63 --11562 11702
NM_001121chr1071928 1341 1334 1190 608 265 113 ------
NM_001122679chr55408 392 372 248 232 1509 --1525
NM_001128chr1684011 3561 1609 1408 1056 901 648 610 ------
NM_001144chr1661453 1036 884 493 447 349 --11099 --
NM_001148chr461748 1739 1571 1557 727 498 ----11821
NM_001149chr104873 566 449 435 1373 ----
NM_001157chr103660 524 93 --186 --
NM_001173chr1483878 1826 1096 1071 916 587 213 46 33831 1890 948 1166 --
NM_001177chr1252175 2128 1908 1594 796 ------
NM_001186chr2152997 2736 2489 2172 232 125 --11173
NM_001198chr632086 1997 528 22111 1578 --12364
NM_001204chr2206647 6561 6308 5764 5534 5155 4948 3089 2980 2551 2430 2074 1585 1282 1264 815 783 588 532 435 27571 5524 17676 11702
NM_001206chr962664 2441 2434 2387 753 67 12009 1717 --
NM_001219chr742144 2053 1544 329 12244 198 --
NM_001257chr1641285 1084 969 71 ----21197 527
NM_001270chr551158 1110 1088 975 94 ----156
NM_001282chr1782698 2530 2474 1816 894 628 609 362 12066 1791 --
NM_001310chr1272198 1996 1010 737 578 212 203 1708 ----
NM_001331chr1162842 2103 1839 678 659 417 1997 --12691
NM_001332chr521381 606 --11095 11299
NM_001346chr342829 2223 2077 912 32607 883 27 ----
NM_001351chr341248 536 366 107 ----1703
NM_001356chrX71999 1815 592 549 421 262 35 ------
NM_001364chr11124749 4321 3902 3699 3429 3324 1694 1526 741 674 462 378 11728 21052 144 --
NM_001387chr593197 3055 2908 2133 2017 936 732 331 129 11225 ----
NM_001396chr2172627 2496 2372 2161 2099 556 198 ------
NM_001399chrX83791 3771 2391 1510 1411 1088 958 928 --23363 692 --
NM_001400chr151370 1268 905 399 141 2872 115 ----
NM_001412chrX83494 2707 2608 2420 1452 1401 1262 881 --22524 1373 13746
NM_001415chrX52023 2002 1958 1739 749 ------
NM_001417chr1221460 741 21267 63 --11689
NM_001419chr1994474 3929 3829 3711 3620 2979 1507 641 355 11386 ----
NM_001420chr19103135 2060 1976 1241 1136 1065 891 836 471 391 12975 12482 1959
NM_001423chr1232039 173 136 41892 1699 618 144 1355 1813
NM_001432chr473523 2973 1392 806 547 374 162 23304 410 ----
NM_001438chr183676 2980 2910 1042 994 977 708 111 --21411 54 --
NM_001448chrX31588 591 366 2372 217 --11492
NM_001453chr641618 1493 241 30 11465 1246 11230
NM_001455chr6134457 3557 3526 1657 1600 1006 580 571 563 537 81 45 37 --23206 1187 --
NM_001457chr341425 1260 1179 1006 1246 --2289 268
NM_001483chr731043 429 403 --1373 --
NM_001527chr694833 4328 3489 3474 1480 1272 990 846 606 --23417 1193 --
NM_001530chr1441156 1087 827 198 1232 1114 --
NM_001584chr113128 65 43 --192 --
NM_001609chr1064141 3431 3160 1741 1338 95 33082 2760 1712 11559 --
NM_001616chr283494 3400 3063 2509 2178 1293 674 220 1276 --11281
NM_001621chr753078 2492 2368 1946 641 22705 139 --22916 2518
NM_001621chr753078 2492 2368 1946 641 22705 139 --22916 2518
NM_001624chr631866 1449 363 21395 194 11454 --
NM_001635chr72103 47 --21087 119 11042
NM_001650chr18154145 3948 3892 3867 3560 3370 3312 2983 1610 1227 1153 777 718 571 197 43922 3232 3172 688 ----
NM_001663chr1462626 2421 2151 2004 1858 510 12702 ----
NM_001668chr162037 1984 918 890 729 65 ------
NM_001682chr1262664 2309 1833 224 84 47 2953 930 ----
NM_001683chr352190 1936 1760 892 426 --3810 262 158 --
NM_001684chr194079 4071 3896 3832 998 548 405 221 164 --23752 2708 11015
NM_001690chr372264 2111 1014 879 846 173 83 12124 ----
NM_001695chr874199 3649 3483 1516 1171 705 249 --12676 14182
NM_001701chr961209 1132 307 184 174 37 ----1215
NM_001709chr1132376 2365 329 --12394 --
NM_001713chr551025 945 437 147 59 ------
NM_001730chr1351562 1417 489 474 88 1566 154 1357
NM_001730chr1351562 1417 489 474 88 1566 154 1357
NM_001731chr12--197 --1783
NM_001742chr731648 1610 1357 1502 1672 11248
NM_001753chr761574 1450 1358 1337 1150 458 11773 11864 --
NM_001754chr2174310 4003 3837 3130 3057 2843 300 33073 3051 1305 181 --
NM_001755chr1642310 1697 1616 39 --1195 --
NM_001759chr1255329 4624 3590 1781 335 14865 24378 1194 1954
NM_001777chr353299 1654 1091 642 425 14027 ----
NM_001792chr183957 426 37 2360 139 ----
NM_001795chr1681553 1398 1184 1020 332 221 157 36 --1277 --
NM_001806chr1952964 1980 885 650 519 12105 ----
NM_001822chr21500 --1296 1475
NM_001845chr1351368 1341 853 500 451 --31128 958 69 --
NM_001874chr1295158 3925 3859 3254 3184 1983 1783 821 704 23410 3397 ----
NM_001884chr53451 407 361 --1368 --
NM_001894chr22------191
NM_001895chr2041248 1145 918 264 ----1321
NM_001941chr1873625 2605 1177 902 372 212 193 --11192 --
NM_001949chr64950 486 417 176 13068 1128 --
NM_001969chr1461521 1384 1070 817 752 460 ------
NM_001977chr431398 100 77 21511 1450 2467 249 --
NM_001981chr152219 1866 1658 746 214 11544 11536 --
NM_001987chr1294058 3431 3050 3022 2819 1685 780 455 436 24132 146 23197 2624 1177
NM_001992chr521375 81 22016 1402 ----
NM_001995chr431311 987 482 1198 --21470 1113
NM_001999chr551341 1287 1071 1020 31 ----21026 433
NM_002006chr4135127 5048 4995 4499 4214 4145 4019 3783 3602 1541 965 819 550 ----1857
NM_002015chr1363225 2850 2452 2357 714 273 --12739 13035
NM_002024chrX71820 1486 1444 705 641 125 86 --21468 876 --
NM_002025chrX209176 9130 8948 8141 7799 7329 7002 6666 6537 5923 3589 3543 2423 2274 1956 1636 1260 992 462 416 48220 5862 5811 2173 --18998
NM_002033chr1143445 3052 931 382 23686 3432 --14108
NM_002040chr2122642 1121 2690 650 12918 1735
NM_002061chr1--11543 --1649
NM_002065chr121543 577 --31766 1466 1319 --
NM_002069chr751916 1577 558 547 400 136 ----
NM_002092chr4104725 4013 3736 3720 3597 3191 3073 1595 1099 485 1850 --1212
NM_002126chr1774168 4134 2823 2773 2706 450 112 23007 75 11350 --
NM_002130chr531347 1150 540 --1518 --
NM_002158chr293735 3601 3588 2867 2513 1534 1072 755 531 23292 3032 ----
NM_002182chr352302 2141 2130 1871 1777 ----22791 2451
NM_002210chr283592 3247 3201 2775 1270 738 694 539 1704 ----
NM_002214chr784791 4434 4382 2176 2041 1719 1382 91 13928 13706 --
NM_002223chr1263882 3556 3541 3109 908 522 11493 23845 3490 13470
NM_002247chr1062385 2004 1920 1808 1792 484 21876 1514 ----
NM_002264chr364704 4535 3668 3349 1650 1573 43466 1785 605 36 --13275
NM_002265chr1741183 1156 962 465 ----11006
NM_002267chr1382018 1680 1611 1580 893 725 576 456 22176 135 11991 1505
NM_002268chr331913 1235 383 ----11338
NM_002270chr585466 5332 4869 4009 3618 651 645 436 33563 749 115 13951 --
NM_002271chr136646 496 489 372 136 43 2454 191 ----
NM_002285chr2104153 4015 3549 2944 2803 1609 783 685 377 345 --1855 --
NM_002309chr2253045 1971 1175 125 102 --12314 1321
NM_002310chr5106171 6150 6111 4749 4725 4395 4152 1866 1176 712 2675 242 2640 318 --
NM_002336chr12115062 4994 4513 4453 3920 3819 2019 1487 1456 1383 290 3423 266 107 25019 4445 14410
NM_002349chr241274 1253 594 492 ------
NM_002351chrX3505 243 94 --1685 1595
NM_002356chr652489 2158 2132 1898 917 2661 202 1827 --
NM_002374chr253434 3246 2418 2357 123 33229 2395 429 13553 196
NM_002522chr1773692 2685 2611 1569 1274 1162 505 11000 13019 --
NM_002524chr151129 1106 345 339 274 --1975 --
NM_002526chr661452 1307 1182 695 153 60 1283 1623 --
NM_002545chr11124641 4312 4207 3349 1941 1878 1784 1772 1671 762 378 50 178 --13992
NM_002547chrX104246 3601 3369 3360 3297 3046 2997 934 783 73 1272 43720 1704 1419 687 --
NM_002570chr1531066 1004 420 1151 1971 1238
NM_002581chr985613 4789 4015 3670 2212 2035 417 367 12184 25054 2085 14052
NM_002594chr2012091 21717 1509 1846 11790
NM_002595chr1261594 1554 682 590 147 23 --11571 11191
NM_002610chr242837 2801 693 160 ----1703
NM_002612chr751495 1366 455 255 99 ------
NM_002613chr16105039 5005 4739 4410 2156 1653 1584 1332 1015 197 54708 4100 1042 360 84 44299 3498 1489 323 --
NM_002645chr1162192 2097 487 409 73 43 --22523 251 --
NM_002655chr833650 991 119 --64668 4593 4484 1421 622 293 15050
NM_002657chr2063083 2641 2423 1428 817 418 21355 1262 ----
NM_002667chr641203 461 286 272 --11186 194
NM_002670chr331119 529 326 --1563 --
NM_002698chr1972108 1974 1902 704 625 545 288 22386 2122 1250 2602 568
NM_002709chr2103619 3300 3162 3092 2617 2296 1319 1219 658 485 1315 11001 --
NM_002716chr1183103 2716 2532 2462 1394 922 455 46 13673 ----
NM_002718chr322424 197 22547 575 ----
NM_002719chr1432197 2030 940 21537 380 12228 --
NM_002731chr182836 2008 926 893 829 720 543 437 1951 ----
NM_002737chr1796358 5987 5868 4532 2095 1573 742 718 21 25720 4090 52542 1924 1266 582 553 --
NM_002740chr3268 56 21982 930 1353 --
NM_002742chr142500 271 1297 --1161
NM_002813chr1271537 1444 1397 1255 1079 1045 211 1378 ----
NM_002814chrX1127 ----161
NM_002827chr2031339 1203 219 1579 --21825 228
NM_002837chr12154559 3944 3936 3803 3756 3725 3378 2882 1395 1380 1237 1036 674 507 480 33769 3476 633 ----
NM_002838chr15874 779 427 188 30 1112 ----
NM_002839chr9103598 3426 2772 2614 2438 1178 1118 637 153 142 1699 ----
NM_002840chr121468 238 ----21666 1287
NM_002857chr152728 2631 2333 2218 874 12089 1879 1521
NM_002858chr121184 123 21096 314 --1461
NM_002869chr1172213 1569 1500 736 494 462 168 ------
NM_002874chr921818 931 --22266 2109 --
NM_002886chr355149 4452 4321 4094 1461 11125 11483 --
NM_002906chr113855 306 138 12233 ----
NM_002940chr431492 461 253 --11208 --
NM_002941chr351481 1281 606 560 112 1234 ----
NM_002942chr341440 1420 1072 989 --1466 1557
NM_002959chr154451 4317 3977 3892 3842 13183 1858 32901 2802 595
NM_003010chr1752113 2106 1660 948 371 11900 12180 1834
NM_003012chr872786 1941 972 848 524 494 180 ----1286
NM_003013chr43840 819 727 1244 ----
NM_003014chr731532 1332 1100 --11480 1190
NM_003017chr651205 418 298 278 130 --1290 --
NM_003030chr371944 1704 1493 793 500 415 395 ------
NM_003031chr16--3967 844 203 --2882 395
NM_003043chr3114322 4169 3831 3702 3595 1709 1570 1411 1226 568 516 --23688 2888 13535
NM_003051chr131521 1418 403 1330 11273 --
NM_003068chr851024 955 818 777 63 21096 352 ----
NM_003070chr94240 187 147 121 ------
NM_003071chr351658 1356 504 444 333 1732 11721 --
NM_003100chr5------193
NM_003108chr2106198 5925 5838 5808 4587 2719 1627 1173 812 733 12476 1933 26088 1455
NM_003128chr232359 1917 936 --1757 22013 536
NM_003142chr2------1272
NM_003144chr652246 1516 1402 628 190 1209 --1461
NM_003149chr341649 1237 1221 410 11403 --1275
NM_003155chr872632 2305 2167 2014 1914 1889 1759 134 ----
NM_003157chr34713 613 394 74 --1232 --
NM_003161chr1793034 2489 2349 2294 578 497 435 412 144 12258 --23287 2805
NM_003185chr2051361 1016 970 951 438 ----1255
NM_003199chr18165700 4736 4705 4584 4360 3556 2142 2101 1909 1902 1662 977 629 548 81 72 25103 3451 45189 4485 2135 1434 --
NM_003220chr631607 558 546 11156 --1351
NM_003221chr694137 3725 3251 3029 2972 1423 422 324 54 23237 3053 ----
NM_003236chr253118 2544 2193 1088 906 22918 2722 33300 974 102 --
NM_003246chr1541515 406 232 185 1725 11589 137
NM_003247chr661873 1519 697 627 504 157 --1484 --
NM_003262chr375225 4058 3662 2002 1883 1686 745 24067 1039 --1536
NM_003274chr2162676 2305 2213 1185 1068 91 12056 ----
NM_003275chr941263 965 555 417 21065 251 ----
NM_003286chr202902 62 --1141 1118
NM_003298chr365394 4703 4142 4129 2249 1756 15736 15789 --
NM_003320chr1174474 4437 3512 3368 878 555 500 23965 957 ----
NM_003339chr521289 31 ----2236 174
NM_003392chr323768 3274 23667 3230 34070 652 507 --
NM_003404chr2041826 1312 575 156 ----11719
NM_003406chr841645 1613 689 77 21385 480 ----
NM_003409chr1871427 1275 1163 1142 586 493 191 11182 ----
NM_003410chrX73117 3109 2548 2150 762 665 116 22189 522 ----
NM_003412chr362768 1217 1141 808 765 667 --1108 12006
NM_003421chr10114441 3985 3958 3687 3653 3571 3450 2891 1771 1308 927 54078 3876 1396 1372 846 1534 --
NM_003430chr19101691 1593 580 508 376 311 292 227 208 136 --1545 --
NM_003439chr753410 1102 1065 649 402 2579 23 1407 --
NM_003458chr394058 3894 3147 2932 1438 913 640 605 123 13724 11376 --
NM_003463chr62891 816 23316 266 12250 --
NM_003468chr243228 3102 3022 1216 --23545 948 13749
NM_003473chr104442 318 296 275 ------
NM_003474chr1041958 1709 1691 872 1909 1918 1679
NM_003478chr1153161 3103 2827 1168 820 ------
NM_003482chr1292781 2326 2313 1724 958 732 648 592 169 ------
NM_003483chr1262911 2337 1994 1971 682 388 --11899 1640
NM_003488chr174686 661 624 88 --2888 359 1218
NM_003489chr2153218 2932 2370 933 632 1946 12946 13035
NM_003505chr731869 1498 665 --2656 217 --
NM_003551chr51446 ----127
NM_003566chr1293064 2567 2492 2479 2425 1304 835 327 273 ------
NM_003574chr1885782 5776 5650 5023 3781 2226 1880 1111 --1179 --
NM_003576chr1342829 2027 995 695 --2496 309 12158
NM_003590chr264038 3664 3361 2681 1117 138 11308 11590 13436
NM_003597chr242256 1599 876 278 31982 827 409 12067 --
NM_003615chr353595 2443 1102 1083 648 12944 11314 --
NM_003618chr221324 1070 ----11243
NM_003626chr11--21170 290 11056 21152 421
NM_003644chr17126248 6215 6197 6096 4527 4112 2632 1540 1369 1228 604 269 35430 5318 1680 1196 32560 2410 874
NM_003663chr373502 3018 2490 2461 2314 1333 826 2731 525 32648 2278 1379 13100
NM_003671chr962323 1401 1298 799 268 227 ------
NM_003679chr163309 3078 2858 2289 1091 846 ------
NM_003681chr2176218 5355 5133 5037 4338 4196 673 44729 4502 2433 2284 ----
NM_003692chr94740 653 291 211 --1745 --
NM_003713chr141498 1300 655 277 1197 ----
NM_003714chr562664 2108 1882 997 710 539 12911 ----
NM_003743chr241842 1750 1641 54 1605 ----
NM_003759chr473862 2809 2798 2691 2606 1030 408 22685 1412 31161 556 419 --
NM_003760chr14825 746 536 194 ------
NM_003763chr2032789 1167 127 42461 922 736 416 12407 1512
NM_003783chr171174 1163 1109 1079 898 762 251 ------
NM_003787chr1841722 1625 1295 522 --11207 --
NM_003822chr172989 2659 2435 1239 1165 628 209 1585 1781 --
NM_003872chr283060 3009 2995 2148 1208 588 490 107 --1712 --
NM_003873chr1052076 1597 835 620 156 12528 1717 --
NM_003885chr1742523 2322 1675 895 12198 --12275
NM_003895chr2162174 2135 1857 1507 1483 489 1560 ----
NM_003913chr674073 1712 1485 1423 875 595 80 21346 544 22874 1047 --
NM_003922chr151120 ----1109
NM_003924chr42556 221 --21272 226 --
NM_003927chr181402 ----1979
NM_003931chr6--1173 --1236
NM_003932chr2241754 1661 404 266 --1227 179
NM_003941chr71430 ----22356 879
NM_003958chr653568 3427 2602 2550 772 22725 999 --12586
NM_003966chr5117522 7503 6910 5942 5663 5107 4881 2251 1561 1431 502 1123 26764 2256 --
NM_003971chr173630 533 254 --1542 1231
NM_003983chr1663718 2995 1077 931 817 781 14264 14419 --
NM_003994chr1243383 1607 647 87 23653 620 1395 1114
NM_004006chrX52467 2090 1797 1637 461 ------
NM_004007chrX52467 2090 1797 1637 461 ------
NM_004009chrX52467 2090 1797 1637 461 ------
NM_004010chrX52467 2090 1797 1637 461 ------
NM_004011chrX52467 2090 1797 1637 461 ------
NM_004012chrX52467 2090 1797 1637 461 ------
NM_004013chrX52467 2090 1797 1637 461 ------
NM_004014chrX52467 2090 1797 1637 461 ------
NM_004015chrX52467 2090 1797 1637 461 ------
NM_004016chrX42381 2004 1711 375 ------
NM_004017chrX52467 2090 1797 1637 461 ------
NM_004018chrX42381 2004 1711 375 ------
NM_004020chrX52467 2090 1797 1637 461 ------
NM_004021chrX42381 2004 1711 375 ------
NM_004022chrX42381 2004 1711 375 ------
NM_004023chrX42381 2004 1711 375 ------
NM_004028chr18154145 3948 3892 3867 3560 3370 3312 2983 1610 1227 1153 777 718 571 197 43922 3232 3172 688 ----
NM_004050chr1462583 2488 1762 931 664 515 ----11743
NM_004087chr321680 359 --11444 11502
NM_004094chr1463045 2909 2531 1860 394 356 42894 2677 2344 2210 1243 12380
NM_004098chr1061173 1035 969 391 236 188 --195 --
NM_004100chr662603 2273 2185 1944 627 273 12672 11847 12529
NM_004113chr361927 1847 1679 1316 546 341 --1386 11474
NM_004117chr672107 1887 1639 1587 1466 563 218 ------
NM_004124chr1452769 1292 1228 362 302 33253 1157 416 13137 --
NM_004133chr872077 2014 1893 1060 1031 440 84 ------
NM_004136chr1532233 2155 748 22451 278 --12181
NM_004161chr23624 388 212 ----11480
NM_004170chr941894 1493 1430 384 1460 1122 21179 532
NM_004171chr11188756 8197 7934 7758 7233 7201 6856 6739 5888 3511 3250 2864 2855 1773 1204 387 68 32 13533 36892 6128 1397 16557
NM_004172chr551822 543 334 254 93 21971 1393 11677 --
NM_004185chr14699 610 571 37 ----1736
NM_004227chr772924 2859 2782 2092 1113 861 389 21992 876 1744 --
NM_004229chrX52002 565 485 412 301 ----12107
NM_004232chr1873825 3584 3515 3464 2432 781 445 33738 2406 1203 168 --
NM_004274chr1463109 2862 1234 987 873 650 11228 32592 2448 186 --
NM_004296chr1472928 1568 1464 1340 1283 1132 862 33251 2483 573 ----
NM_004316chr1221037 779 --11124 11160
NM_004331chr852684 1767 1053 643 161 1580 12454 --
NM_004338chr18156850 6229 5853 5708 5239 4888 4456 4331 1912 1820 1593 1424 211 124 102 37062 2729 170 25642 189 --
NM_004342chr782247 2207 1843 1790 1745 1536 716 136 ------
NM_004346chr451568 1527 451 392 164 21090 624 ----
NM_004370chr631953 859 391 1625 21893 132 --
NM_004384chr521903 1845 --12191 11645
NM_004392chr1372407 2304 817 791 741 598 535 ------
NM_004430chr83971 641 616 ----12484
NM_004432chr962438 1818 1562 971 711 566 12216 ----
NM_004437chr143215 2513 818 336 12670 42960 2858 2377 550 --
NM_004438chr283134 2604 2195 1038 1010 660 637 556 33288 2681 2301 2724 218 --
NM_004454chr361763 1638 798 651 57 27 21819 467 2859 426 1600
NM_004458chrX52665 2545 2453 836 788 --12077 --
NM_004480chr148669 329 296 248 71 46 31 22 158 ----
NM_004496chr1421239 69 1229 --185
NM_004500chr1461876 1780 1747 722 639 481 1656 11468 --
NM_004501chr183724 3220 3206 3114 3108 2792 1586 693 22742 1438 --13883
NM_004504chr252729 1862 1074 920 29 ----12109
NM_004505chr1761992 378 341 302 186 90 ------
NM_004513chr1563841 1550 1411 270 219 146 13902 1732 12590
NM_004523chr1031554 1243 555 11418 ----
NM_004529chr92518 284 1212 --1290
NM_004571chr2162631 1140 1094 509 327 46 --13250 --
NM_004580chr152593 103 --11644 1565
NM_004586chrX25108 3825 35482 5345 3862 14600 --
NM_004598chr573165 2417 2151 1289 773 561 290 ----32671 1192 986
NM_004600chr151399 1060 567 535 259 ------
NM_004620chr113603 158 78 ----188
NM_004654chrY41409 210 95 58 1107 ----
NM_004657chr241488 1420 1379 564 --31598 1450 64 --
NM_004663chr1541598 458 323 225 1343 1439 --
NM_004666chr631292 153 129 --1255 --
NM_004673chr171558 1421 1402 1339 1053 428 287 11290 1969 --
NM_004685chr1372992 2519 2469 2299 1992 1174 637 ------
NM_004687chr1772073 2051 1728 705 380 362 226 --11941 --
NM_004725chr1071511 1489 1274 1019 968 227 167 ------
NM_004726chrX105338 4503 3744 2280 1815 1764 1585 1478 940 910 ----14077
NM_004730chr552080 1781 656 369 166 12198 11536 --
NM_004734chr1343291 2826 2641 2526 ----11226
NM_004741chr1051583 1397 1110 995 185 11324 --21235 1136
NM_004742chr351854 1510 1368 518 256 1487 ----
NM_004744chr4103695 3513 3143 3028 1422 1250 830 426 418 221 --11482 23054 1364
NM_004745chr885866 5299 4684 4302 2273 2049 1358 399 35673 5399 2420 --16268
NM_004747chr1041631 1567 1548 1479 --2523 326 11437
NM_004748chr1583235 3227 2929 1496 1460 777 354 141 21027 498 ----
NM_004763chr26749 693 413 357 301 55 ------
NM_004770chr81234 ----1204
NM_004772chr541181 982 292 151 1167 1411 --
NM_004774chr1763172 2623 2115 1145 740 166 168 --12355
NM_004775chr1872426 2340 2220 1971 1810 1615 48 ----11822
NM_004788chr1142715 1994 1699 48 122 ----
NM_004797chr363663 3492 3302 402 306 204 12389 12683 --
NM_004815chr164660 3286 1742 764 667 590 2976 112 ----
NM_004834chr243280 876 298 122 1940 23288 1301 11090
NM_004840chrX92464 2395 2044 1505 977 738 549 513 483 ------
NM_004842chr641791 1759 1196 1174 ----11187
NM_004849chr651302 1120 498 341 213 1124 ----
NM_004859chr1752254 2116 553 387 145 ----22874 1217
NM_004863chr1435339 4333 4021 14575 11343 --
NM_004866chr574491 4073 1907 1485 1110 98 68 1390 13414 --
NM_004871chr1733361 3333 1696 1273 --23452 330
NM_004904chr7126566 5888 5314 5284 4745 4151 2262 1769 738 477 266 88 35058 1561 346 --11730
NM_004912chr741636 1597 1306 287 21300 26 ----
NM_004926chr141267 31196 634 330 21855 1242 --
NM_004929chr831461 1424 271 ----1385
NM_004932chr551697 1491 1152 562 452 11370 1641 --
NM_004949chr1841484 386 374 47 11503 --1271
NM_004956chr784079 3562 3545 2935 1286 1050 967 694 22861 1220 21737 1366 1755
NM_004985chr1283045 3017 2844 1610 1369 723 451 331 --11206 11172
NM_004992chrX128460 7379 7248 7221 5510 5178 2487 1034 1015 336 303 200 37372 1069 31 15650 --
NM_004992chrX128460 7379 7248 7221 5510 5178 2487 1034 1015 336 303 200 37372 1069 31 15650 --
NM_004999chr684498 4419 4250 3801 3723 3234 3091 1361 23681 421 ----
NM_005010chr731592 1381 719 ----1779
NM_005023chr541490 542 338 115 ------
NM_005028chr1072209 2099 1613 753 110 79 24 --1453 12129
NM_005036chr22138360 7188 6782 6770 5559 5517 3028 2491 1909 1178 1075 875 90 16594 17735 26441 6433
NM_005044chrX74020 3992 3872 3535 2803 1409 345 33337 3287 76 ----
NM_005056chr1255541 5053 4307 868 142 ----24983 214
NM_005065chr14105158 4955 4625 4522 4089 3775 3327 886 880 853 --13965 --
NM_005068chr62522 210 2917 546 21168 373 1360
NM_005095chr191861 1820 1761 1729 1508 758 659 399 48 1554 21597 286 1721
NM_005121chr1783764 3724 3569 2515 2408 1258 1144 130 22898 2747 ----
NM_005126chr332326 1933 1766 12310 --11821
NM_005135chr1562924 2646 974 848 493 279 31322 483 242 ----
NM_005156chr965361 5066 4500 846 538 389 --1572 --
NM_005164chr1272133 958 634 482 397 320 172 12559 1651 --
NM_005188chr11118041 7437 6419 6359 5783 5302 3331 2721 2694 1659 517 --13154 --
NM_005197chr14126163 6003 5448 5095 5027 4744 3895 2369 1782 1595 894 528 --11305 16125
NM_005233chr3112603 2070 1891 1785 1645 898 858 849 300 135 71 42457 1810 1702 471 ----
NM_005235chr2137895 7170 6639 6228 6071 5315 4897 2466 2251 2217 1952 1670 1463 66362 6281 5697 2318 1228 301 27055 2759 --
NM_005259chr211354 ----1191
NM_005296chrX6672 361 212 180 105 62 1944 ----
NM_005311chr7122865 2826 2698 2663 2528 2273 2181 1929 1734 805 505 263 11820 1592 --
NM_005329chr1662258 2168 1817 1733 1704 1641 32074 617 313 21780 129 --
NM_005342chrX32792 2414 837 --2905 433 1694
NM_005359chr18116518 6190 5517 5198 4748 4422 4209 1868 1253 1134 941 12476 24773 4456 --
NM_005388chr951630 1491 1216 1047 201 ------
NM_005397chr753804 3571 3444 2940 1346 22878 46 13157 1169
NM_005399chr143818 3639 1163 354 --13073 --
NM_005406chr1821439 100 11105 1434 152
NM_005426chr12753 698 1376 2861 825 --
NM_005433chr183928 582 569 12043 130 --
NM_005455chr141868 1817 1737 392 ----11392
NM_005475chr1293285 3081 2667 2322 1257 689 544 424 372 --12713 12784
NM_005504chr12146599 5935 5456 5423 4989 4969 4886 4522 2619 2290 1604 1367 359 61 15811 46308 5944 4708 1143 --
NM_005506chr412703 --1249 12355
NM_005509chr551891 1656 1547 424 88 ----11716
NM_005565chr54569 459 402 81 ------
NM_005578chr3114712 4248 4066 3961 3751 3272 1453 1293 838 690 39 41729 1335 1041 83 2843 587 --
NM_005591chr1192652 2625 2592 2351 2038 1878 398 136 58 --12504 --
NM_005596chr995674 5628 5060 2276 2263 1355 1296 1212 106 --36134 2169 1247 11040
NM_005599chr131195 1032 601 --2570 357 1445
NM_005638chrX41502 1414 1314 72 --11783 --
NM_005639chr1271856 1586 1225 558 520 203 152 ----11298
NM_005647chrX--1207 12903 22418 379
NM_005650chr2221375 1317 1196 1493 --
NM_005665chr193953 3890 1952 1406 1026 918 912 445 182 --13357 --
NM_005668chr584264 3993 3679 3447 1256 991 607 377 21161 393 22998 2989 --
NM_005717chr131241 1220 988 ----21141 1072
NM_005738chr751996 1822 1609 1309 59 --22065 215 --
NM_005739chr1572366 2179 1752 1711 763 752 382 --32250 1769 71 --
NM_005746chr762760 2749 2063 455 377 268 ------
NM_005779chr563544 2658 2348 1334 474 460 33653 2409 2285 23289 3000 --
NM_005780chr133741 698 352 1671 1339 --
NM_005788chr11--1745 --1535
NM_005795chr282938 2459 2207 2042 1859 835 423 342 23033 963 22985 2131 13054
NM_005797chr1151183 1148 505 262 140 --21800 1313 --
NM_005798chr1355288 5197 3993 3570 1500 11348 ----
NM_005801chr176789 652 298 277 241 161 --2732 645 --
NM_005807chr12602 566 --1680 1191
NM_005813chr262552 2162 1660 975 726 220 ----22172 522
NM_005822chr662277 1743 1733 840 310 131 1292 1775 --
NM_005828chr1765002 4317 4121 765 468 426 23658 682 14632 --
NM_005832chr341259 1134 984 159 ----11342
NM_005840chrX86989 6690 6464 6282 5045 3033 733 93 35594 5452 2286 24785 2279 16063
NM_005843chr251958 1945 1709 406 305 11307 21827 329 --
NM_005863chr1021431 469 ----1505
NM_005875chr33376 120 51 1310 ----
NM_005898chr1152968 2712 1213 1122 707 12310 --2406 372
NM_005900chr431080 1017 305 1296 11214 --
NM_005901chr18108288 6856 2284 2128 1889 1748 1082 731 568 412 11998 12122 27909 5348
NM_005902chr15114620 4276 4242 4226 3647 3620 1803 1760 534 439 163 24190 3201 13057 --
NM_005903chr554697 4279 4177 1722 958 14592 15243 13309
NM_005909chr533038 2652 1414 ----1502
NM_005924chr74909 756 467 54 2876 316 1766 --
NM_005935chr475024 4835 4687 4220 3686 1092 96 31310 527 314 ----
NM_005941chr884034 3721 3633 3627 3261 1201 817 133 43357 2898 1031 399 11672 --
NM_005955chr1125455 5375 4742 4305 3867 1803 1731 1520 1420 1086 620 468 ------
NM_005962chr102207 59 --12216 12326
NM_005962chr102207 59 --12216 12326
NM_005986chr1342427 781 141 100 22866 1955 22274 2025 --
NM_006011chr1573873 3415 2750 579 406 93 81 --23844 334 13904
NM_006016chr652303 2025 1987 1530 767 --21535 1509 --
NM_006030chr391731 1578 1530 1158 662 542 398 392 237 1201 ----
NM_006037chr284495 3726 1471 971 943 753 370 227 1458 1399 --
NM_006047chr20103553 3317 3130 2879 2814 1398 1356 737 677 178 ------
NM_006055chr263103 3079 2166 1152 102 55 ------
NM_006060chr773793 3256 1497 1359 951 256 27 11270 23287 1058 --
NM_006079chr66671 555 335 149 139 33 ------
NM_006095chr494526 3893 3830 3348 1780 1708 1161 719 495 21455 805 --1445
NM_006106chr1132979 2390 115 11224 --22782 461
NM_006108chr111946 22242 912 12389 22091 1876
NM_006122chr1572647 2364 2177 1812 1718 953 714 --21739 179 173
NM_006133chr1172498 2427 2244 2221 1884 1860 571 12400 32330 2009 96 --
NM_006139chr252354 2091 2084 1895 367 1676 --11132
NM_006154chr1552945 2828 2716 2658 2487 --11151 --
NM_006166chr1242370 2361 2318 1765 1817 1967 --
NM_006186chr23381 276 160 ----11297
NM_006194chr1411308 ----3923 505 326
NM_006203chr594617 4471 4019 3805 3601 1511 1020 414 215 25447 4923 24310 706 13995
NM_006209chr81120 ----1402
NM_006224chr1762158 2048 1608 1545 639 177 12238 11853 12452
NM_006237chr1382310 2220 2044 1849 1707 1562 609 454 --1428 1466
NM_006246chr1471200 1129 1043 949 924 880 223 ------
NM_006251chr552938 2513 2301 1030 844 --11141 --
NM_006252chr1177537 7358 7331 7086 6936 6861 6841 6780 6320 6274 5750 5350 5314 4603 752 551 286 1312 --11281
NM_006256chr172521 2461 2329 2321 1064 931 704 1759 ----
NM_006258chr1051558 1195 1020 1011 67 21078 1028 11147 --
NM_006265chr82430 49 11376 --11091
NM_006267chr251819 1635 1490 680 115 1289 11393 --
NM_006281chr841186 861 799 288 --11012 --
NM_006281chr841186 861 799 288 --11012 --
NM_006283chr8104936 4528 4187 4007 3341 3295 3036 1711 1394 1387 24542 3836 ----
NM_006287chr252108 1021 835 438 265 22086 292 --11701
NM_006306chrX94953 4693 3671 3654 2322 2236 1093 822 770 14559 --14488
NM_006315chr454474 4303 3901 1222 25 44173 3117 1718 526 14353 13264
NM_006320chr44794 182 114 62 --1914 21173 986
NM_006330chr831552 376 58 --11252 11575
NM_006359chrX42521 1990 1884 1562 1685 12074 1173
NM_006371chr385238 5174 4983 4363 4301 3766 3619 3578 11917 ----
NM_006379chr761910 1663 1434 408 139 38 ----12276
NM_006393chr1094080 3712 3446 3115 2759 1121 418 200 46 21452 379 ----
NM_006415chr92926 461 11008 11307 1486
NM_006416chr64795 515 143 86 138 1520 --
NM_006420chr2042633 2282 322 269 --1904 --
NM_006434chr1083265 2648 2641 1270 1052 535 392 154 12224 ----
NM_006439chr43154 70 33 --193 1185
NM_006460chr1731528 663 327 11388 2668 293 11677
NM_006469chr1--21479 24 --1250
NM_006517chrX82349 2287 2108 1693 535 397 164 99 --1882 --
NM_006524chr7121125 1089 1050 966 805 786 721 385 301 217 133 49 ------
NM_006526chr2081829 1801 1606 853 847 808 579 430 ----1214
NM_006529chr42633 95 2397 255 11413 --
NM_006534chr2093184 2819 2637 2499 2396 1341 894 686 42 ------
NM_006544chr14106109 5149 4679 4287 2172 2005 1402 1285 1201 605 11810 23916 1193 --
NM_006546chr1756603 6190 4247 2551 2470 14435 --16647
NM_006548chr321718 381 21096 98 11528 11676
NM_006557chr941246 286 210 186 --21261 191 --
NM_006561chr10135485 5380 4942 4537 4360 4322 3873 2356 2200 2144 454 360 294 25944 3936 22169 1741 --
NM_006572chr1753116 2478 953 848 314 23374 3306 13518 --
NM_006577chr231289 851 138 21193 92 1385 --
NM_006599chr16157783 7360 7332 7197 7098 7030 6749 5776 5571 5250 5131 5086 2715 2199 2059 26785 1128 36321 2749 1238 --
NM_006603chrX41698 1607 1569 174 --11895 --
NM_006609chr242914 2440 678 300 ----1306
NM_006614chr362865 2741 2706 1328 672 441 --22959 245 --
NM_006618chr1169 31145 1128 101 21504 608 --
NM_006620chr664863 4312 3933 3367 1947 1542 --2957 656 13134
NM_006624chr102771 626 11998 --11503
NM_006625chr14913 413 350 181 ------
NM_006625chr14913 413 350 181 ------
NM_006625chr14913 413 350 181 ------
NM_006628chr1561549 1067 895 753 523 286 ----13815
NM_006636chr22379 25 1403 1830 --
NM_006654chr1264575 3956 3637 1462 1438 1134 13497 13717 --
NM_006667chrX31093 740 459 11160 2396 194 --
NM_006699chr172657 2393 2254 2233 1051 610 485 2880 423 11989 --
NM_006717chr953010 2355 1184 1063 110 42941 2905 2630 693 13405 --
NM_006722chr3112911 2785 2715 2687 2433 2075 1201 257 220 198 170 1539 132 --
NM_006729chrX145593 5429 5129 4685 4407 4030 4007 2126 1723 1579 1502 1485 1201 772 35526 5171 4478 12028 1682
NM_006746chrX41267 620 585 268 ------
NM_006750chr16157989 7784 7692 7621 7484 7228 6358 6166 5229 3079 2902 2407 1381 1176 1082 27903 6825 37848 5432 1927 15614
NM_006766chr83833 452 438 --12114 168
NM_006775chr653140 1945 912 808 784 --12446 --
NM_006777chrX2593 72 ----12051
NM_006826chr21238 ----11019
NM_006832chr144736 297 194 158 2254 135 --2312 265
NM_006852chr1772839 2324 2173 1150 1133 384 49 --22650 23 --
NM_006868chr1853019 2985 2937 2205 942 12114 --1660
NM_006873chr21827 13211 21213 874 22282 426
NM_006884chr371944 1704 1493 793 500 415 395 ------
NM_006885chr16104139 4115 3660 3644 3585 3125 1634 353 324 24 13716 --159
NM_006888chr1493527 3432 3303 2818 2692 1050 677 455 380 --33507 3006 513 --
NM_006892chr2061344 1279 1148 1011 892 458 ----1203
NM_006892chr2061344 1279 1148 1011 892 458 ----1203
NM_006895chr2102226 2181 1782 1685 1482 1383 874 836 788 220 --31921 802 83 --
NM_006915chrX42102 1612 996 328 ------
NM_006916chr261420 1314 1113 567 340 285 176 ----
NM_006918chr11115886 5384 5341 4712 4163 3907 3643 2177 1044 1012 654 23653 3627 24112 883 --
NM_006920chr281982 1359 758 619 296 168 100 33 11946 1119 --
NM_006922chr272517 2418 1776 1635 974 114 98 ----22146 1870
NM_006924chr1784382 1714 1563 1320 1045 638 592 86 11467 ----
NM_006938chr182283 83 ----1328
NM_006939chr143419 383 100 1980 ----
NM_006940chr1261736 1367 1227 317 195 186 ------
NM_006948chr2172220 1585 846 553 539 327 215 12357 ----
NM_006981chr982281 2071 1840 1109 851 602 533 485 22341 1001 --1563
NM_007007chr1254805 1221 763 419 150 11572 34840 4065 1132 --
NM_007011chr1596866 6098 5799 4793 4389 2599 1943 1587 1231 22095 1777 35293 2264 1055 1546
NM_007038chr21125902 5709 5471 5219 4830 4357 4055 1966 1796 1650 1022 716 12301 15682 --
NM_007043chr1221956 1315 1441 11325 --
NM_007050chr20157672 7307 6201 5708 5587 5562 5013 2855 2753 2244 2062 1595 859 269 51 67235 6539 6064 5654 338 298 46636 3050 2935 989 16605
NM_007064chr331330 329 134 11501 11608 --
NM_007073chr674116 3034 2871 1049 644 464 408 13600 22585 294 --
NM_007106chr1322196 609 ----12008
NM_007114chr362765 2442 2422 1117 886 28 13217 ----
NM_007129chr134980 816 285 241 --1345 --
NM_007137chrX75565 4628 2050 2026 1423 912 667 33599 1883 1678 ----
NM_007146chr1772922 2340 2096 1885 877 821 748 185 ----
NM_007195chr1883692 3628 3063 1106 861 584 417 322 12707 22748 2590 12966
NM_007203chr973740 3633 3624 3249 645 294 102 1300 21233 107 1697
NM_007207chr13734 701 211 1362 3856 204 127 --
NM_007218chr82589 269 ----1621
NM_007249chr13179459 9326 8021 7816 7537 7449 6836 6060 6046 5726 3556 2298 2028 1767 1629 1568 353 48589 8214 6403 6179 --28411 3449
NM_007287chr383232 2940 2616 2331 2226 1967 1042 830 23127 2011 1926 --
NM_007288chr383232 2940 2616 2331 2226 1967 1042 830 23127 2011 1926 --
NM_007289chr383232 2940 2616 2331 2226 1967 1042 830 23127 2011 1926 --
NM_007325chrX52132 1815 1632 1601 357 32093 1866 207 --11797
NM_007331chr472766 2737 2024 696 664 434 160 ------
NM_007345chr1862098 1698 1581 906 660 598 ----2764 216
NM_007347chr1562088 793 760 412 244 54 ------
NM_007350chr1274091 3313 3126 3040 2839 1752 1227 23907 3457 11333 12962
NM_012074chr14------21089 203
NM_012081chr583654 3192 2676 2319 505 449 415 32 23601 276 32324 1408 1221 12912
NM_012090chr151192 918 375 329 269 21293 24 1868 --
NM_012097chr271858 1833 1784 1462 641 529 98 ----1383
NM_012104chr1153811 3458 1028 571 501 13333 22855 506 --
NM_012104chr1153811 3458 1028 571 501 13333 22855 506 --
NM_012120chr632540 450 228 23023 1087 22085 1127 1617
NM_012129chr742152 2072 1997 1604 --12419 --
NM_012141chr1393794 3381 1593 1305 989 816 463 251 127 1310 11513 1233
NM_012157chr3--1197 1357 11005
NM_012158chr1341759 1277 1164 670 1701 ----
NM_012164chr9106200 6005 5675 5311 4783 2346 1388 598 559 511 27061 6966 22653 1257 11713
NM_012177chr6------1215
NM_012193chr11115281 4792 4601 3883 3609 3372 1600 1416 625 516 451 ----1107
NM_012197chr921650 358 --11142 11578
NM_012199chr163135 882 682 513 70 47 13858 1891 1178
NM_012214chr2105797 5514 5444 5400 4952 4042 2384 1804 1187 572 15019 1879 1583
NM_012215chr1041959 675 613 198 1780 1652 1102
NM_012219chr383026 3013 1192 876 849 665 515 379 ----1370
NM_012234chr353763 3360 2855 1023 959 --21139 396 1790
NM_012249chr273120 2740 2692 1168 776 545 76 22670 913 12192 --
NM_012252chr7105153 5017 4925 1446 1117 767 551 493 367 232 --21751 1490 11065
NM_012262chr1104472 3884 3568 3399 3373 2052 1888 1869 1055 133 ------
NM_012281chr761920 1842 1816 626 588 545 11609 ----
NM_012288chr6125747 5703 5424 4815 4661 4589 2190 2097 1768 999 906 795 1922 13850 1191
NM_012297chr452627 2620 2201 1701 378 --1624 1442
NM_012300chr531970 1653 1633 --11877 --
NM_012301chr751930 1720 418 351 186 1689 1393 --
NM_012302chr151196 498 418 288 83 --21019 899 --
NM_012304chr581825 1717 1681 980 578 439 198 191 42542 2430 1803 887 138 --
NM_012307chr185940 905 341 209 44 --1318 --
NM_012309chr1194690 4481 4200 4001 3892 3458 3147 713 174 24245 3898 ----
NM_012316chr185568 5500 5461 4245 3473 723 636 179 33920 3595 3493 ----
NM_012329chr172669 588 21537 26 1354 1266
NM_012334chr554741 859 760 613 92 24036 3180 23546 754 1897
NM_012347chr663028 2423 2050 1156 956 820 ------
NM_012383chr92441 287 ----1397
NM_012388chr1562823 2498 2484 2173 484 254 12592 --12468
NM_012397chr1831536 1475 328 3449 223 129 --11708
NM_012399chr225801 415 280 71 36 11476 11421 --
NM_012412chr71759 ----1257
NM_012425chr1031884 602 455 1198 32040 714 83 --
NM_012464chr472824 2281 1110 777 607 264 86 1460 ----
NM_013230chrY41652 1642 1216 48 --21801 1314 11263
NM_013231chr1454106 3971 3799 3222 203 1813 14365 13424
NM_013255chr768737 8271 7991 7354 3169 2855 28623 1832 46273 6205 5672 2916 16937
NM_013257chr832362 2023 1568 --32408 1685 700 --
NM_013261chr433799 3540 2895 22585 414 --1586
NM_013262chr641320 943 542 55 ----1556
NM_013269chr1234188 3776 3054 43878 3317 1801 1098 12763 24170 145
NM_013281chr2031362 577 45 ----1286
NM_013286chr373782 3772 3471 3296 3286 634 328 22649 1287 33103 2926 549 --
NM_013302chr1684720 4219 3723 3493 1684 1412 1169 35 34295 3798 3552 --24516 1773
NM_013341chr272752 2575 1041 307 120 89 24 12898 ----
NM_013354chr841323 564 456 287 11215 --1932
NM_013357chr83617 557 42 1259 ----
NM_013372chr15113411 3118 3042 2766 2393 2128 867 855 636 90 58 2923 682 ----
NM_013374chr362091 766 758 729 271 206 12248 32510 2026 1148 12451
NM_013381chr1262188 1524 938 921 779 22 ----11534
NM_013386chr131627 254 147 ------
NM_013411chr131933 790 548 32004 1895 382 --1541
NM_013438chr941332 634 430 111 21492 366 1116 --
NM_013450chr23302 79 46 1446 11284 --
NM_013943chr153170 2987 2911 401 103 22158 1312 1260 --
NM_013989chr1475141 4525 4371 4005 1309 1200 701 --24329 4199 --
NM_013995chrX42303 1828 160 134 12559 ----
NM_014011chr232053 330 162 1598 22155 1742 12627
NM_014021chr153127 3112 2521 2444 2252 ------
NM_014043chr311080 11429 1617 151
NM_014048chr16104627 4318 4089 3973 3806 1841 1433 1196 944 669 11786 13880 --
NM_014106chr1552775 2508 2407 1848 295 12364 ----
NM_014112chr8145458 5430 5138 3818 3613 1889 1732 1641 1465 1410 1073 1034 940 932 14212 ----
NM_014117chr1652750 2287 1748 738 258 1544 11753 12391
NM_014154chr361612 1457 1145 1127 333 153 ----1614
NM_014155chr1167247 5956 5191 4606 2937 665 14663 16302 --
NM_014157chr16104000 3078 1560 1266 1148 1127 588 474 371 257 ----128
NM_014160chr361292 1223 526 278 269 245 21451 56 1308 --
NM_014181chr282784 2647 2149 1897 1025 969 723 111 1226 ----
NM_014182chr121652 1235 2682 663 --
NM_014220chr34519 291 258 125 ----1235
NM_014243chr432016 1492 1476 11442 --11728
NM_014253chrX42324 2298 1818 940 --22210 2059 --
NM_014265chr81786 ----1646
NM_014296chr331249 446 68 11362 ----
NM_014309chr2295379 4880 4769 4328 3500 969 718 431 100 25231 2045 --14092
NM_014325chr1231888 561 529 1837 1622 1323
NM_014331chr4187841 7486 7303 6939 6618 6591 6562 6482 6321 6047 5874 2868 2263 1923 1808 1765 528 105 ------
NM_014333chr113913 608 251 --22562 873 --
NM_014345chr61676 --4919 720 661 198 --
NM_014361chr111389 ----1475
NM_014376chr542552 2011 1574 117 12585 --21630 828
NM_014382chr331302 405 316 130 11105 --
NM_014392chr471248 1241 1146 1041 1029 423 371 --11368 --
NM_014393chr862293 1837 1800 1538 319 141 ------
NM_014421chr491856 1824 1397 668 654 643 370 271 184 1815 ----
NM_014423chr565509 5200 3960 1930 1465 1144 35613 4816 4727 1776 --
NM_014458chr141199 1057 121 93 ------
NM_014494chr1631934 1562 237 1925 --11632
NM_014504chr731887 788 330 --1597 --
NM_014521chr241887 1788 1565 39 21726 1347 ----
NM_014548chr1551349 1019 644 507 225 1658 ----
NM_014554chr1272227 2047 2023 1484 466 149 22 ----12036
NM_014572chr1321364 1209 ----1325
NM_014573chr1751776 704 483 457 157 31535 626 277 21612 516 11366
NM_014574chr1431464 1201 133 ----21425 1100
NM_014584chr143498 361 227 1307 --1635
NM_014586chr2184785 4527 4163 3978 3245 3129 1730 778 21219 566 21499 134 --
NM_014615chr16113534 3458 3118 2659 2432 1430 1171 741 403 359 26 --23235 634 12412
NM_014616chr353179 2789 2504 2218 145 22841 1145 1169 2989 694
NM_014636chr9114357 4149 3814 3788 3671 3523 3414 3021 1305 690 246 --13271 --
NM_014637chr81383 11498 --1970
NM_014647chr1672297 2288 1820 1791 1578 1451 640 ----1882
NM_014674chr373836 3740 2918 2606 731 49 35 22788 56 12779 --
NM_014676chr14520 469 150 58 --11601 --
NM_014682chr861939 1914 1878 1626 1524 615 ------
NM_014686chr1932530 174 166 ----1930
NM_014701chr1563288 3230 2229 931 521 121 ----11334
NM_014702chr663227 2997 1134 853 505 99 13387 --11032
NM_014711chr1692119 1841 1715 1291 683 333 231 187 78 ------
NM_014721chr697482 5750 5612 5606 4592 1823 1002 699 187 26440 4682 25634 2829 --
NM_014729chr872283 1837 1801 1544 692 637 531 ------
NM_014730chr1235300 4953 4459 25076 4173 14658 1720
NM_014730chr1235300 4953 4459 25076 4173 14658 1720
NM_014732chr1665888 5463 4474 1690 1056 905 34002 1001 741 25756 749 --
NM_014733chr531580 546 79 2815 155 11992 --
NM_014739chr6104198 3719 3381 3177 3050 2658 2647 1484 601 498 --13027 --
NM_014746chr273836 3593 3430 3332 2665 1471 1333 ----1540
NM_014747chr1105601 5110 4459 4352 4167 3808 1451 1341 893 810 22307 1113 ----
NM_014751chr851839 1696 1676 1422 402 ----1467
NM_014755chr2124293 4167 3753 3663 933 861 805 775 661 601 285 35 23195 746 14132 --
NM_014767chr1073722 3324 3209 660 360 354 238 11199 ----
NM_014772chr18113639 3321 3028 2987 2523 1025 994 848 812 302 166 13616 22606 193 --
NM_014774chr142518 2448 1252 520 23041 99 13099 --
NM_014787chr172664 1113 1049 795 554 116 31 12082 ----
NM_014810chr173699 3420 2305 1084 868 635 448 12719 23494 3145 23265 1146
NM_014812chr161883 1687 1670 517 334 206 3428 340 180 ----
NM_014819chr582494 2487 2066 1972 1873 1517 983 425 1928 ----
NM_014828chr1452274 1572 1536 726 75 11779 12518 --
NM_014829chr542022 1995 1839 810 21642 185 --12028
NM_014838chr2232517 2205 1003 41094 475 332 106 12053 31876 379 372
NM_014839chr182462 2157 2108 1923 990 495 247 153 ------
NM_014841chr641389 438 396 105 --1389 --
NM_014844chr1494029 3605 3367 3086 2844 2720 2576 1239 1121 11109 11083 --
NM_014850chr3104390 3814 3448 3288 3075 3039 1533 660 650 211 11067 --14727
NM_014860chr272623 2398 2353 2161 1730 761 31 2248 205 12459 --
NM_014870chr184487 3743 3654 3614 3484 2987 1697 475 ----14240
NM_014873chr194886 4465 4364 3634 3594 3164 970 780 250 23037 82 3541 518 495 11809
NM_014877chr1777127 5226 4696 2544 1384 711 439 17044 16535 1774
NM_014888chr741371 1239 1201 1176 21302 199 ----
NM_014897chr1752682 2379 1268 1222 1142 32237 813 200 ----
NM_014899chr543169 2534 2097 1037 12891 13174 --
NM_014903chr1272151 2025 1515 1502 573 533 306 52408 874 692 349 75 1504 --
NM_014904chr1063958 3133 1309 1283 795 427 1678 ----
NM_014906chr1773838 3696 3597 3436 3382 2619 857 11387 34013 2872 2842 11298
NM_014912chr1083152 3045 2556 1394 1355 1293 1228 943 ------
NM_014914chr231151 911 227 2522 239 ----
NM_014917chr13884 316 96 1240 --2322 123
NM_014920chr673445 2997 2562 2499 1513 1385 851 43382 3253 1355 106 --13510
NM_014923chr1372139 2111 1782 1613 777 643 260 1185 ----
NM_014924chr1453181 2621 2296 151 27 23164 240 12502 --
NM_014932chr331950 1424 189 11319 11371 21585 174
NM_014934chr1344009 3211 2658 1493 --33997 2517 1249 13740
NM_014935chr163728 3626 2918 2737 1571 1339 --23905 542 --
NM_014939chr1841485 1171 436 202 11446 11514 --
NM_014950chr1441550 1464 1381 666 --3388 119 67 --
NM_014953chr1334379 3697 2918 --21578 1518 24072 1378
NM_014961chr452108 1919 1584 400 238 1531 ----
NM_014962chr2062502 2362 985 867 819 656 --1428 --
NM_014982chr1465094 4451 3841 677 504 72 --1320 25253 432
NM_014988chr411965 12858 32652 2081 344 --
NM_014989chr631395 246 96 --21323 325 1377
NM_014991chr442490 1078 807 745 1490 11270 --
NM_015000chr1253034 1165 925 425 255 --22526 607 12743
NM_015008chr373121 2570 2498 2323 798 382 251 1374 ----
NM_015015chr1961639 1386 1375 827 463 120 1250 --2560 334
NM_015020chr1653892 2832 2700 1167 491 33449 424 205 ----
NM_015025chr252717 2676 2529 871 383 22361 719 22324 404 --
NM_015027chr1652029 1578 730 243 132 11558 --11792
NM_015035chr20126703 6661 6397 6347 5651 4803 4221 1946 1686 1526 1255 68 24132 1499 24644 4107 --
NM_015040chr243427 2710 830 252 13070 --12773
NM_015042chr1593996 3254 2689 1545 950 632 346 169 143 34226 2649 1271 23583 3513 --
NM_015049chr273316 3115 2786 1245 1183 850 291 1986 ----
NM_015051chr953298 3046 1099 109 67 12830 ----
NM_015057chr134570 528 226 215 ------
NM_015059chr1563729 3357 3131 1539 611 56 13205 54007 952 924 784 475 --
NM_015064chr1223116 2884 33172 2436 313 22315 469 --
NM_015068chr793642 3249 3229 3095 2958 2864 836 592 396 22844 758 ----
NM_015071chr5106073 5617 4992 4895 4382 4169 4097 2200 1685 1454 24289 742 11522 11516
NM_015074chr184857 4737 4501 3203 1921 1032 992 289 24251 3192 11439 11755
NM_015076chr663938 3548 3115 3072 591 478 23229 89 13786 13295
NM_015090chr1186164 6001 5952 5571 5235 5005 4990 4800 4694 4571 4125 1983 1883 1535 1520 1393 394 75 64657 4587 3815 1773 545 159 1169 --
NM_015100chr182060 1753 1498 1454 1381 1372 767 490 11270 1507 --
NM_015110chr922290 131 --12430 1283
NM_015113chr1772429 2406 2232 1942 1690 1625 181 1477 12021 --
NM_015115chr473179 2763 1207 985 751 701 446 --12338 1618
NM_015116chr1361732 1340 1268 1068 658 86 1147 1168 --
NM_015137chr82717 304 --11916 --
NM_015144chr1663966 3105 1021 862 548 163 --13654 --
NM_015149chr162232 2197 827 754 498 353 --11490 --
NM_015150chr34915 881 359 42 ----2717 384
NM_015155chr1052818 2172 1167 287 48 --1202 --
NM_015156chr1473462 3383 3070 2948 1287 1138 105 24041 1330 13047 13169
NM_015170chr862210 334 196 184 95 83 ------
NM_015191chr1142588 2140 307 282 22722 455 ----
NM_015192chr2052084 2072 1135 1098 815 12620 13020 --
NM_015199chr342403 2056 313 42 2634 519 ----
NM_015206chr152276 126 33487 959 292 23905 3611 --
NM_015208chr1863661 3245 2762 567 383 346 22838 1152 23155 3065 --
NM_015209chr181970 1916 1878 812 707 574 484 224 ------
NM_015215chr152458 2351 2009 1000 376 --12928 --
NM_015225chr963010 2449 2239 2189 1236 745 11023 11172 1491
NM_015236chr441514 933 431 123 --21052 130 --
NM_015245chr662765 2632 2157 537 356 325 ------
NM_015247chr16105099 4913 4590 4446 3700 2054 1849 900 827 152 --24233 1302 --
NM_015265chr272694 2533 1913 1779 1046 717 571 ------
NM_015267chr1241850 1840 1458 292 --32137 1707 790 --
NM_015269chr12584 202 ----1136
NM_015271chr483967 3490 3318 3059 1302 687 301 45 24327 294 22934 772 13697
NM_015275chr1272186 1870 1764 805 288 275 74 ------
NM_015278chr65839 683 547 439 233 22431 96 21188 810 --
NM_015285chr1872407 2255 2069 1990 1595 331 52 1983 ----
NM_015288chr5103883 3823 3406 2907 2492 1003 512 478 348 99 33243 915 814 ----
NM_015291chr163538 3409 3192 2765 2258 621 179 12494 --
NM_015299chr1452999 2581 966 953 945 11244 --1597
NM_015310chr8148432 8178 7322 6576 6357 5316 5111 3285 2693 2082 1969 1894 1350 995 37748 5787 5264 38407 7386 394 --
NM_015313chr1164721 4111 1685 1655 1541 964 11323 ----
NM_015314chr7102405 2344 2197 1765 1730 979 833 822 764 739 ------
NM_015317chr252457 1824 1142 853 371 --12850 1554
NM_015335chr1232487 1796 556 21642 105 22218 823 --
NM_015336chr1231879 871 324 --22331 2152 --
NM_015345chr672729 2506 2196 2063 2002 1816 492 185 1806 --
NM_015346chr1441886 1461 1373 328 --21685 583 11892
NM_015347chr1242033 1803 377 302 31927 1830 225 ----
NM_015349chr683071 2968 2804 2436 1880 1165 1021 390 12199 --11171
NM_015355chr173511 268 29 ----1696
NM_015358chr2151011 912 401 151 100 --1878 --
NM_015365chrX93828 3728 3617 3139 2855 2690 1673 984 41 23431 767 23833 2667 1795
NM_015375chr165015 4519 1699 1684 1285 281 13604 ----
NM_015385chr1083265 2648 2641 1270 1052 535 392 154 12224 ----
NM_015387chr221326 541 1740 1312 21655 358
NM_015446chr151605 1476 1357 1117 548 11516 ----
NM_015455chr573055 2784 2656 1569 599 551 170 23842 722 --13610
NM_015458chr853837 3547 1263 1117 853 34359 869 811 --2460 179
NM_015460chr351799 1657 1643 482 464 ----1643
NM_015463chr23728 584 537 ----2573 60
NM_015520chr342751 2364 2058 826 --21934 759 168
NM_015526chr1981455 1279 1221 1090 962 446 411 382 21350 948 1188 --
NM_015534chr111109 ----1724
NM_015535chr2103605 3364 3197 2943 1558 1096 1060 683 480 384 33983 1395 977 2766 100 --
NM_015550chr743132 3029 1068 235 23403 3381 167 22866 2739
NM_015553chr6135199 4238 3909 3817 2076 1847 1729 1661 1575 1379 1348 483 41 1434 ----
NM_015554chr1542797 2600 2092 1884 11051 1884 22563 2078
NM_015564chr583091 2264 2193 1064 1032 886 477 285 22355 113 23546 896 --
NM_015567chr1341332 1246 1125 42 11177 ----
NM_015569chr193215 3085 1869 1851 1749 1742 1459 553 170 ------
NM_015570chr76705 664 594 526 468 93 ----11526
NM_015575chr273545 3361 1278 1251 1239 942 456 --13098 1110
NM_015576chr352384 2348 1930 993 907 1717 12990 --
NM_015602chr121685 130 11271 --21441 1125
NM_015610chr772861 2820 2615 2532 2492 2327 1038 32134 1148 312 ----
NM_015635chr982005 1865 1776 1658 1396 566 164 46 ----12177
NM_015640chr174265 4119 1652 1385 643 308 186 --21881 403 11160
NM_015850chr852438 1807 1564 855 612 22429 1951 ----
NM_015852chr7183629 3471 1348 1267 1147 1102 1063 979 895 850 811 727 643 430 307 262 223 139 --23279 1309 1860
NM_015879chr18148382 7648 7254 7211 6896 6723 6534 6063 2736 1719 1663 1580 1250 292 55235 2158 1383 652 51 12946 28634 8333
NM_015886chr8115720 5695 5500 5440 5069 4939 4649 4362 3535 995 391 1664 ----
NM_015888chr183391 3221 2552 2198 1182 721 251 175 --12189 23183 2693
NM_015891chr631887 1775 589 11432 --11973
NM_015901chr104838 807 795 312 ----151
NM_015906chr164802 1925 1736 1346 1151 919 44133 2957 1592 771 11210 11389
NM_015912chr862447 2221 2164 752 407 273 --3571 202 76 --
NM_015975chrX61297 1151 537 435 193 164 ------
NM_015980chr551654 1228 1122 1046 401 11433 2640 476 --
NM_015981chr553123 2862 2250 1198 416 --23211 2784 --
NM_016003chr772861 2820 2615 2532 2492 2327 1038 32134 1148 312 ----
NM_016018chr8102869 2712 2663 2561 2322 1794 1775 1100 637 196 --1687 1385
NM_016021chr672791 2733 2526 2269 1916 1060 686 1743 ----
NM_016040chr172754 2737 2387 2086 1940 390 55 ------
NM_016045chr2041741 1315 1157 48 ----21367 498
NM_016061chr21408 11247 --11536
NM_016073chr151810 21127 861 ----
NM_016075chr1351149 1070 802 697 287 --22901 80 --
NM_016076chr152758 2535 940 258 117 --1304 --
NM_016078chr171985 1934 --1946
NM_016081chr452235 605 392 363 26 167 --1882
NM_016083chr643043 1160 529 178 --1599 13463
NM_016096chr82785 53 --190 11681
NM_016120chrX4941 815 456 48 --11068 11182
NM_016124chr171511 1374 1332 1151 543 428 257 11464 11520 --
NM_016131chr282377 2342 2084 1941 1757 1721 448 317 1126 --3841 596 66
NM_016132chr1543035 2896 630 358 11096 --1808
NM_016133chr251575 1420 610 426 207 ------
NM_016156chr1141888 1595 1568 304 31704 1526 385 ----
NM_016206chr389021 8300 7222 7065 6760 5518 1144 830 28828 642 --33248 3212 3118
NM_016248chr1353875 2522 1109 604 397 22763 559 --154
NM_016255chr663127 2406 2242 579 475 238 1819 --12497
NM_016257chr193538 3422 2997 2971 2955 1338 1051 602 135 ------
NM_016260chr2137648 7557 7032 6711 6605 6368 5264 2748 2535 2433 2018 497 455 37050 7025 463 11676 --
NM_016271chr1812298 31917 1869 1821 1409 --
NM_016272chr2232757 2595 2128 2870 728 22389 1891 12470
NM_016275chr352793 2743 2625 2453 871 ----1111
NM_016281chr1241038 786 770 63 ----1318
NM_016287chr142101 1779 1572 1421 ----1144
NM_016289chr221630 658 ----11487
NM_016377chr641791 1759 1196 1174 ----11187
NM_016422chr1152477 2029 813 159 87 --1371 --
NM_016433chr1271491 1273 1228 1122 1066 253 226 159 ----
NM_016436chr2042109 826 715 307 --3900 277 79 --
NM_016467chr221231 409 ----21259 510
NM_016472chr1441111 490 464 262 --1424 --
NM_016507chr1742899 2867 2791 2566 11008 22623 1207 --
NM_016513chr673445 2997 2562 2499 1513 1385 851 43382 3253 1355 106 --13510
NM_016530chr1563876 3655 3297 1333 376 181 ------
NM_016531chr463685 3476 3343 642 253 204 13420 34043 1396 536 --
NM_016559chr32506 494 21162 1025 --1243
NM_016591chr5--1227 --1415
NM_016599chr431510 431 167 ----11021
NM_016603chr572235 2169 2144 510 235 212 150 ------
NM_016626chr1851295 1242 1093 402 173 ----11545
NM_016651chr1411067 ----11126
NM_016653chr221009 982 31240 1118 162 11223 11201
NM_016824chr1071928 1341 1334 1190 608 265 113 ------
NM_016952chr1174046 3152 3033 2982 2675 985 38 196 1793 --
NM_016953chr296082 5657 3771 2207 1768 1471 1217 1048 702 1921 24181 1395 32399 1516 399
NM_016954chrX2534 41 --1547 --
NM_017412chr851412 1246 960 347 165 --1274 --
NM_017420chr1443852 1159 1151 43 1374 12698 12801
NM_017423chr42149 112 ----21740 1516
NM_017437chr1442210 1606 807 263 1320 1365 --
NM_017447chr2163377 1737 1730 862 233 57 --11134 --
NM_017540chr543036 2543 2089 2049 32281 1069 836 ----
NM_017553chr1551217 1165 1041 286 270 135 1297 --
NM_017563chr355517 5257 2084 1730 361 34793 4665 4457 21005 181 --
NM_017580chr1082324 2251 2084 933 806 620 562 103 --1577 --
NM_017629chr151813 1753 1745 1247 696 ------
NM_017632chr4188 ----1374
NM_017633chr632530 1336 561 23269 3014 ----
NM_017635chr11--21382 553 --1390
NM_017637chr9228907 8548 8471 7763 7148 6761 6725 6699 6315 5846 3534 3368 2929 2584 2494 1878 1659 1607 957 179 170 22 36680 3478 2951 17287 16073
NM_017643chr1752911 2823 2188 1998 391 12096 12347 --
NM_017644chr384962 4752 4729 4578 3639 2028 1330 859 43489 3174 1797 159 ----
NM_017650chr744055 1305 1041 842 31262 1126 203 11761 1225
NM_017658chr1494109 3823 3625 2928 2890 1759 1555 488 86 ----14376
NM_017661chr1531163 342 220 1885 --1162
NM_017671chr2072099 2031 1946 1551 699 145 103 141 22129 421 --
NM_017684chr1541375 728 257 233 21474 800 ----
NM_017705chr1573799 3735 3474 2472 1386 1128 1004 3825 768 242 ----
NM_017719chr352534 2054 1827 892 714 22187 554 ----
NM_017738chr941145 308 247 225 ----1239
NM_017741chr432371 1897 98 1119 21041 142 12816
NM_017742chr183604 574 236 1688 1248 1531
NM_017752chrX51601 1326 333 260 191 2667 218 1460 12005
NM_017753chr96414 330 307 95 83 21 ------
NM_017754chr695057 5017 3905 3208 1226 1000 446 373 239 15073 ----
NM_017762chr1561666 1623 1565 893 670 244 ------
NM_017769chr1443149 2897 1173 747 --1244 196
NM_017770chr642000 1124 254 94 42678 2657 2332 2234 1809 --
NM_017776chrX4199 161 142 115 21603 636 ----
NM_017778chr831200 355 79 --1967 11475
NM_017779chr152700 2018 1111 933 114 --11735 --
NM_017791chr1441614 628 590 33 21169 616 11580 --
NM_017811chr962917 2756 2074 2016 485 276 --21944 463 --
NM_017813chr865794 5560 4699 1564 1089 501 11920 24181 3842 24588 4317
NM_017824chr1082508 2402 2008 1806 974 539 301 254 22712 2138 --11042
NM_017831chr1884519 4495 4237 3656 3351 3241 881 65 --13994 --
NM_017847chr1102281 2265 2194 2096 2055 2040 1783 1423 159 47 ----21392 249
NM_017848chrX44136 2942 1313 1295 127 23238 410 --
NM_017856chrX61831 1691 1389 592 444 361 1519 --11909
NM_017902chr1094418 4023 3628 1323 1283 1235 901 844 675 1683 ----
NM_017919chr9105768 5677 5280 3632 3610 1922 1869 1300 1218 504 34734 4686 4067 --25292 4451
NM_017925chr941677 1297 387 82 ------
NM_017944chr1152415 2141 1131 1101 320 13079 ----
NM_017954chr751633 1603 1473 593 460 ------
NM_018014chr261109 1092 1049 953 923 507 --1212 --
NM_018017chr1072912 2444 2263 2061 1949 876 438 ------
NM_018030chr183999 50 38 2857 355 1783 --
NM_018036chr1464402 3660 3449 2935 1707 1687 11383 ----
NM_018045chr152925 2318 326 318 39 12082 22726 577 --
NM_018048chr1241308 704 259 96 11871 1503 --
NM_018084chr232749 2306 452 23317 3104 22921 181 --
NM_018085chr1148132 7086 6722 6565 5463 3287 3178 3135 3093 2891 2399 2356 1035 905 47560 5215 155 48 1394 47658 7642 7505 1464
NM_018086chr221243 1235 ----11273
NM_018092chr1631520 1127 378 1179 21401 1182 --
NM_018105chr851150 1082 863 233 221 ------
NM_018121chr1062898 2795 2415 2329 2052 613 12196 11098 1536
NM_018157chr1233119 2044 668 --2564 494 --
NM_018176chr431611 138 73 11142 --179
NM_018178chr162030 1658 1589 1348 219 180 --11559 --
NM_018181chr1841992 1973 1565 1466 ----1361
NM_018184chr362184 2017 1819 1537 527 97 1242 ----
NM_018196chrX2252 83 --11106 11055
NM_018211chr142001 1900 844 550 32101 695 81 ----
NM_018244chr2041339 1047 870 864 ----21265 1137
NM_018254chr11777 ----12448
NM_018263chr242439 2300 123 92 22360 2001 ----
NM_018293chr372904 2485 2401 2282 2110 715 424 22648 400 12250 --
NM_018317chr44336 221 135 66 ----152
NM_018323chr431864 1517 409 11499 127 --
NM_018330chr1041669 585 369 196 292 49 143 1222
NM_018351chr1263694 923 772 712 486 117 12973 11061 --
NM_018364chr193565 3298 3112 2499 1547 908 595 514 136 1275 ----
NM_018373chr14115832 5703 5307 4783 4635 4079 3926 2235 2122 223 128 11246 21631 1203 --
NM_018374chr7125160 4784 4459 4394 4251 3813 3727 1919 1661 790 738 345 21668 1645 1101 14850
NM_018383chr241880 1749 1442 300 --12073 --
NM_018394chr351443 1088 985 556 537 ------
NM_018409chr4103081 2641 2073 2032 1099 1044 718 666 236 96 23251 2048 1365 --
NM_018424chr941862 1470 1423 1344 1562 ----
NM_018425chr1082518 2299 2060 1832 617 577 541 356 11949 ----
NM_018429chr552626 2515 866 857 624 ------
NM_018439chr1852255 2067 1633 1066 1004 12389 ----
NM_018440chr8108286 7930 7491 7223 6640 6053 5908 5411 2604 1574 17058 47793 5690 1448 82 2900 542
NM_018452chr6_random73604 3373 3359 3149 2553 2532 2459 --1355 --
NM_018482chr832606 1968 272 --31678 1664 1638 1464
NM_018566chr164572 3958 662 595 405 298 ----13431
NM_018638chr12135542 5239 4333 3754 3647 3512 1534 1468 1389 1160 897 301 144 12024 --11727
NM_018640chr1252350 2032 2018 484 321 --12230 --
NM_018650chr121687 824 1510 1908 --
NM_018700chr551676 1613 1603 1093 188 --1621 --
NM_018704chr161826 1715 1541 1487 607 534 21603 1528 ----
NM_018898chr541800 505 245 53 1699 --123
NM_018899chr541800 505 245 53 1699 --123
NM_018900chr541800 505 245 53 1699 --123
NM_018901chr541800 505 245 53 1699 --123
NM_018902chr541800 505 245 53 1699 --123
NM_018903chr541800 505 245 53 1699 --123
NM_018904chr541800 505 245 53 1699 --123
NM_018905chr541800 505 245 53 1699 --123
NM_018906chr541800 505 245 53 1699 --123
NM_018907chr541800 505 245 53 1699 --123
NM_018908chr541800 505 245 53 1699 --123
NM_018909chr541800 505 245 53 1699 --123
NM_018910chr541800 505 245 53 1699 --123
NM_018911chr541800 505 245 53 1699 --123
NM_018932chr52802 708 ----1739
NM_018945chr673704 3057 2615 2256 863 593 456 12329 23576 1202 21244 1078
NM_018947chr765030 4561 3571 1975 914 815 1692 ----
NM_018958chr1574098 3889 3203 3013 2741 1246 882 --33629 3087 1616 1416
NM_018963chr2141530 357 241 166 1420 1984 1563
NM_018976chr1262645 2610 2572 2561 2005 23 2747 294 1275 --
NM_018977chrX5310 258 212 199 155 1797 1222 --
NM_018979chr1232510 951 336 2415 243 12349 12644
NM_018999chr1094277 3541 1803 1411 839 604 558 205 160 2983 712 34871 3338 488 13556
NM_019001chr3114120 4021 3915 3829 3685 3317 1914 1634 833 781 257 13179 11761 --
NM_019004chr762359 1745 1654 1541 801 613 ----1108
NM_019014chr251499 1362 551 428 367 --1675 --
NM_019022chr1873208 3200 1989 1145 948 668 202 ----13004
NM_019027chr482313 2298 1985 1979 1967 821 465 35 ----22463 28
NM_019042chr761213 1123 501 493 446 101 --2405 183 --
NM_019050chr452292 1732 1407 455 164 --21392 73 12033
NM_019063chr23378 252 209 --1326 11501
NM_019072chr5114245 4209 4171 3981 3500 3006 2971 949 280 189 32 13553 1194 13107
NM_019084chr1042501 2484 583 297 12510 1214 --
NM_019091chr26985 789 347 279 244 125 --11111 1143
NM_019094chr1273713 3007 2486 1454 403 155 93 12954 ----
NM_019098chr861853 1403 1288 697 636 120 11262 --21273 1219
NM_019106chr2273402 3385 2884 2275 1209 935 606 12388 22912 408 --
NM_019117chrX63096 2588 2505 1385 1233 849 --21371 767 --
NM_019556chrX61513 1205 511 407 362 187 ----199
NM_019593chr2042776 2156 1980 740 23036 580 1468 --
NM_019610chr161627 1484 1417 536 396 219 ----11774
NM_019842chr6------1382
NM_019859chr1061494 511 437 306 127 27 ------
NM_019860chr1061542 559 485 354 175 75 ------
NM_019885chr242645 1807 900 143 --32977 2601 2115 --
NM_019903chr1071928 1341 1334 1190 608 265 113 ------
NM_020119chr7113842 3784 3486 3465 3439 3366 3220 1211 1198 474 176 --22987 969 --
NM_020122chr2136050 5639 5336 5263 4346 2287 2201 2020 1708 1603 1482 1474 276 14514 1756 --
NM_020123chr1041566 1374 316 73 --11468 --
NM_020130chr861388 1107 1093 523 173 104 --11027 --
NM_020132chr2154486 3602 1539 1509 546 23592 1725 13869 24316 3319
NM_020133chr6136122 5829 5549 5105 4678 4418 2508 2270 2262 2215 1547 1203 808 44495 4187 1461 1007 16076 26152 4629
NM_020141chr152311 2133 2046 352 166 12006 32421 2407 2327 --
NM_020159chr451460 1271 610 288 206 11542 ----
NM_020177chr522797 2392 32862 1076 1021 32855 631 480 13182
NM_020180chr183915 838 525 --2869 81 --
NM_020182chr2083059 2899 2488 1367 1285 980 906 174 --21311 1065 --
NM_020193chr1141243 872 502 441 ------
NM_020198chr171463 2426 389 11466 1304
NM_020208chr393440 2973 2904 2635 2343 1135 618 390 304 1663 ----
NM_020245chr6114782 3658 3644 3378 3109 1754 1612 1424 1265 1206 1123 34750 3422 1287 --13912
NM_020310chr1742592 2067 1843 1107 11127 12813 21782 671
NM_020336chr2051185 1028 920 343 243 13505 --196
NM_020338chr1093429 2611 2572 2500 2414 1357 877 636 92 32711 992 910 1557 --
NM_020341chr2041865 1639 1487 1441 31857 1693 265 1284 1150
NM_020346chr1131432 1157 610 11604 1141 --
NM_020348chr1031998 1978 848 32614 2495 833 --1904
NM_020390chr374088 3839 3125 1483 580 471 259 21875 298 1478 1327
NM_020403chr1341444 1381 469 442 11334 11386 --
NM_020416chr442708 2644 2396 919 12222 22145 1687 1251
NM_020443chr196871 6794 6255 5874 2412 1575 1351 582 378 26683 723 56083 5621 810 450 307 11559
NM_020453chr451959 1902 1705 1542 1482 ------
NM_020466chr694608 3582 3510 3054 1947 1505 1079 737 237 --24079 859 --
NM_020673chr20117801 7390 6946 6604 6506 5402 5311 4760 2735 2086 733 47545 6266 1537 1279 21172 376 --
NM_020698chr12123118 3015 2959 2781 2421 1081 975 884 829 753 278 240 23136 1124 --1948
NM_020711chr231718 680 670 22596 186 12329 --
NM_020717chrX94399 4219 3509 3489 3476 3262 1706 1403 192 ----11946
NM_020718chr1686040 5534 5228 4268 4002 2415 2127 1215 --22367 487 13987
NM_020734chr1253189 2615 363 298 196 22588 1001 1188 --
NM_020739chr1583235 3227 2929 1496 1460 777 354 141 21027 498 ----
NM_020742chrX52730 2226 2017 661 173 21936 106 ----
NM_020755chr651377 1342 1170 436 293 ------
NM_020760chr221357 250 1364 --1651
NM_020766chrX94175 4126 4039 3910 2867 1545 699 682 255 14288 --14045
NM_020772chr17138585 7508 6990 6264 5348 5280 2787 2440 808 397 376 325 136 47849 6158 5342 1133 62953 2805 2434 2078 1100 986 27441 3050
NM_020774chr1865470 5197 4635 2381 1811 1249 --35591 4579 1992 --
NM_020778chr15104922 4211 3835 3524 3492 3486 3089 3083 1957 347 140 24325 808 13273
NM_020782chr1283718 3309 2989 1424 656 434 333 233 ----13917
NM_020787chr1751136 978 246 203 54 --1318 --
NM_020794chr171219 495 399 326 103 75 39 ------
NM_020796chr562273 1196 1183 991 464 288 32084 98 31 22857 2804 --
NM_020800chr351146 1121 541 444 309 --11053 --
NM_020801chr552216 1895 1837 861 617 21981 636 ----
NM_020802chr1152701 2103 1253 402 297 21168 665 ----
NM_020809chr1152170 2075 1425 895 169 1918 ----
NM_020810chr1473182 2764 2737 2232 1329 442 126 1424 --21108 882
NM_020821chr1541375 728 257 233 21474 800 ----
NM_020830chr2123087 2946 2802 2611 2542 2471 2209 2002 1304 543 363 111 --1774 22914 117
NM_020858chr1562033 2008 1698 1495 422 322 11995 1558 12433
NM_020861chr641389 462 239 99 --1177 --
NM_020872chr311830 ----2587 202
NM_020899chr1772559 2452 2221 2043 1925 766 362 2658 480 11850 12548
NM_020914chr1742211 1793 1696 842 1567 --1283
NM_020918chr1063355 1174 1150 936 763 634 12895 --33672 3420 2332
NM_020921chr1483643 2558 2477 1455 1160 859 557 392 1835 2551 334 33386 971 789
NM_020925chr151171 989 577 422 280 --21480 243 --
NM_020935chr283376 3123 3114 3013 1466 1195 300 113 1130 11101 11690
NM_020948chr173566 3505 2443 1464 1261 1151 463 13239 --1570
NM_020977chr461748 1739 1571 1557 727 498 ----11821
NM_020987chr104873 566 449 435 1373 ----
NM_021007chr272311 2078 1780 733 169 117 101 22193 2177 11773 --
NM_021032chr361927 1847 1679 1316 546 341 --1386 11474
NM_021033chr1363532 3446 3323 860 751 320 ----12841
NM_021038chr393233 2968 2728 2694 2558 2382 874 447 352 12978 1856 11184
NM_021072chr532669 936 42 11043 21891 488 --
NM_021097chr252971 2293 2068 1103 874 12441 ----
NM_021101chr352279 2207 1966 748 125 --138 22489 730
NM_021120chrX53176 2174 2083 352 93 1990 ----
NM_021148chr732224 2002 390 ----22163 1534
NM_021163chr7123570 3466 3091 2905 2559 1483 1048 996 864 810 721 706 --23291 980 12781
NM_021183chrX52464 1892 431 363 115 12360 ----
NM_021205chr152739 1787 878 820 703 31821 542 472 --12772
NM_021238chr1241756 794 577 232 11484 2391 72 11742
NM_021239chr1471454 1296 1020 1002 448 407 221 ------
NM_021249chr1441122 1090 624 98 1607 ----
NM_021255chr1473876 3866 3586 3312 3166 674 462 32622 1077 228 --24089 3561
NM_021572chr631288 971 457 ----11024
NM_021629chr384996 4713 1842 1505 1342 1072 416 130 14989 ----
NM_021647chr454077 3731 1902 1697 1490 34044 3793 1358 --14215
NM_021648chr652694 2554 1742 598 389 ----1947
NM_021728chr14----1972 2196 174
NM_021813chr6105120 4835 4537 4338 4162 3961 3899 2091 1628 879 --25345 338 --
NM_021814chr641541 1387 627 334 128 ----
NM_021818chr1451520 1293 1091 205 68 ----11442
NM_021824chr22213 200 ----136
NM_021911chr5115211 4380 4108 3840 3774 3743 3557 3451 1040 1019 438 45025 3618 3529 47 11930 11034
NM_021912chr15104109 3270 2923 2601 1562 1538 1342 240 99 91 ----13614
NM_021940chr651644 1238 1177 1119 556 --21308 361 --
NM_021945chr693476 3215 3002 2942 2704 1197 926 605 294 --23151 182 2890 62
NM_021954chr1363513 3431 3331 3166 2591 503 12950 13550 --
NM_021960chr192738 2529 2379 2295 1976 1950 1697 1084 232 --2909 237 --
NM_021961chr11137090 5970 5688 5549 5477 5321 4750 2178 1975 1223 651 393 96 ------
NM_021964chr3106435 6109 5497 5332 4857 4199 2502 1317 1310 425 --14377 11219
NM_021977chr652976 2422 1356 1192 413 12511 33072 2409 804 --
NM_021998chrX41073 381 323 291 21124 105 ----
NM_022041chr1652730 2442 878 486 389 21972 410 1146 --
NM_022048chr1586100 4975 4166 3895 2116 942 621 469 45225 4215 864 116 25871 682 15595
NM_022049chr151771 1621 1405 580 290 ----11311
NM_022062chr1161803 1639 1304 768 478 290 21947 127 1351 --
NM_022093chr11371 1133 --2987 113
NM_022130chr521474 1290 143 11196 --
NM_022140chr592125 1892 1802 1534 1527 891 799 96 89 --12023 --
NM_022166chr1695445 5280 4802 4685 4489 2293 1522 559 530 34418 1095 543 ----
NM_022334chr26749 693 413 357 301 55 ------
NM_022336chr272424 2184 2136 1778 1672 442 325 ----2417 37
NM_022351chr8113740 3471 3108 2663 2615 2419 2400 1510 1040 894 785 23590 1298 22479 1089 --
NM_022405chr393440 2973 2904 2635 2343 1135 618 390 304 1663 ----
NM_022456chr1297381 7247 5804 5437 5335 2524 1441 1069 1036 37470 5812 357 22363 1670 22438 1625
NM_022473chr1594125 4085 3446 1217 851 671 601 394 213 43961 1661 1359 648 11169 --
NM_022474chr1472559 2110 1052 990 363 344 299 ------
NM_022491chr1263587 3275 2350 1431 1413 972 22843 2508 ----
NM_022648chr2104377 4360 3629 3513 3021 1110 817 741 644 528 1468 1342 11749
NM_022716chr172802 2605 2388 815 526 188 106 13055 12628 --
NM_022726chr631310 509 112 1236 11169 21524 680
NM_022745chr132870 2325 603 1632 12543 --
NM_022748chr752625 2454 2261 161 100 32150 1827 93 ----
NM_022776chr341655 1635 1502 122 1446 11149 --
NM_022781chr932398 789 656 23191 3125 --12070
NM_022784chr153829 388 129 1331 ----
NM_022787chr162781 2746 2313 2041 1716 1698 11033 12046 --
NM_022826chr231124 224 210 ----11112
NM_022831chr141846 1552 456 103 1115 --11765
NM_022841chr1551965 1933 1765 788 743 --22626 1104 1346
NM_022845chr1632264 1651 1570 --1149 --
NM_022893chr271194 927 776 673 420 301 125 --1813 --
NM_022897chr531070 946 116 ----1308
NM_022898chr14114411 4092 3347 3279 3273 3236 2985 1641 1089 796 195 13022 11812 --
NM_022912chr2102687 2570 2319 1878 1219 1081 603 593 450 180 ----1744
NM_022977chrX52665 2545 2453 836 788 --12077 --
NM_023002chr1921605 770 --12064 3818 347 125
NM_023016chr261994 1875 1108 977 417 90 11027 ----
NM_023035chr192644 591 ----1283
NM_023105chr852438 1807 1564 855 612 22429 1951 ----
NM_023106chr852438 1807 1564 855 612 22429 1951 ----
NM_023110chr852438 1807 1564 855 612 22429 1951 ----
NM_023111chr852438 1807 1564 855 612 22429 1951 ----
NM_023929chr861960 1815 1743 747 705 192 2558 404 ----
NM_024007chr542836 2670 262 139 12115 1325 22085 927
NM_024090chr431671 318 117 31603 1342 289 11237 11493
NM_024295chr862004 1949 1518 563 343 216 2787 35 ----
NM_024306chr16173 1943 --21041 913
NM_024332chrX51815 1385 337 280 162 2727 591 21169 204 11432
NM_024345chr985301 4888 4533 4061 3807 3747 2358 1977 15557 15122 25274 1020
NM_024408chr183500 3379 2854 2481 2438 826 753 61 12353 2647 247 --
NM_024494chr14699 610 571 37 ----1736
NM_024524chr321132 526 --22288 636 --
NM_024551chr122290 236 136 12129 1395
NM_024551chr122290 236 136 12129 1395
NM_024607chr873517 3166 2950 2883 294 163 39 13815 144 --
NM_024611chr1593948 3585 2712 2663 1327 1206 1006 427 273 --11313 --
NM_024626chr171460 1432 1398 643 604 460 138 11331 11123 --
NM_024629chr451162 461 453 427 274 ----11092
NM_024645chr851299 506 305 284 102 1396 11532 --
NM_024646chr163897 3743 3684 3387 1449 727 13343 1304 --
NM_024659chr25956 911 760 751 732 --2158 23 --
NM_024665chr3104244 4230 3788 3530 3248 1507 1472 1113 152 119 14451 14345 --
NM_024670chr1031260 477 407 1228 ----
NM_024692chr211655 ----11191
NM_024715chr541935 1816 1327 161 --11412 --
NM_024721chr862458 2204 2175 1764 1651 676 32465 1782 276 12599 --
NM_024744chr242710 2402 1973 290 --12251 22408 632
NM_024749chr142297 1788 832 478 --22201 2068 --
NM_024761chr995359 4956 4739 4465 3726 2096 1690 1044 197 34439 3975 215 ----
NM_024770chr2136168 5516 5198 4710 4565 2475 2444 1932 1813 1555 1247 964 895 22258 372 21122 459 --
NM_024817chr15105996 5918 5464 4032 1903 1615 1555 1293 875 840 12051 25890 1665 14988
NM_024828chr951502 1259 1087 337 271 ------
NM_024830chr5102095 2042 1936 1821 1663 1647 1567 1382 818 526 ------
NM_024837chr1551321 1179 564 552 418 --11287 11555
NM_024913chr741540 1441 1377 674 --11451 --
NM_024946chr1631548 690 216 --21809 551 --
NM_024947chr3189627 8903 8826 8385 7730 6958 6709 3677 3500 3062 2984 2776 2109 1930 1073 1050 594 192 38422 6811 6251 ----
NM_024949chr484194 4008 3777 1633 1197 753 618 244 34519 3982 1328 ----
NM_024953chr1272822 2789 2553 2471 2412 2010 1070 1740 1458 1188
NM_024989chr2147244 6857 2736 2676 2397 2317 2132 1902 1708 1309 1132 1038 644 380 26712 5642 --15853
NM_024991chr1083265 2648 2641 1270 1052 535 392 154 12224 ----
NM_024993chr251432 1146 1138 1128 302 1438 ----
NM_025054chr863384 2871 2729 1154 1044 354 13572 --11493
NM_025135chr185475 463 406 399 362 ------
NM_025138chr1341387 1216 1200 74 --21164 1143 --
NM_025146chr342749 2189 1747 847 --1911 --
NM_025147chr231124 879 305 --1122 11147
NM_025160chr183639 3351 3085 2668 1130 475 101 76 23035 739 --24181 569
NM_025179chr1104714 4647 4372 4082 3845 1746 882 873 718 264 23613 966 --11010
NM_025180chr353300 2483 2458 2428 39 --12673 1222
NM_025184chrX1715 ----1127
NM_025191chr133120 2942 571 2627 296 12633 --
NM_025195chr841355 404 353 322 11489 11920 --
NM_025235chr1041944 1714 1669 260 --1308 --
NM_030621chr1463930 3508 1255 1206 375 215 --21011 718 --
NM_030627chr583415 2894 2506 1285 935 583 268 183 --13225 --
NM_030629chr1671946 1452 1425 1318 724 565 170 ----21297 670
NM_030634chr11271 1125 11833 22421 142
NM_030637chr14----1649 1294
NM_030647chr765740 4052 1894 1880 1522 1132 15384 14894 --
NM_030648chr475545 5038 4915 4753 4055 3774 3409 14021 --11081
NM_030650chr283453 3273 3113 3096 2725 1570 1113 281 13758 ----
NM_030664chr1052389 2320 2257 1792 1715 --11911 --
NM_030674chr1295488 5433 5315 5049 4736 4572 1725 1099 100 --25278 4344 24608 2005
NM_030762chr1251962 1688 1601 526 141 11225 --11890
NM_030806chr1149049 9016 8825 8193 7660 7533 7468 5685 1954 1278 751 527 410 190 58952 8926 5890 5872 23 33537 1934 376 11008
NM_030816chr162956 2892 2480 1467 840 81 13212 23658 1445 --
NM_030817chr1253243 3175 2896 1217 1118 2483 39 ----
NM_030918chr185348 5022 4624 4054 3655 3453 2048 1219 24768 276 11356 --
NM_031268chr16105039 5005 4739 4410 2156 1653 1584 1332 1015 197 54708 4100 1042 360 84 44299 3498 1489 323 --
NM_031296chr4------22773 2514
NM_031314chr1461876 1780 1747 722 639 481 1656 11468 --
NM_031362chr2112833 2569 2172 2089 2035 1980 1799 1077 767 426 357 22243 1741 11878 11034
NM_031365chr2112969 2705 2308 2225 2171 2116 1935 1818 903 562 493 22379 1877 12014 11170
NM_031366chr2112969 2705 2308 2225 2171 2116 1935 1818 903 562 493 22379 1877 12014 11170
NM_031411chr541800 505 245 53 1699 --123
NM_031418chr1122461 770 2626 103 1464 1363
NM_031426chr932653 2086 151 2361 259 12820 12812
NM_031427chr14115426 5404 5150 4920 4469 3641 2257 2001 1514 326 226 34985 4727 3940 12318 --
NM_031438chr51159 11564 --1762
NM_031442chrX82480 2263 798 777 713 264 230 193 12208 12571 --
NM_031468chr766426 6397 5636 3089 2855 2537 46593 6045 2170 1893 27436 6601 27514 5690
NM_031469chr693949 3664 3587 3477 3142 2748 881 503 365 1183 13954 12561
NM_031476chr1632379 891 541 12531 12833 1375
NM_031483chr2063493 3158 2991 2528 688 672 ------
NM_031844chr183724 3220 3206 3114 3108 2792 1586 693 22742 1438 --13883
NM_031845chr253434 3246 2418 2357 123 33229 2395 429 13553 196
NM_031847chr253434 3246 2418 2357 123 33229 2395 429 13553 196
NM_031849chr541800 505 245 53 1699 --123
NM_031857chr541800 505 245 53 1699 --123
NM_031860chr541800 505 245 53 1699 --123
NM_031911chr452543 988 664 267 65 1631 --12587
NM_032012chr945208 4906 4696 4287 --13235 --
NM_032042chr562860 2248 2144 1891 1757 430 22329 2319 --12097
NM_032047chr362437 2234 1791 549 107 44 --1927 1559
NM_032116chr1365607 4757 3648 3582 1080 489 43834 2346 1755 251 15566 15479
NM_032139chr192358 226 ----2833 386
NM_032145chr651682 1568 723 711 505 ------
NM_032153chr372480 2472 1709 949 919 654 182 --22000 235 --
NM_032160chr1874334 4305 2976 1445 1304 1046 911 ----14321
NM_032177chr5193 ----157
NM_032189chr13144988 4191 4100 3637 3570 3492 3357 3312 3209 3095 1847 1746 1578 524 24922 4283 ----
NM_032199chr1063763 3071 2578 821 793 394 12801 22780 189 --
NM_032208chr282929 2482 2302 1119 1035 923 813 194 23339 1417 11395 --
NM_032221chr2021984 804 --11708 11659
NM_032228chr1153276 1326 1140 725 206 22691 102 12261 13494
NM_032233chr145870 793 610 270 223 ----1213
NM_032281chr19103135 2060 1976 1241 1136 1065 891 836 471 391 12975 12482 1959
NM_032288chr342366 2103 1985 387 ------
NM_032291chr141886 1756 680 657 --31706 1314 487 21407 92
NM_032295chr741495 371 335 265 11297 11013 --
NM_032321chr293232 3093 2925 2901 2699 2327 2284 503 87 1445 11020 --
NM_032373chr10115573 5217 5037 4688 4269 3585 1902 1775 1574 1361 799 21051 181 14732 --
NM_032379chr116788 690 588 234 81 41 --1602 --
NM_032439chr10101692 1670 1328 1267 1084 1072 678 401 382 126 11219 ----
NM_032440chr10--1884 133 12658
NM_032445chr1592633 2623 2373 1972 1965 1011 476 195 90 12231 1349 --
NM_032446chr5113890 3823 3769 3609 3241 3203 1532 1479 857 692 566 32876 1429 934 12670 --
NM_032457chr413408 --22822 1419 23385 3066
NM_032471chr641148 838 276 212 1356 ----
NM_032472chr23404 33 21 ------
NM_032499chr1571773 1749 1713 1503 494 211 150 11083 21408 1126 --
NM_032509chr872533 2074 1777 991 881 497 343 ----11817
NM_032510chr1851752 1601 791 305 22 ------
NM_032521chr2083229 2964 2661 2470 2061 2001 821 169 11187 ----
NM_032574chr21266 ----1183
NM_032632chr1431363 782 24 --1338 1699
NM_032682chr352923 2726 1331 892 582 1398 1947 --
NM_032825chr1971028 1007 266 209 177 163 45 1909 ----
NM_032828chr19104963 4823 4595 4379 4218 3342 3202 569 495 353 11034 ----
NM_032832chr641388 455 126 119 11125 1535 --
NM_032833chr142457 2342 2090 1068 --169 --
NM_032837chr1781880 1865 1742 1717 1318 397 321 240 --1773 --
NM_032873chr1164295 4147 4036 3668 2852 1046 31278 983 377 --11807
NM_032943chr116788 690 588 234 81 41 --1602 --
NM_032968chrX54210 3943 1653 1035 656 23298 1509 --13350
NM_032969chrX54210 3943 1653 1035 656 23298 1509 --13350
NM_032973chrY64202 3935 2897 1647 1035 656 23293 1509 --13345
NM_032991chr451568 1527 451 392 164 21090 624 ----
NM_033020chr164802 1925 1736 1346 1151 919 44133 2957 1592 771 11210 11389
NM_033030chr2----11628 21086 83
NM_033044chr151192 918 375 329 269 21293 24 1868 --
NM_033081chr2061479 1345 1075 1043 496 60 --1488 --
NM_033132chr1342330 1929 929 220 1542 190 --
NM_033138chr782247 2207 1843 1790 1745 1536 716 136 ------
NM_033139chr782247 2207 1843 1790 1745 1536 716 136 ------
NM_033140chr782247 2207 1843 1790 1745 1536 716 136 ------
NM_033143chr474655 3219 1853 1369 1065 311 147 1259 ----
NM_033157chr782247 2207 1843 1790 1745 1536 716 136 ------
NM_033181chr643043 1160 529 178 --1599 13463
NM_033224chr7118091 7714 7332 6733 5596 5034 3191 3113 2223 1956 296 47464 2362 1042 370 37744 6537 1418 --
NM_033225chr852414 553 521 439 52 33198 2246 188 ----
NM_033274chr563388 2516 2399 851 602 335 1502 22885 1173 1576
NM_033290chrX93740 3706 3605 2955 2765 1268 1163 985 969 --11168 --
NM_033305chr951384 1344 1315 418 137 ------
NM_033331chr962323 1401 1298 799 268 227 ------
NM_033360chr1283166 3138 2965 1731 1490 844 572 452 --11327 11293
NM_033387chr952289 2265 503 208 35 --1213 12628
NM_033389chr1784654 4051 1865 1857 1677 1283 440 237 44645 4423 4022 3334 11682 --
NM_033425chr1133544 761 435 22577 483 1271 33521 1370 913
NM_033429chr1592598 2551 2313 2185 1094 632 576 351 95 21273 321 22675 1314 12485
NM_033480chr663028 2423 2050 1156 956 820 ------
NM_033481chr663028 2423 2050 1156 956 820 ------
NM_033505chr295372 5312 4888 4256 1300 1121 492 424 93 15759 25317 1913 24540 1163
NM_033515chr621186 441 ----11066
NM_033516chr92464 236 2246 181 11044 --
NM_033542chr2041905 1399 1379 63 1353 21845 1684 --
NM_033631chr183632 2702 1491 1155 933 913 733 187 23063 2838 22868 105 --
NM_033644chr531970 1653 1633 --11877 --
NM_033645chr531970 1653 1633 --11877 --
NM_033656chr2185873 4835 3975 1895 1207 1004 710 652 14875 15275 --
NM_052811chr1355288 5197 3993 3570 1500 11348 ----
NM_052834chr1872407 2255 2069 1990 1595 331 52 1983 ----
NM_052875chr1132019 1850 833 ----21914 127
NM_052885chr1264755 4666 4514 4430 1176 523 44630 3742 969 890 138 1495
NM_052886chr831747 1356 288 1429 1712 11959
NM_052898chr861622 1442 1335 1225 596 251 11920 11839 --
NM_052900chr84328 273 153 79 11514 1450 --
NM_052906chr2244329 1515 1289 127 --23932 239 1181
NM_052907chr12134321 4038 3350 3081 2995 2897 2606 1265 992 861 315 291 278 ----22806 2686
NM_052910chr1341953 641 631 93 --22208 1641 --
NM_052917chr242496 1038 401 251 32367 585 218 22987 822 --
NM_052918chr1093553 3132 3007 2961 1360 1023 324 276 257 12330 12863 --
NM_052927chr53588 207 168 21820 1638 --12004
NM_052938chr181208 1159 1069 1014 949 886 833 47 ----11188
NM_052996chr1661469 1449 559 370 123 57 --31771 1360 673 --
NM_053016chr9138032 7286 6423 6187 5860 2327 2096 1849 1219 800 763 224 101 27554 2894 22113 818 26558 5290
NM_053025chr331472 1214 525 1292 ----
NM_053026chr331472 1214 525 1292 ----
NM_053027chr331472 1214 525 1292 ----
NM_053028chr331472 1214 525 1292 ----
NM_053031chr331472 1214 525 1292 ----
NM_053032chr331472 1214 525 1292 ----
NM_053056chr1123158 2687 22745 463 --2748 733
NM_054016chr142033 1951 1559 323 11413 ----
NM_054016chr142033 1951 1559 323 11413 ----
NM_054016chr142033 1951 1559 323 11413 ----
NM_057178chr1782853 2787 1886 1856 1820 718 605 539 12653 12229 --
NM_078487chr983322 3295 3025 2600 2485 2196 424 115 --12037 --
NM_079420chr24313 287 248 21 --174 --
NM_079422chr24313 287 248 21 --174 --
NM_080597chr183999 50 38 2857 355 1783 --
NM_080645chr631953 859 391 1625 21893 132 --
NM_080676chr2053293 3182 3145 2537 2349 ------
NM_080717chr1251399 1008 986 231 24 1542 11404 --
NM_080737chrX41228 532 162 144 ------
NM_080743chr652293 2243 2109 344 192 --11982 --
NM_080759chr1372407 2304 817 791 741 598 535 ------
NM_080760chr1372407 2304 817 791 741 598 535 ------
NM_080764chr2223163 2428 32712 1028 39 --175
NM_080792chr2051942 1598 1427 1411 500 22186 239 --11837
NM_080867chr14124808 3928 3394 3362 3227 1510 1492 1052 973 587 338 163 24096 766 --13428
NM_080872chr874050 3548 3489 3181 2969 2817 185 23400 915 1668 32697 622 615
NM_080921chr15874 779 427 188 30 1112 ----
NM_080927chr363159 2537 2220 1224 1118 1038 --11138 --
NM_130391chr9103598 3426 2772 2614 2438 1178 1118 637 153 142 1699 ----
NM_130392chr9103598 3426 2772 2614 2438 1178 1118 637 153 142 1699 ----
NM_130393chr9103598 3426 2772 2614 2438 1178 1118 637 153 142 1699 ----
NM_130436chr2172627 2496 2372 2161 2099 556 198 ------
NM_130438chr2173204 3073 2949 2738 2676 1133 775 --1154 --
NM_130439chr102207 59 --12216 12326
NM_130439chr102207 59 --12216 12326
NM_130440chr121468 238 ----21666 1287
NM_130809chr543151 2967 2689 2515 --2245 186 --
NM_133170chr20157672 7307 6201 5708 5587 5562 5013 2855 2753 2244 2062 1595 859 269 51 67235 6539 6064 5654 338 298 46636 3050 2935 989 16605
NM_133264chr1773112 2491 678 622 244 217 122 13685 1870 --
NM_133265chrX43145 2351 2216 1266 13123 33139 3105 2843 --
NM_133329chr261863 1456 1284 1278 534 482 ------
NM_133330chr472863 2809 2611 2270 873 229 117 --13040 1887
NM_133331chr472863 2809 2611 2270 873 229 117 --13040 1887
NM_133334chr486332 6242 5982 5290 4011 2338 152 123 34758 2101 930 11129 1407
NM_133335chr472863 2809 2611 2270 873 229 117 --13040 1887
NM_133372chr552637 2537 2174 1155 215 ------
NM_133473chr1941821 676 470 397 ----1435
NM_133478chr292386 2365 2205 2041 1848 1654 1595 532 154 1487 1588 --
NM_133496chr1104404 4261 2846 2807 1465 1306 1169 1062 567 237 23449 582 --14134
NM_133631chr351481 1281 606 560 112 1234 ----
NM_133646chr275602 4630 4134 2243 895 384 31 31441 1404 356 14125 --
NM_133647chr1562924 2646 974 848 493 279 31322 483 242 ----
NM_138270chrX43331 2111 958 653 13309 ----
NM_138319chr1531066 1004 420 1151 1971 1238
NM_138333chr952269 1721 841 580 62 --1600 --
NM_138338chr2262867 2482 961 465 284 275 1921 23336 3084 --
NM_138348chr5106157 6009 5661 5541 5527 5499 4602 2557 1508 842 31089 333 252 --26426 5146
NM_138395chr22786 479 2310 291 ----
NM_138423chr1572098 1975 1666 1614 1424 310 302 1259 ----
NM_138444chr13104815 4469 4227 3903 1991 1427 1409 1401 1137 182 54679 4347 3569 1707 293 53286 1937 1727 1171 350 --
NM_138457chr693385 3011 2495 1367 636 383 253 241 116 11137 --13004
NM_138459chr683619 3402 2649 2327 986 429 215 128 ------
NM_138468chr296064 5391 5103 5026 4725 4329 4146 4119 793 25170 502 14528 --
NM_138473chr1254427 4236 4010 1880 1033 25182 4034 13402 --
NM_138559chr261099 1082 1039 943 913 497 --1202 --
NM_138576chr14114411 4092 3347 3279 3273 3236 2985 1641 1089 796 195 13022 11812 --
NM_138633chr641791 1759 1196 1174 ----11187
NM_138694chr642837 2442 1048 172 23402 2974 ----
NM_138713chr16157783 7360 7332 7197 7098 7030 6749 5776 5571 5250 5131 5086 2715 2199 2059 26785 1128 36321 2749 1238 --
NM_138714chr16157783 7360 7332 7197 7098 7030 6749 5776 5571 5250 5131 5086 2715 2199 2059 26785 1128 36321 2749 1238 --
NM_138731chr1494285 3674 2702 1490 1096 817 649 640 96 23816 152 24228 1398 --
NM_138771chr741429 1222 1188 1103 ------
NM_138782chr592415 2227 2019 1926 1514 562 433 131 103 1516 140 --
NM_138809chr562758 2359 2278 1021 988 141 ------
NM_138819chrX1370 2348 185 2116 65 --
NM_138959chr176830 6541 6050 5459 4933 4873 1857 34421 1043 271 25531 1454 15110
NM_138971chr1153811 3458 1028 571 501 13333 22855 506 --
NM_138971chr1153811 3458 1028 571 501 13333 22855 506 --
NM_138972chr1153811 3458 1028 571 501 13333 22855 506 --
NM_138972chr1153811 3458 1028 571 501 13333 22855 506 --
NM_138973chr1153811 3458 1028 571 501 13333 22855 506 --
NM_138973chr1153811 3458 1028 571 501 13333 22855 506 --
NM_139045chr94240 187 147 121 ------
NM_139246chr962355 1553 812 718 365 346 ----1409
NM_139279chr273410 2662 2296 1329 1266 617 34 33221 2455 588 ----
NM_139283chr1251018 976 908 514 392 1711 22536 602 11941
NM_139286chr91175 ----164
NM_139316chr72103 47 --21087 119 11042
NM_139321chr2064214 4193 3707 3346 771 151 11358 24239 2631 --
NM_139323chr2041826 1312 575 156 ----11719
NM_144567chr152846 2587 2263 2230 667 1383 ----
NM_144571chr4156377 5834 5766 5535 5168 5096 4977 4827 2769 1940 1616 1478 1066 529 330 25407 2504 --15145
NM_144578chr14125095 4856 4786 4636 4066 3930 3702 2003 1502 479 442 410 1828 2836 484 --
NM_144590chr1072793 2538 2077 2069 1860 817 414 --1531 1736
NM_144599chr1564548 4433 2076 1459 1027 772 35116 3359 651 1891 --
NM_144609chr171874 21130 1080 --1957
NM_144628chr2073094 3024 2786 2284 2009 1100 910 1971 --1704
NM_144632chr261909 904 682 654 563 187 ------
NM_144728chr13734 701 211 1362 3856 204 127 --
NM_144729chr13734 701 211 1362 3856 204 127 --
NM_144778chr1352512 2289 1923 889 402 --1104 1142
NM_144949chr232053 330 162 1598 22155 1742 12627
NM_144963chr872716 2609 2340 2305 2296 2128 470 21735 834 1915 --
NM_144973chr1275359 5018 4672 4310 841 140 31 --25293 544 --
NM_145013chr1152228 1903 1827 782 133 --12095 12548
NM_145055chr1873402 3292 3010 1461 1396 894 124 ----13626
NM_145117chr1162733 2390 2183 2164 2046 831 22132 672 2604 458 --
NM_145165chr1442395 900 724 57 2563 535 2590 556 --
NM_145176chr683370 2816 2410 1254 1181 847 812 595 --11368 --
NM_145206chr10113335 3126 2871 2356 2173 1133 1105 1094 1004 709 24 1471 ----
NM_145207chr455143 4174 3277 1803 240 14017 12127 11655
NM_145251chr1411432 11051 --1261
NM_145259chr2156758 6687 6474 6319 6108 5554 4988 4455 2331 2157 1394 1323 1171 1163 734 ----15316
NM_145261chr34827 798 343 110 ----1564
NM_145284chrX3844 742 439 12178 --1872
NM_145305chrX51210 1194 1166 1051 160 ----1417
NM_145307chr1034479 1545 614 21212 429 --14430
NM_145320chr743132 3029 1068 235 23403 3381 167 22866 2739
NM_145321chr743132 3029 1068 235 23403 3381 167 22866 2739
NM_145322chr743132 3029 1068 235 23403 3381 167 22866 2739
NM_145351chr1762781 2239 2200 1969 864 747 11712 --11975
NM_145686chr243280 876 298 122 1940 23288 1301 11090
NM_145687chr243280 876 298 122 1940 23288 1301 11090
NM_145690chr841645 1613 689 77 21385 480 ----
NM_145698chr1051967 1667 1434 638 170 1430 ----
NM_145756chr181568 ----21235 526
NM_145803chr113603 158 78 ----188
NM_145808chr7133151 3142 2710 2655 2516 2319 2227 2185 2059 1037 969 789 534 --1144 --
NM_145868chr103660 524 93 --186 --
NM_145869chr103660 524 93 --186 --
NM_145909chr651278 1070 484 318 107 --11208 1206
NM_147147chr674116 3034 2871 1049 644 464 408 13600 22585 294 --
NM_147150chr973740 3633 3624 3249 645 294 102 1300 21233 107 1697
NM_147175chrX21397 437 1249 21648 186 12155
NM_147223chr242025 1933 1824 237 1788 1135 --
NM_147233chr241842 1750 1641 54 1605 ----
NM_148957chr1342294 2015 877 127 1172 --11716
NM_152221chr22------191
NM_152233chr1441122 1090 624 98 1607 ----
NM_152265chr141064 643 466 72 11403 --145
NM_152280chr172752 2653 2314 1089 452 127 88 --21021 630 --
NM_152289chr1931711 1612 131 11198 --21697 1101
NM_152332chr1462802 2548 1765 930 227 95 189 ----
NM_152344chr1761499 466 429 217 152 136 ------
NM_152388chr264008 3780 3447 3268 1343 1094 --12919 --
NM_152409chr583484 2950 2898 2192 1361 1331 701 322 22304 418 ----
NM_152414chr831515 154 113 ----1482
NM_152424chrX94732 3730 1873 1865 1780 1202 835 465 417 23133 1148 ----
NM_152435chr125256 243 201 192 104 ------
NM_152450chr1531972 1586 1571 --1567 21683 1405
NM_152455chr1562393 1783 1069 644 565 164 12209 ----
NM_152470chr18104142 4051 4008 3629 3535 3362 3224 1195 323 74 2952 549 11561 --
NM_152519chr281608 1598 1465 1458 452 433 239 196 1276 31436 1373 352 12064
NM_152529chr294038 4009 3390 3026 2805 2703 1673 1509 1165 ------
NM_152546chr52124 21 2583 545 21150 337 --
NM_152556chr742429 1665 670 292 ----1344
NM_152581chrX31093 565 162 21164 582 162 --
NM_152588chr1231344 430 396 21851 240 11838 --
NM_152594chr1552171 1639 868 502 362 ------
NM_152605chr1941364 1066 258 249 --1286 --
NM_152622chr573441 3172 3114 1406 1249 1174 550 --23119 2652 12711
NM_152624chr5136370 6125 5501 5369 5358 4776 4672 4533 2300 2029 1620 694 71 ------
NM_152629chr983512 3428 1611 1498 1299 1015 979 76 ------
NM_152665chr131109 852 414 --1817 --
NM_152678chr332599 1711 152 12476 1157 --
NM_152688chr62208 63 --1242 1911
NM_152695chrX62140 1901 1448 916 601 32 11991 1346 --
NM_152699chr373775 3654 3053 2984 2678 2497 830 1816 23339 471 --
NM_152707chr102386 243 ----1159
NM_152716chr1121660 1334 ----1575
NM_152721chr184606 261 237 99 --1501 --
NM_152724chr1031884 602 455 1198 32040 714 83 --
NM_152754chr7103863 3345 3176 2563 1464 1446 917 466 312 208 --21014 198 13451
NM_152758chr853027 2401 1957 914 609 ------
NM_152774chr762092 2056 1947 1079 648 298 ------
NM_152787chrX73981 3970 3259 2604 1468 588 384 ----11099
NM_152838chr20103553 3317 3130 2879 2814 1398 1356 737 677 178 ------
NM_152902chr142047 1768 1377 361 11669 1781 --
NM_152903chr1331110 315 179 31997 1051 195 --1938
NM_152924chr1596866 6098 5799 4793 4389 2599 1943 1587 1231 22095 1777 35293 2264 1055 1546
NM_152989chr1261736 1367 1227 317 195 186 ------
NM_152999chr7114961 3896 3873 1636 1515 1401 1276 598 592 579 169 1338 ----
NM_153184chr341650 1624 1236 759 --11369 --
NM_153188chr585466 5332 4869 4009 3618 651 645 436 33563 749 115 13951 --
NM_153207chr12123425 3215 3085 2646 2566 1275 1057 917 598 404 257 28 12554 ----
NM_153261chr16--3588 348 331 ----
NM_153262chr142981 2323 2298 601 13065 1892 --
NM_153367chr1073281 2757 1216 570 564 387 168 21535 398 1854 11284
NM_153607chr583188 3164 2017 1110 940 922 875 562 22455 2328 --22962 194
NM_153616chr1562033 2008 1698 1495 422 322 11995 1558 12433
NM_153617chr1562033 2008 1698 1495 422 322 11995 1558 12433
NM_153618chr1562033 2008 1698 1495 422 322 11995 1558 12433
NM_153619chr15103271 3246 2936 2733 2328 1227 1202 546 166 143 23233 1217 --13671
NM_153634chr1241662 1195 607 522 1162 1312 135
NM_153688chr1651810 1703 1426 684 304 --21894 1803 11320
NM_153712chr283086 3076 2972 2923 2852 2344 1125 471 ------
NM_170709chr832362 2023 1568 --32408 1685 700 --
NM_170710chr483082 2988 2759 2581 2467 2185 463 210 1499 --11144
NM_170719chr1341387 1216 1200 74 --21164 1143 --
NM_170721chr1731229 538 488 --21141 295 --
NM_170731chr1132376 2365 329 --12394 --
NM_170732chr1132376 2365 329 --12394 --
NM_170733chr1132376 2365 329 --12394 --
NM_170734chr1132376 2365 329 --12394 --
NM_170735chr1132376 2365 329 --12394 --
NM_170740chr683465 3167 2660 2518 2119 1346 151 81 12500 ----
NM_170750chrX1273 ----1207
NM_171825chr553123 2862 2250 1198 416 --23211 2784 --
NM_171998chrX82383 1953 1685 912 870 675 327 142 21832 1776 --1553
NM_172058chr881734 1516 1288 490 360 339 304 282 11456 ----
NM_172059chr881734 1516 1288 490 360 339 304 282 11456 ----
NM_172060chr881734 1516 1288 490 360 339 304 282 11456 ----
NM_172069chr251916 1825 364 188 113 1380 ----
NM_172071chr1126986 6938 6915 5581 5532 4930 4567 2713 1523 516 458 142 1555 21682 162 25874 471
NM_172103chr662603 2273 2185 1944 627 273 12672 11847 12529
NM_172105chr662603 2273 2185 1944 627 273 12672 11847 12529
NM_172217chr1563841 1550 1411 270 219 146 13902 1732 12590
NM_172240chr124980 524 314 51 21006 540 ----
NM_172337chr14----1972 2196 174
NM_172344chr261863 1456 1284 1278 534 482 ------
NM_172367chr1782165 2146 1790 993 818 359 211 128 --22706 2064 1774
NM_173065chr173211 2892 2767 2707 1313 1253 81 22379 2213 11301 12713
NM_173083chr131036 897 247 2831 159 ----
NM_173171chr23381 276 160 ----11297
NM_173172chr24990 584 468 175 --1283 11605
NM_173173chr23381 276 160 ----11297
NM_173198chr982281 2071 1840 1109 851 602 533 485 22341 1001 --1563
NM_173200chr982281 2071 1840 1109 851 602 533 485 22341 1001 --1563
NM_173214chr16157783 7360 7332 7197 7098 7030 6749 5776 5571 5250 5131 5086 2715 2199 2059 26785 1128 36321 2749 1238 --
NM_173463chr4134376 4362 3981 3905 3442 3231 2931 1581 1300 1281 919 814 612 23063 117 ----
NM_173468chr475999 3687 2056 1811 1100 1024 660 13829 15868 --
NM_173469chr1511144 21212 999 11119 --
NM_173470chrX4854 659 434 111 12874 1244 --
NM_173503chr17------136
NM_173510chr2252595 1913 1791 816 710 11799 12169 --
NM_173531chr1993788 3538 2928 1455 1154 647 405 202 128 ----22428 166
NM_173562chr642984 2403 702 414 73140 2994 2819 2619 2582 2067 758 ----
NM_173576chr1051796 812 781 301 102 1219 1573 --
NM_173582chr11126321 6069 5947 5399 5087 4200 4039 2359 2015 1866 935 506 15465 ----
NM_173602chr1233404 2721 765 33669 2341 478 ----
NM_173607chr1441733 1322 302 27 22130 598 ----
NM_173642chr1127058 6377 6004 5918 5884 5829 2105 1867 1663 1421 652 185 28354 29 15923 15722
NM_173644chr2051944 1620 1553 391 323 21430 707 ----
NM_173683chr861480 662 607 442 436 52 --2686 577 --
NM_173694chrX52599 1799 805 713 43 2858 138 ----
NM_173808chr174260 3693 3152 1618 1307 1222 388 54274 4248 1248 989 718 --1699
NM_173812chr1261549 1068 382 238 102 89 ------
NM_173825chr342957 2339 632 175 --12859 --
NM_173829chr596052 5054 5019 4933 4678 3782 2306 1064 789 15424 --14244
NM_174911chr8123770 3724 3278 3097 2925 2697 907 644 631 619 296 271 1585 --14000
NM_174916chr15102327 2014 1985 1928 1827 1730 757 556 174 31 1906 1943 --
NM_175056chr322147 848 11358 --12008
NM_175061chr742206 1575 615 448 --11436 --
NM_175566chr111389 ----1475
NM_175607chr351415 1330 1287 1070 172 1527 ----
NM_175612chr351415 1330 1287 1070 172 1527 ----
NM_175623chr1297381 7247 5804 5437 5335 2524 1441 1069 1036 37470 5812 357 22363 1670 22438 1625
NM_175624chr1297476 7342 5899 5532 5430 2619 1536 1164 1131 37565 5907 452 22458 1765 22533 1720
NM_175625chr1297476 7342 5899 5532 5430 2619 1536 1164 1131 37565 5907 452 22458 1765 22533 1720
NM_175736chr1297703 7629 7539 7442 6233 5309 5169 5078 2703 --33131 1598 844 11534
NM_175848chr2061344 1279 1148 1011 892 458 ----1203
NM_175848chr2061344 1279 1148 1011 892 458 ----1203
NM_175849chr2061344 1279 1148 1011 892 458 ----1203
NM_175849chr2061344 1279 1148 1011 892 458 ----1203
NM_175850chr2061344 1279 1148 1011 892 458 ----1203
NM_175850chr2061344 1279 1148 1011 892 458 ----1203
NM_175854chr1352497 2119 969 678 104 --12152 11870
NM_176814chr71305 ----11441
NM_176824chr43343 335 170 1429 ----
NM_177398chr142011 1231 563 460 31849 1832 285 ----
NM_177399chr142011 1231 563 460 31849 1832 285 ----
NM_177414chr141498 1300 655 277 1197 ----
NM_177438chr1463930 3508 1255 1206 375 215 --21011 718 --
NM_177538chr2118571 8220 6062 5733 3421 3360 3191 2492 1320 1122 107 13132 26892 1153 186
NM_177559chr2041248 1145 918 264 ----1321
NM_177560chr2041248 1145 918 264 ----1321
NM_177966chr361486 1463 1402 1377 1313 216 ------
NM_177968chr251824 1600 1389 638 552 --1629 1291
NM_177972chr1174474 4437 3512 3368 878 555 500 23965 957 ----
NM_177974chr1572098 1975 1666 1614 1424 310 302 1259 ----
NM_177985chr271858 1833 1784 1462 641 529 98 ----1383
NM_177990chr2041865 1639 1487 1441 31857 1693 265 1284 1150
NM_178010chr1261736 1367 1227 317 195 186 ------
NM_178011chr1062261 2255 932 892 124 36 22909 2176 12302 12943
NM_178037chr1223116 2884 33172 2436 313 22315 469 --
NM_178038chr1223116 2884 33172 2436 313 22315 469 --
NM_178140chr582779 2501 2249 2080 2058 407 311 101 268 49 ----
NM_178151chrX137616 7083 7076 5859 5592 5068 4849 2658 1838 1009 985 427 42 --26277 36 37603 7089 577
NM_178152chrX137616 7083 7076 5859 5592 5068 4849 2658 1838 1009 985 427 42 --26277 36 37603 7089 577
NM_178153chrX137616 7083 7076 5859 5592 5068 4849 2658 1838 1009 985 427 42 --26277 36 37603 7089 577
NM_178154chr148669 329 296 248 71 46 31 22 158 ----
NM_178155chr148669 329 296 248 71 46 31 22 158 ----
NM_178156chr148669 329 296 248 71 46 31 22 158 ----
NM_178157chr148669 329 296 248 71 46 31 22 158 ----
NM_178313chr24884 863 819 39 ----1620
NM_178427chr162037 1984 918 890 729 65 ------
NM_178496chr331416 575 119 1619 1358 --
NM_178505chr1082990 2977 2942 2337 2288 1454 1254 452 3670 321 132 11441 --
NM_178509chr1753670 3577 2589 1138 904 23654 566 21561 879 --
NM_178566chr951685 1666 1228 465 391 --11653 11428
NM_178585chr442490 1078 807 745 1490 11270 --
NM_178586chr1432197 2030 940 21537 380 12228 --
NM_178815chr101866 --1109 1467
NM_181054chr1441302 1233 973 344 1378 1260 --
NM_181265chr483082 2988 2759 2581 2467 2185 463 210 1499 --11144
NM_181332chrX52730 2226 2017 661 173 21936 106 ----
NM_181351chr1192854 2283 2233 1904 806 739 260 104 78 1273 --1402
NM_181358chr163114 2954 2872 1694 1293 489 23295 1428 14012 --
NM_181361chr341259 1134 984 159 ----11342
NM_181443chr2062502 2362 985 867 819 656 --1428 --
NM_181481chr18156850 6229 5853 5708 5239 4888 4456 4331 1912 1820 1593 1424 211 124 102 37062 2729 170 25642 189 --
NM_181482chr18156850 6229 5853 5708 5239 4888 4456 4331 1912 1820 1593 1424 211 124 102 37062 2729 170 25642 189 --
NM_181483chr18156850 6229 5853 5708 5239 4888 4456 4331 1912 1820 1593 1424 211 124 102 37062 2729 170 25642 189 --
NM_181486chr1251399 1008 986 231 24 1542 11404 --
NM_181492chr2221313 1255 2530 134 1431 --
NM_181521chr1687202 6961 6596 6240 4718 2772 2478 1424 15022 34749 1315 798 --
NM_181659chr2093184 2819 2637 2499 2396 1341 894 686 42 ------
NM_181659chr2093184 2819 2637 2499 2396 1341 894 686 42 ------
NM_181670chr1241462 1386 1236 1099 11456 ----
NM_181672chrX31738 1517 725 ----21351 548
NM_181673chrX31738 1517 725 ----21351 548
NM_181705chr5115804 5545 5235 4779 4556 4301 4137 3670 3516 2160 341 1684 ----
NM_181706chr1152336 2269 2168 1705 843 ------
NM_181714chr621836 68 11590 11930 --
NM_181782chr641862 1436 561 249 --1609 --
NM_181794chr641148 838 276 212 1356 ----
NM_181795chr641148 838 276 212 1356 ----
NM_181836chr542396 1928 445 149 1589 ----
NM_181838chr521289 31 ----2236 174
NM_181876chr442708 2644 2396 919 12222 22145 1687 1251
NM_181897chr322424 197 22547 575 ----
NM_182485chr493755 2983 2319 1276 874 848 585 480 440 --1159 11172
NM_182487chr972761 2699 1364 1333 975 661 276 13259 --14172
NM_182551chr2113126 3029 2758 2205 1373 1136 1029 965 485 320 56 ------
NM_182646chr493755 2983 2319 1276 874 848 585 480 440 --1159 11172
NM_182663chr182117 1729 1592 757 310 271 242 71 11756 1736 --
NM_182664chr192247 1859 1722 887 440 401 372 201 122 21886 1482 1866 --
NM_182665chr182117 1729 1592 757 310 271 242 71 11756 1736 --
NM_182734chr2052331 2319 1062 164 56 12867 13267 --
NM_182757chr643351 2798 2387 344 ----12535
NM_182763chr192727 2518 2368 2284 1965 1939 1686 1073 221 --2898 226 --
NM_182765chr1041913 875 840 398 11919 22320 1493 1665
NM_182797chr202482 30 --3221 76 62 --
NM_182830chr1482170 2031 1847 1509 902 693 140 81 32257 786 755 1837 31460 908 87
NM_182898chr7126566 5888 5314 5284 4745 4151 2262 1769 738 477 266 88 35058 1561 346 --11730
NM_182899chr7126566 5888 5314 5284 4745 4151 2262 1769 738 477 266 88 35058 1561 346 --11730
NM_182907chr632086 1997 528 22111 1578 --12364
NM_182948chr182836 2008 926 893 829 720 543 437 1951 ----
NM_182964chr1162733 2390 2183 2164 2046 831 22132 672 2604 458 --
NM_182970chr2074062 3423 2950 2746 1355 721 311 1294 1687 23729 3167
NM_183004chr1461521 1384 1070 817 752 460 ------
NM_183078chr663474 3333 2508 2456 1503 678 22631 905 --12492
NM_183234chr152593 103 --11644 1565
NM_183235chr152593 103 --11644 1565
NM_183236chr152593 103 --11644 1565
NM_183353chrX4941 815 456 48 --11068 11182
NM_194247chr294261 4218 3881 3600 3071 2898 1755 1582 1137 34065 3715 587 11287 21740 1453
NM_194278chr1484151 3655 3585 3229 928 858 605 588 23341 2965 11254 --
NM_194285chr1172721 2457 2294 2189 1369 1355 415 11055 12248 13320
NM_194286chr12105322 4966 4392 4247 3790 2070 1770 1380 1310 88 15171 ----
NM_194292chr131742 1606 170 ----174
NM_194314chr163753 1502 1371 703 472 375 1131 1732 --
NM_194328chr932398 789 656 23191 3125 --12070
NM_194329chr932398 789 656 23191 3125 --12070
NM_194330chr932398 789 656 23191 3125 --12070
NM_194332chr932398 789 656 23191 3125 --12070
NM_194434chr1885782 5776 5650 5023 3781 2226 1880 1111 --1179 --
NM_194454chr741636 1597 1306 287 21300 26 ----
NM_194455chr741636 1597 1306 287 21300 26 ----
NM_194456chr741636 1597 1306 287 21300 26 ----
NM_197941chr562738 2602 2013 1035 829 724 ----1848
NM_197970chr2----11628 21086 83
NM_198056chr372204 2155 1734 1443 894 572 57 ----22242 81
NM_198123chr84328 273 153 79 11514 1450 --
NM_198124chr84328 273 153 79 11514 1450 --
NM_198128chr1812298 31917 1869 1821 1409 --
NM_198158chr3112911 2785 2715 2687 2433 2075 1201 257 220 198 170 1539 132 --
NM_198159chr3112911 2785 2715 2687 2433 2075 1201 257 220 198 170 1539 132 --
NM_198177chr3112911 2785 2715 2687 2433 2075 1201 257 220 198 170 1539 132 --
NM_198178chr3112911 2785 2715 2687 2433 2075 1201 257 220 198 170 1539 132 --
NM_198179chr4--1574 --1119
NM_198181chr1512302 ----12878
NM_198196chr352476 2419 2155 770 759 1908 ----
NM_198215chr1051462 1355 1210 549 297 ------
NM_198268chr163114 2954 2872 1694 1293 489 23295 1428 14012 --
NM_198269chr163114 2954 2872 1694 1293 489 23295 1428 14012 --
NM_198270chrX73515 3367 3085 2827 1013 753 645 --12760 2772 416
NM_198281chr492542 1220 1179 1068 600 473 248 219 170 12979 1627 13208
NM_198320chr1295158 3925 3859 3254 3184 1983 1783 821 704 23410 3397 ----
NM_198321chr543036 2543 2089 2049 32281 1069 836 ----
NM_198353chr42496 430 ----1350
NM_198390chr1671946 1452 1425 1318 724 565 170 ----21297 670
NM_198391chr2031362 577 45 ----1286
NM_198400chr1552945 2828 2716 2658 2487 --11151 --
NM_198401chr831644 1507 489 11096 --1559
NM_198450chrX72269 2104 1930 1495 907 888 561 1113 1178 --
NM_198465chrX3408 347 33 --22086 232 1724
NM_198468chr684410 4129 4084 3380 3013 1645 1199 1028 24220 1549 ----
NM_198503chr121807 281 --32009 536 485 --
NM_198506chr461513 1390 1074 173 114 86 ------
NM_198513chr841773 1536 305 167 1518 ----
NM_198529chr171146 ----1391
NM_198530chr1751279 861 440 307 276 1411 ----
NM_198581chr2137168 6959 6758 6548 6302 5686 2761 2697 2302 1968 1859 257 105 ----12675
NM_198715chr1126173 5547 4968 4901 4108 2179 2060 1208 886 181 55 44 14926 11050 --
NM_198793chr353295 1650 1087 638 421 14023 ----
NM_198896chr1172213 1569 1500 736 494 462 168 ------
NM_198900chr1297703 7629 7539 7442 6233 5309 5169 5078 2703 --33131 1598 844 11534
NM_198904chr531852 215 127 1255 11812 --
NM_198935chr2083260 2779 2161 2080 2024 739 572 382 1911 ----
NM_198947chr1141078 301 264 251 2385 192 ----
NM_198968chr1344009 3211 2658 1493 --33997 2517 1249 13740
NM_198990chr763110 2377 912 885 195 127 22752 2055 22815 2397 --
NM_199000chr73866 618 377 21943 1413 134 11486
NM_199003chr851434 1366 1147 517 505 ------
NM_199040chr1273713 3007 2486 1454 403 155 93 12954 ----
NM_199050chr2193975 3922 3632 3565 3531 3461 2860 1015 1005 126 23513 1126 --
NM_199132chr1982165 2085 711 526 442 211 171 87 --21937 560 --
NM_199169chr2083059 2899 2488 1367 1285 980 906 174 --21311 1065 --
NM_199170chr2083059 2899 2488 1367 1285 980 906 174 --21311 1065 --
NM_199171chr2083059 2899 2488 1367 1285 980 906 174 --21311 1065 --
NM_199229chr281621 1509 1420 1314 1113 567 340 285 176 ----
NM_199320chr422605 108 12038 32667 2646 350 --
NM_199320chr422605 108 12038 32667 2646 350 --
NM_199324chr4103490 2931 2796 2784 2766 2683 2578 575 487 282 22833 2404 11502 --
NM_199421chr14124808 3928 3394 3362 3227 1510 1492 1052 973 587 338 163 24096 766 --13428
NM_199461chr1063049 2892 1413 1248 1030 540 23018 1133 ----
NM_199462chr165015 4519 1699 1684 1285 281 13604 ----
NM_199482chr221326 541 1740 1312 21655 358
NM_199487chr2041339 1047 870 864 ----21265 1137
NM_201263chr16628 376 276 137 92 60 12143 22059 70 11596
NM_201266chr283060 3009 2995 2148 1208 588 490 107 --1712 --
NM_201278chr1141888 1595 1568 304 31704 1526 385 ----
NM_201279chr283060 3009 2995 2148 1208 588 490 107 --1712 --
NM_201280chr631457 1160 74 ----21413 28
NM_201281chr1141888 1595 1568 304 31704 1526 385 ----
NM_201432chr17126248 6215 6197 6096 4527 4112 2632 1540 1369 1228 604 269 35430 5318 1680 1196 32560 2410 874
NM_201433chr17126248 6215 6197 6096 4527 4112 2632 1540 1369 1228 604 269 35430 5318 1680 1196 32560 2410 874
NM_201436chr71759 ----1257
NM_201516chr71815 ----1313
NM_201517chr71759 ----1257
NM_201548chr231159 595 72 ----21486 34
NM_201559chr6134457 3557 3526 1657 1600 1006 580 571 563 537 81 45 37 --23206 1187 --
NM_203342chr143215 2513 818 336 12670 42960 2858 2377 550 --
NM_203343chr143215 2513 818 336 12670 42960 2858 2377 550 --
NM_203349chr1572084 1983 857 739 724 662 280 21427 590 1103 --
NM_203350chr141763 1712 1632 287 ----11287
NM_203390chr851884 1225 523 384 133 1709 --11318
NM_203403chr91248 --1839 21158 353
NM_203406chr552809 2182 2021 1842 735 ------
NM_203446chr2182984 2945 2667 2317 2293 669 271 142 12073 1301 --
NM_203451chr1382227 2095 1938 1830 634 459 228 202 12211 ----
NM_203453chr921986 280 41717 1583 1260 69 11763 --
NM_203458chr162962 2933 954 594 543 463 23361 1483 ----
NM_203459chr12340 227 2699 151 ----
NM_203487chr1341444 1381 469 442 11334 11386 --
NM_203504chr452627 2620 2201 1701 378 --1624 1442
NM_203505chr452627 2620 2201 1701 378 --1624 1442
NM_205860chr172989 2659 2435 1239 1165 628 209 1585 1781 --
NM_206594chr183676 2980 2910 1042 994 977 708 111 --21411 54 --
NM_206595chr183676 2980 2910 1042 994 977 708 111 --21411 54 --
NM_206853chr694155 3502 3296 2518 1320 821 350 334 52 --1680 --
NM_206854chr695416 4763 4557 3779 2082 1611 1595 1313 357 --21941 65 --
NM_206855chr6116381 5728 5522 4744 4031 2278 1322 854 569 322 233 1805 11030 --
NM_206866chr2152997 2736 2489 2172 232 125 --11173
NM_206876chr2103619 3300 3162 3092 2617 2296 1319 1219 658 485 1315 11001 --
NM_206907chr552938 2513 2301 1030 844 --11141 --
NM_206909chr8148432 8178 7322 6576 6357 5316 5111 3285 2693 2082 1969 1894 1350 995 37748 5787 5264 38407 7386 394 --
NM_206914chr1282248 2176 2167 2041 1653 1591 707 453 1120 ----
NM_206927chr116788 690 588 234 81 41 --1602 --
NM_206928chr116788 690 588 234 81 41 --1602 --
NM_206929chr116788 690 588 234 81 41 --1602 --
NM_206930chr116788 690 588 234 81 41 --1602 --
NM_207015chr362277 2026 1979 1882 1758 45 21525 494 22312 1501 --
NM_207171chr182060 1753 1498 1454 1381 1372 767 490 11270 1507 --
NM_207292chr393233 2968 2728 2694 2558 2382 874 447 352 12978 1856 11184
NM_207293chr393233 2968 2728 2694 2558 2382 874 447 352 12978 1856 11184
NM_207294chr393233 2968 2728 2694 2558 2382 874 447 352 12978 1856 11184
NM_207295chr393233 2968 2728 2694 2558 2382 874 447 352 12978 1856 11184
NM_207296chr393233 2968 2728 2694 2558 2382 874 447 352 12978 1856 11184
NM_207297chr393258 2993 2753 2719 2583 2407 899 472 377 13003 1881 11209
NM_207299chr96414 330 307 95 83 21 ------
NM_207303chr1074127 3809 954 867 815 549 399 1595 --23962 3489
NM_207304chr1352399 2176 1810 776 289 ----129
NM_207337chr1221130 769 1844 1382 --
NM_207361chr1376213 4533 4002 1586 1348 325 185 2675 81 --1542
NM_207372chr1062037 1964 421 342 283 79 ------
NM_207406chr4136302 5688 4152 4097 2576 2417 2030 1431 1340 658 410 307 187 11260 16186 15514
NM_207422chrX51435 1281 992 185 102 2999 922 ----
NM_207429chr1152317 2267 1855 1672 115 --1820 --
NM_207577chr1162940 2896 2469 2403 2162 182 167 --175
NM_207647chr932462 1895 1843 11687 ----
NM_212460chr751996 1822 1609 1309 59 --22065 215 --
NM_212467chr1561995 1725 977 969 603 506 12553 12363 11888
NM_212558chr9104264 4163 4025 3237 3170 3130 3028 1041 994 522 12630 --11183
NM_213589chr2125589 4781 4474 4418 4113 3772 3645 3501 3493 3474 1614 655 --14388 --
NM_213590chr1355288 5197 3993 3570 1500 11348 ----
NM_213651chr131627 254 147 ------
NM_213654chr361612 1457 1145 1127 333 153 ----1614